superscript iii reverse transcriptase  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    Qiagen superscript iii reverse transcriptase
    Superscript Iii Reverse Transcriptase, supplied by Qiagen, used in various techniques. Bioz Stars score: 94/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript iii reverse transcriptase/product/Qiagen
    Average 94 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    superscript iii reverse transcriptase - by Bioz Stars, 2020-04
    94/100 stars

    Images

    Related Articles

    Amplification:

    Article Title: Expression and Function of Sulfonylurea, Adrenergic, and Glucagon- Like Peptide 1 Receptors in Isolated Porcine Islets
    Article Snippet: .. PCR products for receptors of interest were amplified from mRNA by reverse-transcription-PCR using Superscript III reverse transcriptase and Taq DNA polymerase (Qiagen) according to the manufacturer’s instructions. .. The PCR products of the correct size were inserted into the TOPO TA cloning expression vector pCRII and transformed into One Shot Mach T1 Phage-Resistant Chemically Competent E. coli (Invitrogen Life Technologies).

    Article Title: Sa-Lrp from Sulfolobus acidocaldarius is a versatile, glutamine-responsive, and architectural transcriptional regulator
    Article Snippet: When using Superscript III Reverse Transcriptase, this was followed by RNase H treatment (Qiagen). .. The amplicon sizes were between 100 and 300 base pairs.

    Article Title: Chronic Pulsatile Hyperglycemia Reduces Insulin Secretion and Increases Accumulation of Reactive Oxygen Species in Fetal Sheep Islets
    Article Snippet: .. PCR products for ovine genes were amplified from fetal ovine mRNA by reverse transcription-PCR using Superscript III reverse transcriptase and Taq DNA polymerase (QIAGEN) according to the manufacturer’s instructions. .. Correct PCR products were verified by confirming product size after separation in a 1% agarose DNA gel.

    Article Title: Chronic exposure to elevated norepinephrine suppresses insulin secretion in fetal sheep with placental insufficiency and intrauterine growth restriction
    Article Snippet: .. PCR products for ovine adrenergic receptors, α1 (A, B, D), α2 (A, B, C), and β ( , , ), were amplified from perirenal fat mRNA by reverse transcription-PCR using Superscript III reverse transcriptase and Taq DNA polymerase (Qiagen) according to the manufacturer's instructions (Chen and Limesand, unpublished data). .. The PCR products of the correct size were inserted into the TOPO TA cloning expression vector pCRII (Invitrogen Life Technologies) and transformed into One Shot Mach T1 Phage-Resistant Chemically Competent E. coli (Invitrogen Life Technologies).

    Article Title: Trypanosoma cruzi Targets Akt in Host Cells as an Intracellular Antiapoptotic Strategy
    Article Snippet: In brief, RNA was isolated with the Trizol reagent and chloroform, cDNA was synthesized from500 ng of total RNA with Superscript III reverse transcriptase primed with random hexamers, and quantitative real-time PCR (qPCR) reactions were performed with QuantiTect SYBR Green PCR kit (Qiagen) on an Applied Biosystems 7300 Real-Time PCR system. .. Conditions for the PCR reactions were as follows: 95°C for 15 min, followed by 50 cycles at 94°C for 15 s, 54°C for 30 s, and 72°C for 45 s, concluding with a dissociation stage to measure amplification product specificity.

    Article Title: Transcriptome profiling of esophageal squamous cell carcinoma reveals a long noncoding RNA acting as a tumor suppressor
    Article Snippet: 3′- and 5′-RACE were performed using the RLM RACE kit (Ambion AM1700) and 5′-RACE System for Rapid Amplification cDNA Ends (Life Technology, 18374-058). .. For the qRT-PCRs, the SuperScript III reverse transcriptase was employed to synthetize the first-strand cDNA. qPCR analysis was performed with 0.5 μL cDNA as template in a 20 μL reaction volumes using SYBR green master mixture on the Rotor-Gene® Q real-time cycler (Qiagen).

    Article Title: Identification of HCV Resistant Variants against Direct Acting Antivirals in Plasma and Liver of Treatment Naïve Patients
    Article Snippet: .. DNA-free RNA was reverse transcribed using the Superscript III reverse transcriptase and amplified by PCR using Hotstar Hifidelity Taq DNA polymerase (Qiagen). .. PCR amplified products were analyzed using the DPS protocol; the entire procedure from sample preparation to DPS was repeated three times in the two experiments using plasmid DNA or transcribed RNA.

    Article Title: Viral metagenomics revealed novel betatorquevirus species in pediatric inpatients with encephalitis/meningoencephalitis from Ghana
    Article Snippet: Reverse transcription and cDNA synthesis were performed using 12 μl extracted RNA mixed with 100 pmol of random primer with a 20 bp fixed 5′ end sequence and at the 3′ a random nonamer (CCAGATGCCATCCAAGTGACNNNNNNNNN) and incubated at 72 °C, 2 min. First strand synthesis was done in a reaction mix consisting 1 µl SuperScript™ III reverse transcriptase, 1 µl dNTP (10 mM each; Qiagen), 5 × first-strand extension buffer and 10 mM dithiothreitol incubated at 25 °C for 10 min, followed by 50 °C incubation for 1 h and 70 °C for 15 minutes. .. The second strand reaction was carried out by incubation with 20 pmol of random primer, 2 µl 10x Klenow buffer and 5U Klenow Fragment (New England Biolabs, USA) at 37 °C for 1 h. The dsDNA obtained was PCR amplified using 5 µl sample, 20 pmol of the fixed portion of the random primer (CCAGATGCCATCCAAGTGAC), 5U HotStart Taq DNA Polymerase (Qiagen), 2.5 mM MgCl2, 0.2 mM dNTPs, and 1 X PCR buffer.

    Positive Control:

    Article Title: Chronic exposure to elevated norepinephrine suppresses insulin secretion in fetal sheep with placental insufficiency and intrauterine growth restriction
    Article Snippet: Total RNA was extracted from purified islet of Langerhans ( , , ) using the RNeasy Micro Kit (Qiagen, Valencia, CA) or from perirenal adipose tissue (positive control) as previously described ( , ). .. PCR products for ovine adrenergic receptors, α1 (A, B, D), α2 (A, B, C), and β ( , , ), were amplified from perirenal fat mRNA by reverse transcription-PCR using Superscript III reverse transcriptase and Taq DNA polymerase (Qiagen) according to the manufacturer's instructions (Chen and Limesand, unpublished data).

    Synthesized:

    Article Title: Trypanosoma cruzi Targets Akt in Host Cells as an Intracellular Antiapoptotic Strategy
    Article Snippet: .. In brief, RNA was isolated with the Trizol reagent and chloroform, cDNA was synthesized from500 ng of total RNA with Superscript III reverse transcriptase primed with random hexamers, and quantitative real-time PCR (qPCR) reactions were performed with QuantiTect SYBR Green PCR kit (Qiagen) on an Applied Biosystems 7300 Real-Time PCR system. .. Conditions for the PCR reactions were as follows: 95°C for 15 min, followed by 50 cycles at 94°C for 15 s, 54°C for 30 s, and 72°C for 45 s, concluding with a dissociation stage to measure amplification product specificity.

    Article Title: Identification of HCV Resistant Variants against Direct Acting Antivirals in Plasma and Liver of Treatment Naïve Patients
    Article Snippet: To measure the error rate of reverse transcriptase, RNA was synthesized from the plasmid using RiboMAX large scale RNA production system SP6 and T7 (Promega Corporation, Madison, WI, USA). .. DNA-free RNA was reverse transcribed using the Superscript III reverse transcriptase and amplified by PCR using Hotstar Hifidelity Taq DNA polymerase (Qiagen).

    TA Cloning:

    Article Title: Expression and Function of Sulfonylurea, Adrenergic, and Glucagon- Like Peptide 1 Receptors in Isolated Porcine Islets
    Article Snippet: PCR products for receptors of interest were amplified from mRNA by reverse-transcription-PCR using Superscript III reverse transcriptase and Taq DNA polymerase (Qiagen) according to the manufacturer’s instructions. .. The PCR products of the correct size were inserted into the TOPO TA cloning expression vector pCRII and transformed into One Shot Mach T1 Phage-Resistant Chemically Competent E. coli (Invitrogen Life Technologies).

    Article Title: Chronic Pulsatile Hyperglycemia Reduces Insulin Secretion and Increases Accumulation of Reactive Oxygen Species in Fetal Sheep Islets
    Article Snippet: PCR products for ovine genes were amplified from fetal ovine mRNA by reverse transcription-PCR using Superscript III reverse transcriptase and Taq DNA polymerase (QIAGEN) according to the manufacturer’s instructions. .. PCR products were then inserted into the TOPO TA cloning expression vector pCRII (Invitrogen, Carlsbad, CA) and transformed into One Shot Mach T1 Phage-Resistant Chemically Competent E. coli (Invitrogen).

