superscript iii reverse transcriptase enzyme kit  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    SuperScript III Reverse Transcriptase
    Description:
    Invitrogen SuperScript III Reverse Transcriptase is a genetically engineered MMLV reverse transcriptase RT that was created by introduction of several mutations for reduced RNase H activity increased half life and improved thermal stability SuperScript III RT offers higher cDNA yields improved cDNA lengths improved efficiency on GC rich target RNAs and overall better performance than wild type MMLV and MMLV RNase H minus enzymes SuperScript RTs are the most highly trusted and widely used RTs with over 50 000 citations reviews and publications to date Note The latest member of the SuperScript RT family SuperScript IV Reverse Transcriptase features enhanced thermostability processivity yields and performance with any RNA samples including those of suboptimal purity or integrity
    Catalog Number:
    18080044
    Price:
    None
    Applications:
    PCR & Real-Time PCR|Reverse Transcription
    Category:
    Proteins Enzymes Peptides
    Buy from Supplier


    Structured Review

    Thermo Fisher superscript iii reverse transcriptase enzyme kit
    Invitrogen SuperScript III Reverse Transcriptase is a genetically engineered MMLV reverse transcriptase RT that was created by introduction of several mutations for reduced RNase H activity increased half life and improved thermal stability SuperScript III RT offers higher cDNA yields improved cDNA lengths improved efficiency on GC rich target RNAs and overall better performance than wild type MMLV and MMLV RNase H minus enzymes SuperScript RTs are the most highly trusted and widely used RTs with over 50 000 citations reviews and publications to date Note The latest member of the SuperScript RT family SuperScript IV Reverse Transcriptase features enhanced thermostability processivity yields and performance with any RNA samples including those of suboptimal purity or integrity
    https://www.bioz.com/result/superscript iii reverse transcriptase enzyme kit/product/Thermo Fisher
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    superscript iii reverse transcriptase enzyme kit - by Bioz Stars, 2020-04
    99/100 stars

    Related Products / Commonly Used Together

    cdna
    first-strand cdna
    supernatant rna
    rna
    total rna

    Images

    Related Articles

    Clone Assay:

    Article Title: HNF4? and NF-E2 are key transcriptional regulators of the murine Abcc6 gene expression
    Article Snippet: Paragraph title: Cloning of the Hnf1 α, Hnf4 α, p45-Nf-E2 and Sp1 cDNAs ... Total RNA isolated (1μg) from mouse liver was reversely transcribed with the Superscript III reverse transcriptase kit primed with Oligo(dT) (Invitrogen). cDNAs were then PCR-amplified with the specific primers (see ), using the PCR Platinum Supermix (Invitrogen).

    Article Title: Spliceozymes: Ribozymes that Remove Introns from Pre-mRNAs in Trans
    Article Snippet: In reaction volumes of 20 µL, RNA from the in vitro reaction containing 2 pmol CAT pre-mRNA and 20 pmol spliceozyme, or 3.2 µg of total RNA were incubated with 200 units of Superscript III reverse transcriptase (Invitrogen), for 60 minutes at 55°C, using the primer 5′-ccgtaacacgccacatc-3′ complementary to the CAT 3′ exon. .. The products were cloned into plasmid pUC19b and 10 clones were sequenced for each reaction.

    Amplification:

    Article Title: Expansion of the human ?-opioid receptor gene architecture: novel functional variants
    Article Snippet: .. The cDNAs were synthesized using 2–5 µg of total RNA with either cDNA Archive reverse transcription kit (ABI) or Superscript III reverse transcription kit (Invitrogen, Carlsbad, CA, USA), using random primer. cDNA samples were amplified using the GeneAmp XL (rTth DNA polymerase) PCR kit (ABI). .. The sequences of the human and mouse primers and amplification conditions are listed in the Supplementary Material, Table S4 .

    Article Title: A Reverse Genetics System for Zika Virus Based on a Simple Molecular Cloning Strategy
    Article Snippet: .. Viral RNA was isolated from cell lysates using the NucleoSpin RNA II kit (Machery-Nagel, Düren, Germany) and reverse transcribed using SuperScript III RT (Thermo Fisher Scientific Waltham, MA, USA). cDNA was amplified by PCR and amplicons were sequenced by Sanger sequencing (GATC Biotech, Constance, Germany) using primers spanning the complete ZIKV genome. .. Sequences of the 5′ and 3′UTRs were obtained by the rapid amplification of cDNA ends (RACE) using the 5′/3′ RACE second generation kit (Roche, Basel, Switzerland) with a polyA-tail added to the cDNA prior to the 3′ RACE reaction by using the poly(A) polymerase (New England Biolabs, Ipswich, MA, USA).

