Structured Review

Toyobo superscript iii reverse transcriptase
Superscript Iii Reverse Transcriptase, supplied by Toyobo, used in various techniques. Bioz Stars score: 94/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/superscript iii reverse transcriptase/product/Toyobo
Average 94 stars, based on 2 article reviews
Price from $9.99 to $1999.99
superscript iii reverse transcriptase - by Bioz Stars, 2020-04
94/100 stars

Images

Related Articles

Real-time Polymerase Chain Reaction:

Article Title: Strain-Specific Contribution of Eukaryotic Elongation Factor 1 Gamma to the Translation of Influenza A Virus Proteins
Article Snippet: .. At 2, 4, and 6 hpi, isolated total RNA was reverse-transcribed using SuperScript III Reverse Transcriptase with influenza gene-specific tagged primers at the 5’ end, and qPCR was then performed using Thunderbird SYBR qPCR mix (TOYOBO) on an ABI PRISM 7900HT. ..

Article Title: The deubiquitinase USP6 affects memory and synaptic plasticity through modulating NMDA receptor stability
Article Snippet: .. Real-time PCR analysis Tissue or cell samples were homogenized, and total RNA was isolated using TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. cDNA was synthesized using SuperScript III Reverse Transcriptase (TOYOBO) with random hexamers and OligdT primers. qRT-PCR was performed using a ROCHE 480 real-time LightCycler system and SYBR green reagent (ABI); primer sequence information is in . .. At least three independent experiments were performed for all experiments described, and all results presented were calculated from CT values derived from the qRT-PCR reactions.

Synthesized:

Article Title: The deubiquitinase USP6 affects memory and synaptic plasticity through modulating NMDA receptor stability
Article Snippet: .. Real-time PCR analysis Tissue or cell samples were homogenized, and total RNA was isolated using TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. cDNA was synthesized using SuperScript III Reverse Transcriptase (TOYOBO) with random hexamers and OligdT primers. qRT-PCR was performed using a ROCHE 480 real-time LightCycler system and SYBR green reagent (ABI); primer sequence information is in . .. At least three independent experiments were performed for all experiments described, and all results presented were calculated from CT values derived from the qRT-PCR reactions.

Isolation:

Article Title: Strain-Specific Contribution of Eukaryotic Elongation Factor 1 Gamma to the Translation of Influenza A Virus Proteins
Article Snippet: .. At 2, 4, and 6 hpi, isolated total RNA was reverse-transcribed using SuperScript III Reverse Transcriptase with influenza gene-specific tagged primers at the 5’ end, and qPCR was then performed using Thunderbird SYBR qPCR mix (TOYOBO) on an ABI PRISM 7900HT. ..

Article Title: The deubiquitinase USP6 affects memory and synaptic plasticity through modulating NMDA receptor stability
Article Snippet: .. Real-time PCR analysis Tissue or cell samples were homogenized, and total RNA was isolated using TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. cDNA was synthesized using SuperScript III Reverse Transcriptase (TOYOBO) with random hexamers and OligdT primers. qRT-PCR was performed using a ROCHE 480 real-time LightCycler system and SYBR green reagent (ABI); primer sequence information is in . .. At least three independent experiments were performed for all experiments described, and all results presented were calculated from CT values derived from the qRT-PCR reactions.

Quantitative RT-PCR:

Article Title: Strain-Specific Contribution of Eukaryotic Elongation Factor 1 Gamma to the Translation of Influenza A Virus Proteins
Article Snippet: Paragraph title: Strand-Specific RT-qPCR ... At 2, 4, and 6 hpi, isolated total RNA was reverse-transcribed using SuperScript III Reverse Transcriptase with influenza gene-specific tagged primers at the 5’ end, and qPCR was then performed using Thunderbird SYBR qPCR mix (TOYOBO) on an ABI PRISM 7900HT.