    Article Title: Chronic exposure to elevated norepinephrine suppresses insulin secretion in fetal sheep with placental insufficiency and intrauterine growth restriction
    Article Snippet: PCR products for ovine adrenergic receptors, α1 (A, B, D), α2 (A, B, C), and β ( , , ), were amplified from perirenal fat mRNA by reverse transcription-PCR using Superscript III reverse transcriptase and Taq DNA polymerase (Qiagen) according to the manufacturer's instructions (Chen and Limesand, unpublished data). .. The PCR products of the correct size were inserted into the TOPO TA cloning expression vector pCRII (Invitrogen Life Technologies) and transformed into One Shot Mach T1 Phage-Resistant Chemically Competent E. coli (Invitrogen Life Technologies).

    Quantitative RT-PCR:

    Article Title: Sa-Lrp from Sulfolobus acidocaldarius is a versatile, glutamine-responsive, and architectural transcriptional regulator
    Article Snippet: When using Superscript III Reverse Transcriptase, this was followed by RNase H treatment (Qiagen). .. The quantitative reverse transcriptase PCR (qRT-PCR) reactions mixtures were prepared using the iQ SYBR Green Supermix (Bio-Rad) or FastStart Universal SYBR Green Master, Rox (Roche) and gene-specific primer sets for the following genes: Saci_1588 (DC1117f/DC1118r), Saci_1483 (DC1119f/DC1120r), Saci_0558 (DC1121f/DC1122r), Saci_2141 (DC1123f/DC1124r), Saci_0155 (DC1125f/DC1126r), Saci_2320 (DC1127f/DC1128r), Saci_2136 (DC1340f/DC1341r), Saci_1596 (DC1370f/DC1371r), Saci_0992 (DC1374f/DC1375r), Saci_1492 (DC1383f/DC1384r), Saci_1493 (DC1385f/DC1386r), Saci_1494 (DC1387f/DC1388r), Saci_1495 (DC1389f/DC1390r), Saci_1496 (DC1391f/DC1392r), Saci_1497 (DC1393f/DC1394r), Saci_1498 (DC1395f/DC1396r), Saci_1499 (DC1397f/DC1398r), Saci_1500 (DC1399f/DC1400r), and Saci_1336 (DC1304f/DC1305r).

    Article Title: Transcriptome profiling of esophageal squamous cell carcinoma reveals a long noncoding RNA acting as a tumor suppressor
    Article Snippet: Paragraph title: Rapid amplification of cDNA ends (RACE), northern blot and quantitative RT-PCR (qRT-PCR) ... For the qRT-PCRs, the SuperScript III reverse transcriptase was employed to synthetize the first-strand cDNA. qPCR analysis was performed with 0.5 μL cDNA as template in a 20 μL reaction volumes using SYBR green master mixture on the Rotor-Gene® Q real-time cycler (Qiagen).

    Article Title: Lateralization of gene expression in the honeybee brain during olfactory learning
    Article Snippet: Paragraph title: Validation of high throughput sequencing data results by qRT-PCR ... The SuperScript III reverse transcriptase was employed to synthesize the first-strand cDNA. qPCR analysis was performed with 0.5 μL cDNA as template in a 20 μL reaction volumes using SYBR green master mixture on the Rotor-Gene® Q real-time cycler (Qiagen).

    SYBR Green Assay:

    Article Title: Expression and Function of Sulfonylurea, Adrenergic, and Glucagon- Like Peptide 1 Receptors in Isolated Porcine Islets
    Article Snippet: PCR products for receptors of interest were amplified from mRNA by reverse-transcription-PCR using Superscript III reverse transcriptase and Taq DNA polymerase (Qiagen) according to the manufacturer’s instructions. .. The relative mRNA expression for each receptor was determined by quantitative PCR using SYBR Green (Qiagen) in an iQ5 Real-Time PCR Detection System (Bio-Rad Laboratories, Irvine, CA).

    Article Title: Sa-Lrp from Sulfolobus acidocaldarius is a versatile, glutamine-responsive, and architectural transcriptional regulator
    Article Snippet: When using Superscript III Reverse Transcriptase, this was followed by RNase H treatment (Qiagen). .. The quantitative reverse transcriptase PCR (qRT-PCR) reactions mixtures were prepared using the iQ SYBR Green Supermix (Bio-Rad) or FastStart Universal SYBR Green Master, Rox (Roche) and gene-specific primer sets for the following genes: Saci_1588 (DC1117f/DC1118r), Saci_1483 (DC1119f/DC1120r), Saci_0558 (DC1121f/DC1122r), Saci_2141 (DC1123f/DC1124r), Saci_0155 (DC1125f/DC1126r), Saci_2320 (DC1127f/DC1128r), Saci_2136 (DC1340f/DC1341r), Saci_1596 (DC1370f/DC1371r), Saci_0992 (DC1374f/DC1375r), Saci_1492 (DC1383f/DC1384r), Saci_1493 (DC1385f/DC1386r), Saci_1494 (DC1387f/DC1388r), Saci_1495 (DC1389f/DC1390r), Saci_1496 (DC1391f/DC1392r), Saci_1497 (DC1393f/DC1394r), Saci_1498 (DC1395f/DC1396r), Saci_1499 (DC1397f/DC1398r), Saci_1500 (DC1399f/DC1400r), and Saci_1336 (DC1304f/DC1305r).

    Article Title: Trypanosoma cruzi Targets Akt in Host Cells as an Intracellular Antiapoptotic Strategy
    Article Snippet: .. In brief, RNA was isolated with the Trizol reagent and chloroform, cDNA was synthesized from500 ng of total RNA with Superscript III reverse transcriptase primed with random hexamers, and quantitative real-time PCR (qPCR) reactions were performed with QuantiTect SYBR Green PCR kit (Qiagen) on an Applied Biosystems 7300 Real-Time PCR system. .. Conditions for the PCR reactions were as follows: 95°C for 15 min, followed by 50 cycles at 94°C for 15 s, 54°C for 30 s, and 72°C for 45 s, concluding with a dissociation stage to measure amplification product specificity.

    Article Title: Transcriptome profiling of esophageal squamous cell carcinoma reveals a long noncoding RNA acting as a tumor suppressor
    Article Snippet: .. For the qRT-PCRs, the SuperScript III reverse transcriptase was employed to synthetize the first-strand cDNA. qPCR analysis was performed with 0.5 μL cDNA as template in a 20 μL reaction volumes using SYBR green master mixture on the Rotor-Gene® Q real-time cycler (Qiagen). .. The expression levels were normalized to GAPDH and the relative expression was calculated by the delta-delta Ct method.

    Article Title: Lateralization of gene expression in the honeybee brain during olfactory learning
    Article Snippet: .. The SuperScript III reverse transcriptase was employed to synthesize the first-strand cDNA. qPCR analysis was performed with 0.5 μL cDNA as template in a 20 μL reaction volumes using SYBR green master mixture on the Rotor-Gene® Q real-time cycler (Qiagen). ..

    Incubation:

    Article Title: Viral metagenomics revealed novel betatorquevirus species in pediatric inpatients with encephalitis/meningoencephalitis from Ghana
    Article Snippet: .. Reverse transcription and cDNA synthesis were performed using 12 μl extracted RNA mixed with 100 pmol of random primer with a 20 bp fixed 5′ end sequence and at the 3′ a random nonamer (CCAGATGCCATCCAAGTGACNNNNNNNNN) and incubated at 72 °C, 2 min. First strand synthesis was done in a reaction mix consisting 1 µl SuperScript™ III reverse transcriptase, 1 µl dNTP (10 mM each; Qiagen), 5 × first-strand extension buffer and 10 mM dithiothreitol incubated at 25 °C for 10 min, followed by 50 °C incubation for 1 h and 70 °C for 15 minutes. .. The second strand reaction was carried out by incubation with 20 pmol of random primer, 2 µl 10x Klenow buffer and 5U Klenow Fragment (New England Biolabs, USA) at 37 °C for 1 h. The dsDNA obtained was PCR amplified using 5 µl sample, 20 pmol of the fixed portion of the random primer (CCAGATGCCATCCAAGTGAC), 5U HotStart Taq DNA Polymerase (Qiagen), 2.5 mM MgCl2, 0.2 mM dNTPs, and 1 X PCR buffer.

    Expressing:

    Article Title: Expression and Function of Sulfonylurea, Adrenergic, and Glucagon- Like Peptide 1 Receptors in Isolated Porcine Islets
    Article Snippet: PCR products for receptors of interest were amplified from mRNA by reverse-transcription-PCR using Superscript III reverse transcriptase and Taq DNA polymerase (Qiagen) according to the manufacturer’s instructions. .. The PCR products of the correct size were inserted into the TOPO TA cloning expression vector pCRII and transformed into One Shot Mach T1 Phage-Resistant Chemically Competent E. coli (Invitrogen Life Technologies).