    Article Title: Revolver is a New Class of Transposon-like Gene Composing the Triticeae Genome
    Article Snippet: The primers for amplification of Revolver cDNA were designed from both ends of a positive cDNA clone. .. The single-strand cDNAs were synthesized from CapFishingTM adapter-added total RNA by SuperScript III reverse transcriptase (Invitrogen) using an oligo(dT) primer extended with 23 bp of 3′ Revolver sequence (5′-TTTTTTTTTTTTTTGGCACAACTCATGTAAAAGAGGG-3′).

    Article Title: Spliceozymes: Ribozymes that Remove Introns from Pre-mRNAs in Trans
    Article Snippet: In reaction volumes of 20 µL, RNA from the in vitro reaction containing 2 pmol CAT pre-mRNA and 20 pmol spliceozyme, or 3.2 µg of total RNA were incubated with 200 units of Superscript III reverse transcriptase (Invitrogen), for 60 minutes at 55°C, using the primer 5′-ccgtaacacgccacatc-3′ complementary to the CAT 3′ exon. .. DNA sequences were amplified by PCR with primers 5′-cggcctttattcacattct-3′ and 5′-gtgtagaaactgccggaa-3′.

    Article Title: Identification of RNA silencing components in soybean and sorghum
    Article Snippet: After treatment with DNase I, 5 μg RNA was reverse transcribed (RT) by the Superscript III reverse transcriptase (Invitrogen) using an oligo-T18 primer to generate cDNAs at 50°C for 1 hour. .. The resulting cDNAs was used as templates to perform PCR amplification with primers listed in Additional file : Table S3.

    Article Title: Lysophosphatidic acid via LPA-receptor 5/protein kinase D-dependent pathways induces a motile and pro-inflammatory microglial phenotype
    Article Snippet: RNA was reverse-transcribed using the SuperScript® III reverse transcription kit (Invitrogen, Waltham, MA, USA). qPCR was performed on an Applied Biosystems 7900HT Fast Real-Time PCR System using the QuantiTect SYBR® Green PCR kit (Qiagen, Hilden, Germany). .. Amplification of murine hypoxanthine-guanine phosphoribosyltransferase (HPRT) was performed on all samples as internal control for variations in messenger RNA (mRNA) concentration.

    Synthesized:

    Article Title: Expansion of the human ?-opioid receptor gene architecture: novel functional variants
    Article Snippet: .. The cDNAs were synthesized using 2–5 µg of total RNA with either cDNA Archive reverse transcription kit (ABI) or Superscript III reverse transcription kit (Invitrogen, Carlsbad, CA, USA), using random primer. cDNA samples were amplified using the GeneAmp XL (rTth DNA polymerase) PCR kit (ABI). .. The sequences of the human and mouse primers and amplification conditions are listed in the Supplementary Material, Table S4 .

    Article Title: Revolver is a New Class of Transposon-like Gene Composing the Triticeae Genome
    Article Snippet: .. The single-strand cDNAs were synthesized from CapFishingTM adapter-added total RNA by SuperScript III reverse transcriptase (Invitrogen) using an oligo(dT) primer extended with 23 bp of 3′ Revolver sequence (5′-TTTTTTTTTTTTTTGGCACAACTCATGTAAAAGAGGG-3′). ..

    TA Cloning:

    Article Title: HNF4? and NF-E2 are key transcriptional regulators of the murine Abcc6 gene expression
    Article Snippet: Total RNA isolated (1μg) from mouse liver was reversely transcribed with the Superscript III reverse transcriptase kit primed with Oligo(dT) (Invitrogen). cDNAs were then PCR-amplified with the specific primers (see ), using the PCR Platinum Supermix (Invitrogen). .. Each PCR product was cloned into an expression vector, pTarget (Promega), using TA-cloning.