Article Title: The deubiquitinase USP6 affects memory and synaptic plasticity through modulating NMDA receptor stability
Article Snippet: .. Real-time PCR analysis Tissue or cell samples were homogenized, and total RNA was isolated using TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. cDNA was synthesized using SuperScript III Reverse Transcriptase (TOYOBO) with random hexamers and OligdT primers. qRT-PCR was performed using a ROCHE 480 real-time LightCycler system and SYBR green reagent (ABI); primer sequence information is in . .. At least three independent experiments were performed for all experiments described, and all results presented were calculated from CT values derived from the qRT-PCR reactions.

SYBR Green Assay:

Article Title: The deubiquitinase USP6 affects memory and synaptic plasticity through modulating NMDA receptor stability
Article Snippet: .. Real-time PCR analysis Tissue or cell samples were homogenized, and total RNA was isolated using TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. cDNA was synthesized using SuperScript III Reverse Transcriptase (TOYOBO) with random hexamers and OligdT primers. qRT-PCR was performed using a ROCHE 480 real-time LightCycler system and SYBR green reagent (ABI); primer sequence information is in . .. At least three independent experiments were performed for all experiments described, and all results presented were calculated from CT values derived from the qRT-PCR reactions.

Infection:

Article Title: Strain-Specific Contribution of Eukaryotic Elongation Factor 1 Gamma to the Translation of Influenza A Virus Proteins
Article Snippet: Briefly, wild-type A549 cells, clone 1–24 cells, or clone 3–9 cells were infected with the indicated virus at an MOI of 10. .. At 2, 4, and 6 hpi, isolated total RNA was reverse-transcribed using SuperScript III Reverse Transcriptase with influenza gene-specific tagged primers at the 5’ end, and qPCR was then performed using Thunderbird SYBR qPCR mix (TOYOBO) on an ABI PRISM 7900HT.

Sequencing:

Article Title: The deubiquitinase USP6 affects memory and synaptic plasticity through modulating NMDA receptor stability
Article Snippet: .. Real-time PCR analysis Tissue or cell samples were homogenized, and total RNA was isolated using TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. cDNA was synthesized using SuperScript III Reverse Transcriptase (TOYOBO) with random hexamers and OligdT primers. qRT-PCR was performed using a ROCHE 480 real-time LightCycler system and SYBR green reagent (ABI); primer sequence information is in . .. At least three independent experiments were performed for all experiments described, and all results presented were calculated from CT values derived from the qRT-PCR reactions.

Derivative Assay:

Article Title: The deubiquitinase USP6 affects memory and synaptic plasticity through modulating NMDA receptor stability
Article Snippet: Real-time PCR analysis Tissue or cell samples were homogenized, and total RNA was isolated using TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. cDNA was synthesized using SuperScript III Reverse Transcriptase (TOYOBO) with random hexamers and OligdT primers. qRT-PCR was performed using a ROCHE 480 real-time LightCycler system and SYBR green reagent (ABI); primer sequence information is in . .. At least three independent experiments were performed for all experiments described, and all results presented were calculated from CT values derived from the qRT-PCR reactions.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Toyobo superscript iii reverse transcriptase kit
    Sequence analysis and phenotypic observation of OsGPAT3 clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9)-induced mutants and allelic mutants. Gene structure of OsGPAT3 and mutation analysis of OsGPAT3 gene in transgenic plants and allelic mutants ( A ). The sequence (5′–CTAGTACTCGACGTCGAAGGCGG–3′) located in the first exon of the OsGPAT3 gene was selected as the target site of single guide <t>RNA</t> (sgRNA). The black boxes indicate the exons. The blue characters indicate the protospacer adjacent motif (PAM). The red characters indicate the <t>three</t> different types of mutation events generated by CRISPR/Cas9 in the mutants. Phenotypic comparison of the WT and mutant anthers at stage 13; the lemma and paleae were removed for clarity ( B ). Compressed anthers of wild type Zh8015 ( C ) and the mutants ( D : gc-1 , E : gc-2 , F : gc-3 , G : gpat3-3 , H : gpat3-4 ) after I 2 /KI staining. Detection of DNA fragmentation in wild-type ( I ) and mutant ( J : gpat3-3 , K : gpat3-4 , L : gc-1 , M : gc-2 , N : gc-3 ) anthers using a TUNEL assay at the dehiscence stage (stage 13). White arrows indicate TUNEL-positive signals detected in the tapetum cells of wild-type and gpat3-2 anthers, while blue arrows indicate TUNEL-positive signal observed in the outer cell layers (including the epidermis, endothecium, and middle layer), and vascular bundle cells. The qPCR analysis of OsGPAT3 in wild-type, CRISPR/Cas9-induced mutants, and allelic mutants ( O ). Ad, anther dehiscence; DMsp, degenerated microspore; Mp, mature pollen; T, tapetum. Scale bars = 2 mm in ( B ), 500 μm in ( C – H ), and 50 μm in ( I – N ). ** indicates significant differences at p
    Superscript Iii Reverse Transcriptase Kit, supplied by Toyobo, used in various techniques. Bioz Stars score: 94/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript iii reverse transcriptase kit/product/Toyobo
    Average 94 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    superscript iii reverse transcriptase kit - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    94
    Toyobo superscript iii reverse transcriptase
    Sequence analysis and phenotypic observation of OsGPAT3 clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9)-induced mutants and allelic mutants. Gene structure of OsGPAT3 and mutation analysis of OsGPAT3 gene in transgenic plants and allelic mutants ( A ). The sequence (5′–CTAGTACTCGACGTCGAAGGCGG–3′) located in the first exon of the OsGPAT3 gene was selected as the target site of single guide <t>RNA</t> (sgRNA). The black boxes indicate the exons. The blue characters indicate the protospacer adjacent motif (PAM). The red characters indicate the <t>three</t> different types of mutation events generated by CRISPR/Cas9 in the mutants. Phenotypic comparison of the WT and mutant anthers at stage 13; the lemma and paleae were removed for clarity ( B ). Compressed anthers of wild type Zh8015 ( C ) and the mutants ( D : gc-1 , E : gc-2 , F : gc-3 , G : gpat3-3 , H : gpat3-4 ) after I 2 /KI staining. Detection of DNA fragmentation in wild-type ( I ) and mutant ( J : gpat3-3 , K : gpat3-4 , L : gc-1 , M : gc-2 , N : gc-3 ) anthers using a TUNEL assay at the dehiscence stage (stage 13). White arrows indicate TUNEL-positive signals detected in the tapetum cells of wild-type and gpat3-2 anthers, while blue arrows indicate TUNEL-positive signal observed in the outer cell layers (including the epidermis, endothecium, and middle layer), and vascular bundle cells. The qPCR analysis of OsGPAT3 in wild-type, CRISPR/Cas9-induced mutants, and allelic mutants ( O ). Ad, anther dehiscence; DMsp, degenerated microspore; Mp, mature pollen; T, tapetum. Scale bars = 2 mm in ( B ), 500 μm in ( C – H ), and 50 μm in ( I – N ). ** indicates significant differences at p
    Superscript Iii Reverse Transcriptase, supplied by Toyobo, used in various techniques. Bioz Stars score: 94/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript iii reverse transcriptase/product/Toyobo
    Average 94 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    superscript iii reverse transcriptase - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    Image Search Results


