superscript iii reverse transcriptase  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    New England Biolabs superscript iii reverse transcriptase
    Superscript Iii Reverse Transcriptase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 94/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript iii reverse transcriptase/product/New England Biolabs
    Average 94 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    superscript iii reverse transcriptase - by Bioz Stars, 2020-04
    94/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Viral Characteristics Associated with Maintenance of Elite Neutralizing Activity in Chronically HIV-1 Clade C-Infected Monozygotic Pediatric Twins
    Article Snippet: Paragraph title: Cloning of autologous HIV-1 envelope genes and production of replication-incompetent pseudoviruses. ... Briefly, viral RNA was isolated from 140 μl of plasma using a QIAamp viral RNA minikit and reverse transcribed, using gene-specific primer OFM19 (5′-GCACTCAAGGCAAGCTTTATTGAGGCTTA-3′) and SuperScript III reverse transcriptase, into cDNA, which was used in a two-round nested PCR for amplification of the envelope gene using high-fidelity Phusion DNA polymerase (New England Biolabs).

    Article Title: Random Splicing of Several Exons Caused by a Single Base Change in the Target Exon of CRISPR/Cas9 Mediated Gene Knockout
    Article Snippet: Paragraph title: 2.3. Analysis of Single-Cell Clones ... RNA was reverse transcribed with Superscript® III reverse transcriptase using oligo(dT)18 primers (New England Biolabs, Frankfurt, Germany).

    Article Title: High resolution sequencing of hepatitis C virus reveals limited intra-hepatic compartmentalization in end-stage liver disease
    Article Snippet: Amplification of HCV structural genes for single genome amplification HCV cDNAs for SGA were generated using primers specific for either genotype 1a (2616a-1a: GGG ATG CTG CAT TGA GTA, where the name reflects the location (H77 numbering), orientation (sense/antisense) and genotype specificity of the primer) or genotype 3a (3471a-3a: CAA TAG TTC CAA GAA GGC CCC TAG TTT GCT G). cDNA was generated from 5 μg RNA using 0.4 μM antisense primers together with Superscript III reverse transcriptase; cDNA synthesis was performed for 30 min at 55 °C, followed by denaturation at 94 °C for 2 min. Two-step “nested” PCR amplifications were set-up on ice using a Phusion™ High-Fidelity DNA polymerase system (New England Biolabs, GC buffer) in accordance with the manufacturer’s instructions, with the addition of 4% dimethyl sulfoxide (DMSO) to improve yield. .. The nested PCR reactions were repeated using a single genome amplification (SGA) end-stage limit dilution procedure to recover single molecules of HCV, cloned (pcDNA™.1D/V5-His-TOPO, Life Technologies) and sequenced, as previously described .

    Centrifugation:

    Article Title: GRID-seq reveals the global RNA-chromatin interactome
    Article Snippet: Nuclei were collected by brief centrifugation, washed twice with 1× Tango Buffer, re-suspended in 500 μl of AluI solution (1× Tango Buffer, 1 U/μl RiboLock, 1× Protease inhibitor, 1% Triton X-100, 0.5 U/μl AluI) (Thermo Fisher), and incubated at 37°C for 2 hrs with agitation. .. For primer extension, 10 μl of H2 O, 36 μl of 1 M KCl, 32 μl of 10 mM dNTP mix, 28 μl of 5× RT First Strand Buffer (Thermo Fisher), 28 μl of 100 mM DTT and 5 μl of SuperScript III Reverse Transcriptase were added directly into the suspension, and the reaction was incubated at 50°C for 45 min. For in situ linker ligation to AluI-cut genomic DNA, nuclei were collected, washed twice with 200 μl of 1× DNA Ligase Buffer (NEB) to remove free linker, re-suspended in 1.2 ml of DNA Ligation Solution (0.2 U/μl RiboLock, 1× DNA Ligase Buffer, 1 mg/ml BSA, 1% Triton X-100, 1 U/μl T4 DNA Ligase (Thermo Fisher)) and incubated overnight at 16°C with rotation.

    Article Title: GRID-seq reveals the global RNA-chromatin interactome
    Article Snippet: Nuclei were collected by brief centrifugation, washed twice with 1× Tango Buffer, re-suspended in 500 μl of AluI solution (1× Tango Buffer, 1 U/μl RiboLock, 1× Protease inhibitor, 1% Triton X-100, 0.5 U/μl AluI) (Thermo Fisher), and incubated at 37°C for 2 hrs with agitation. .. For primer extension, 10 μl of H2 O, 36 μl of 1 M KCl, 32 μl of 10 mM dNTP mix, 28 μl of 5× RT First Strand Buffer (Thermo Fisher), 28 μl of 100 mM DTT and 5 μl of SuperScript III Reverse Transcriptase were added directly into the suspension, and the reaction was incubated at 50°C for 45 min. For in situ linker ligation to AluI-cut genomic DNA, nuclei were collected, washed twice with 200 μl of 1× DNA Ligase Buffer (NEB) to remove free linker, re-suspended in 1.2 ml of DNA Ligation Solution (0.2 U/μl RiboLock, 1× DNA Ligase Buffer, 1 mg/ml BSA, 1% Triton X-100, 1 U/μl T4 DNA Ligase (Thermo Fisher)) and incubated overnight at 16°C with rotation.

    Amplification:

    Article Title: LOXL4 knockdown enhances tumor growth and lung metastasis through collagen-dependent extracellular matrix changes in triple-negative breast cancer
    Article Snippet: RNA isolation and quantitative real-time PCR Total RNA was isolated using TRIzol Reagent (Invitrogen, Carlsbad, CA, USA) and was reverse-transcribed using random hexamers and Superscript III reverse transcriptase. cDNAs were synthesized using M-MLV reverse transcriptase (New England Biolabs, Ipswich, MA, USA) and random primers. mRNA levels were measured in control and shLOXL4 cells using the quantitative real-time method and the following primer sets: LOX (174 bp) F, GTTCCAAGCTGGCTACTC, and R, GGGTTGTCGTCAGAGTAC; LOXL1 (244 bp) F, CAGACCCCAACTATGTGCAA, and R, ATGCTGTGGTAATGCTGGTG; LOXL2 (239 bp) F, GGAAAGCGTACAAGCCAGAG, and R, GCACTGG ATCTCGTTGAGGT; LOXL3 (162 bp) F, ATGGGTGCT ATCCACCTGAG, and R, GAGTCGGATCCTGGTC TCTG; LOXL4 (165 bp) F, ACCGAAGACAAAGCC ACAAC, and R, CACACGACACTGGCAGAGAT; and β-actin (335 bp) F, TTCCTGGGCATGGAGTCCTGTGG, and R, CGCCTAGAAGCATTTGCGGTGG. .. Expression ratios were calculated as the normalized threshold cycle (Ct) difference between the control and samples after adjustment for amplification efficiency relative to expression of the housekeeping gene β-actin.

    Article Title: Viral Characteristics Associated with Maintenance of Elite Neutralizing Activity in Chronically HIV-1 Clade C-Infected Monozygotic Pediatric Twins
    Article Snippet: .. Briefly, viral RNA was isolated from 140 μl of plasma using a QIAamp viral RNA minikit and reverse transcribed, using gene-specific primer OFM19 (5′-GCACTCAAGGCAAGCTTTATTGAGGCTTA-3′) and SuperScript III reverse transcriptase, into cDNA, which was used in a two-round nested PCR for amplification of the envelope gene using high-fidelity Phusion DNA polymerase (New England Biolabs). .. The envelope amplicons were purified and ligated into the pcDNA3.1D/V5-His-TOPO vector (Invitrogen).

    Article Title: Random Splicing of Several Exons Caused by a Single Base Change in the Target Exon of CRISPR/Cas9 Mediated Gene Knockout
    Article Snippet: RNA was reverse transcribed with Superscript® III reverse transcriptase using oligo(dT)18 primers (New England Biolabs, Frankfurt, Germany). .. AGA cDNA was PCR amplified and cloned into pcDNA3 (Invitrogen, Waltham, MA, USA) with BamHI and XhoI.

    Article Title: High resolution sequencing of hepatitis C virus reveals limited intra-hepatic compartmentalization in end-stage liver disease
    Article Snippet: .. Amplification of HCV structural genes for single genome amplification HCV cDNAs for SGA were generated using primers specific for either genotype 1a (2616a-1a: GGG ATG CTG CAT TGA GTA, where the name reflects the location (H77 numbering), orientation (sense/antisense) and genotype specificity of the primer) or genotype 3a (3471a-3a: CAA TAG TTC CAA GAA GGC CCC TAG TTT GCT G). cDNA was generated from 5 μg RNA using 0.4 μM antisense primers together with Superscript III reverse transcriptase; cDNA synthesis was performed for 30 min at 55 °C, followed by denaturation at 94 °C for 2 min. Two-step “nested” PCR amplifications were set-up on ice using a Phusion™ High-Fidelity DNA polymerase system (New England Biolabs, GC buffer) in accordance with the manufacturer’s instructions, with the addition of 4% dimethyl sulfoxide (DMSO) to improve yield. .. The first round primers were: genotype 1 (70s: AGA AAG CGT CTA GCC ATG GCG TTA G and 2616a-1a) or: genotype 3 (70s and 3471a-3a), the PCR amplification conditions were: 30× (94 °C, 15 s; 60 °C, 15 s; 72 °C, 150 s).