    Construct:

    Article Title: Transcriptome characterization via 454 pyrosequencing of the annelid Pristina leidyi, an emerging model for studying the evolution of regeneration
    Article Snippet: .. RNA was extracted using TRIReagent (Applied Biosystems), and cDNA was constructed using random oligos and Superscript III reverse transcriptase (Invitrogen). .. Primers were constructed against the large subunit of rubisco (rbcL ) [GenBank:AY147205.1] and c-phycocyanin (cpc ) [GenBank:AF164139.1] genes of A. platensis (Additional file ).

    Real-time Polymerase Chain Reaction:

    Article Title: CXCR3 modulates glial accumulation and activation in cuprizone-induced demyelination of the central nervous system
    Article Snippet: Paragraph title: Cytokine and chemokine mRNA determination by quantitative real-time polymerase chain reaction ... Up to 3 μg of total RNA was reverse-transcribed into cDNA by using SuperScript III Reverse Transcriptase (Invitrogen).

    Article Title: RNA sequencing analysis reveals quiescent microglia isolation methods from postnatal mouse brains and limitations of BV2 cells
    Article Snippet: .. Quantitative real-time PCR RNA was reverse-transcribed into cDNA using Superscript III Reverse Transcriptase (Invitrogen) with random hexamer primers. .. Transcript abundance was determined by quantitative PCR using SYBR Green PCR Mix (Applied Biosystems) with the following primer pairs: Tspo : GCCTACTTTGTACGTGGCGAG (F), CCTCCCAGCTCTTTCCAGAC (R); Ptgs2 : TTCAACACACTCTATCACTGGC (F), AGAAGCGTTTGCGGTACTCAT (R); Cd86 : TGTTTCCGTGGAGACGCAAG (F), TTGAGCCTTTGTAAATGGGCA (R); Tnfa : CCCTCACACTCAGATCATCTTCT (F), GCTACGACGTGGGCTACAG (R); Il6 : TAGTCCTTCCTACCCCAATTTCC (F), TTGGTCCTTAGCCACTCCTTC (R); Il1b : GCAACTGTTCCTGAACTCAACT (F), ATCTTTTGGGGTCCGTCAACT (R); Tgfb1 : CTCCCGTGGCTTCTAGTGC (F), GCCTTAGTTTGGACAGGATCTG (R); Tgfbr1 : TCTGCATTGCACTTATGCTGA (F), AAAGGGCGATCTAGTGATGGA (R); Tgfbr2 : CCGCTGCATATCGTCCTGTG (F), AGTGGATGGATGGTCCTATTACA (R); Serpine1 : TTCAGCCCTTGCTTGCCTC (F), ACACTTTTACTCCGAAGTCGGT (R); C5a : GAACAAACCTACGTCATTTCAGC (F), GTCAACAGTGCCGCGTTTT (R); C5ar1 : TACCATTAGTGCCGACCGTTT (F), CCGGTACACGAAGGATGGAAT (R); C5ar2 : CTGCTGTCTACCGTAGGCTG (F), AGAGGAATCGAACAGTGGTGA (R); Gapdh : AGGTCGGTGTGAACGGATTTG (F), TGTAGACCATGTAGTTGAGGTCA (R).

    Article Title: The core genome m5C methyltransferase JHP1050 (M.Hpy99III) plays an important role in orchestrating gene expression in Helicobacter pylori
    Article Snippet: .. Quantitative PCR (qPCR) One μg of RNA was used for cDNA synthesis using the SuperScript™ III Reverse Transcriptase (Thermo Fisher Scientific, Darmstadt, Germany) as described before ( ). qPCR was performed with gene specific primers ( ) and SYBR Green Master Mix (Qiagen, Hilden, Germany). .. Reactions were run in a BioRad CFX96 system.

    Article Title: Lysophosphatidic acid via LPA-receptor 5/protein kinase D-dependent pathways induces a motile and pro-inflammatory microglial phenotype
    Article Snippet: .. RNA was reverse-transcribed using the SuperScript® III reverse transcription kit (Invitrogen, Waltham, MA, USA). qPCR was performed on an Applied Biosystems 7900HT Fast Real-Time PCR System using the QuantiTect SYBR® Green PCR kit (Qiagen, Hilden, Germany). .. Amplification of murine hypoxanthine-guanine phosphoribosyltransferase (HPRT) was performed on all samples as internal control for variations in messenger RNA (mRNA) concentration.

