superscript iii reverse transcriptase kit  (Toyobo)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    Toyobo superscript iii reverse transcriptase kit
    Sequence analysis and phenotypic observation of OsGPAT3 clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9)-induced mutants and allelic mutants. Gene structure of OsGPAT3 and mutation analysis of OsGPAT3 gene in transgenic plants and allelic mutants ( A ). The sequence (5′–CTAGTACTCGACGTCGAAGGCGG–3′) located in the first exon of the OsGPAT3 gene was selected as the target site of single guide <t>RNA</t> (sgRNA). The black boxes indicate the exons. The blue characters indicate the protospacer adjacent motif (PAM). The red characters indicate the <t>three</t> different types of mutation events generated by CRISPR/Cas9 in the mutants. Phenotypic comparison of the WT and mutant anthers at stage 13; the lemma and paleae were removed for clarity ( B ). Compressed anthers of wild type Zh8015 ( C ) and the mutants ( D : gc-1 , E : gc-2 , F : gc-3 , G : gpat3-3 , H : gpat3-4 ) after I 2 /KI staining. Detection of DNA fragmentation in wild-type ( I ) and mutant ( J : gpat3-3 , K : gpat3-4 , L : gc-1 , M : gc-2 , N : gc-3 ) anthers using a TUNEL assay at the dehiscence stage (stage 13). White arrows indicate TUNEL-positive signals detected in the tapetum cells of wild-type and gpat3-2 anthers, while blue arrows indicate TUNEL-positive signal observed in the outer cell layers (including the epidermis, endothecium, and middle layer), and vascular bundle cells. The qPCR analysis of OsGPAT3 in wild-type, CRISPR/Cas9-induced mutants, and allelic mutants ( O ). Ad, anther dehiscence; DMsp, degenerated microspore; Mp, mature pollen; T, tapetum. Scale bars = 2 mm in ( B ), 500 μm in ( C – H ), and 50 μm in ( I – N ). ** indicates significant differences at p
    Superscript Iii Reverse Transcriptase Kit, supplied by Toyobo, used in various techniques. Bioz Stars score: 94/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript iii reverse transcriptase kit/product/Toyobo
    Average 94 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    superscript iii reverse transcriptase kit - by Bioz Stars, 2020-04
    94/100 stars

    Images

    1) Product Images from "OsGPAT3 Plays a Critical Role in Anther Wall Programmed Cell Death and Pollen Development in Rice"

    Article Title: OsGPAT3 Plays a Critical Role in Anther Wall Programmed Cell Death and Pollen Development in Rice