    High Throughput Screening Assay:

    Article Title: Denaturing CLIP (dCLIP) pipeline identifies discrete RNA footprints on chromatin-associated proteins and reveals that CBX7 targets 3’UTRs to regulate mRNA expression
    Article Snippet: Strand-specific cDNA libraries were constructed using Superscript III reverse-transcriptase for first-strand synthesis, NEBNext mRNA Second Strand Synthesis Module supplemented with dUTP (NEB) for second-strand synthesis, and NEBNext ChIP-Seq Library Prep Master Mix Set for library preparation. .. Libraries were subjected to high-throughput sequencing using Illumina HiSeq 2000 apparatus according to manufacturer instructions.

    DNA Ligation:

    Article Title: GRID-seq reveals the global RNA-chromatin interactome
    Article Snippet: .. For primer extension, 10 μl of H2 O, 36 μl of 1 M KCl, 32 μl of 10 mM dNTP mix, 28 μl of 5× RT First Strand Buffer (Thermo Fisher), 28 μl of 100 mM DTT and 5 μl of SuperScript III Reverse Transcriptase were added directly into the suspension, and the reaction was incubated at 50°C for 45 min. For in situ linker ligation to AluI-cut genomic DNA, nuclei were collected, washed twice with 200 μl of 1× DNA Ligase Buffer (NEB) to remove free linker, re-suspended in 1.2 ml of DNA Ligation Solution (0.2 U/μl RiboLock, 1× DNA Ligase Buffer, 1 mg/ml BSA, 1% Triton X-100, 1 U/μl T4 DNA Ligase (Thermo Fisher)) and incubated overnight at 16°C with rotation. .. Nuclei were collected, washed with PBS, re-suspended in 266 μl of Proteinase K solution (50 mM Tris-Cl pH 7.5, 100 mM NaCl, 1 mM EDTA, 1% SDS, 1 mg/ml Proteinase K (Thermo Fisher)) and incubated at 65°C for 30 min. After adding 20 μl of 5 M NaCl, protease-treated nuclei were incubated for another 1.5 hr.

    Article Title: GRID-seq reveals the global RNA-chromatin interactome
    Article Snippet: .. For primer extension, 10 μl of H2 O, 36 μl of 1 M KCl, 32 μl of 10 mM dNTP mix, 28 μl of 5× RT First Strand Buffer (Thermo Fisher), 28 μl of 100 mM DTT and 5 μl of SuperScript III Reverse Transcriptase were added directly into the suspension, and the reaction was incubated at 50°C for 45 min. For in situ linker ligation to AluI-cut genomic DNA, nuclei were collected, washed twice with 200 μl of 1× DNA Ligase Buffer (NEB) to remove free linker, re-suspended in 1.2 ml of DNA Ligation Solution (0.2 U/μl RiboLock, 1× DNA Ligase Buffer, 1 mg/ml BSA, 1% Triton X-100, 1 U/μl T4 DNA Ligase (Thermo Fisher)) and incubated overnight at 16°C with rotation. .. Nuclei were collected, washed with PBS, re-suspended in 266 μl of Proteinase K solution (50 mM Tris-Cl pH 7.5, 100 mM NaCl, 1 mM EDTA, 1% SDS, 1 mg/ml Proteinase K (Thermo Fisher)) and incubated at 65°C for 30 min. After adding 20 μl of 5 M NaCl, protease-treated nuclei were incubated for another 1.5 hr.

    Synthesized:

    Article Title: LOXL4 knockdown enhances tumor growth and lung metastasis through collagen-dependent extracellular matrix changes in triple-negative breast cancer
    Article Snippet: .. RNA isolation and quantitative real-time PCR Total RNA was isolated using TRIzol Reagent (Invitrogen, Carlsbad, CA, USA) and was reverse-transcribed using random hexamers and Superscript III reverse transcriptase. cDNAs were synthesized using M-MLV reverse transcriptase (New England Biolabs, Ipswich, MA, USA) and random primers. mRNA levels were measured in control and shLOXL4 cells using the quantitative real-time method and the following primer sets: LOX (174 bp) F, GTTCCAAGCTGGCTACTC, and R, GGGTTGTCGTCAGAGTAC; LOXL1 (244 bp) F, CAGACCCCAACTATGTGCAA, and R, ATGCTGTGGTAATGCTGGTG; LOXL2 (239 bp) F, GGAAAGCGTACAAGCCAGAG, and R, GCACTGG ATCTCGTTGAGGT; LOXL3 (162 bp) F, ATGGGTGCT ATCCACCTGAG, and R, GAGTCGGATCCTGGTC TCTG; LOXL4 (165 bp) F, ACCGAAGACAAAGCC ACAAC, and R, CACACGACACTGGCAGAGAT; and β-actin (335 bp) F, TTCCTGGGCATGGAGTCCTGTGG, and R, CGCCTAGAAGCATTTGCGGTGG. .. Relative gene expression was determined using an ABI 7500 real-time polymerase chain reaction (PCR) instrument (Applied Biosystems, South San Francisco, CA, USA) with pre-optimized conditions.

    Article Title: IL-6-mediated cross-talk between human preadipocytes and ductal carcinoma in situ in breast cancer progression
    Article Snippet: .. Total RNA was isolated using TRIzol reagent (Invitrogen, Carlsbad, CA) and was reverse-transcribed using random hexamers and Superscript III reverse transcriptase. cDNAs were synthesized using M-MLV reverse transcriptase (New England Biolabs, Ipswich, MA) and specific primers. .. IL-6 and Interleukin 6 receptor (IL-6R) mRNA expression levels were measured in single culture and co-culture using the following primer sets (Additional file : Table S1).

    Article Title: IL-6-mediated cross-talk between human preadipocytes and ductal carcinoma in situ in breast cancer progression
    Article Snippet: .. RT-PCR and real-time RT-PCR Total RNA was isolated using TRIzol reagent (Invitrogen, Carlsbad, CA) and was reverse-transcribed using random hexamers and Superscript III reverse transcriptase. cDNAs were synthesized using M-MLV reverse transcriptase (New England Biolabs, Ipswich, MA) and specific primers. .. IL-6 and Interleukin 6 receptor (IL-6R) mRNA expression levels were measured in single culture and co-culture using the following primer sets (Additional file : Table S1).

    Quantitative RT-PCR:

    Article Title: IL-6-mediated cross-talk between human preadipocytes and ductal carcinoma in situ in breast cancer progression
    Article Snippet: Paragraph title: RT-PCR and real-time RT-PCR ... Total RNA was isolated using TRIzol reagent (Invitrogen, Carlsbad, CA) and was reverse-transcribed using random hexamers and Superscript III reverse transcriptase. cDNAs were synthesized using M-MLV reverse transcriptase (New England Biolabs, Ipswich, MA) and specific primers.

    Article Title: IL-6-mediated cross-talk between human preadipocytes and ductal carcinoma in situ in breast cancer progression
    Article Snippet: .. RT-PCR and real-time RT-PCR Total RNA was isolated using TRIzol reagent (Invitrogen, Carlsbad, CA) and was reverse-transcribed using random hexamers and Superscript III reverse transcriptase. cDNAs were synthesized using M-MLV reverse transcriptase (New England Biolabs, Ipswich, MA) and specific primers. .. IL-6 and Interleukin 6 receptor (IL-6R) mRNA expression levels were measured in single culture and co-culture using the following primer sets (Additional file : Table S1).

    SYBR Green Assay:

    Article Title: IL-6-mediated cross-talk between human preadipocytes and ductal carcinoma in situ in breast cancer progression
    Article Snippet: Total RNA was isolated using TRIzol reagent (Invitrogen, Carlsbad, CA) and was reverse-transcribed using random hexamers and Superscript III reverse transcriptase. cDNAs were synthesized using M-MLV reverse transcriptase (New England Biolabs, Ipswich, MA) and specific primers. .. Real-time RT-PCR reactions were run on an ABI PRISM 7900 utilizing a SYBR Green PCR master mix (Applied Biosystems, Foster City, CA).

    Article Title: IL-6-mediated cross-talk between human preadipocytes and ductal carcinoma in situ in breast cancer progression
    Article Snippet: RT-PCR and real-time RT-PCR Total RNA was isolated using TRIzol reagent (Invitrogen, Carlsbad, CA) and was reverse-transcribed using random hexamers and Superscript III reverse transcriptase. cDNAs were synthesized using M-MLV reverse transcriptase (New England Biolabs, Ipswich, MA) and specific primers. .. Real-time RT-PCR reactions were run on an ABI PRISM 7900 utilizing a SYBR Green PCR master mix (Applied Biosystems, Foster City, CA).

    Incubation:

    Article Title: GRID-seq reveals the global RNA-chromatin interactome
    Article Snippet: .. For primer extension, 10 μl of H2 O, 36 μl of 1 M KCl, 32 μl of 10 mM dNTP mix, 28 μl of 5× RT First Strand Buffer (Thermo Fisher), 28 μl of 100 mM DTT and 5 μl of SuperScript III Reverse Transcriptase were added directly into the suspension, and the reaction was incubated at 50°C for 45 min. For in situ linker ligation to AluI-cut genomic DNA, nuclei were collected, washed twice with 200 μl of 1× DNA Ligase Buffer (NEB) to remove free linker, re-suspended in 1.2 ml of DNA Ligation Solution (0.2 U/μl RiboLock, 1× DNA Ligase Buffer, 1 mg/ml BSA, 1% Triton X-100, 1 U/μl T4 DNA Ligase (Thermo Fisher)) and incubated overnight at 16°C with rotation. .. Nuclei were collected, washed with PBS, re-suspended in 266 μl of Proteinase K solution (50 mM Tris-Cl pH 7.5, 100 mM NaCl, 1 mM EDTA, 1% SDS, 1 mg/ml Proteinase K (Thermo Fisher)) and incubated at 65°C for 30 min. After adding 20 μl of 5 M NaCl, protease-treated nuclei were incubated for another 1.5 hr.