    Random Hexamer Labeling:

    Article Title: RNA sequencing analysis reveals quiescent microglia isolation methods from postnatal mouse brains and limitations of BV2 cells
    Article Snippet: .. Quantitative real-time PCR RNA was reverse-transcribed into cDNA using Superscript III Reverse Transcriptase (Invitrogen) with random hexamer primers. .. Transcript abundance was determined by quantitative PCR using SYBR Green PCR Mix (Applied Biosystems) with the following primer pairs: Tspo : GCCTACTTTGTACGTGGCGAG (F), CCTCCCAGCTCTTTCCAGAC (R); Ptgs2 : TTCAACACACTCTATCACTGGC (F), AGAAGCGTTTGCGGTACTCAT (R); Cd86 : TGTTTCCGTGGAGACGCAAG (F), TTGAGCCTTTGTAAATGGGCA (R); Tnfa : CCCTCACACTCAGATCATCTTCT (F), GCTACGACGTGGGCTACAG (R); Il6 : TAGTCCTTCCTACCCCAATTTCC (F), TTGGTCCTTAGCCACTCCTTC (R); Il1b : GCAACTGTTCCTGAACTCAACT (F), ATCTTTTGGGGTCCGTCAACT (R); Tgfb1 : CTCCCGTGGCTTCTAGTGC (F), GCCTTAGTTTGGACAGGATCTG (R); Tgfbr1 : TCTGCATTGCACTTATGCTGA (F), AAAGGGCGATCTAGTGATGGA (R); Tgfbr2 : CCGCTGCATATCGTCCTGTG (F), AGTGGATGGATGGTCCTATTACA (R); Serpine1 : TTCAGCCCTTGCTTGCCTC (F), ACACTTTTACTCCGAAGTCGGT (R); C5a : GAACAAACCTACGTCATTTCAGC (F), GTCAACAGTGCCGCGTTTT (R); C5ar1 : TACCATTAGTGCCGACCGTTT (F), CCGGTACACGAAGGATGGAAT (R); C5ar2 : CTGCTGTCTACCGTAGGCTG (F), AGAGGAATCGAACAGTGGTGA (R); Gapdh : AGGTCGGTGTGAACGGATTTG (F), TGTAGACCATGTAGTTGAGGTCA (R).

    Expressing:

    Article Title: CXCR3 modulates glial accumulation and activation in cuprizone-induced demyelination of the central nervous system
    Article Snippet: Up to 3 μg of total RNA was reverse-transcribed into cDNA by using SuperScript III Reverse Transcriptase (Invitrogen). .. Real-time quantitative PCR assays were performed on a StepOnePlus Real-Time PCR System (Applied Biosystems) using TaqMan™ Gene Expression Assays (Applied Biosystems) for Gapdh, Plp1 , Mbp , Cnp , Cxcl9 , Cxcl10 , Tnf , Il6 , Ifng , Ccl2 , Ccl3 , Ccl5 .

    Article Title: HNF4? and NF-E2 are key transcriptional regulators of the murine Abcc6 gene expression
    Article Snippet: Total RNA isolated (1μg) from mouse liver was reversely transcribed with the Superscript III reverse transcriptase kit primed with Oligo(dT) (Invitrogen). cDNAs were then PCR-amplified with the specific primers (see ), using the PCR Platinum Supermix (Invitrogen). .. Each PCR product was cloned into an expression vector, pTarget (Promega), using TA-cloning.

    Article Title: Allelic methylation levels of the noncoding VTRNA2-1 located on chromosome 5q31.1 predict outcome in AML
    Article Snippet: RNA was RT using SuperScript III Reverse Transcriptase (Invitrogen) and random hexamers (Promega). .. RT-quantitative PCR for miR886-3p and -5p was performed using TaqMan MicroRNA assays (Applied Biosystems), vtRNA2-1 expression was analyzed using TaqMan probes (Applied Biosystems).

    Article Title: Lysophosphatidic acid via LPA-receptor 5/protein kinase D-dependent pathways induces a motile and pro-inflammatory microglial phenotype
    Article Snippet: RNA was reverse-transcribed using the SuperScript® III reverse transcription kit (Invitrogen, Waltham, MA, USA). qPCR was performed on an Applied Biosystems 7900HT Fast Real-Time PCR System using the QuantiTect SYBR® Green PCR kit (Qiagen, Hilden, Germany). .. Expression profiles and associated statistical parameters were analyzed using the relative expression software tool (REST; http://www.gene-quantification.de/rest-index.html ) using a pairwise re-allocation test.