    Journal: International Journal of Molecular Sciences

    doi: 10.3390/ijms19124017

    Sequence analysis and phenotypic observation of OsGPAT3 clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9)-induced mutants and allelic mutants. Gene structure of OsGPAT3 and mutation analysis of OsGPAT3 gene in transgenic plants and allelic mutants ( A ). The sequence (5′–CTAGTACTCGACGTCGAAGGCGG–3′) located in the first exon of the OsGPAT3 gene was selected as the target site of single guide RNA (sgRNA). The black boxes indicate the exons. The blue characters indicate the protospacer adjacent motif (PAM). The red characters indicate the three different types of mutation events generated by CRISPR/Cas9 in the mutants. Phenotypic comparison of the WT and mutant anthers at stage 13; the lemma and paleae were removed for clarity ( B ). Compressed anthers of wild type Zh8015 ( C ) and the mutants ( D : gc-1 , E : gc-2 , F : gc-3 , G : gpat3-3 , H : gpat3-4 ) after I 2 /KI staining. Detection of DNA fragmentation in wild-type ( I ) and mutant ( J : gpat3-3 , K : gpat3-4 , L : gc-1 , M : gc-2 , N : gc-3 ) anthers using a TUNEL assay at the dehiscence stage (stage 13). White arrows indicate TUNEL-positive signals detected in the tapetum cells of wild-type and gpat3-2 anthers, while blue arrows indicate TUNEL-positive signal observed in the outer cell layers (including the epidermis, endothecium, and middle layer), and vascular bundle cells. The qPCR analysis of OsGPAT3 in wild-type, CRISPR/Cas9-induced mutants, and allelic mutants ( O ). Ad, anther dehiscence; DMsp, degenerated microspore; Mp, mature pollen; T, tapetum. Scale bars = 2 mm in ( B ), 500 μm in ( C – H ), and 50 μm in ( I – N ). ** indicates significant differences at p
    Figure Legend Snippet: Sequence analysis and phenotypic observation of OsGPAT3 clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9)-induced mutants and allelic mutants. Gene structure of OsGPAT3 and mutation analysis of OsGPAT3 gene in transgenic plants and allelic mutants ( A ). The sequence (5′–CTAGTACTCGACGTCGAAGGCGG–3′) located in the first exon of the OsGPAT3 gene was selected as the target site of single guide RNA (sgRNA). The black boxes indicate the exons. The blue characters indicate the protospacer adjacent motif (PAM). The red characters indicate the three different types of mutation events generated by CRISPR/Cas9 in the mutants. Phenotypic comparison of the WT and mutant anthers at stage 13; the lemma and paleae were removed for clarity ( B ). Compressed anthers of wild type Zh8015 ( C ) and the mutants ( D : gc-1 , E : gc-2 , F : gc-3 , G : gpat3-3 , H : gpat3-4 ) after I 2 /KI staining. Detection of DNA fragmentation in wild-type ( I ) and mutant ( J : gpat3-3 , K : gpat3-4 , L : gc-1 , M : gc-2 , N : gc-3 ) anthers using a TUNEL assay at the dehiscence stage (stage 13). White arrows indicate TUNEL-positive signals detected in the tapetum cells of wild-type and gpat3-2 anthers, while blue arrows indicate TUNEL-positive signal observed in the outer cell layers (including the epidermis, endothecium, and middle layer), and vascular bundle cells. The qPCR analysis of OsGPAT3 in wild-type, CRISPR/Cas9-induced mutants, and allelic mutants ( O ). Ad, anther dehiscence; DMsp, degenerated microspore; Mp, mature pollen; T, tapetum. Scale bars = 2 mm in ( B ), 500 μm in ( C – H ), and 50 μm in ( I – N ). ** indicates significant differences at p

    Techniques Used: Sequencing, CRISPR, Mutagenesis, Transgenic Assay, Generated, Staining, TUNEL Assay, Real-time Polymerase Chain Reaction

    2) Product Images from "OsGPAT3 Plays a Critical Role in Anther Wall Programmed Cell Death and Pollen Development in Rice"

    Article Title: OsGPAT3 Plays a Critical Role in Anther Wall Programmed Cell Death and Pollen Development in Rice