    Sequence analysis and phenotypic observation of OsGPAT3 clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9)-induced mutants and allelic mutants. Gene structure of OsGPAT3 and mutation analysis of OsGPAT3 gene in transgenic plants and allelic mutants ( A ). The sequence (5′–CTAGTACTCGACGTCGAAGGCGG–3′) located in the first exon of the OsGPAT3 gene was selected as the target site of single guide RNA (sgRNA). The black boxes indicate the exons. The blue characters indicate the protospacer adjacent motif (PAM). The red characters indicate the three different types of mutation events generated by CRISPR/Cas9 in the mutants. Phenotypic comparison of the WT and mutant anthers at stage 13; the lemma and paleae were removed for clarity ( B ). Compressed anthers of wild type Zh8015 ( C ) and the mutants ( D : gc-1 , E : gc-2 , F : gc-3 , G : gpat3-3 , H : gpat3-4 ) after I 2 /KI staining. Detection of DNA fragmentation in wild-type ( I ) and mutant ( J : gpat3-3 , K : gpat3-4 , L : gc-1 , M : gc-2 , N : gc-3 ) anthers using a TUNEL assay at the dehiscence stage (stage 13). White arrows indicate TUNEL-positive signals detected in the tapetum cells of wild-type and gpat3-2 anthers, while blue arrows indicate TUNEL-positive signal observed in the outer cell layers (including the epidermis, endothecium, and middle layer), and vascular bundle cells. The qPCR analysis of OsGPAT3 in wild-type, CRISPR/Cas9-induced mutants, and allelic mutants ( O ). Ad, anther dehiscence; DMsp, degenerated microspore; Mp, mature pollen; T, tapetum. Scale bars = 2 mm in ( B ), 500 μm in ( C – H ), and 50 μm in ( I – N ). ** indicates significant differences at p

    Journal: International Journal of Molecular Sciences

    Article Title: OsGPAT3 Plays a Critical Role in Anther Wall Programmed Cell Death and Pollen Development in Rice

    doi: 10.3390/ijms19124017

    Figure Lengend Snippet: Sequence analysis and phenotypic observation of OsGPAT3 clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9)-induced mutants and allelic mutants. Gene structure of OsGPAT3 and mutation analysis of OsGPAT3 gene in transgenic plants and allelic mutants ( A ). The sequence (5′–CTAGTACTCGACGTCGAAGGCGG–3′) located in the first exon of the OsGPAT3 gene was selected as the target site of single guide RNA (sgRNA). The black boxes indicate the exons. The blue characters indicate the protospacer adjacent motif (PAM). The red characters indicate the three different types of mutation events generated by CRISPR/Cas9 in the mutants. Phenotypic comparison of the WT and mutant anthers at stage 13; the lemma and paleae were removed for clarity ( B ). Compressed anthers of wild type Zh8015 ( C ) and the mutants ( D : gc-1 , E : gc-2 , F : gc-3 , G : gpat3-3 , H : gpat3-4 ) after I 2 /KI staining. Detection of DNA fragmentation in wild-type ( I ) and mutant ( J : gpat3-3 , K : gpat3-4 , L : gc-1 , M : gc-2 , N : gc-3 ) anthers using a TUNEL assay at the dehiscence stage (stage 13). White arrows indicate TUNEL-positive signals detected in the tapetum cells of wild-type and gpat3-2 anthers, while blue arrows indicate TUNEL-positive signal observed in the outer cell layers (including the epidermis, endothecium, and middle layer), and vascular bundle cells. The qPCR analysis of OsGPAT3 in wild-type, CRISPR/Cas9-induced mutants, and allelic mutants ( O ). Ad, anther dehiscence; DMsp, degenerated microspore; Mp, mature pollen; T, tapetum. Scale bars = 2 mm in ( B ), 500 μm in ( C – H ), and 50 μm in ( I – N ). ** indicates significant differences at p

    Article Snippet: RNA was then reverse-transcribed (RT) from DNase I-treated RNA using Oligo-dT (18) primers in a 20-µL reaction using a SuperScript III Reverse Transcriptase Kit (TOYOBO, Japan).