    Article Title: Sa-Lrp from Sulfolobus acidocaldarius is a versatile, glutamine-responsive, and architectural transcriptional regulator
    Article Snippet: cDNA synthesis and quantitative reverse transcriptase PCR Samples used to analyze the gene expression of the ups operon and DNA repair were prepared differently. cDNA synthesis of the former was carried out from total RNA using the First Strand cDNA Synthesis kit (Fermentas) or with Superscript III Reverse Transcriptase (Invitrogen, Gent, Belgium) with 200-ng random primers following the manufacturer's instructions. .. When using Superscript III Reverse Transcriptase, this was followed by RNase H treatment (Qiagen).

    Article Title: Chronic Pulsatile Hyperglycemia Reduces Insulin Secretion and Increases Accumulation of Reactive Oxygen Species in Fetal Sheep Islets
    Article Snippet: PCR products for ovine genes were amplified from fetal ovine mRNA by reverse transcription-PCR using Superscript III reverse transcriptase and Taq DNA polymerase (QIAGEN) according to the manufacturer’s instructions. .. PCR products were then inserted into the TOPO TA cloning expression vector pCRII (Invitrogen, Carlsbad, CA) and transformed into One Shot Mach T1 Phage-Resistant Chemically Competent E. coli (Invitrogen).

    Article Title: Chronic exposure to elevated norepinephrine suppresses insulin secretion in fetal sheep with placental insufficiency and intrauterine growth restriction
    Article Snippet: PCR products for ovine adrenergic receptors, α1 (A, B, D), α2 (A, B, C), and β ( , , ), were amplified from perirenal fat mRNA by reverse transcription-PCR using Superscript III reverse transcriptase and Taq DNA polymerase (Qiagen) according to the manufacturer's instructions (Chen and Limesand, unpublished data). .. The PCR products of the correct size were inserted into the TOPO TA cloning expression vector pCRII (Invitrogen Life Technologies) and transformed into One Shot Mach T1 Phage-Resistant Chemically Competent E. coli (Invitrogen Life Technologies).

    Article Title: Trypanosoma cruzi Targets Akt in Host Cells as an Intracellular Antiapoptotic Strategy
    Article Snippet: In brief, RNA was isolated with the Trizol reagent and chloroform, cDNA was synthesized from500 ng of total RNA with Superscript III reverse transcriptase primed with random hexamers, and quantitative real-time PCR (qPCR) reactions were performed with QuantiTect SYBR Green PCR kit (Qiagen) on an Applied Biosystems 7300 Real-Time PCR system. .. Primers used to calculate Akt expression were synthesized as described previously ( ).

    Article Title: Transcriptome profiling of esophageal squamous cell carcinoma reveals a long noncoding RNA acting as a tumor suppressor
    Article Snippet: For the qRT-PCRs, the SuperScript III reverse transcriptase was employed to synthetize the first-strand cDNA. qPCR analysis was performed with 0.5 μL cDNA as template in a 20 μL reaction volumes using SYBR green master mixture on the Rotor-Gene® Q real-time cycler (Qiagen). .. The expression levels were normalized to GAPDH and the relative expression was calculated by the delta-delta Ct method.

    Article Title: Lateralization of gene expression in the honeybee brain during olfactory learning
    Article Snippet: The SuperScript III reverse transcriptase was employed to synthesize the first-strand cDNA. qPCR analysis was performed with 0.5 μL cDNA as template in a 20 μL reaction volumes using SYBR green master mixture on the Rotor-Gene® Q real-time cycler (Qiagen). .. The expression levels of each gene were normalized to RPL8 and relative expression was calculated by the delta-delta Ct method.

    Transformation Assay:

    Article Title: Expression and Function of Sulfonylurea, Adrenergic, and Glucagon- Like Peptide 1 Receptors in Isolated Porcine Islets
    Article Snippet: PCR products for receptors of interest were amplified from mRNA by reverse-transcription-PCR using Superscript III reverse transcriptase and Taq DNA polymerase (Qiagen) according to the manufacturer’s instructions. .. The PCR products of the correct size were inserted into the TOPO TA cloning expression vector pCRII and transformed into One Shot Mach T1 Phage-Resistant Chemically Competent E. coli (Invitrogen Life Technologies).

    Article Title: Chronic Pulsatile Hyperglycemia Reduces Insulin Secretion and Increases Accumulation of Reactive Oxygen Species in Fetal Sheep Islets
    Article Snippet: PCR products for ovine genes were amplified from fetal ovine mRNA by reverse transcription-PCR using Superscript III reverse transcriptase and Taq DNA polymerase (QIAGEN) according to the manufacturer’s instructions. .. PCR products were then inserted into the TOPO TA cloning expression vector pCRII (Invitrogen, Carlsbad, CA) and transformed into One Shot Mach T1 Phage-Resistant Chemically Competent E. coli (Invitrogen).

    Article Title: Chronic exposure to elevated norepinephrine suppresses insulin secretion in fetal sheep with placental insufficiency and intrauterine growth restriction
    Article Snippet: PCR products for ovine adrenergic receptors, α1 (A, B, D), α2 (A, B, C), and β ( , , ), were amplified from perirenal fat mRNA by reverse transcription-PCR using Superscript III reverse transcriptase and Taq DNA polymerase (Qiagen) according to the manufacturer's instructions (Chen and Limesand, unpublished data). .. The PCR products of the correct size were inserted into the TOPO TA cloning expression vector pCRII (Invitrogen Life Technologies) and transformed into One Shot Mach T1 Phage-Resistant Chemically Competent E. coli (Invitrogen Life Technologies).

    Article Title: Identification of HCV Resistant Variants against Direct Acting Antivirals in Plasma and Liver of Treatment Naïve Patients
    Article Snippet: To ensure this synthetic plasmid contained only one plasmid sequence, E.coli bacteria were transformed and a plasmid was isolated from a single bacterial clone. .. DNA-free RNA was reverse transcribed using the Superscript III reverse transcriptase and amplified by PCR using Hotstar Hifidelity Taq DNA polymerase (Qiagen).

    Northern Blot:

    Article Title: Transcriptome profiling of esophageal squamous cell carcinoma reveals a long noncoding RNA acting as a tumor suppressor
    Article Snippet: Paragraph title: Rapid amplification of cDNA ends (RACE), northern blot and quantitative RT-PCR (qRT-PCR) ... For the qRT-PCRs, the SuperScript III reverse transcriptase was employed to synthetize the first-strand cDNA. qPCR analysis was performed with 0.5 μL cDNA as template in a 20 μL reaction volumes using SYBR green master mixture on the Rotor-Gene® Q real-time cycler (Qiagen).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Viral metagenomics revealed novel betatorquevirus species in pediatric inpatients with encephalitis/meningoencephalitis from Ghana
    Article Snippet: Reverse transcription and cDNA synthesis were performed using 12 μl extracted RNA mixed with 100 pmol of random primer with a 20 bp fixed 5′ end sequence and at the 3′ a random nonamer (CCAGATGCCATCCAAGTGACNNNNNNNNN) and incubated at 72 °C, 2 min. First strand synthesis was done in a reaction mix consisting 1 µl SuperScript™ III reverse transcriptase, 1 µl dNTP (10 mM each; Qiagen), 5 × first-strand extension buffer and 10 mM dithiothreitol incubated at 25 °C for 10 min, followed by 50 °C incubation for 1 h and 70 °C for 15 minutes. .. The random RT-PCR product DNA and extracted DNA were used for library preparation by using QIAseq FX DNA Library Kit (Qiagen, Germany) with double index barcode labeling according the manufacturer’s instructions.

    DNA Sequencing:

    Article Title: Expression and Function of Sulfonylurea, Adrenergic, and Glucagon- Like Peptide 1 Receptors in Isolated Porcine Islets
    Article Snippet: PCR products for receptors of interest were amplified from mRNA by reverse-transcription-PCR using Superscript III reverse transcriptase and Taq DNA polymerase (Qiagen) according to the manufacturer’s instructions. .. Plasmids were prepared for nucleotide sequencing with a QIAprep Spin Miniprep Kit (Qiagen) and sequenced at the University of Arizona DNA sequencing service.

    Article Title: Chronic Pulsatile Hyperglycemia Reduces Insulin Secretion and Increases Accumulation of Reactive Oxygen Species in Fetal Sheep Islets
    Article Snippet: PCR products for ovine genes were amplified from fetal ovine mRNA by reverse transcription-PCR using Superscript III reverse transcriptase and Taq DNA polymerase (QIAGEN) according to the manufacturer’s instructions. .. Plasmids were prepared for nucleotide sequencing with a QIAprep Spin Miniprep Kit (QIAGEN) and sequenced at the University of Arizona DNA Sequencing Service.