    Article Title: GRID-seq reveals the global RNA-chromatin interactome
    Article Snippet: .. For primer extension, 10 μl of H2 O, 36 μl of 1 M KCl, 32 μl of 10 mM dNTP mix, 28 μl of 5× RT First Strand Buffer (Thermo Fisher), 28 μl of 100 mM DTT and 5 μl of SuperScript III Reverse Transcriptase were added directly into the suspension, and the reaction was incubated at 50°C for 45 min. For in situ linker ligation to AluI-cut genomic DNA, nuclei were collected, washed twice with 200 μl of 1× DNA Ligase Buffer (NEB) to remove free linker, re-suspended in 1.2 ml of DNA Ligation Solution (0.2 U/μl RiboLock, 1× DNA Ligase Buffer, 1 mg/ml BSA, 1% Triton X-100, 1 U/μl T4 DNA Ligase (Thermo Fisher)) and incubated overnight at 16°C with rotation. .. Nuclei were collected, washed with PBS, re-suspended in 266 μl of Proteinase K solution (50 mM Tris-Cl pH 7.5, 100 mM NaCl, 1 mM EDTA, 1% SDS, 1 mg/ml Proteinase K (Thermo Fisher)) and incubated at 65°C for 30 min. After adding 20 μl of 5 M NaCl, protease-treated nuclei were incubated for another 1.5 hr.

    Expressing:

    Article Title: LOXL4 knockdown enhances tumor growth and lung metastasis through collagen-dependent extracellular matrix changes in triple-negative breast cancer
    Article Snippet: RNA isolation and quantitative real-time PCR Total RNA was isolated using TRIzol Reagent (Invitrogen, Carlsbad, CA, USA) and was reverse-transcribed using random hexamers and Superscript III reverse transcriptase. cDNAs were synthesized using M-MLV reverse transcriptase (New England Biolabs, Ipswich, MA, USA) and random primers. mRNA levels were measured in control and shLOXL4 cells using the quantitative real-time method and the following primer sets: LOX (174 bp) F, GTTCCAAGCTGGCTACTC, and R, GGGTTGTCGTCAGAGTAC; LOXL1 (244 bp) F, CAGACCCCAACTATGTGCAA, and R, ATGCTGTGGTAATGCTGGTG; LOXL2 (239 bp) F, GGAAAGCGTACAAGCCAGAG, and R, GCACTGG ATCTCGTTGAGGT; LOXL3 (162 bp) F, ATGGGTGCT ATCCACCTGAG, and R, GAGTCGGATCCTGGTC TCTG; LOXL4 (165 bp) F, ACCGAAGACAAAGCC ACAAC, and R, CACACGACACTGGCAGAGAT; and β-actin (335 bp) F, TTCCTGGGCATGGAGTCCTGTGG, and R, CGCCTAGAAGCATTTGCGGTGG. .. Relative gene expression was determined using an ABI 7500 real-time polymerase chain reaction (PCR) instrument (Applied Biosystems, South San Francisco, CA, USA) with pre-optimized conditions.

    Article Title: IL-6-mediated cross-talk between human preadipocytes and ductal carcinoma in situ in breast cancer progression
    Article Snippet: Total RNA was isolated using TRIzol reagent (Invitrogen, Carlsbad, CA) and was reverse-transcribed using random hexamers and Superscript III reverse transcriptase. cDNAs were synthesized using M-MLV reverse transcriptase (New England Biolabs, Ipswich, MA) and specific primers. .. IL-6 and Interleukin 6 receptor (IL-6R) mRNA expression levels were measured in single culture and co-culture using the following primer sets (Additional file : Table S1).

    Article Title: Random Splicing of Several Exons Caused by a Single Base Change in the Target Exon of CRISPR/Cas9 Mediated Gene Knockout
    Article Snippet: Analysis of Single-Cell Clones Flotillin-1 expression in single-cell clones was analyzed by Western Blot using a monoclonal mouse anti-flotillin-1 antibody that recognizes an epitope in the C-terminal half of flotillin-1 (BD Transduction Laboratories, Franklin Lakes, NJ, USA). .. RNA was reverse transcribed with Superscript® III reverse transcriptase using oligo(dT)18 primers (New England Biolabs, Frankfurt, Germany).

    Article Title: IL-6-mediated cross-talk between human preadipocytes and ductal carcinoma in situ in breast cancer progression
    Article Snippet: RT-PCR and real-time RT-PCR Total RNA was isolated using TRIzol reagent (Invitrogen, Carlsbad, CA) and was reverse-transcribed using random hexamers and Superscript III reverse transcriptase. cDNAs were synthesized using M-MLV reverse transcriptase (New England Biolabs, Ipswich, MA) and specific primers. .. IL-6 and Interleukin 6 receptor (IL-6R) mRNA expression levels were measured in single culture and co-culture using the following primer sets (Additional file : Table S1).

    Western Blot:

    Article Title: Random Splicing of Several Exons Caused by a Single Base Change in the Target Exon of CRISPR/Cas9 Mediated Gene Knockout
    Article Snippet: Analysis of Single-Cell Clones Flotillin-1 expression in single-cell clones was analyzed by Western Blot using a monoclonal mouse anti-flotillin-1 antibody that recognizes an epitope in the C-terminal half of flotillin-1 (BD Transduction Laboratories, Franklin Lakes, NJ, USA). .. RNA was reverse transcribed with Superscript® III reverse transcriptase using oligo(dT)18 primers (New England Biolabs, Frankfurt, Germany).

    Countercurrent Chromatography:

    Article Title: High resolution sequencing of hepatitis C virus reveals limited intra-hepatic compartmentalization in end-stage liver disease
    Article Snippet: .. Amplification of HCV structural genes for single genome amplification HCV cDNAs for SGA were generated using primers specific for either genotype 1a (2616a-1a: GGG ATG CTG CAT TGA GTA, where the name reflects the location (H77 numbering), orientation (sense/antisense) and genotype specificity of the primer) or genotype 3a (3471a-3a: CAA TAG TTC CAA GAA GGC CCC TAG TTT GCT G). cDNA was generated from 5 μg RNA using 0.4 μM antisense primers together with Superscript III reverse transcriptase; cDNA synthesis was performed for 30 min at 55 °C, followed by denaturation at 94 °C for 2 min. Two-step “nested” PCR amplifications were set-up on ice using a Phusion™ High-Fidelity DNA polymerase system (New England Biolabs, GC buffer) in accordance with the manufacturer’s instructions, with the addition of 4% dimethyl sulfoxide (DMSO) to improve yield. .. The first round primers were: genotype 1 (70s: AGA AAG CGT CTA GCC ATG GCG TTA G and 2616a-1a) or: genotype 3 (70s and 3471a-3a), the PCR amplification conditions were: 30× (94 °C, 15 s; 60 °C, 15 s; 72 °C, 150 s).

    Transfection:

    Article Title: Viral Characteristics Associated with Maintenance of Elite Neutralizing Activity in Chronically HIV-1 Clade C-Infected Monozygotic Pediatric Twins
    Article Snippet: Briefly, viral RNA was isolated from 140 μl of plasma using a QIAamp viral RNA minikit and reverse transcribed, using gene-specific primer OFM19 (5′-GCACTCAAGGCAAGCTTTATTGAGGCTTA-3′) and SuperScript III reverse transcriptase, into cDNA, which was used in a two-round nested PCR for amplification of the envelope gene using high-fidelity Phusion DNA polymerase (New England Biolabs). .. Pseudoviruses were prepared by cotransfecting 1.25 μg of an HIV-1 envelope-containing plasmid with 2.5 μg of an envelope-deficient HIV-1 backbone (PSG3Δenv) vector at a molar ratio of 1:2, using PEI-MAX as the transfection reagent, into HEK293T cells seeded in a 6-well culture plates.

    Ligation:

    Article Title: GRID-seq reveals the global RNA-chromatin interactome
    Article Snippet: .. For primer extension, 10 μl of H2 O, 36 μl of 1 M KCl, 32 μl of 10 mM dNTP mix, 28 μl of 5× RT First Strand Buffer (Thermo Fisher), 28 μl of 100 mM DTT and 5 μl of SuperScript III Reverse Transcriptase were added directly into the suspension, and the reaction was incubated at 50°C for 45 min. For in situ linker ligation to AluI-cut genomic DNA, nuclei were collected, washed twice with 200 μl of 1× DNA Ligase Buffer (NEB) to remove free linker, re-suspended in 1.2 ml of DNA Ligation Solution (0.2 U/μl RiboLock, 1× DNA Ligase Buffer, 1 mg/ml BSA, 1% Triton X-100, 1 U/μl T4 DNA Ligase (Thermo Fisher)) and incubated overnight at 16°C with rotation. .. Nuclei were collected, washed with PBS, re-suspended in 266 μl of Proteinase K solution (50 mM Tris-Cl pH 7.5, 100 mM NaCl, 1 mM EDTA, 1% SDS, 1 mg/ml Proteinase K (Thermo Fisher)) and incubated at 65°C for 30 min. After adding 20 μl of 5 M NaCl, protease-treated nuclei were incubated for another 1.5 hr.