    Derivative Assay:

    Article Title: Transcriptome characterization via 454 pyrosequencing of the annelid Pristina leidyi, an emerging model for studying the evolution of regeneration
    Article Snippet: Possible contamination by the dried Spirulina food source was assayed via PCR, using cDNA samples derived from live Arthrospira platensis (Spirulina) as a reference. .. RNA was extracted using TRIReagent (Applied Biosystems), and cDNA was constructed using random oligos and Superscript III reverse transcriptase (Invitrogen).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Revolver is a New Class of Transposon-like Gene Composing the Triticeae Genome
    Article Snippet: Paragraph title: Reverse transcriptase–polymerase chain reaction (RT–PCR) ... The single-strand cDNAs were synthesized from CapFishingTM adapter-added total RNA by SuperScript III reverse transcriptase (Invitrogen) using an oligo(dT) primer extended with 23 bp of 3′ Revolver sequence (5′-TTTTTTTTTTTTTTGGCACAACTCATGTAAAAGAGGG-3′).

    Article Title: Spliceozymes: Ribozymes that Remove Introns from Pre-mRNAs in Trans
    Article Snippet: Paragraph title: RT-PCR, sequence analysis, RT-qPCR, and plasmid yield ... In reaction volumes of 20 µL, RNA from the in vitro reaction containing 2 pmol CAT pre-mRNA and 20 pmol spliceozyme, or 3.2 µg of total RNA were incubated with 200 units of Superscript III reverse transcriptase (Invitrogen), for 60 minutes at 55°C, using the primer 5′-ccgtaacacgccacatc-3′ complementary to the CAT 3′ exon.

    Article Title: Identification of RNA silencing components in soybean and sorghum
    Article Snippet: Paragraph title: RT-PCR analysis ... After treatment with DNase I, 5 μg RNA was reverse transcribed (RT) by the Superscript III reverse transcriptase (Invitrogen) using an oligo-T18 primer to generate cDNAs at 50°C for 1 hour.

    Sequencing:

    Article Title: Expansion of the human ?-opioid receptor gene architecture: novel functional variants
    Article Snippet: The cDNAs were synthesized using 2–5 µg of total RNA with either cDNA Archive reverse transcription kit (ABI) or Superscript III reverse transcription kit (Invitrogen, Carlsbad, CA, USA), using random primer. cDNA samples were amplified using the GeneAmp XL (rTth DNA polymerase) PCR kit (ABI). .. The DNA sequence was determined by UNC-CH Genome Analysis Facility and compared with the predicted sequence of the 13th exon of the human OPRM1 and human genomic DNA (UCSC database).

    Article Title: Transcriptome characterization via 454 pyrosequencing of the annelid Pristina leidyi, an emerging model for studying the evolution of regeneration
    Article Snippet: Worm culture, sampling, and RNA extraction To generate material for this sequencing effort, we established twelve replicate lab cultures of a single clonal line of Pristina leidyi (PRIle(cbs)cloneA). .. RNA was extracted using TRIReagent (Applied Biosystems), and cDNA was constructed using random oligos and Superscript III reverse transcriptase (Invitrogen).

    Article Title: A Reverse Genetics System for Zika Virus Based on a Simple Molecular Cloning Strategy
    Article Snippet: .. Viral RNA was isolated from cell lysates using the NucleoSpin RNA II kit (Machery-Nagel, Düren, Germany) and reverse transcribed using SuperScript III RT (Thermo Fisher Scientific Waltham, MA, USA). cDNA was amplified by PCR and amplicons were sequenced by Sanger sequencing (GATC Biotech, Constance, Germany) using primers spanning the complete ZIKV genome. .. Sequences of the 5′ and 3′UTRs were obtained by the rapid amplification of cDNA ends (RACE) using the 5′/3′ RACE second generation kit (Roche, Basel, Switzerland) with a polyA-tail added to the cDNA prior to the 3′ RACE reaction by using the poly(A) polymerase (New England Biolabs, Ipswich, MA, USA).