    Article Title: Chronic exposure to elevated norepinephrine suppresses insulin secretion in fetal sheep with placental insufficiency and intrauterine growth restriction
    Article Snippet: PCR products for ovine adrenergic receptors, α1 (A, B, D), α2 (A, B, C), and β ( , , ), were amplified from perirenal fat mRNA by reverse transcription-PCR using Superscript III reverse transcriptase and Taq DNA polymerase (Qiagen) according to the manufacturer's instructions (Chen and Limesand, unpublished data). .. Plasmids were prepared for nucleotide sequencing with a QIAprep Spin Miniprep Kit (Qiagen) and sequenced at the University of Arizona DNA Sequencing Service.

    Sequencing:

    Article Title: Expression and Function of Sulfonylurea, Adrenergic, and Glucagon- Like Peptide 1 Receptors in Isolated Porcine Islets
    Article Snippet: PCR products for receptors of interest were amplified from mRNA by reverse-transcription-PCR using Superscript III reverse transcriptase and Taq DNA polymerase (Qiagen) according to the manufacturer’s instructions. .. Plasmids were prepared for nucleotide sequencing with a QIAprep Spin Miniprep Kit (Qiagen) and sequenced at the University of Arizona DNA sequencing service.

    Article Title: Chronic Pulsatile Hyperglycemia Reduces Insulin Secretion and Increases Accumulation of Reactive Oxygen Species in Fetal Sheep Islets
    Article Snippet: Synthetic oligonucleotide primers were designed against sequences for genes of interest (GenBank accession numbers listed in parentheses and are for ovine sequences unless otherwise noted): antioxidants SOD-1 , SOD-2 , GPx-1 , catalase ( ) and uncoupling protein 2 (UCP2; bovine sequence ); insulin ( ) and insulin transcription factors pancreatic and duodenal homeobox 1 (PDX-1; ) and V-maf musculoaponeurotic fibrosarcoma oncogene homolog A (MafA; bovine sequence ); endoplasmic reticulum stress response genes glucose regulatory protein-78 (GRP78; ), and DNA-damage inducible transcript-3 (DDIT-3; ); and the reference gene ribosomal protein S15 (S15; ) were designed with the aid of Primer-BLAST (NCBI, Bethesda, MD) software and purchased from Eurofins MWG Operon (Huntsville, AL) (primer sequences are available upon request). .. PCR products for ovine genes were amplified from fetal ovine mRNA by reverse transcription-PCR using Superscript III reverse transcriptase and Taq DNA polymerase (QIAGEN) according to the manufacturer’s instructions.

    Article Title: Identification of HCV Resistant Variants against Direct Acting Antivirals in Plasma and Liver of Treatment Naïve Patients
    Article Snippet: The sequence of the plasmid was confirmed by Sanger sequencing. .. DNA-free RNA was reverse transcribed using the Superscript III reverse transcriptase and amplified by PCR using Hotstar Hifidelity Taq DNA polymerase (Qiagen).

    Article Title: Viral metagenomics revealed novel betatorquevirus species in pediatric inpatients with encephalitis/meningoencephalitis from Ghana
    Article Snippet: .. Reverse transcription and cDNA synthesis were performed using 12 μl extracted RNA mixed with 100 pmol of random primer with a 20 bp fixed 5′ end sequence and at the 3′ a random nonamer (CCAGATGCCATCCAAGTGACNNNNNNNNN) and incubated at 72 °C, 2 min. First strand synthesis was done in a reaction mix consisting 1 µl SuperScript™ III reverse transcriptase, 1 µl dNTP (10 mM each; Qiagen), 5 × first-strand extension buffer and 10 mM dithiothreitol incubated at 25 °C for 10 min, followed by 50 °C incubation for 1 h and 70 °C for 15 minutes. .. The second strand reaction was carried out by incubation with 20 pmol of random primer, 2 µl 10x Klenow buffer and 5U Klenow Fragment (New England Biolabs, USA) at 37 °C for 1 h. The dsDNA obtained was PCR amplified using 5 µl sample, 20 pmol of the fixed portion of the random primer (CCAGATGCCATCCAAGTGAC), 5U HotStart Taq DNA Polymerase (Qiagen), 2.5 mM MgCl2, 0.2 mM dNTPs, and 1 X PCR buffer.

    Isolation:

    Article Title: Trypanosoma cruzi Targets Akt in Host Cells as an Intracellular Antiapoptotic Strategy
    Article Snippet: .. In brief, RNA was isolated with the Trizol reagent and chloroform, cDNA was synthesized from500 ng of total RNA with Superscript III reverse transcriptase primed with random hexamers, and quantitative real-time PCR (qPCR) reactions were performed with QuantiTect SYBR Green PCR kit (Qiagen) on an Applied Biosystems 7300 Real-Time PCR system. .. Conditions for the PCR reactions were as follows: 95°C for 15 min, followed by 50 cycles at 94°C for 15 s, 54°C for 30 s, and 72°C for 45 s, concluding with a dissociation stage to measure amplification product specificity.

    Article Title: Transcriptome profiling of esophageal squamous cell carcinoma reveals a long noncoding RNA acting as a tumor suppressor
    Article Snippet: Rapid amplification of cDNA ends (RACE), northern blot and quantitative RT-PCR (qRT-PCR) Total RNAs were isolated from the cell lines (Het-1A, EC109, KYSE510, KYSE450, TE-1, KYSE30, KYSE150) with the Trizol reagent (Invitrogen) according to the manufacturer's instructions, and then subjected to DNaseI treatment. .. For the qRT-PCRs, the SuperScript III reverse transcriptase was employed to synthetize the first-strand cDNA. qPCR analysis was performed with 0.5 μL cDNA as template in a 20 μL reaction volumes using SYBR green master mixture on the Rotor-Gene® Q real-time cycler (Qiagen).

    Article Title: Identification of HCV Resistant Variants against Direct Acting Antivirals in Plasma and Liver of Treatment Naïve Patients
    Article Snippet: To ensure this synthetic plasmid contained only one plasmid sequence, E.coli bacteria were transformed and a plasmid was isolated from a single bacterial clone. .. DNA-free RNA was reverse transcribed using the Superscript III reverse transcriptase and amplified by PCR using Hotstar Hifidelity Taq DNA polymerase (Qiagen).

    Article Title: Lateralization of gene expression in the honeybee brain during olfactory learning
    Article Snippet: Total RNAs were isolated from these brain tissues using the Invitrogen Trizol kit. .. The SuperScript III reverse transcriptase was employed to synthesize the first-strand cDNA. qPCR analysis was performed with 0.5 μL cDNA as template in a 20 μL reaction volumes using SYBR green master mixture on the Rotor-Gene® Q real-time cycler (Qiagen).

    Article Title: Viral metagenomics revealed novel betatorquevirus species in pediatric inpatients with encephalitis/meningoencephalitis from Ghana
    Article Snippet: Enriched viral particles were then subjected to RNA/DNA extraction by using MagMAX™ Viral RNA Isolation Kit (Life Technologies, Carlsbad, California, USA) and QIAamp DNA Mini Kit (Qiagen, Hilden, Germany) according the manufacturer’s instructions. .. Reverse transcription and cDNA synthesis were performed using 12 μl extracted RNA mixed with 100 pmol of random primer with a 20 bp fixed 5′ end sequence and at the 3′ a random nonamer (CCAGATGCCATCCAAGTGACNNNNNNNNN) and incubated at 72 °C, 2 min. First strand synthesis was done in a reaction mix consisting 1 µl SuperScript™ III reverse transcriptase, 1 µl dNTP (10 mM each; Qiagen), 5 × first-strand extension buffer and 10 mM dithiothreitol incubated at 25 °C for 10 min, followed by 50 °C incubation for 1 h and 70 °C for 15 minutes.

    Size-exclusion Chromatography:

    Article Title: Sa-Lrp from Sulfolobus acidocaldarius is a versatile, glutamine-responsive, and architectural transcriptional regulator
    Article Snippet: When using Superscript III Reverse Transcriptase, this was followed by RNase H treatment (Qiagen). .. To determine the efficiency of each primer pair, qPCRs were performed using a 10-fold dilution series of S. acidocaldarius genomic DNA as a template and the efficiency was then calculated from the average slope of a linear regression curve. qPCR was carried out in an iCycler IQ (Bio-Rad) or ABI 7300 (Applied Biosystems, Carlsbad, CA) using the following protocol: 95°C for 10 min and 40 cycles of 95°C for 15 sec and 50°C for 60 sec.