    Article Title: GRID-seq reveals the global RNA-chromatin interactome
    Article Snippet: .. For primer extension, 10 μl of H2 O, 36 μl of 1 M KCl, 32 μl of 10 mM dNTP mix, 28 μl of 5× RT First Strand Buffer (Thermo Fisher), 28 μl of 100 mM DTT and 5 μl of SuperScript III Reverse Transcriptase were added directly into the suspension, and the reaction was incubated at 50°C for 45 min. For in situ linker ligation to AluI-cut genomic DNA, nuclei were collected, washed twice with 200 μl of 1× DNA Ligase Buffer (NEB) to remove free linker, re-suspended in 1.2 ml of DNA Ligation Solution (0.2 U/μl RiboLock, 1× DNA Ligase Buffer, 1 mg/ml BSA, 1% Triton X-100, 1 U/μl T4 DNA Ligase (Thermo Fisher)) and incubated overnight at 16°C with rotation. .. Nuclei were collected, washed with PBS, re-suspended in 266 μl of Proteinase K solution (50 mM Tris-Cl pH 7.5, 100 mM NaCl, 1 mM EDTA, 1% SDS, 1 mg/ml Proteinase K (Thermo Fisher)) and incubated at 65°C for 30 min. After adding 20 μl of 5 M NaCl, protease-treated nuclei were incubated for another 1.5 hr.

    Protease Inhibitor:

    Article Title: GRID-seq reveals the global RNA-chromatin interactome
    Article Snippet: Nuclei were collected, re-suspended in 400 μl of PNK solution (1× Tango Buffer, 1 U/μl RiboLock, 1× Protease inhibitor, 1 mM ATP, 0.35 U/μl T4 PNK (Thermo Fisher)), and incubated at 37°C for 1.5 hr with agitation. .. For primer extension, 10 μl of H2 O, 36 μl of 1 M KCl, 32 μl of 10 mM dNTP mix, 28 μl of 5× RT First Strand Buffer (Thermo Fisher), 28 μl of 100 mM DTT and 5 μl of SuperScript III Reverse Transcriptase were added directly into the suspension, and the reaction was incubated at 50°C for 45 min. For in situ linker ligation to AluI-cut genomic DNA, nuclei were collected, washed twice with 200 μl of 1× DNA Ligase Buffer (NEB) to remove free linker, re-suspended in 1.2 ml of DNA Ligation Solution (0.2 U/μl RiboLock, 1× DNA Ligase Buffer, 1 mg/ml BSA, 1% Triton X-100, 1 U/μl T4 DNA Ligase (Thermo Fisher)) and incubated overnight at 16°C with rotation.

    Article Title: GRID-seq reveals the global RNA-chromatin interactome
    Article Snippet: Nuclei were collected, re-suspended in 400 μl of PNK solution (1× Tango Buffer, 1 U/μl RiboLock, 1× Protease inhibitor, 1 mM ATP, 0.35 U/μl T4 PNK (Thermo Fisher)), and incubated at 37°C for 1.5 hr with agitation. .. For primer extension, 10 μl of H2 O, 36 μl of 1 M KCl, 32 μl of 10 mM dNTP mix, 28 μl of 5× RT First Strand Buffer (Thermo Fisher), 28 μl of 100 mM DTT and 5 μl of SuperScript III Reverse Transcriptase were added directly into the suspension, and the reaction was incubated at 50°C for 45 min. For in situ linker ligation to AluI-cut genomic DNA, nuclei were collected, washed twice with 200 μl of 1× DNA Ligase Buffer (NEB) to remove free linker, re-suspended in 1.2 ml of DNA Ligation Solution (0.2 U/μl RiboLock, 1× DNA Ligase Buffer, 1 mg/ml BSA, 1% Triton X-100, 1 U/μl T4 DNA Ligase (Thermo Fisher)) and incubated overnight at 16°C with rotation.

    Generated:

    Article Title: Viral Characteristics Associated with Maintenance of Elite Neutralizing Activity in Chronically HIV-1 Clade C-Infected Monozygotic Pediatric Twins
    Article Snippet: Autologous replication-incompetent envelope pseudoviruses were generated from AIIMS_329 and AIIMS_330 as described previously ( ). .. Briefly, viral RNA was isolated from 140 μl of plasma using a QIAamp viral RNA minikit and reverse transcribed, using gene-specific primer OFM19 (5′-GCACTCAAGGCAAGCTTTATTGAGGCTTA-3′) and SuperScript III reverse transcriptase, into cDNA, which was used in a two-round nested PCR for amplification of the envelope gene using high-fidelity Phusion DNA polymerase (New England Biolabs).

    Article Title: Denaturing CLIP (dCLIP) pipeline identifies discrete RNA footprints on chromatin-associated proteins and reveals that CBX7 targets 3’UTRs to regulate mRNA expression
    Article Snippet: Strand-specific cDNA libraries were constructed using Superscript III reverse-transcriptase for first-strand synthesis, NEBNext mRNA Second Strand Synthesis Module supplemented with dUTP (NEB) for second-strand synthesis, and NEBNext ChIP-Seq Library Prep Master Mix Set for library preparation. .. Approximately 40 million single-end 50nt reads were generated for every RNA-seq sample ( ).

    Article Title: High resolution sequencing of hepatitis C virus reveals limited intra-hepatic compartmentalization in end-stage liver disease
    Article Snippet: .. Amplification of HCV structural genes for single genome amplification HCV cDNAs for SGA were generated using primers specific for either genotype 1a (2616a-1a: GGG ATG CTG CAT TGA GTA, where the name reflects the location (H77 numbering), orientation (sense/antisense) and genotype specificity of the primer) or genotype 3a (3471a-3a: CAA TAG TTC CAA GAA GGC CCC TAG TTT GCT G). cDNA was generated from 5 μg RNA using 0.4 μM antisense primers together with Superscript III reverse transcriptase; cDNA synthesis was performed for 30 min at 55 °C, followed by denaturation at 94 °C for 2 min. Two-step “nested” PCR amplifications were set-up on ice using a Phusion™ High-Fidelity DNA polymerase system (New England Biolabs, GC buffer) in accordance with the manufacturer’s instructions, with the addition of 4% dimethyl sulfoxide (DMSO) to improve yield. .. The first round primers were: genotype 1 (70s: AGA AAG CGT CTA GCC ATG GCG TTA G and 2616a-1a) or: genotype 3 (70s and 3471a-3a), the PCR amplification conditions were: 30× (94 °C, 15 s; 60 °C, 15 s; 72 °C, 150 s).

    Polymerase Chain Reaction:

    Article Title: LOXL4 knockdown enhances tumor growth and lung metastasis through collagen-dependent extracellular matrix changes in triple-negative breast cancer
    Article Snippet: RNA isolation and quantitative real-time PCR Total RNA was isolated using TRIzol Reagent (Invitrogen, Carlsbad, CA, USA) and was reverse-transcribed using random hexamers and Superscript III reverse transcriptase. cDNAs were synthesized using M-MLV reverse transcriptase (New England Biolabs, Ipswich, MA, USA) and random primers. mRNA levels were measured in control and shLOXL4 cells using the quantitative real-time method and the following primer sets: LOX (174 bp) F, GTTCCAAGCTGGCTACTC, and R, GGGTTGTCGTCAGAGTAC; LOXL1 (244 bp) F, CAGACCCCAACTATGTGCAA, and R, ATGCTGTGGTAATGCTGGTG; LOXL2 (239 bp) F, GGAAAGCGTACAAGCCAGAG, and R, GCACTGG ATCTCGTTGAGGT; LOXL3 (162 bp) F, ATGGGTGCT ATCCACCTGAG, and R, GAGTCGGATCCTGGTC TCTG; LOXL4 (165 bp) F, ACCGAAGACAAAGCC ACAAC, and R, CACACGACACTGGCAGAGAT; and β-actin (335 bp) F, TTCCTGGGCATGGAGTCCTGTGG, and R, CGCCTAGAAGCATTTGCGGTGG. .. Relative gene expression was determined using an ABI 7500 real-time polymerase chain reaction (PCR) instrument (Applied Biosystems, South San Francisco, CA, USA) with pre-optimized conditions.

    Article Title: IL-6-mediated cross-talk between human preadipocytes and ductal carcinoma in situ in breast cancer progression
    Article Snippet: Total RNA was isolated using TRIzol reagent (Invitrogen, Carlsbad, CA) and was reverse-transcribed using random hexamers and Superscript III reverse transcriptase. cDNAs were synthesized using M-MLV reverse transcriptase (New England Biolabs, Ipswich, MA) and specific primers. .. Real-time RT-PCR reactions were run on an ABI PRISM 7900 utilizing a SYBR Green PCR master mix (Applied Biosystems, Foster City, CA).

    Article Title: Random Splicing of Several Exons Caused by a Single Base Change in the Target Exon of CRISPR/Cas9 Mediated Gene Knockout
    Article Snippet: RNA was reverse transcribed with Superscript® III reverse transcriptase using oligo(dT)18 primers (New England Biolabs, Frankfurt, Germany). .. FLOT1 cDNA covering the coding region and 570 bp of genomic DNA surrounding the gRNA target site were PCR-amplified out of cDNA or genomic DNA, respectively, using Q5® High Fidelity DNA polymerase (NEB, Frankfurt, Germany).