    Journal: International Journal of Molecular Sciences

    doi: 10.3390/ijms19124017

    Sequence analysis and phenotypic observation of OsGPAT3 clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9)-induced mutants and allelic mutants. Gene structure of OsGPAT3 and mutation analysis of OsGPAT3 gene in transgenic plants and allelic mutants ( A ). The sequence (5′–CTAGTACTCGACGTCGAAGGCGG–3′) located in the first exon of the OsGPAT3 gene was selected as the target site of single guide RNA (sgRNA). The black boxes indicate the exons. The blue characters indicate the protospacer adjacent motif (PAM). The red characters indicate the three different types of mutation events generated by CRISPR/Cas9 in the mutants. Phenotypic comparison of the WT and mutant anthers at stage 13; the lemma and paleae were removed for clarity ( B ). Compressed anthers of wild type Zh8015 ( C ) and the mutants ( D : gc-1 , E : gc-2 , F : gc-3 , G : gpat3-3 , H : gpat3-4 ) after I 2 /KI staining. Detection of DNA fragmentation in wild-type ( I ) and mutant ( J : gpat3-3 , K : gpat3-4 , L : gc-1 , M : gc-2 , N : gc-3 ) anthers using a TUNEL assay at the dehiscence stage (stage 13). White arrows indicate TUNEL-positive signals detected in the tapetum cells of wild-type and gpat3-2 anthers, while blue arrows indicate TUNEL-positive signal observed in the outer cell layers (including the epidermis, endothecium, and middle layer), and vascular bundle cells. The qPCR analysis of OsGPAT3 in wild-type, CRISPR/Cas9-induced mutants, and allelic mutants ( O ). Ad, anther dehiscence; DMsp, degenerated microspore; Mp, mature pollen; T, tapetum. Scale bars = 2 mm in ( B ), 500 μm in ( C – H ), and 50 μm in ( I – N ). ** indicates significant differences at p
    Figure Legend Snippet: Sequence analysis and phenotypic observation of OsGPAT3 clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9)-induced mutants and allelic mutants. Gene structure of OsGPAT3 and mutation analysis of OsGPAT3 gene in transgenic plants and allelic mutants ( A ). The sequence (5′–CTAGTACTCGACGTCGAAGGCGG–3′) located in the first exon of the OsGPAT3 gene was selected as the target site of single guide RNA (sgRNA). The black boxes indicate the exons. The blue characters indicate the protospacer adjacent motif (PAM). The red characters indicate the three different types of mutation events generated by CRISPR/Cas9 in the mutants. Phenotypic comparison of the WT and mutant anthers at stage 13; the lemma and paleae were removed for clarity ( B ). Compressed anthers of wild type Zh8015 ( C ) and the mutants ( D : gc-1 , E : gc-2 , F : gc-3 , G : gpat3-3 , H : gpat3-4 ) after I 2 /KI staining. Detection of DNA fragmentation in wild-type ( I ) and mutant ( J : gpat3-3 , K : gpat3-4 , L : gc-1 , M : gc-2 , N : gc-3 ) anthers using a TUNEL assay at the dehiscence stage (stage 13). White arrows indicate TUNEL-positive signals detected in the tapetum cells of wild-type and gpat3-2 anthers, while blue arrows indicate TUNEL-positive signal observed in the outer cell layers (including the epidermis, endothecium, and middle layer), and vascular bundle cells. The qPCR analysis of OsGPAT3 in wild-type, CRISPR/Cas9-induced mutants, and allelic mutants ( O ). Ad, anther dehiscence; DMsp, degenerated microspore; Mp, mature pollen; T, tapetum. Scale bars = 2 mm in ( B ), 500 μm in ( C – H ), and 50 μm in ( I – N ). ** indicates significant differences at p

    Techniques Used: Sequencing, CRISPR, Mutagenesis, Transgenic Assay, Generated, Staining, TUNEL Assay, Real-time Polymerase Chain Reaction

    Related Articles

    Real-time Polymerase Chain Reaction:

    Article Title: OsGPAT3 Plays a Critical Role in Anther Wall Programmed Cell Death and Pollen Development in Rice
    Article Snippet: Paragraph title: 4.7. RNA Extraction, First-Strand Synthesis, and qPCR Analysis ... RNA was then reverse-transcribed (RT) from DNase I-treated RNA using Oligo-dT (18) primers in a 20-µL reaction using a SuperScript III Reverse Transcriptase Kit (TOYOBO, Japan).

    Mutagenesis:

    Article Title: OsGPAT3 Plays a Critical Role in Anther Wall Programmed Cell Death and Pollen Development in Rice
    Article Snippet: RNA Extraction, First-Strand Synthesis, and qPCR Analysis Rice anthers at different developmental stages of the gpat3-2 mutant and wild-type plants were collected for qPCR analysis of gene expression levels. .. RNA was then reverse-transcribed (RT) from DNase I-treated RNA using Oligo-dT (18) primers in a 20-µL reaction using a SuperScript III Reverse Transcriptase Kit (TOYOBO, Japan).

    RNA Extraction:

    Article Title: OsGPAT3 Plays a Critical Role in Anther Wall Programmed Cell Death and Pollen Development in Rice
    Article Snippet: Paragraph title: 4.7. RNA Extraction, First-Strand Synthesis, and qPCR Analysis ... RNA was then reverse-transcribed (RT) from DNase I-treated RNA using Oligo-dT (18) primers in a 20-µL reaction using a SuperScript III Reverse Transcriptase Kit (TOYOBO, Japan).