    Labeling:

    Article Title: Viral metagenomics revealed novel betatorquevirus species in pediatric inpatients with encephalitis/meningoencephalitis from Ghana
    Article Snippet: Reverse transcription and cDNA synthesis were performed using 12 μl extracted RNA mixed with 100 pmol of random primer with a 20 bp fixed 5′ end sequence and at the 3′ a random nonamer (CCAGATGCCATCCAAGTGACNNNNNNNNN) and incubated at 72 °C, 2 min. First strand synthesis was done in a reaction mix consisting 1 µl SuperScript™ III reverse transcriptase, 1 µl dNTP (10 mM each; Qiagen), 5 × first-strand extension buffer and 10 mM dithiothreitol incubated at 25 °C for 10 min, followed by 50 °C incubation for 1 h and 70 °C for 15 minutes. .. The random RT-PCR product DNA and extracted DNA were used for library preparation by using QIAseq FX DNA Library Kit (Qiagen, Germany) with double index barcode labeling according the manufacturer’s instructions.

    Purification:

    Article Title: Expression and Function of Sulfonylurea, Adrenergic, and Glucagon- Like Peptide 1 Receptors in Isolated Porcine Islets
    Article Snippet: RNA was extracted from purified porcine islets using RNeasy Micro Kit (Qiagen, Valencia, CA). .. PCR products for receptors of interest were amplified from mRNA by reverse-transcription-PCR using Superscript III reverse transcriptase and Taq DNA polymerase (Qiagen) according to the manufacturer’s instructions.

    Article Title: Chronic exposure to elevated norepinephrine suppresses insulin secretion in fetal sheep with placental insufficiency and intrauterine growth restriction
    Article Snippet: Total RNA was extracted from purified islet of Langerhans ( , , ) using the RNeasy Micro Kit (Qiagen, Valencia, CA) or from perirenal adipose tissue (positive control) as previously described ( , ). .. PCR products for ovine adrenergic receptors, α1 (A, B, D), α2 (A, B, C), and β ( , , ), were amplified from perirenal fat mRNA by reverse transcription-PCR using Superscript III reverse transcriptase and Taq DNA polymerase (Qiagen) according to the manufacturer's instructions (Chen and Limesand, unpublished data).

    Polymerase Chain Reaction:

    Article Title: Expression and Function of Sulfonylurea, Adrenergic, and Glucagon- Like Peptide 1 Receptors in Isolated Porcine Islets
    Article Snippet: .. PCR products for receptors of interest were amplified from mRNA by reverse-transcription-PCR using Superscript III reverse transcriptase and Taq DNA polymerase (Qiagen) according to the manufacturer’s instructions. .. The PCR products of the correct size were inserted into the TOPO TA cloning expression vector pCRII and transformed into One Shot Mach T1 Phage-Resistant Chemically Competent E. coli (Invitrogen Life Technologies).

    Article Title: Sa-Lrp from Sulfolobus acidocaldarius is a versatile, glutamine-responsive, and architectural transcriptional regulator
    Article Snippet: Paragraph title: cDNA synthesis and quantitative reverse transcriptase PCR ... When using Superscript III Reverse Transcriptase, this was followed by RNase H treatment (Qiagen).

    Article Title: Chronic Pulsatile Hyperglycemia Reduces Insulin Secretion and Increases Accumulation of Reactive Oxygen Species in Fetal Sheep Islets
    Article Snippet: .. PCR products for ovine genes were amplified from fetal ovine mRNA by reverse transcription-PCR using Superscript III reverse transcriptase and Taq DNA polymerase (QIAGEN) according to the manufacturer’s instructions. .. Correct PCR products were verified by confirming product size after separation in a 1% agarose DNA gel.

    Article Title: Chronic exposure to elevated norepinephrine suppresses insulin secretion in fetal sheep with placental insufficiency and intrauterine growth restriction
    Article Snippet: .. PCR products for ovine adrenergic receptors, α1 (A, B, D), α2 (A, B, C), and β ( , , ), were amplified from perirenal fat mRNA by reverse transcription-PCR using Superscript III reverse transcriptase and Taq DNA polymerase (Qiagen) according to the manufacturer's instructions (Chen and Limesand, unpublished data). .. The PCR products of the correct size were inserted into the TOPO TA cloning expression vector pCRII (Invitrogen Life Technologies) and transformed into One Shot Mach T1 Phage-Resistant Chemically Competent E. coli (Invitrogen Life Technologies).

    Article Title: Trypanosoma cruzi Targets Akt in Host Cells as an Intracellular Antiapoptotic Strategy
    Article Snippet: .. In brief, RNA was isolated with the Trizol reagent and chloroform, cDNA was synthesized from500 ng of total RNA with Superscript III reverse transcriptase primed with random hexamers, and quantitative real-time PCR (qPCR) reactions were performed with QuantiTect SYBR Green PCR kit (Qiagen) on an Applied Biosystems 7300 Real-Time PCR system. .. Conditions for the PCR reactions were as follows: 95°C for 15 min, followed by 50 cycles at 94°C for 15 s, 54°C for 30 s, and 72°C for 45 s, concluding with a dissociation stage to measure amplification product specificity.

    Article Title: Identification of HCV Resistant Variants against Direct Acting Antivirals in Plasma and Liver of Treatment Naïve Patients
    Article Snippet: .. DNA-free RNA was reverse transcribed using the Superscript III reverse transcriptase and amplified by PCR using Hotstar Hifidelity Taq DNA polymerase (Qiagen). .. PCR amplified products were analyzed using the DPS protocol; the entire procedure from sample preparation to DPS was repeated three times in the two experiments using plasmid DNA or transcribed RNA.

    Article Title: Viral metagenomics revealed novel betatorquevirus species in pediatric inpatients with encephalitis/meningoencephalitis from Ghana
    Article Snippet: Reverse transcription and cDNA synthesis were performed using 12 μl extracted RNA mixed with 100 pmol of random primer with a 20 bp fixed 5′ end sequence and at the 3′ a random nonamer (CCAGATGCCATCCAAGTGACNNNNNNNNN) and incubated at 72 °C, 2 min. First strand synthesis was done in a reaction mix consisting 1 µl SuperScript™ III reverse transcriptase, 1 µl dNTP (10 mM each; Qiagen), 5 × first-strand extension buffer and 10 mM dithiothreitol incubated at 25 °C for 10 min, followed by 50 °C incubation for 1 h and 70 °C for 15 minutes. .. The second strand reaction was carried out by incubation with 20 pmol of random primer, 2 µl 10x Klenow buffer and 5U Klenow Fragment (New England Biolabs, USA) at 37 °C for 1 h. The dsDNA obtained was PCR amplified using 5 µl sample, 20 pmol of the fixed portion of the random primer (CCAGATGCCATCCAAGTGAC), 5U HotStart Taq DNA Polymerase (Qiagen), 2.5 mM MgCl2, 0.2 mM dNTPs, and 1 X PCR buffer.

    Nested PCR:

    Article Title: Identification of HCV Resistant Variants against Direct Acting Antivirals in Plasma and Liver of Treatment Naïve Patients
    Article Snippet: Subsequently, template DNA was digested with DNase1 and absence of template plasmid in the RNA transcript was verified from serially diluted transcript using the nested PCR system as mentioned above. .. DNA-free RNA was reverse transcribed using the Superscript III reverse transcriptase and amplified by PCR using Hotstar Hifidelity Taq DNA polymerase (Qiagen).

    Rapid Amplification of cDNA Ends:

    Article Title: Transcriptome profiling of esophageal squamous cell carcinoma reveals a long noncoding RNA acting as a tumor suppressor
    Article Snippet: Paragraph title: Rapid amplification of cDNA ends (RACE), northern blot and quantitative RT-PCR (qRT-PCR) ... For the qRT-PCRs, the SuperScript III reverse transcriptase was employed to synthetize the first-strand cDNA. qPCR analysis was performed with 0.5 μL cDNA as template in a 20 μL reaction volumes using SYBR green master mixture on the Rotor-Gene® Q real-time cycler (Qiagen).

    Plasmid Preparation:

    Article Title: Expression and Function of Sulfonylurea, Adrenergic, and Glucagon- Like Peptide 1 Receptors in Isolated Porcine Islets
    Article Snippet: PCR products for receptors of interest were amplified from mRNA by reverse-transcription-PCR using Superscript III reverse transcriptase and Taq DNA polymerase (Qiagen) according to the manufacturer’s instructions. .. The PCR products of the correct size were inserted into the TOPO TA cloning expression vector pCRII and transformed into One Shot Mach T1 Phage-Resistant Chemically Competent E. coli (Invitrogen Life Technologies).