    Article Title: Revolver is a New Class of Transposon-like Gene Composing the Triticeae Genome
    Article Snippet: .. The single-strand cDNAs were synthesized from CapFishingTM adapter-added total RNA by SuperScript III reverse transcriptase (Invitrogen) using an oligo(dT) primer extended with 23 bp of 3′ Revolver sequence (5′-TTTTTTTTTTTTTTGGCACAACTCATGTAAAAGAGGG-3′). ..

    Article Title: HNF4? and NF-E2 are key transcriptional regulators of the murine Abcc6 gene expression
    Article Snippet: Total RNA isolated (1μg) from mouse liver was reversely transcribed with the Superscript III reverse transcriptase kit primed with Oligo(dT) (Invitrogen). cDNAs were then PCR-amplified with the specific primers (see ), using the PCR Platinum Supermix (Invitrogen). .. After cloning, the sequence of all cDNAs was verified by direct sequencing.

    Article Title: Spliceozymes: Ribozymes that Remove Introns from Pre-mRNAs in Trans
    Article Snippet: Paragraph title: RT-PCR, sequence analysis, RT-qPCR, and plasmid yield ... In reaction volumes of 20 µL, RNA from the in vitro reaction containing 2 pmol CAT pre-mRNA and 20 pmol spliceozyme, or 3.2 µg of total RNA were incubated with 200 units of Superscript III reverse transcriptase (Invitrogen), for 60 minutes at 55°C, using the primer 5′-ccgtaacacgccacatc-3′ complementary to the CAT 3′ exon.

    In Vivo:

    Article Title: Spliceozymes: Ribozymes that Remove Introns from Pre-mRNAs in Trans
    Article Snippet: For the analysis of in vivo splicing reactions, total RNA was isolated from logarithmically growing E. coli cultures using the Nucleospin RNA II kit (Machery-Nagel). .. In reaction volumes of 20 µL, RNA from the in vitro reaction containing 2 pmol CAT pre-mRNA and 20 pmol spliceozyme, or 3.2 µg of total RNA were incubated with 200 units of Superscript III reverse transcriptase (Invitrogen), for 60 minutes at 55°C, using the primer 5′-ccgtaacacgccacatc-3′ complementary to the CAT 3′ exon.

    Passaging:

    Article Title: A Reverse Genetics System for Zika Virus Based on a Simple Molecular Cloning Strategy
    Article Snippet: In addition, we amplified the MR766 and the H/PF/2013 strains (obtained from the European Virus Archive; Marseille, France) by passaging once in C6/36 mosquito cells and once in VeroE6 cells. .. Viral RNA was isolated from cell lysates using the NucleoSpin RNA II kit (Machery-Nagel, Düren, Germany) and reverse transcribed using SuperScript III RT (Thermo Fisher Scientific Waltham, MA, USA). cDNA was amplified by PCR and amplicons were sequenced by Sanger sequencing (GATC Biotech, Constance, Germany) using primers spanning the complete ZIKV genome.

    Isolation:

    Article Title: CXCR3 modulates glial accumulation and activation in cuprizone-induced demyelination of the central nervous system
    Article Snippet: Cytokine and chemokine mRNA determination by quantitative real-time polymerase chain reaction Total RNA was isolated and purified from aliquots of homogenized brain samples using Trizol reagent (Sigma-Aldrich). .. Up to 3 μg of total RNA was reverse-transcribed into cDNA by using SuperScript III Reverse Transcriptase (Invitrogen).

    Article Title: A Reverse Genetics System for Zika Virus Based on a Simple Molecular Cloning Strategy
    Article Snippet: .. Viral RNA was isolated from cell lysates using the NucleoSpin RNA II kit (Machery-Nagel, Düren, Germany) and reverse transcribed using SuperScript III RT (Thermo Fisher Scientific Waltham, MA, USA). cDNA was amplified by PCR and amplicons were sequenced by Sanger sequencing (GATC Biotech, Constance, Germany) using primers spanning the complete ZIKV genome. .. Sequences of the 5′ and 3′UTRs were obtained by the rapid amplification of cDNA ends (RACE) using the 5′/3′ RACE second generation kit (Roche, Basel, Switzerland) with a polyA-tail added to the cDNA prior to the 3′ RACE reaction by using the poly(A) polymerase (New England Biolabs, Ipswich, MA, USA).