    Article Title: IL-6-mediated cross-talk between human preadipocytes and ductal carcinoma in situ in breast cancer progression
    Article Snippet: RT-PCR and real-time RT-PCR Total RNA was isolated using TRIzol reagent (Invitrogen, Carlsbad, CA) and was reverse-transcribed using random hexamers and Superscript III reverse transcriptase. cDNAs were synthesized using M-MLV reverse transcriptase (New England Biolabs, Ipswich, MA) and specific primers. .. Real-time RT-PCR reactions were run on an ABI PRISM 7900 utilizing a SYBR Green PCR master mix (Applied Biosystems, Foster City, CA).

    Article Title: High resolution sequencing of hepatitis C virus reveals limited intra-hepatic compartmentalization in end-stage liver disease
    Article Snippet: Amplification of HCV structural genes for single genome amplification HCV cDNAs for SGA were generated using primers specific for either genotype 1a (2616a-1a: GGG ATG CTG CAT TGA GTA, where the name reflects the location (H77 numbering), orientation (sense/antisense) and genotype specificity of the primer) or genotype 3a (3471a-3a: CAA TAG TTC CAA GAA GGC CCC TAG TTT GCT G). cDNA was generated from 5 μg RNA using 0.4 μM antisense primers together with Superscript III reverse transcriptase; cDNA synthesis was performed for 30 min at 55 °C, followed by denaturation at 94 °C for 2 min. Two-step “nested” PCR amplifications were set-up on ice using a Phusion™ High-Fidelity DNA polymerase system (New England Biolabs, GC buffer) in accordance with the manufacturer’s instructions, with the addition of 4% dimethyl sulfoxide (DMSO) to improve yield. .. The first round primers were: genotype 1 (70s: AGA AAG CGT CTA GCC ATG GCG TTA G and 2616a-1a) or: genotype 3 (70s and 3471a-3a), the PCR amplification conditions were: 30× (94 °C, 15 s; 60 °C, 15 s; 72 °C, 150 s).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: IL-6-mediated cross-talk between human preadipocytes and ductal carcinoma in situ in breast cancer progression
    Article Snippet: Paragraph title: RT-PCR and real-time RT-PCR ... Total RNA was isolated using TRIzol reagent (Invitrogen, Carlsbad, CA) and was reverse-transcribed using random hexamers and Superscript III reverse transcriptase. cDNAs were synthesized using M-MLV reverse transcriptase (New England Biolabs, Ipswich, MA) and specific primers.

    Article Title: IL-6-mediated cross-talk between human preadipocytes and ductal carcinoma in situ in breast cancer progression
    Article Snippet: .. RT-PCR and real-time RT-PCR Total RNA was isolated using TRIzol reagent (Invitrogen, Carlsbad, CA) and was reverse-transcribed using random hexamers and Superscript III reverse transcriptase. cDNAs were synthesized using M-MLV reverse transcriptase (New England Biolabs, Ipswich, MA) and specific primers. .. IL-6 and Interleukin 6 receptor (IL-6R) mRNA expression levels were measured in single culture and co-culture using the following primer sets (Additional file : Table S1).

    Affinity Purification:

    Article Title: GRID-seq reveals the global RNA-chromatin interactome
    Article Snippet: For primer extension, 10 μl of H2 O, 36 μl of 1 M KCl, 32 μl of 10 mM dNTP mix, 28 μl of 5× RT First Strand Buffer (Thermo Fisher), 28 μl of 100 mM DTT and 5 μl of SuperScript III Reverse Transcriptase were added directly into the suspension, and the reaction was incubated at 50°C for 45 min. For in situ linker ligation to AluI-cut genomic DNA, nuclei were collected, washed twice with 200 μl of 1× DNA Ligase Buffer (NEB) to remove free linker, re-suspended in 1.2 ml of DNA Ligation Solution (0.2 U/μl RiboLock, 1× DNA Ligase Buffer, 1 mg/ml BSA, 1% Triton X-100, 1 U/μl T4 DNA Ligase (Thermo Fisher)) and incubated overnight at 16°C with rotation. .. Isolated DNA was mixed with 300 μg of Streptavidin-conjugated magnetic beads that had been washed with B & W Buffer for biotin affinity purification.

    Article Title: GRID-seq reveals the global RNA-chromatin interactome
    Article Snippet: For primer extension, 10 μl of H2 O, 36 μl of 1 M KCl, 32 μl of 10 mM dNTP mix, 28 μl of 5× RT First Strand Buffer (Thermo Fisher), 28 μl of 100 mM DTT and 5 μl of SuperScript III Reverse Transcriptase were added directly into the suspension, and the reaction was incubated at 50°C for 45 min. For in situ linker ligation to AluI-cut genomic DNA, nuclei were collected, washed twice with 200 μl of 1× DNA Ligase Buffer (NEB) to remove free linker, re-suspended in 1.2 ml of DNA Ligation Solution (0.2 U/μl RiboLock, 1× DNA Ligase Buffer, 1 mg/ml BSA, 1% Triton X-100, 1 U/μl T4 DNA Ligase (Thermo Fisher)) and incubated overnight at 16°C with rotation. .. Isolated DNA was mixed with 300 μg of Streptavidin-conjugated magnetic beads that had been washed with B & W Buffer for biotin affinity purification.

    Cellular Antioxidant Activity Assay:

    Article Title: High resolution sequencing of hepatitis C virus reveals limited intra-hepatic compartmentalization in end-stage liver disease
    Article Snippet: .. Amplification of HCV structural genes for single genome amplification HCV cDNAs for SGA were generated using primers specific for either genotype 1a (2616a-1a: GGG ATG CTG CAT TGA GTA, where the name reflects the location (H77 numbering), orientation (sense/antisense) and genotype specificity of the primer) or genotype 3a (3471a-3a: CAA TAG TTC CAA GAA GGC CCC TAG TTT GCT G). cDNA was generated from 5 μg RNA using 0.4 μM antisense primers together with Superscript III reverse transcriptase; cDNA synthesis was performed for 30 min at 55 °C, followed by denaturation at 94 °C for 2 min. Two-step “nested” PCR amplifications were set-up on ice using a Phusion™ High-Fidelity DNA polymerase system (New England Biolabs, GC buffer) in accordance with the manufacturer’s instructions, with the addition of 4% dimethyl sulfoxide (DMSO) to improve yield. .. The first round primers were: genotype 1 (70s: AGA AAG CGT CTA GCC ATG GCG TTA G and 2616a-1a) or: genotype 3 (70s and 3471a-3a), the PCR amplification conditions were: 30× (94 °C, 15 s; 60 °C, 15 s; 72 °C, 150 s).

    ChIP-sequencing:

    Article Title: Denaturing CLIP (dCLIP) pipeline identifies discrete RNA footprints on chromatin-associated proteins and reveals that CBX7 targets 3’UTRs to regulate mRNA expression
    Article Snippet: .. Strand-specific cDNA libraries were constructed using Superscript III reverse-transcriptase for first-strand synthesis, NEBNext mRNA Second Strand Synthesis Module supplemented with dUTP (NEB) for second-strand synthesis, and NEBNext ChIP-Seq Library Prep Master Mix Set for library preparation. .. Libraries were subjected to high-throughput sequencing using Illumina HiSeq 2000 apparatus according to manufacturer instructions.

    RNA Sequencing Assay:

    Article Title: Denaturing CLIP (dCLIP) pipeline identifies discrete RNA footprints on chromatin-associated proteins and reveals that CBX7 targets 3’UTRs to regulate mRNA expression
    Article Snippet: Paragraph title: RNA-seq analysis ... Strand-specific cDNA libraries were constructed using Superscript III reverse-transcriptase for first-strand synthesis, NEBNext mRNA Second Strand Synthesis Module supplemented with dUTP (NEB) for second-strand synthesis, and NEBNext ChIP-Seq Library Prep Master Mix Set for library preparation.

    Magnetic Beads:

    Article Title: GRID-seq reveals the global RNA-chromatin interactome
    Article Snippet: For primer extension, 10 μl of H2 O, 36 μl of 1 M KCl, 32 μl of 10 mM dNTP mix, 28 μl of 5× RT First Strand Buffer (Thermo Fisher), 28 μl of 100 mM DTT and 5 μl of SuperScript III Reverse Transcriptase were added directly into the suspension, and the reaction was incubated at 50°C for 45 min. For in situ linker ligation to AluI-cut genomic DNA, nuclei were collected, washed twice with 200 μl of 1× DNA Ligase Buffer (NEB) to remove free linker, re-suspended in 1.2 ml of DNA Ligation Solution (0.2 U/μl RiboLock, 1× DNA Ligase Buffer, 1 mg/ml BSA, 1% Triton X-100, 1 U/μl T4 DNA Ligase (Thermo Fisher)) and incubated overnight at 16°C with rotation. .. Isolated DNA was mixed with 300 μg of Streptavidin-conjugated magnetic beads that had been washed with B & W Buffer for biotin affinity purification.