    Article Title: Chronic Pulsatile Hyperglycemia Reduces Insulin Secretion and Increases Accumulation of Reactive Oxygen Species in Fetal Sheep Islets
    Article Snippet: PCR products for ovine genes were amplified from fetal ovine mRNA by reverse transcription-PCR using Superscript III reverse transcriptase and Taq DNA polymerase (QIAGEN) according to the manufacturer’s instructions. .. PCR products were then inserted into the TOPO TA cloning expression vector pCRII (Invitrogen, Carlsbad, CA) and transformed into One Shot Mach T1 Phage-Resistant Chemically Competent E. coli (Invitrogen).

    Article Title: Chronic exposure to elevated norepinephrine suppresses insulin secretion in fetal sheep with placental insufficiency and intrauterine growth restriction
    Article Snippet: PCR products for ovine adrenergic receptors, α1 (A, B, D), α2 (A, B, C), and β ( , , ), were amplified from perirenal fat mRNA by reverse transcription-PCR using Superscript III reverse transcriptase and Taq DNA polymerase (Qiagen) according to the manufacturer's instructions (Chen and Limesand, unpublished data). .. The PCR products of the correct size were inserted into the TOPO TA cloning expression vector pCRII (Invitrogen Life Technologies) and transformed into One Shot Mach T1 Phage-Resistant Chemically Competent E. coli (Invitrogen Life Technologies).

    Article Title: Identification of HCV Resistant Variants against Direct Acting Antivirals in Plasma and Liver of Treatment Naïve Patients
    Article Snippet: Subsequently, template DNA was digested with DNase1 and absence of template plasmid in the RNA transcript was verified from serially diluted transcript using the nested PCR system as mentioned above. .. DNA-free RNA was reverse transcribed using the Superscript III reverse transcriptase and amplified by PCR using Hotstar Hifidelity Taq DNA polymerase (Qiagen).

    Software:

    Article Title: Chronic Pulsatile Hyperglycemia Reduces Insulin Secretion and Increases Accumulation of Reactive Oxygen Species in Fetal Sheep Islets
    Article Snippet: Synthetic oligonucleotide primers were designed against sequences for genes of interest (GenBank accession numbers listed in parentheses and are for ovine sequences unless otherwise noted): antioxidants SOD-1 , SOD-2 , GPx-1 , catalase ( ) and uncoupling protein 2 (UCP2; bovine sequence ); insulin ( ) and insulin transcription factors pancreatic and duodenal homeobox 1 (PDX-1; ) and V-maf musculoaponeurotic fibrosarcoma oncogene homolog A (MafA; bovine sequence ); endoplasmic reticulum stress response genes glucose regulatory protein-78 (GRP78; ), and DNA-damage inducible transcript-3 (DDIT-3; ); and the reference gene ribosomal protein S15 (S15; ) were designed with the aid of Primer-BLAST (NCBI, Bethesda, MD) software and purchased from Eurofins MWG Operon (Huntsville, AL) (primer sequences are available upon request). .. PCR products for ovine genes were amplified from fetal ovine mRNA by reverse transcription-PCR using Superscript III reverse transcriptase and Taq DNA polymerase (QIAGEN) according to the manufacturer’s instructions.

    Article Title: Chronic exposure to elevated norepinephrine suppresses insulin secretion in fetal sheep with placental insufficiency and intrauterine growth restriction
    Article Snippet: Synthetic oligonucleotide primers were designed with the aid of OligoPerfect Designer (Invitrogen Life Technologies, Carlsbad, CA) software and purchased from Eurofins MWG Operon (Huntsville, AL) (primer sequences are available upon request). .. PCR products for ovine adrenergic receptors, α1 (A, B, D), α2 (A, B, C), and β ( , , ), were amplified from perirenal fat mRNA by reverse transcription-PCR using Superscript III reverse transcriptase and Taq DNA polymerase (Qiagen) according to the manufacturer's instructions (Chen and Limesand, unpublished data).

    Real-time Polymerase Chain Reaction:

    Article Title: Expression and Function of Sulfonylurea, Adrenergic, and Glucagon- Like Peptide 1 Receptors in Isolated Porcine Islets
    Article Snippet: PCR products for receptors of interest were amplified from mRNA by reverse-transcription-PCR using Superscript III reverse transcriptase and Taq DNA polymerase (Qiagen) according to the manufacturer’s instructions. .. The relative mRNA expression for each receptor was determined by quantitative PCR using SYBR Green (Qiagen) in an iQ5 Real-Time PCR Detection System (Bio-Rad Laboratories, Irvine, CA).

    Article Title: Sa-Lrp from Sulfolobus acidocaldarius is a versatile, glutamine-responsive, and architectural transcriptional regulator
    Article Snippet: When using Superscript III Reverse Transcriptase, this was followed by RNase H treatment (Qiagen). .. To determine the efficiency of each primer pair, qPCRs were performed using a 10-fold dilution series of S. acidocaldarius genomic DNA as a template and the efficiency was then calculated from the average slope of a linear regression curve. qPCR was carried out in an iCycler IQ (Bio-Rad) or ABI 7300 (Applied Biosystems, Carlsbad, CA) using the following protocol: 95°C for 10 min and 40 cycles of 95°C for 15 sec and 50°C for 60 sec.

    Article Title: Chronic Pulsatile Hyperglycemia Reduces Insulin Secretion and Increases Accumulation of Reactive Oxygen Species in Fetal Sheep Islets
    Article Snippet: Paragraph title: PCR and quantitative real-time PCR (qPCR) ... PCR products for ovine genes were amplified from fetal ovine mRNA by reverse transcription-PCR using Superscript III reverse transcriptase and Taq DNA polymerase (QIAGEN) according to the manufacturer’s instructions.

    Article Title: Trypanosoma cruzi Targets Akt in Host Cells as an Intracellular Antiapoptotic Strategy
    Article Snippet: .. In brief, RNA was isolated with the Trizol reagent and chloroform, cDNA was synthesized from500 ng of total RNA with Superscript III reverse transcriptase primed with random hexamers, and quantitative real-time PCR (qPCR) reactions were performed with QuantiTect SYBR Green PCR kit (Qiagen) on an Applied Biosystems 7300 Real-Time PCR system. .. Conditions for the PCR reactions were as follows: 95°C for 15 min, followed by 50 cycles at 94°C for 15 s, 54°C for 30 s, and 72°C for 45 s, concluding with a dissociation stage to measure amplification product specificity.

    Article Title: Transcriptome profiling of esophageal squamous cell carcinoma reveals a long noncoding RNA acting as a tumor suppressor
    Article Snippet: .. For the qRT-PCRs, the SuperScript III reverse transcriptase was employed to synthetize the first-strand cDNA. qPCR analysis was performed with 0.5 μL cDNA as template in a 20 μL reaction volumes using SYBR green master mixture on the Rotor-Gene® Q real-time cycler (Qiagen). .. The expression levels were normalized to GAPDH and the relative expression was calculated by the delta-delta Ct method.

    Article Title: Lateralization of gene expression in the honeybee brain during olfactory learning
    Article Snippet: .. The SuperScript III reverse transcriptase was employed to synthesize the first-strand cDNA. qPCR analysis was performed with 0.5 μL cDNA as template in a 20 μL reaction volumes using SYBR green master mixture on the Rotor-Gene® Q real-time cycler (Qiagen). ..

    Sample Prep:

    Article Title: Identification of HCV Resistant Variants against Direct Acting Antivirals in Plasma and Liver of Treatment Naïve Patients
    Article Snippet: DNA-free RNA was reverse transcribed using the Superscript III reverse transcriptase and amplified by PCR using Hotstar Hifidelity Taq DNA polymerase (Qiagen). .. PCR amplified products were analyzed using the DPS protocol; the entire procedure from sample preparation to DPS was repeated three times in the two experiments using plasmid DNA or transcribed RNA.

    Electrophoresis:

    Article Title: Chronic exposure to elevated norepinephrine suppresses insulin secretion in fetal sheep with placental insufficiency and intrauterine growth restriction
    Article Snippet: The quality and concentration of the RNA were determined by measuring absorbance at 260 and 280 nm with the NanoDrop ND-1000 Spectrophotometer (NanoDrop, Wilmington, DE), and RNA integrity was evaluated with an Experion Automated Electrophoresis System (Bio-Rad Laboratories, Hercules, CA). .. PCR products for ovine adrenergic receptors, α1 (A, B, D), α2 (A, B, C), and β ( , , ), were amplified from perirenal fat mRNA by reverse transcription-PCR using Superscript III reverse transcriptase and Taq DNA polymerase (Qiagen) according to the manufacturer's instructions (Chen and Limesand, unpublished data).

    Next-Generation Sequencing:

    Article Title: Lateralization of gene expression in the honeybee brain during olfactory learning
    Article Snippet: Paragraph title: Validation of high throughput sequencing data results by qRT-PCR ... The SuperScript III reverse transcriptase was employed to synthesize the first-strand cDNA. qPCR analysis was performed with 0.5 μL cDNA as template in a 20 μL reaction volumes using SYBR green master mixture on the Rotor-Gene® Q real-time cycler (Qiagen).