    Expressing:

    Article Title: OsGPAT3 Plays a Critical Role in Anther Wall Programmed Cell Death and Pollen Development in Rice
    Article Snippet: RNA Extraction, First-Strand Synthesis, and qPCR Analysis Rice anthers at different developmental stages of the gpat3-2 mutant and wild-type plants were collected for qPCR analysis of gene expression levels. .. RNA was then reverse-transcribed (RT) from DNase I-treated RNA using Oligo-dT (18) primers in a 20-µL reaction using a SuperScript III Reverse Transcriptase Kit (TOYOBO, Japan).

    Polymerase Chain Reaction:

    Article Title: OsGPAT3 Plays a Critical Role in Anther Wall Programmed Cell Death and Pollen Development in Rice
    Article Snippet: RNA was then reverse-transcribed (RT) from DNase I-treated RNA using Oligo-dT (18) primers in a 20-µL reaction using a SuperScript III Reverse Transcriptase Kit (TOYOBO, Japan). .. For qPCR, first-strand complementary DNA (cDNA) was diluted three times and then 3 µL of the RT products were used as the template of every PCR reaction using SYBR Premix Ex Taq II (TaKaRa) according to the manufacturer’s instructions.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Toyobo superscript iii reverse transcriptase kit
    Sequence analysis and phenotypic observation of OsGPAT3 clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9)-induced mutants and allelic mutants. Gene structure of OsGPAT3 and mutation analysis of OsGPAT3 gene in transgenic plants and allelic mutants ( A ). The sequence (5′–CTAGTACTCGACGTCGAAGGCGG–3′) located in the first exon of the OsGPAT3 gene was selected as the target site of single guide <t>RNA</t> (sgRNA). The black boxes indicate the exons. The blue characters indicate the protospacer adjacent motif (PAM). The red characters indicate the <t>three</t> different types of mutation events generated by CRISPR/Cas9 in the mutants. Phenotypic comparison of the WT and mutant anthers at stage 13; the lemma and paleae were removed for clarity ( B ). Compressed anthers of wild type Zh8015 ( C ) and the mutants ( D : gc-1 , E : gc-2 , F : gc-3 , G : gpat3-3 , H : gpat3-4 ) after I 2 /KI staining. Detection of DNA fragmentation in wild-type ( I ) and mutant ( J : gpat3-3 , K : gpat3-4 , L : gc-1 , M : gc-2 , N : gc-3 ) anthers using a TUNEL assay at the dehiscence stage (stage 13). White arrows indicate TUNEL-positive signals detected in the tapetum cells of wild-type and gpat3-2 anthers, while blue arrows indicate TUNEL-positive signal observed in the outer cell layers (including the epidermis, endothecium, and middle layer), and vascular bundle cells. The qPCR analysis of OsGPAT3 in wild-type, CRISPR/Cas9-induced mutants, and allelic mutants ( O ). Ad, anther dehiscence; DMsp, degenerated microspore; Mp, mature pollen; T, tapetum. Scale bars = 2 mm in ( B ), 500 μm in ( C – H ), and 50 μm in ( I – N ). ** indicates significant differences at p
    Superscript Iii Reverse Transcriptase Kit, supplied by Toyobo, used in various techniques. Bioz Stars score: 94/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript iii reverse transcriptase kit/product/Toyobo
    Average 94 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    superscript iii reverse transcriptase kit - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    Image Search Results