    Article Title: GRID-seq reveals the global RNA-chromatin interactome
    Article Snippet: For primer extension, 10 μl of H2 O, 36 μl of 1 M KCl, 32 μl of 10 mM dNTP mix, 28 μl of 5× RT First Strand Buffer (Thermo Fisher), 28 μl of 100 mM DTT and 5 μl of SuperScript III Reverse Transcriptase were added directly into the suspension, and the reaction was incubated at 50°C for 45 min. For in situ linker ligation to AluI-cut genomic DNA, nuclei were collected, washed twice with 200 μl of 1× DNA Ligase Buffer (NEB) to remove free linker, re-suspended in 1.2 ml of DNA Ligation Solution (0.2 U/μl RiboLock, 1× DNA Ligase Buffer, 1 mg/ml BSA, 1% Triton X-100, 1 U/μl T4 DNA Ligase (Thermo Fisher)) and incubated overnight at 16°C with rotation. .. Isolated DNA was mixed with 300 μg of Streptavidin-conjugated magnetic beads that had been washed with B & W Buffer for biotin affinity purification.

    Isolation:

    Article Title: LOXL4 knockdown enhances tumor growth and lung metastasis through collagen-dependent extracellular matrix changes in triple-negative breast cancer
    Article Snippet: .. RNA isolation and quantitative real-time PCR Total RNA was isolated using TRIzol Reagent (Invitrogen, Carlsbad, CA, USA) and was reverse-transcribed using random hexamers and Superscript III reverse transcriptase. cDNAs were synthesized using M-MLV reverse transcriptase (New England Biolabs, Ipswich, MA, USA) and random primers. mRNA levels were measured in control and shLOXL4 cells using the quantitative real-time method and the following primer sets: LOX (174 bp) F, GTTCCAAGCTGGCTACTC, and R, GGGTTGTCGTCAGAGTAC; LOXL1 (244 bp) F, CAGACCCCAACTATGTGCAA, and R, ATGCTGTGGTAATGCTGGTG; LOXL2 (239 bp) F, GGAAAGCGTACAAGCCAGAG, and R, GCACTGG ATCTCGTTGAGGT; LOXL3 (162 bp) F, ATGGGTGCT ATCCACCTGAG, and R, GAGTCGGATCCTGGTC TCTG; LOXL4 (165 bp) F, ACCGAAGACAAAGCC ACAAC, and R, CACACGACACTGGCAGAGAT; and β-actin (335 bp) F, TTCCTGGGCATGGAGTCCTGTGG, and R, CGCCTAGAAGCATTTGCGGTGG. .. Relative gene expression was determined using an ABI 7500 real-time polymerase chain reaction (PCR) instrument (Applied Biosystems, South San Francisco, CA, USA) with pre-optimized conditions.

    Article Title: GRID-seq reveals the global RNA-chromatin interactome
    Article Snippet: For primer extension, 10 μl of H2 O, 36 μl of 1 M KCl, 32 μl of 10 mM dNTP mix, 28 μl of 5× RT First Strand Buffer (Thermo Fisher), 28 μl of 100 mM DTT and 5 μl of SuperScript III Reverse Transcriptase were added directly into the suspension, and the reaction was incubated at 50°C for 45 min. For in situ linker ligation to AluI-cut genomic DNA, nuclei were collected, washed twice with 200 μl of 1× DNA Ligase Buffer (NEB) to remove free linker, re-suspended in 1.2 ml of DNA Ligation Solution (0.2 U/μl RiboLock, 1× DNA Ligase Buffer, 1 mg/ml BSA, 1% Triton X-100, 1 U/μl T4 DNA Ligase (Thermo Fisher)) and incubated overnight at 16°C with rotation. .. Isolated DNA was mixed with 300 μg of Streptavidin-conjugated magnetic beads that had been washed with B & W Buffer for biotin affinity purification.

    Article Title: IL-6-mediated cross-talk between human preadipocytes and ductal carcinoma in situ in breast cancer progression
    Article Snippet: .. Total RNA was isolated using TRIzol reagent (Invitrogen, Carlsbad, CA) and was reverse-transcribed using random hexamers and Superscript III reverse transcriptase. cDNAs were synthesized using M-MLV reverse transcriptase (New England Biolabs, Ipswich, MA) and specific primers. .. IL-6 and Interleukin 6 receptor (IL-6R) mRNA expression levels were measured in single culture and co-culture using the following primer sets (Additional file : Table S1).

    Article Title: Viral Characteristics Associated with Maintenance of Elite Neutralizing Activity in Chronically HIV-1 Clade C-Infected Monozygotic Pediatric Twins
    Article Snippet: .. Briefly, viral RNA was isolated from 140 μl of plasma using a QIAamp viral RNA minikit and reverse transcribed, using gene-specific primer OFM19 (5′-GCACTCAAGGCAAGCTTTATTGAGGCTTA-3′) and SuperScript III reverse transcriptase, into cDNA, which was used in a two-round nested PCR for amplification of the envelope gene using high-fidelity Phusion DNA polymerase (New England Biolabs). .. The envelope amplicons were purified and ligated into the pcDNA3.1D/V5-His-TOPO vector (Invitrogen).

    Article Title: Random Splicing of Several Exons Caused by a Single Base Change in the Target Exon of CRISPR/Cas9 Mediated Gene Knockout
    Article Snippet: Genomic DNA and total RNA were isolated with peqGold Trifast (Peqlab, Erlangen, Germany) from two FLOT1 knockout HeLa single-cell clones or from AGA HEK 293T clones. .. RNA was reverse transcribed with Superscript® III reverse transcriptase using oligo(dT)18 primers (New England Biolabs, Frankfurt, Germany).

    Article Title: IL-6-mediated cross-talk between human preadipocytes and ductal carcinoma in situ in breast cancer progression
    Article Snippet: .. RT-PCR and real-time RT-PCR Total RNA was isolated using TRIzol reagent (Invitrogen, Carlsbad, CA) and was reverse-transcribed using random hexamers and Superscript III reverse transcriptase. cDNAs were synthesized using M-MLV reverse transcriptase (New England Biolabs, Ipswich, MA) and specific primers. .. IL-6 and Interleukin 6 receptor (IL-6R) mRNA expression levels were measured in single culture and co-culture using the following primer sets (Additional file : Table S1).

    Article Title: GRID-seq reveals the global RNA-chromatin interactome
    Article Snippet: For primer extension, 10 μl of H2 O, 36 μl of 1 M KCl, 32 μl of 10 mM dNTP mix, 28 μl of 5× RT First Strand Buffer (Thermo Fisher), 28 μl of 100 mM DTT and 5 μl of SuperScript III Reverse Transcriptase were added directly into the suspension, and the reaction was incubated at 50°C for 45 min. For in situ linker ligation to AluI-cut genomic DNA, nuclei were collected, washed twice with 200 μl of 1× DNA Ligase Buffer (NEB) to remove free linker, re-suspended in 1.2 ml of DNA Ligation Solution (0.2 U/μl RiboLock, 1× DNA Ligase Buffer, 1 mg/ml BSA, 1% Triton X-100, 1 U/μl T4 DNA Ligase (Thermo Fisher)) and incubated overnight at 16°C with rotation. .. Isolated DNA was mixed with 300 μg of Streptavidin-conjugated magnetic beads that had been washed with B & W Buffer for biotin affinity purification.

    Microscopy:

    Article Title: GRID-seq reveals the global RNA-chromatin interactome
    Article Snippet: SDS was immediately quenched with 50 μl of 10% Triton X-100 and the integrity of nuclei was examined under microscope. .. For primer extension, 10 μl of H2 O, 36 μl of 1 M KCl, 32 μl of 10 mM dNTP mix, 28 μl of 5× RT First Strand Buffer (Thermo Fisher), 28 μl of 100 mM DTT and 5 μl of SuperScript III Reverse Transcriptase were added directly into the suspension, and the reaction was incubated at 50°C for 45 min. For in situ linker ligation to AluI-cut genomic DNA, nuclei were collected, washed twice with 200 μl of 1× DNA Ligase Buffer (NEB) to remove free linker, re-suspended in 1.2 ml of DNA Ligation Solution (0.2 U/μl RiboLock, 1× DNA Ligase Buffer, 1 mg/ml BSA, 1% Triton X-100, 1 U/μl T4 DNA Ligase (Thermo Fisher)) and incubated overnight at 16°C with rotation.

    Article Title: GRID-seq reveals the global RNA-chromatin interactome
    Article Snippet: SDS was immediately quenched with 50 μl of 10% Triton X-100 and the integrity of nuclei was examined under microscope. .. For primer extension, 10 μl of H2 O, 36 μl of 1 M KCl, 32 μl of 10 mM dNTP mix, 28 μl of 5× RT First Strand Buffer (Thermo Fisher), 28 μl of 100 mM DTT and 5 μl of SuperScript III Reverse Transcriptase were added directly into the suspension, and the reaction was incubated at 50°C for 45 min. For in situ linker ligation to AluI-cut genomic DNA, nuclei were collected, washed twice with 200 μl of 1× DNA Ligase Buffer (NEB) to remove free linker, re-suspended in 1.2 ml of DNA Ligation Solution (0.2 U/μl RiboLock, 1× DNA Ligase Buffer, 1 mg/ml BSA, 1% Triton X-100, 1 U/μl T4 DNA Ligase (Thermo Fisher)) and incubated overnight at 16°C with rotation.

    Purification:

    Article Title: Viral Characteristics Associated with Maintenance of Elite Neutralizing Activity in Chronically HIV-1 Clade C-Infected Monozygotic Pediatric Twins
    Article Snippet: Briefly, viral RNA was isolated from 140 μl of plasma using a QIAamp viral RNA minikit and reverse transcribed, using gene-specific primer OFM19 (5′-GCACTCAAGGCAAGCTTTATTGAGGCTTA-3′) and SuperScript III reverse transcriptase, into cDNA, which was used in a two-round nested PCR for amplification of the envelope gene using high-fidelity Phusion DNA polymerase (New England Biolabs). .. The envelope amplicons were purified and ligated into the pcDNA3.1D/V5-His-TOPO vector (Invitrogen).