    Article Title: Viral metagenomics revealed novel betatorquevirus species in pediatric inpatients with encephalitis/meningoencephalitis from Ghana
    Article Snippet: Paragraph title: Novel human anelloviruses discovery in the cerebrospinal fluids and serum by next-generation sequencing ... Reverse transcription and cDNA synthesis were performed using 12 μl extracted RNA mixed with 100 pmol of random primer with a 20 bp fixed 5′ end sequence and at the 3′ a random nonamer (CCAGATGCCATCCAAGTGACNNNNNNNNN) and incubated at 72 °C, 2 min. First strand synthesis was done in a reaction mix consisting 1 µl SuperScript™ III reverse transcriptase, 1 µl dNTP (10 mM each; Qiagen), 5 × first-strand extension buffer and 10 mM dithiothreitol incubated at 25 °C for 10 min, followed by 50 °C incubation for 1 h and 70 °C for 15 minutes.

    Spectrophotometry:

    Article Title: Expression and Function of Sulfonylurea, Adrenergic, and Glucagon- Like Peptide 1 Receptors in Isolated Porcine Islets
    Article Snippet: RNA quality and concentration was assessed using absorbance at 260 and 280 nm with a NanoDrop ND-1000 Spectrophotometer (NanoDrop, Wilmington, DE). .. PCR products for receptors of interest were amplified from mRNA by reverse-transcription-PCR using Superscript III reverse transcriptase and Taq DNA polymerase (Qiagen) according to the manufacturer’s instructions.

    Article Title: Chronic exposure to elevated norepinephrine suppresses insulin secretion in fetal sheep with placental insufficiency and intrauterine growth restriction
    Article Snippet: The quality and concentration of the RNA were determined by measuring absorbance at 260 and 280 nm with the NanoDrop ND-1000 Spectrophotometer (NanoDrop, Wilmington, DE), and RNA integrity was evaluated with an Experion Automated Electrophoresis System (Bio-Rad Laboratories, Hercules, CA). .. PCR products for ovine adrenergic receptors, α1 (A, B, D), α2 (A, B, C), and β ( , , ), were amplified from perirenal fat mRNA by reverse transcription-PCR using Superscript III reverse transcriptase and Taq DNA polymerase (Qiagen) according to the manufacturer's instructions (Chen and Limesand, unpublished data).

    Concentration Assay:

    Article Title: Expression and Function of Sulfonylurea, Adrenergic, and Glucagon- Like Peptide 1 Receptors in Isolated Porcine Islets
    Article Snippet: RNA quality and concentration was assessed using absorbance at 260 and 280 nm with a NanoDrop ND-1000 Spectrophotometer (NanoDrop, Wilmington, DE). .. PCR products for receptors of interest were amplified from mRNA by reverse-transcription-PCR using Superscript III reverse transcriptase and Taq DNA polymerase (Qiagen) according to the manufacturer’s instructions.

    Article Title: Chronic exposure to elevated norepinephrine suppresses insulin secretion in fetal sheep with placental insufficiency and intrauterine growth restriction
    Article Snippet: The quality and concentration of the RNA were determined by measuring absorbance at 260 and 280 nm with the NanoDrop ND-1000 Spectrophotometer (NanoDrop, Wilmington, DE), and RNA integrity was evaluated with an Experion Automated Electrophoresis System (Bio-Rad Laboratories, Hercules, CA). .. PCR products for ovine adrenergic receptors, α1 (A, B, D), α2 (A, B, C), and β ( , , ), were amplified from perirenal fat mRNA by reverse transcription-PCR using Superscript III reverse transcriptase and Taq DNA polymerase (Qiagen) according to the manufacturer's instructions (Chen and Limesand, unpublished data).

    Article Title: Viral metagenomics revealed novel betatorquevirus species in pediatric inpatients with encephalitis/meningoencephalitis from Ghana
    Article Snippet: Reverse transcription and cDNA synthesis were performed using 12 μl extracted RNA mixed with 100 pmol of random primer with a 20 bp fixed 5′ end sequence and at the 3′ a random nonamer (CCAGATGCCATCCAAGTGACNNNNNNNNN) and incubated at 72 °C, 2 min. First strand synthesis was done in a reaction mix consisting 1 µl SuperScript™ III reverse transcriptase, 1 µl dNTP (10 mM each; Qiagen), 5 × first-strand extension buffer and 10 mM dithiothreitol incubated at 25 °C for 10 min, followed by 50 °C incubation for 1 h and 70 °C for 15 minutes. .. Library concentration was then measured using Qubit and Bioanalyzer instruments.

    T-Test:

    Article Title: Transcriptome profiling of esophageal squamous cell carcinoma reveals a long noncoding RNA acting as a tumor suppressor
    Article Snippet: For the qRT-PCRs, the SuperScript III reverse transcriptase was employed to synthetize the first-strand cDNA. qPCR analysis was performed with 0.5 μL cDNA as template in a 20 μL reaction volumes using SYBR green master mixture on the Rotor-Gene® Q real-time cycler (Qiagen). .. All analyses shown were carried out on at least three biological replicates for each sample; P-values were calculated by Student's t-test from the biological replicates.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96
    Qiagen superscript iii reverse transcriptase kit
    Expression of different TLRs in mouse splenic lymphocytes and NK cells after S. japonicum infection. (a) Splenic lymphocytes were separated from normal and S. japonicum -infected wild-type mice, and CD3 − NK1.1 + NK cells were isolated from splenic lymphocytes by using flow cytometry and the purity of isolated splenic NK cells was identified by FACS. (b) Total <t>RNA</t> of splenic lymphocytes and NK cells was harvested, respectively. The accumulation of TLR2, TLR3, TLR4, and TLR7 mRNA was quantified by using qPCR. The levels of TLR transcripts were normalized to β -actin transcripts by using the relative quantity (RQ) = 2 −△△Ct method. Data represent means ± SEM of at least <t>three</t> experiments. (c, d) Expression of TLR2, TLR3, TLR4, and TLR7 on splenic NK cells was assessed by using flow cytometry. (c) A representative result is shown. (d) Statistic results of 6 to 8 independent results are shown. N: normal; INF: infected; ∗ P
    Superscript Iii Reverse Transcriptase Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 96/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript iii reverse transcriptase kit/product/Qiagen
    Average 96 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    superscript iii reverse transcriptase kit - by Bioz Stars, 2020-04
    96/100 stars
      Buy from Supplier

    94
    Qiagen superscript iii reverse transcriptase
    Jmjd 3 ablation affects global histone methylation in lung tissues and methylation status of the promoter regions of target genes. ( A ) Global gene methylation analysis of Jmjd3 +/+ and Jmjd3 −/− lung tissues at E17.5 by ChIP-Seq. ↑, methylation increased; ↓, methylation decreased. ( B ) ChIP-Seq analysis of H3K27me3 and H3K4me3 levels in the promoter and gene body regions of the SP-B gene in Jmjd3 +/+ and Jmjd3 −/− lung tissues at E17.5. Data shown are representative of <t>three</t> independent experiments. ( C ) Jmjd3 binding to the SP-B promoter in lung tissues was determined by ChIP-PCR. Chromatin was immunoprecipitated from the lung tissues of E17.5 Jmjd3 +/+ and Jmjd3 −/− embryos. Primer design for the ChIP-PCR assay of mouse SP-B promoter regions ( top panel ). The primers sets cover the following regions: A, −2347–−2142; B, −2065–−1835; C, −1451–−1334; D, −1001–−878; E, −516–−383; F, −218–+14. ChIP-PCR assay showing Jmjd3 binding around 2 kb upstream of the TSS of the SP-B promoter region ( bottom panel ). ( D ) <t>ChIP-qPCR</t> analysis of histone methylation levels in the SP-B promoter region in the lung tissues of E17.5 Jmjd3 +/+ and Jmjd3 −/− embryos. ( E ) Locus-specific demethylation analysis of Jmjd3 by ChIP-Seq. ChIP-Seq was done to determine the H3K27 and H3K4 methylation level of genes located in the region (∼280 kb) containing SP-B on chromosome 6 and the region (∼160 kb) containing AQP-5 on chromosome 15. Arrows indicate the gene expression direction.
    Superscript Iii Reverse Transcriptase, supplied by Qiagen, used in various techniques. Bioz Stars score: 94/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript iii reverse transcriptase/product/Qiagen
    Average 94 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    superscript iii reverse transcriptase - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    Image Search Results