    Sequence analysis and phenotypic observation of OsGPAT3 clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9)-induced mutants and allelic mutants. Gene structure of OsGPAT3 and mutation analysis of OsGPAT3 gene in transgenic plants and allelic mutants ( A ). The sequence (5′–CTAGTACTCGACGTCGAAGGCGG–3′) located in the first exon of the OsGPAT3 gene was selected as the target site of single guide RNA (sgRNA). The black boxes indicate the exons. The blue characters indicate the protospacer adjacent motif (PAM). The red characters indicate the three different types of mutation events generated by CRISPR/Cas9 in the mutants. Phenotypic comparison of the WT and mutant anthers at stage 13; the lemma and paleae were removed for clarity ( B ). Compressed anthers of wild type Zh8015 ( C ) and the mutants ( D : gc-1 , E : gc-2 , F : gc-3 , G : gpat3-3 , H : gpat3-4 ) after I 2 /KI staining. Detection of DNA fragmentation in wild-type ( I ) and mutant ( J : gpat3-3 , K : gpat3-4 , L : gc-1 , M : gc-2 , N : gc-3 ) anthers using a TUNEL assay at the dehiscence stage (stage 13). White arrows indicate TUNEL-positive signals detected in the tapetum cells of wild-type and gpat3-2 anthers, while blue arrows indicate TUNEL-positive signal observed in the outer cell layers (including the epidermis, endothecium, and middle layer), and vascular bundle cells. The qPCR analysis of OsGPAT3 in wild-type, CRISPR/Cas9-induced mutants, and allelic mutants ( O ). Ad, anther dehiscence; DMsp, degenerated microspore; Mp, mature pollen; T, tapetum. Scale bars = 2 mm in ( B ), 500 μm in ( C – H ), and 50 μm in ( I – N ). ** indicates significant differences at p

    Journal: International Journal of Molecular Sciences

    Article Title: OsGPAT3 Plays a Critical Role in Anther Wall Programmed Cell Death and Pollen Development in Rice

    doi: 10.3390/ijms19124017

    Figure Lengend Snippet: Sequence analysis and phenotypic observation of OsGPAT3 clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9)-induced mutants and allelic mutants. Gene structure of OsGPAT3 and mutation analysis of OsGPAT3 gene in transgenic plants and allelic mutants ( A ). The sequence (5′–CTAGTACTCGACGTCGAAGGCGG–3′) located in the first exon of the OsGPAT3 gene was selected as the target site of single guide RNA (sgRNA). The black boxes indicate the exons. The blue characters indicate the protospacer adjacent motif (PAM). The red characters indicate the three different types of mutation events generated by CRISPR/Cas9 in the mutants. Phenotypic comparison of the WT and mutant anthers at stage 13; the lemma and paleae were removed for clarity ( B ). Compressed anthers of wild type Zh8015 ( C ) and the mutants ( D : gc-1 , E : gc-2 , F : gc-3 , G : gpat3-3 , H : gpat3-4 ) after I 2 /KI staining. Detection of DNA fragmentation in wild-type ( I ) and mutant ( J : gpat3-3 , K : gpat3-4 , L : gc-1 , M : gc-2 , N : gc-3 ) anthers using a TUNEL assay at the dehiscence stage (stage 13). White arrows indicate TUNEL-positive signals detected in the tapetum cells of wild-type and gpat3-2 anthers, while blue arrows indicate TUNEL-positive signal observed in the outer cell layers (including the epidermis, endothecium, and middle layer), and vascular bundle cells. The qPCR analysis of OsGPAT3 in wild-type, CRISPR/Cas9-induced mutants, and allelic mutants ( O ). Ad, anther dehiscence; DMsp, degenerated microspore; Mp, mature pollen; T, tapetum. Scale bars = 2 mm in ( B ), 500 μm in ( C – H ), and 50 μm in ( I – N ). ** indicates significant differences at p

    Article Snippet: RNA was then reverse-transcribed (RT) from DNase I-treated RNA using Oligo-dT (18) primers in a 20-µL reaction using a SuperScript III Reverse Transcriptase Kit (TOYOBO, Japan).