    Article Title: HNF4? and NF-E2 are key transcriptional regulators of the murine Abcc6 gene expression
    Article Snippet: .. Total RNA isolated (1μg) from mouse liver was reversely transcribed with the Superscript III reverse transcriptase kit primed with Oligo(dT) (Invitrogen). cDNAs were then PCR-amplified with the specific primers (see ), using the PCR Platinum Supermix (Invitrogen). .. Each PCR product was cloned into an expression vector, pTarget (Promega), using TA-cloning.

    Article Title: Spliceozymes: Ribozymes that Remove Introns from Pre-mRNAs in Trans
    Article Snippet: For the analysis of in vivo splicing reactions, total RNA was isolated from logarithmically growing E. coli cultures using the Nucleospin RNA II kit (Machery-Nagel). .. In reaction volumes of 20 µL, RNA from the in vitro reaction containing 2 pmol CAT pre-mRNA and 20 pmol spliceozyme, or 3.2 µg of total RNA were incubated with 200 units of Superscript III reverse transcriptase (Invitrogen), for 60 minutes at 55°C, using the primer 5′-ccgtaacacgccacatc-3′ complementary to the CAT 3′ exon.

    Purification:

    Article Title: CXCR3 modulates glial accumulation and activation in cuprizone-induced demyelination of the central nervous system
    Article Snippet: Cytokine and chemokine mRNA determination by quantitative real-time polymerase chain reaction Total RNA was isolated and purified from aliquots of homogenized brain samples using Trizol reagent (Sigma-Aldrich). .. Up to 3 μg of total RNA was reverse-transcribed into cDNA by using SuperScript III Reverse Transcriptase (Invitrogen).

    Article Title: Revolver is a New Class of Transposon-like Gene Composing the Triticeae Genome
    Article Snippet: The RT–PCR products were purified, ligated to the pGEM-T vector (Promega), and sequenced. .. The single-strand cDNAs were synthesized from CapFishingTM adapter-added total RNA by SuperScript III reverse transcriptase (Invitrogen) using an oligo(dT) primer extended with 23 bp of 3′ Revolver sequence (5′-TTTTTTTTTTTTTTGGCACAACTCATGTAAAAGAGGG-3′).

    Polymerase Chain Reaction:

    Article Title: Expansion of the human ?-opioid receptor gene architecture: novel functional variants
    Article Snippet: .. The cDNAs were synthesized using 2–5 µg of total RNA with either cDNA Archive reverse transcription kit (ABI) or Superscript III reverse transcription kit (Invitrogen, Carlsbad, CA, USA), using random primer. cDNA samples were amplified using the GeneAmp XL (rTth DNA polymerase) PCR kit (ABI). .. The sequences of the human and mouse primers and amplification conditions are listed in the Supplementary Material, Table S4 .

    Article Title: Transcriptome characterization via 454 pyrosequencing of the annelid Pristina leidyi, an emerging model for studying the evolution of regeneration
    Article Snippet: Possible contamination by the dried Spirulina food source was assayed via PCR, using cDNA samples derived from live Arthrospira platensis (Spirulina) as a reference. .. RNA was extracted using TRIReagent (Applied Biosystems), and cDNA was constructed using random oligos and Superscript III reverse transcriptase (Invitrogen).

    Article Title: RNA sequencing analysis reveals quiescent microglia isolation methods from postnatal mouse brains and limitations of BV2 cells
    Article Snippet: Quantitative real-time PCR RNA was reverse-transcribed into cDNA using Superscript III Reverse Transcriptase (Invitrogen) with random hexamer primers. .. Transcript abundance was determined by quantitative PCR using SYBR Green PCR Mix (Applied Biosystems) with the following primer pairs: Tspo : GCCTACTTTGTACGTGGCGAG (F), CCTCCCAGCTCTTTCCAGAC (R); Ptgs2 : TTCAACACACTCTATCACTGGC (F), AGAAGCGTTTGCGGTACTCAT (R); Cd86 : TGTTTCCGTGGAGACGCAAG (F), TTGAGCCTTTGTAAATGGGCA (R); Tnfa : CCCTCACACTCAGATCATCTTCT (F), GCTACGACGTGGGCTACAG (R); Il6 : TAGTCCTTCCTACCCCAATTTCC (F), TTGGTCCTTAGCCACTCCTTC (R); Il1b : GCAACTGTTCCTGAACTCAACT (F), ATCTTTTGGGGTCCGTCAACT (R); Tgfb1 : CTCCCGTGGCTTCTAGTGC (F), GCCTTAGTTTGGACAGGATCTG (R); Tgfbr1 : TCTGCATTGCACTTATGCTGA (F), AAAGGGCGATCTAGTGATGGA (R); Tgfbr2 : CCGCTGCATATCGTCCTGTG (F), AGTGGATGGATGGTCCTATTACA (R); Serpine1 : TTCAGCCCTTGCTTGCCTC (F), ACACTTTTACTCCGAAGTCGGT (R); C5a : GAACAAACCTACGTCATTTCAGC (F), GTCAACAGTGCCGCGTTTT (R); C5ar1 : TACCATTAGTGCCGACCGTTT (F), CCGGTACACGAAGGATGGAAT (R); C5ar2 : CTGCTGTCTACCGTAGGCTG (F), AGAGGAATCGAACAGTGGTGA (R); Gapdh : AGGTCGGTGTGAACGGATTTG (F), TGTAGACCATGTAGTTGAGGTCA (R).