    Expression of different TLRs in mouse splenic lymphocytes and NK cells after S. japonicum infection. (a) Splenic lymphocytes were separated from normal and S. japonicum -infected wild-type mice, and CD3 − NK1.1 + NK cells were isolated from splenic lymphocytes by using flow cytometry and the purity of isolated splenic NK cells was identified by FACS. (b) Total RNA of splenic lymphocytes and NK cells was harvested, respectively. The accumulation of TLR2, TLR3, TLR4, and TLR7 mRNA was quantified by using qPCR. The levels of TLR transcripts were normalized to β -actin transcripts by using the relative quantity (RQ) = 2 −△△Ct method. Data represent means ± SEM of at least three experiments. (c, d) Expression of TLR2, TLR3, TLR4, and TLR7 on splenic NK cells was assessed by using flow cytometry. (c) A representative result is shown. (d) Statistic results of 6 to 8 independent results are shown. N: normal; INF: infected; ∗ P

    Journal: Journal of Immunology Research

    Article Title: TLR3 Modulates the Response of NK Cells against Schistosoma japonicum

    doi: 10.1155/2018/7519856

    Figure Lengend Snippet: Expression of different TLRs in mouse splenic lymphocytes and NK cells after S. japonicum infection. (a) Splenic lymphocytes were separated from normal and S. japonicum -infected wild-type mice, and CD3 − NK1.1 + NK cells were isolated from splenic lymphocytes by using flow cytometry and the purity of isolated splenic NK cells was identified by FACS. (b) Total RNA of splenic lymphocytes and NK cells was harvested, respectively. The accumulation of TLR2, TLR3, TLR4, and TLR7 mRNA was quantified by using qPCR. The levels of TLR transcripts were normalized to β -actin transcripts by using the relative quantity (RQ) = 2 −△△Ct method. Data represent means ± SEM of at least three experiments. (c, d) Expression of TLR2, TLR3, TLR4, and TLR7 on splenic NK cells was assessed by using flow cytometry. (c) A representative result is shown. (d) Statistic results of 6 to 8 independent results are shown. N: normal; INF: infected; ∗ P

    Article Snippet: 1 μ g of total RNA was transcribed to cDNA by using a SuperScript III Reverse Transcriptase Kit (Qiagen, Valencia, CA).

    Techniques: Expressing, Infection, Mouse Assay, Isolation, Flow Cytometry, Cytometry, FACS, Real-time Polymerase Chain Reaction

    Expression of different TLRs in mouse splenic lymphocytes and NK cells after S. japonicum infection. (a) Splenic lymphocytes were separated from normal and S. japonicum -infected wild-type mice, and CD3 − NK1.1 + NK cells were isolated from splenic lymphocytes by using flow cytometry and the purity of isolated splenic NK cells was identified by FACS. (b) Total RNA of splenic lymphocytes and NK cells was harvested, respectively. The accumulation of TLR2, TLR3, TLR4, and TLR7 mRNA was quantified by using qPCR. The levels of TLR transcripts were normalized to β -actin transcripts by using the relative quantity (RQ) = 2 −△△Ct method. Data represent means ± SEM of at least three experiments. (c, d) Expression of TLR2, TLR3, TLR4, and TLR7 on splenic NK cells was assessed by using flow cytometry. (c) A representative result is shown. (d) Statistic results of 6 to 8 independent results are shown. N: normal; INF: infected; ∗ P

    Journal: Journal of Immunology Research

    Article Title: TLR3 Modulates the Response of NK Cells against Schistosoma japonicum

    doi: 10.1155/2018/7519856

    Figure Lengend Snippet: Expression of different TLRs in mouse splenic lymphocytes and NK cells after S. japonicum infection. (a) Splenic lymphocytes were separated from normal and S. japonicum -infected wild-type mice, and CD3 − NK1.1 + NK cells were isolated from splenic lymphocytes by using flow cytometry and the purity of isolated splenic NK cells was identified by FACS. (b) Total RNA of splenic lymphocytes and NK cells was harvested, respectively. The accumulation of TLR2, TLR3, TLR4, and TLR7 mRNA was quantified by using qPCR. The levels of TLR transcripts were normalized to β -actin transcripts by using the relative quantity (RQ) = 2 −△△Ct method. Data represent means ± SEM of at least three experiments. (c, d) Expression of TLR2, TLR3, TLR4, and TLR7 on splenic NK cells was assessed by using flow cytometry. (c) A representative result is shown. (d) Statistic results of 6 to 8 independent results are shown. N: normal; INF: infected; ∗ P

    Article Snippet: 1 μ g of total RNA was transcribed to cDNA by using a SuperScript III Reverse Transcriptase Kit (Qiagen, Valencia, CA).

    Techniques: Expressing, Infection, Mouse Assay, Isolation, Flow Cytometry, Cytometry, FACS, Real-time Polymerase Chain Reaction

    Jmjd 3 ablation affects global histone methylation in lung tissues and methylation status of the promoter regions of target genes. ( A ) Global gene methylation analysis of Jmjd3 +/+ and Jmjd3 −/− lung tissues at E17.5 by ChIP-Seq. ↑, methylation increased; ↓, methylation decreased. ( B ) ChIP-Seq analysis of H3K27me3 and H3K4me3 levels in the promoter and gene body regions of the SP-B gene in Jmjd3 +/+ and Jmjd3 −/− lung tissues at E17.5. Data shown are representative of three independent experiments. ( C ) Jmjd3 binding to the SP-B promoter in lung tissues was determined by ChIP-PCR. Chromatin was immunoprecipitated from the lung tissues of E17.5 Jmjd3 +/+ and Jmjd3 −/− embryos. Primer design for the ChIP-PCR assay of mouse SP-B promoter regions ( top panel ). The primers sets cover the following regions: A, −2347–−2142; B, −2065–−1835; C, −1451–−1334; D, −1001–−878; E, −516–−383; F, −218–+14. ChIP-PCR assay showing Jmjd3 binding around 2 kb upstream of the TSS of the SP-B promoter region ( bottom panel ). ( D ) ChIP-qPCR analysis of histone methylation levels in the SP-B promoter region in the lung tissues of E17.5 Jmjd3 +/+ and Jmjd3 −/− embryos. ( E ) Locus-specific demethylation analysis of Jmjd3 by ChIP-Seq. ChIP-Seq was done to determine the H3K27 and H3K4 methylation level of genes located in the region (∼280 kb) containing SP-B on chromosome 6 and the region (∼160 kb) containing AQP-5 on chromosome 15. Arrows indicate the gene expression direction.

    Journal: PLoS Genetics

    Article Title: Stage-Dependent and Locus-Specific Role of Histone Demethylase Jumonji D3 (JMJD3) in the Embryonic Stages of Lung Development

    doi: 10.1371/journal.pgen.1004524

    Figure Lengend Snippet: Jmjd 3 ablation affects global histone methylation in lung tissues and methylation status of the promoter regions of target genes. ( A ) Global gene methylation analysis of Jmjd3 +/+ and Jmjd3 −/− lung tissues at E17.5 by ChIP-Seq. ↑, methylation increased; ↓, methylation decreased. ( B ) ChIP-Seq analysis of H3K27me3 and H3K4me3 levels in the promoter and gene body regions of the SP-B gene in Jmjd3 +/+ and Jmjd3 −/− lung tissues at E17.5. Data shown are representative of three independent experiments. ( C ) Jmjd3 binding to the SP-B promoter in lung tissues was determined by ChIP-PCR. Chromatin was immunoprecipitated from the lung tissues of E17.5 Jmjd3 +/+ and Jmjd3 −/− embryos. Primer design for the ChIP-PCR assay of mouse SP-B promoter regions ( top panel ). The primers sets cover the following regions: A, −2347–−2142; B, −2065–−1835; C, −1451–−1334; D, −1001–−878; E, −516–−383; F, −218–+14. ChIP-PCR assay showing Jmjd3 binding around 2 kb upstream of the TSS of the SP-B promoter region ( bottom panel ). ( D ) ChIP-qPCR analysis of histone methylation levels in the SP-B promoter region in the lung tissues of E17.5 Jmjd3 +/+ and Jmjd3 −/− embryos. ( E ) Locus-specific demethylation analysis of Jmjd3 by ChIP-Seq. ChIP-Seq was done to determine the H3K27 and H3K4 methylation level of genes located in the region (∼280 kb) containing SP-B on chromosome 6 and the region (∼160 kb) containing AQP-5 on chromosome 15. Arrows indicate the gene expression direction.

    Article Snippet: A total of 1 µg of RNA was converted to cDNA using Superscript III Reverse Transcriptase (Qiagen) with random hexamer primers. qPCR was carried out using SYBR Green mix on the ABI 7000 PCR machine.

    Techniques: Methylation, Chromatin Immunoprecipitation, Binding Assay, Polymerase Chain Reaction, Immunoprecipitation, Real-time Polymerase Chain Reaction, Expressing