    Techniques: Sequencing, CRISPR, Mutagenesis, Transgenic Assay, Generated, Staining, TUNEL Assay, Real-time Polymerase Chain Reaction

    Sequence analysis and phenotypic observation of OsGPAT3 clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9)-induced mutants and allelic mutants. Gene structure of OsGPAT3 and mutation analysis of OsGPAT3 gene in transgenic plants and allelic mutants ( A ). The sequence (5′–CTAGTACTCGACGTCGAAGGCGG–3′) located in the first exon of the OsGPAT3 gene was selected as the target site of single guide RNA (sgRNA). The black boxes indicate the exons. The blue characters indicate the protospacer adjacent motif (PAM). The red characters indicate the three different types of mutation events generated by CRISPR/Cas9 in the mutants. Phenotypic comparison of the WT and mutant anthers at stage 13; the lemma and paleae were removed for clarity ( B ). Compressed anthers of wild type Zh8015 ( C ) and the mutants ( D : gc-1 , E : gc-2 , F : gc-3 , G : gpat3-3 , H : gpat3-4 ) after I 2 /KI staining. Detection of DNA fragmentation in wild-type ( I ) and mutant ( J : gpat3-3 , K : gpat3-4 , L : gc-1 , M : gc-2 , N : gc-3 ) anthers using a TUNEL assay at the dehiscence stage (stage 13). White arrows indicate TUNEL-positive signals detected in the tapetum cells of wild-type and gpat3-2 anthers, while blue arrows indicate TUNEL-positive signal observed in the outer cell layers (including the epidermis, endothecium, and middle layer), and vascular bundle cells. The qPCR analysis of OsGPAT3 in wild-type, CRISPR/Cas9-induced mutants, and allelic mutants ( O ). Ad, anther dehiscence; DMsp, degenerated microspore; Mp, mature pollen; T, tapetum. Scale bars = 2 mm in ( B ), 500 μm in ( C – H ), and 50 μm in ( I – N ). ** indicates significant differences at p

    Journal: International Journal of Molecular Sciences

    Article Title: OsGPAT3 Plays a Critical Role in Anther Wall Programmed Cell Death and Pollen Development in Rice

    doi: 10.3390/ijms19124017

    Figure Lengend Snippet: Sequence analysis and phenotypic observation of OsGPAT3 clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9)-induced mutants and allelic mutants. Gene structure of OsGPAT3 and mutation analysis of OsGPAT3 gene in transgenic plants and allelic mutants ( A ). The sequence (5′–CTAGTACTCGACGTCGAAGGCGG–3′) located in the first exon of the OsGPAT3 gene was selected as the target site of single guide RNA (sgRNA). The black boxes indicate the exons. The blue characters indicate the protospacer adjacent motif (PAM). The red characters indicate the three different types of mutation events generated by CRISPR/Cas9 in the mutants. Phenotypic comparison of the WT and mutant anthers at stage 13; the lemma and paleae were removed for clarity ( B ). Compressed anthers of wild type Zh8015 ( C ) and the mutants ( D : gc-1 , E : gc-2 , F : gc-3 , G : gpat3-3 , H : gpat3-4 ) after I 2 /KI staining. Detection of DNA fragmentation in wild-type ( I ) and mutant ( J : gpat3-3 , K : gpat3-4 , L : gc-1 , M : gc-2 , N : gc-3 ) anthers using a TUNEL assay at the dehiscence stage (stage 13). White arrows indicate TUNEL-positive signals detected in the tapetum cells of wild-type and gpat3-2 anthers, while blue arrows indicate TUNEL-positive signal observed in the outer cell layers (including the epidermis, endothecium, and middle layer), and vascular bundle cells. The qPCR analysis of OsGPAT3 in wild-type, CRISPR/Cas9-induced mutants, and allelic mutants ( O ). Ad, anther dehiscence; DMsp, degenerated microspore; Mp, mature pollen; T, tapetum. Scale bars = 2 mm in ( B ), 500 μm in ( C – H ), and 50 μm in ( I – N ). ** indicates significant differences at p

    Article Snippet: RNA was then reverse-transcribed (RT) from DNase I-treated RNA using Oligo-dT (18) primers in a 20-µL reaction using a SuperScript III Reverse Transcriptase Kit (TOYOBO, Japan).

    Techniques: Sequencing, CRISPR, Mutagenesis, Transgenic Assay, Generated, Staining, TUNEL Assay, Real-time Polymerase Chain Reaction