    Sequencing:

    Article Title: Denaturing CLIP (dCLIP) pipeline identifies discrete RNA footprints on chromatin-associated proteins and reveals that CBX7 targets 3’UTRs to regulate mRNA expression
    Article Snippet: Strand-specific cDNA libraries were constructed using Superscript III reverse-transcriptase for first-strand synthesis, NEBNext mRNA Second Strand Synthesis Module supplemented with dUTP (NEB) for second-strand synthesis, and NEBNext ChIP-Seq Library Prep Master Mix Set for library preparation. .. Libraries were subjected to high-throughput sequencing using Illumina HiSeq 2000 apparatus according to manufacturer instructions.

    Co-Culture Assay:

    Article Title: IL-6-mediated cross-talk between human preadipocytes and ductal carcinoma in situ in breast cancer progression
    Article Snippet: Total RNA was isolated using TRIzol reagent (Invitrogen, Carlsbad, CA) and was reverse-transcribed using random hexamers and Superscript III reverse transcriptase. cDNAs were synthesized using M-MLV reverse transcriptase (New England Biolabs, Ipswich, MA) and specific primers. .. IL-6 and Interleukin 6 receptor (IL-6R) mRNA expression levels were measured in single culture and co-culture using the following primer sets (Additional file : Table S1).

    Article Title: IL-6-mediated cross-talk between human preadipocytes and ductal carcinoma in situ in breast cancer progression
    Article Snippet: RT-PCR and real-time RT-PCR Total RNA was isolated using TRIzol reagent (Invitrogen, Carlsbad, CA) and was reverse-transcribed using random hexamers and Superscript III reverse transcriptase. cDNAs were synthesized using M-MLV reverse transcriptase (New England Biolabs, Ipswich, MA) and specific primers. .. IL-6 and Interleukin 6 receptor (IL-6R) mRNA expression levels were measured in single culture and co-culture using the following primer sets (Additional file : Table S1).

    Nested PCR:

    Article Title: Viral Characteristics Associated with Maintenance of Elite Neutralizing Activity in Chronically HIV-1 Clade C-Infected Monozygotic Pediatric Twins
    Article Snippet: .. Briefly, viral RNA was isolated from 140 μl of plasma using a QIAamp viral RNA minikit and reverse transcribed, using gene-specific primer OFM19 (5′-GCACTCAAGGCAAGCTTTATTGAGGCTTA-3′) and SuperScript III reverse transcriptase, into cDNA, which was used in a two-round nested PCR for amplification of the envelope gene using high-fidelity Phusion DNA polymerase (New England Biolabs). .. The envelope amplicons were purified and ligated into the pcDNA3.1D/V5-His-TOPO vector (Invitrogen).

    Article Title: High resolution sequencing of hepatitis C virus reveals limited intra-hepatic compartmentalization in end-stage liver disease
    Article Snippet: .. Amplification of HCV structural genes for single genome amplification HCV cDNAs for SGA were generated using primers specific for either genotype 1a (2616a-1a: GGG ATG CTG CAT TGA GTA, where the name reflects the location (H77 numbering), orientation (sense/antisense) and genotype specificity of the primer) or genotype 3a (3471a-3a: CAA TAG TTC CAA GAA GGC CCC TAG TTT GCT G). cDNA was generated from 5 μg RNA using 0.4 μM antisense primers together with Superscript III reverse transcriptase; cDNA synthesis was performed for 30 min at 55 °C, followed by denaturation at 94 °C for 2 min. Two-step “nested” PCR amplifications were set-up on ice using a Phusion™ High-Fidelity DNA polymerase system (New England Biolabs, GC buffer) in accordance with the manufacturer’s instructions, with the addition of 4% dimethyl sulfoxide (DMSO) to improve yield. .. The first round primers were: genotype 1 (70s: AGA AAG CGT CTA GCC ATG GCG TTA G and 2616a-1a) or: genotype 3 (70s and 3471a-3a), the PCR amplification conditions were: 30× (94 °C, 15 s; 60 °C, 15 s; 72 °C, 150 s).

    Chloramphenicol Acetyltransferase Assay:

    Article Title: High resolution sequencing of hepatitis C virus reveals limited intra-hepatic compartmentalization in end-stage liver disease
    Article Snippet: .. Amplification of HCV structural genes for single genome amplification HCV cDNAs for SGA were generated using primers specific for either genotype 1a (2616a-1a: GGG ATG CTG CAT TGA GTA, where the name reflects the location (H77 numbering), orientation (sense/antisense) and genotype specificity of the primer) or genotype 3a (3471a-3a: CAA TAG TTC CAA GAA GGC CCC TAG TTT GCT G). cDNA was generated from 5 μg RNA using 0.4 μM antisense primers together with Superscript III reverse transcriptase; cDNA synthesis was performed for 30 min at 55 °C, followed by denaturation at 94 °C for 2 min. Two-step “nested” PCR amplifications were set-up on ice using a Phusion™ High-Fidelity DNA polymerase system (New England Biolabs, GC buffer) in accordance with the manufacturer’s instructions, with the addition of 4% dimethyl sulfoxide (DMSO) to improve yield. .. The first round primers were: genotype 1 (70s: AGA AAG CGT CTA GCC ATG GCG TTA G and 2616a-1a) or: genotype 3 (70s and 3471a-3a), the PCR amplification conditions were: 30× (94 °C, 15 s; 60 °C, 15 s; 72 °C, 150 s).

    Plasmid Preparation:

    Article Title: Viral Characteristics Associated with Maintenance of Elite Neutralizing Activity in Chronically HIV-1 Clade C-Infected Monozygotic Pediatric Twins
    Article Snippet: Briefly, viral RNA was isolated from 140 μl of plasma using a QIAamp viral RNA minikit and reverse transcribed, using gene-specific primer OFM19 (5′-GCACTCAAGGCAAGCTTTATTGAGGCTTA-3′) and SuperScript III reverse transcriptase, into cDNA, which was used in a two-round nested PCR for amplification of the envelope gene using high-fidelity Phusion DNA polymerase (New England Biolabs). .. The envelope amplicons were purified and ligated into the pcDNA3.1D/V5-His-TOPO vector (Invitrogen).

    Real-time Polymerase Chain Reaction:

    Article Title: LOXL4 knockdown enhances tumor growth and lung metastasis through collagen-dependent extracellular matrix changes in triple-negative breast cancer
    Article Snippet: .. RNA isolation and quantitative real-time PCR Total RNA was isolated using TRIzol Reagent (Invitrogen, Carlsbad, CA, USA) and was reverse-transcribed using random hexamers and Superscript III reverse transcriptase. cDNAs were synthesized using M-MLV reverse transcriptase (New England Biolabs, Ipswich, MA, USA) and random primers. mRNA levels were measured in control and shLOXL4 cells using the quantitative real-time method and the following primer sets: LOX (174 bp) F, GTTCCAAGCTGGCTACTC, and R, GGGTTGTCGTCAGAGTAC; LOXL1 (244 bp) F, CAGACCCCAACTATGTGCAA, and R, ATGCTGTGGTAATGCTGGTG; LOXL2 (239 bp) F, GGAAAGCGTACAAGCCAGAG, and R, GCACTGG ATCTCGTTGAGGT; LOXL3 (162 bp) F, ATGGGTGCT ATCCACCTGAG, and R, GAGTCGGATCCTGGTC TCTG; LOXL4 (165 bp) F, ACCGAAGACAAAGCC ACAAC, and R, CACACGACACTGGCAGAGAT; and β-actin (335 bp) F, TTCCTGGGCATGGAGTCCTGTGG, and R, CGCCTAGAAGCATTTGCGGTGG. .. Relative gene expression was determined using an ABI 7500 real-time polymerase chain reaction (PCR) instrument (Applied Biosystems, South San Francisco, CA, USA) with pre-optimized conditions.

    In Situ:

    Article Title: GRID-seq reveals the global RNA-chromatin interactome
    Article Snippet: .. For primer extension, 10 μl of H2 O, 36 μl of 1 M KCl, 32 μl of 10 mM dNTP mix, 28 μl of 5× RT First Strand Buffer (Thermo Fisher), 28 μl of 100 mM DTT and 5 μl of SuperScript III Reverse Transcriptase were added directly into the suspension, and the reaction was incubated at 50°C for 45 min. For in situ linker ligation to AluI-cut genomic DNA, nuclei were collected, washed twice with 200 μl of 1× DNA Ligase Buffer (NEB) to remove free linker, re-suspended in 1.2 ml of DNA Ligation Solution (0.2 U/μl RiboLock, 1× DNA Ligase Buffer, 1 mg/ml BSA, 1% Triton X-100, 1 U/μl T4 DNA Ligase (Thermo Fisher)) and incubated overnight at 16°C with rotation. .. Nuclei were collected, washed with PBS, re-suspended in 266 μl of Proteinase K solution (50 mM Tris-Cl pH 7.5, 100 mM NaCl, 1 mM EDTA, 1% SDS, 1 mg/ml Proteinase K (Thermo Fisher)) and incubated at 65°C for 30 min. After adding 20 μl of 5 M NaCl, protease-treated nuclei were incubated for another 1.5 hr.