    Techniques: Sequencing, CRISPR, Mutagenesis, Transgenic Assay, Generated, Staining, TUNEL Assay, Real-time Polymerase Chain Reaction

    Sequence analysis and phenotypic observation of OsGPAT3 clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9)-induced mutants and allelic mutants. Gene structure of OsGPAT3 and mutation analysis of OsGPAT3 gene in transgenic plants and allelic mutants ( A ). The sequence (5′–CTAGTACTCGACGTCGAAGGCGG–3′) located in the first exon of the OsGPAT3 gene was selected as the target site of single guide RNA (sgRNA). The black boxes indicate the exons. The blue characters indicate the protospacer adjacent motif (PAM). The red characters indicate the three different types of mutation events generated by CRISPR/Cas9 in the mutants. Phenotypic comparison of the WT and mutant anthers at stage 13; the lemma and paleae were removed for clarity ( B ). Compressed anthers of wild type Zh8015 ( C ) and the mutants ( D : gc-1 , E : gc-2 , F : gc-3 , G : gpat3-3 , H : gpat3-4 ) after I 2 /KI staining. Detection of DNA fragmentation in wild-type ( I ) and mutant ( J : gpat3-3 , K : gpat3-4 , L : gc-1 , M : gc-2 , N : gc-3 ) anthers using a TUNEL assay at the dehiscence stage (stage 13). White arrows indicate TUNEL-positive signals detected in the tapetum cells of wild-type and gpat3-2 anthers, while blue arrows indicate TUNEL-positive signal observed in the outer cell layers (including the epidermis, endothecium, and middle layer), and vascular bundle cells. The qPCR analysis of OsGPAT3 in wild-type, CRISPR/Cas9-induced mutants, and allelic mutants ( O ). Ad, anther dehiscence; DMsp, degenerated microspore; Mp, mature pollen; T, tapetum. Scale bars = 2 mm in ( B ), 500 μm in ( C – H ), and 50 μm in ( I – N ). ** indicates significant differences at p

    Journal: International Journal of Molecular Sciences

    Article Title: OsGPAT3 Plays a Critical Role in Anther Wall Programmed Cell Death and Pollen Development in Rice

    doi: 10.3390/ijms19124017

    Figure Lengend Snippet: Sequence analysis and phenotypic observation of OsGPAT3 clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9)-induced mutants and allelic mutants. Gene structure of OsGPAT3 and mutation analysis of OsGPAT3 gene in transgenic plants and allelic mutants ( A ). The sequence (5′–CTAGTACTCGACGTCGAAGGCGG–3′) located in the first exon of the OsGPAT3 gene was selected as the target site of single guide RNA (sgRNA). The black boxes indicate the exons. The blue characters indicate the protospacer adjacent motif (PAM). The red characters indicate the three different types of mutation events generated by CRISPR/Cas9 in the mutants. Phenotypic comparison of the WT and mutant anthers at stage 13; the lemma and paleae were removed for clarity ( B ). Compressed anthers of wild type Zh8015 ( C ) and the mutants ( D : gc-1 , E : gc-2 , F : gc-3 , G : gpat3-3 , H : gpat3-4 ) after I 2 /KI staining. Detection of DNA fragmentation in wild-type ( I ) and mutant ( J : gpat3-3 , K : gpat3-4 , L : gc-1 , M : gc-2 , N : gc-3 ) anthers using a TUNEL assay at the dehiscence stage (stage 13). White arrows indicate TUNEL-positive signals detected in the tapetum cells of wild-type and gpat3-2 anthers, while blue arrows indicate TUNEL-positive signal observed in the outer cell layers (including the epidermis, endothecium, and middle layer), and vascular bundle cells. The qPCR analysis of OsGPAT3 in wild-type, CRISPR/Cas9-induced mutants, and allelic mutants ( O ). Ad, anther dehiscence; DMsp, degenerated microspore; Mp, mature pollen; T, tapetum. Scale bars = 2 mm in ( B ), 500 μm in ( C – H ), and 50 μm in ( I – N ). ** indicates significant differences at p

    Article Snippet: RNA was then reverse-transcribed (RT) from DNase I-treated RNA using Oligo-dT (18) primers in a 20-µL reaction using a SuperScript III Reverse Transcriptase Kit (TOYOBO, Japan).

    Techniques: Sequencing, CRISPR, Mutagenesis, Transgenic Assay, Generated, Staining, TUNEL Assay, Real-time Polymerase Chain Reaction