    Article Title: GRID-seq reveals the global RNA-chromatin interactome
    Article Snippet: .. For primer extension, 10 μl of H2 O, 36 μl of 1 M KCl, 32 μl of 10 mM dNTP mix, 28 μl of 5× RT First Strand Buffer (Thermo Fisher), 28 μl of 100 mM DTT and 5 μl of SuperScript III Reverse Transcriptase were added directly into the suspension, and the reaction was incubated at 50°C for 45 min. For in situ linker ligation to AluI-cut genomic DNA, nuclei were collected, washed twice with 200 μl of 1× DNA Ligase Buffer (NEB) to remove free linker, re-suspended in 1.2 ml of DNA Ligation Solution (0.2 U/μl RiboLock, 1× DNA Ligase Buffer, 1 mg/ml BSA, 1% Triton X-100, 1 U/μl T4 DNA Ligase (Thermo Fisher)) and incubated overnight at 16°C with rotation. .. Nuclei were collected, washed with PBS, re-suspended in 266 μl of Proteinase K solution (50 mM Tris-Cl pH 7.5, 100 mM NaCl, 1 mM EDTA, 1% SDS, 1 mg/ml Proteinase K (Thermo Fisher)) and incubated at 65°C for 30 min. After adding 20 μl of 5 M NaCl, protease-treated nuclei were incubated for another 1.5 hr.

    Knock-Out:

    Article Title: Random Splicing of Several Exons Caused by a Single Base Change in the Target Exon of CRISPR/Cas9 Mediated Gene Knockout
    Article Snippet: Genomic DNA and total RNA were isolated with peqGold Trifast (Peqlab, Erlangen, Germany) from two FLOT1 knockout HeLa single-cell clones or from AGA HEK 293T clones. .. RNA was reverse transcribed with Superscript® III reverse transcriptase using oligo(dT)18 primers (New England Biolabs, Frankfurt, Germany).

    Construct:

    Article Title: Denaturing CLIP (dCLIP) pipeline identifies discrete RNA footprints on chromatin-associated proteins and reveals that CBX7 targets 3’UTRs to regulate mRNA expression
    Article Snippet: .. Strand-specific cDNA libraries were constructed using Superscript III reverse-transcriptase for first-strand synthesis, NEBNext mRNA Second Strand Synthesis Module supplemented with dUTP (NEB) for second-strand synthesis, and NEBNext ChIP-Seq Library Prep Master Mix Set for library preparation. .. Libraries were subjected to high-throughput sequencing using Illumina HiSeq 2000 apparatus according to manufacturer instructions.

    CTG Assay:

    Article Title: High resolution sequencing of hepatitis C virus reveals limited intra-hepatic compartmentalization in end-stage liver disease
    Article Snippet: .. Amplification of HCV structural genes for single genome amplification HCV cDNAs for SGA were generated using primers specific for either genotype 1a (2616a-1a: GGG ATG CTG CAT TGA GTA, where the name reflects the location (H77 numbering), orientation (sense/antisense) and genotype specificity of the primer) or genotype 3a (3471a-3a: CAA TAG TTC CAA GAA GGC CCC TAG TTT GCT G). cDNA was generated from 5 μg RNA using 0.4 μM antisense primers together with Superscript III reverse transcriptase; cDNA synthesis was performed for 30 min at 55 °C, followed by denaturation at 94 °C for 2 min. Two-step “nested” PCR amplifications were set-up on ice using a Phusion™ High-Fidelity DNA polymerase system (New England Biolabs, GC buffer) in accordance with the manufacturer’s instructions, with the addition of 4% dimethyl sulfoxide (DMSO) to improve yield. .. The first round primers were: genotype 1 (70s: AGA AAG CGT CTA GCC ATG GCG TTA G and 2616a-1a) or: genotype 3 (70s and 3471a-3a), the PCR amplification conditions were: 30× (94 °C, 15 s; 60 °C, 15 s; 72 °C, 150 s).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 84
    New England Biolabs reverse transcriptase superscript iii
    Molecular clone of MuV JL2 , indicating gene boundaries and restriction sites in pMuV JL2 . The bar shows the antigenome of pMuV JL2 and the locations of viral genes (not to scale). Arrows beneath the bar indicate the location of unique restriction sites suitable for ligation-independent cloning using exonuclease <t>III</t> in pMuV JL2 . The vector sequence flanking the antigenome contains a Not I site upstream of a T7 RNA polymerase promoter located 5′ to the antigenome (i.e. to the left of N) and a Kas I site downstream of the antigenome 3′ terminus (i.e. to the right of L) which is internal to the hepatitis delta ribozyme (these restriction sites are shown in bold). (a) Restriction sites present in the consensus MuV JL2 sequence – these were either already unique in the consensus MuV JL2 sequence or made unique by mutagenesis of sites at other locations in the MuV genome or the plasmid vector. (b) Restriction sites introduced into the final clone by in vitro mutagenesis. Additional Sma I, Avr II, Bsr GI and Xho I restriction sites in the MuV JL2 sequence (c) were removed by in vitro mutagenesis. A Sap I site and two Fsp I sites were removed from the vector sequence by in vitro mutagenesis or deletion to render sites in the MuV JL2 sequence unique in the final clone. Restriction-enzyme names are abbreviated for clarity. Details of their position in the MuV JL2 sequence are available on request. The asterisks indicate that these sites are unique in the plasmid <t>DNA</t> which is methylated, as there are two sites at 11408–11413 and 11608–11613 that are also cleavable with Stu I and Nru I, respectively, in unmethylated plasmid DNA.
    Reverse Transcriptase Superscript Iii, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 84/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/reverse transcriptase superscript iii/product/New England Biolabs
    Average 84 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    reverse transcriptase superscript iii - by Bioz Stars, 2020-04
    84/100 stars
      Buy from Supplier

    Image Search Results


    Molecular clone of MuV JL2 , indicating gene boundaries and restriction sites in pMuV JL2 . The bar shows the antigenome of pMuV JL2 and the locations of viral genes (not to scale). Arrows beneath the bar indicate the location of unique restriction sites suitable for ligation-independent cloning using exonuclease III in pMuV JL2 . The vector sequence flanking the antigenome contains a Not I site upstream of a T7 RNA polymerase promoter located 5′ to the antigenome (i.e. to the left of N) and a Kas I site downstream of the antigenome 3′ terminus (i.e. to the right of L) which is internal to the hepatitis delta ribozyme (these restriction sites are shown in bold). (a) Restriction sites present in the consensus MuV JL2 sequence – these were either already unique in the consensus MuV JL2 sequence or made unique by mutagenesis of sites at other locations in the MuV genome or the plasmid vector. (b) Restriction sites introduced into the final clone by in vitro mutagenesis. Additional Sma I, Avr II, Bsr GI and Xho I restriction sites in the MuV JL2 sequence (c) were removed by in vitro mutagenesis. A Sap I site and two Fsp I sites were removed from the vector sequence by in vitro mutagenesis or deletion to render sites in the MuV JL2 sequence unique in the final clone. Restriction-enzyme names are abbreviated for clarity. Details of their position in the MuV JL2 sequence are available on request. The asterisks indicate that these sites are unique in the plasmid DNA which is methylated, as there are two sites at 11408–11413 and 11608–11613 that are also cleavable with Stu I and Nru I, respectively, in unmethylated plasmid DNA.

    Journal: The Journal of General Virology

    Article Title: Molecular differences between two Jeryl Lynn mumps virus vaccine component strains, JL5 and JL2

    doi: 10.1099/vir.0.013946-0

    Figure Lengend Snippet: Molecular clone of MuV JL2 , indicating gene boundaries and restriction sites in pMuV JL2 . The bar shows the antigenome of pMuV JL2 and the locations of viral genes (not to scale). Arrows beneath the bar indicate the location of unique restriction sites suitable for ligation-independent cloning using exonuclease III in pMuV JL2 . The vector sequence flanking the antigenome contains a Not I site upstream of a T7 RNA polymerase promoter located 5′ to the antigenome (i.e. to the left of N) and a Kas I site downstream of the antigenome 3′ terminus (i.e. to the right of L) which is internal to the hepatitis delta ribozyme (these restriction sites are shown in bold). (a) Restriction sites present in the consensus MuV JL2 sequence – these were either already unique in the consensus MuV JL2 sequence or made unique by mutagenesis of sites at other locations in the MuV genome or the plasmid vector. (b) Restriction sites introduced into the final clone by in vitro mutagenesis. Additional Sma I, Avr II, Bsr GI and Xho I restriction sites in the MuV JL2 sequence (c) were removed by in vitro mutagenesis. A Sap I site and two Fsp I sites were removed from the vector sequence by in vitro mutagenesis or deletion to render sites in the MuV JL2 sequence unique in the final clone. Restriction-enzyme names are abbreviated for clarity. Details of their position in the MuV JL2 sequence are available on request. The asterisks indicate that these sites are unique in the plasmid DNA which is methylated, as there are two sites at 11408–11413 and 11608–11613 that are also cleavable with Stu I and Nru I, respectively, in unmethylated plasmid DNA.

    Article Snippet: Restriction enzymes, reverse transcriptase SuperScript III, high-fidelity Taq DNA polymerase, Pfu polymerase, Phusion DNA polymerase, Klenow fragment of DNA polymerase, exonuclease III and DNA ligase were obtained from New England Biolabs (NEB) or Invitrogen and used according to the manufacturers' instructions.

    Techniques: Ligation, Clone Assay, Plasmid Preparation, Sequencing, Mutagenesis, In Vitro, Methylation