    Article Title: A Reverse Genetics System for Zika Virus Based on a Simple Molecular Cloning Strategy
    Article Snippet: .. Viral RNA was isolated from cell lysates using the NucleoSpin RNA II kit (Machery-Nagel, Düren, Germany) and reverse transcribed using SuperScript III RT (Thermo Fisher Scientific Waltham, MA, USA). cDNA was amplified by PCR and amplicons were sequenced by Sanger sequencing (GATC Biotech, Constance, Germany) using primers spanning the complete ZIKV genome. .. Sequences of the 5′ and 3′UTRs were obtained by the rapid amplification of cDNA ends (RACE) using the 5′/3′ RACE second generation kit (Roche, Basel, Switzerland) with a polyA-tail added to the cDNA prior to the 3′ RACE reaction by using the poly(A) polymerase (New England Biolabs, Ipswich, MA, USA).

    Article Title: Revolver is a New Class of Transposon-like Gene Composing the Triticeae Genome
    Article Snippet: The PCR reaction program consisted of 30 cycles of 30 s at 95°C, 30 s at 63°C, 1 min at 72°C. .. The single-strand cDNAs were synthesized from CapFishingTM adapter-added total RNA by SuperScript III reverse transcriptase (Invitrogen) using an oligo(dT) primer extended with 23 bp of 3′ Revolver sequence (5′-TTTTTTTTTTTTTTGGCACAACTCATGTAAAAGAGGG-3′).

    Article Title: HNF4? and NF-E2 are key transcriptional regulators of the murine Abcc6 gene expression
    Article Snippet: .. Total RNA isolated (1μg) from mouse liver was reversely transcribed with the Superscript III reverse transcriptase kit primed with Oligo(dT) (Invitrogen). cDNAs were then PCR-amplified with the specific primers (see ), using the PCR Platinum Supermix (Invitrogen). .. Each PCR product was cloned into an expression vector, pTarget (Promega), using TA-cloning.

    Article Title: Spliceozymes: Ribozymes that Remove Introns from Pre-mRNAs in Trans
    Article Snippet: In reaction volumes of 20 µL, RNA from the in vitro reaction containing 2 pmol CAT pre-mRNA and 20 pmol spliceozyme, or 3.2 µg of total RNA were incubated with 200 units of Superscript III reverse transcriptase (Invitrogen), for 60 minutes at 55°C, using the primer 5′-ccgtaacacgccacatc-3′ complementary to the CAT 3′ exon. .. DNA sequences were amplified by PCR with primers 5′-cggcctttattcacattct-3′ and 5′-gtgtagaaactgccggaa-3′.

    Article Title: Allelic methylation levels of the noncoding VTRNA2-1 located on chromosome 5q31.1 predict outcome in AML
    Article Snippet: RNA was RT using SuperScript III Reverse Transcriptase (Invitrogen) and random hexamers (Promega). .. RT-quantitative PCR for miR886-3p and -5p was performed using TaqMan MicroRNA assays (Applied Biosystems), vtRNA2-1 expression was analyzed using TaqMan probes (Applied Biosystems).

    Article Title: Identification of RNA silencing components in soybean and sorghum
    Article Snippet: After treatment with DNase I, 5 μg RNA was reverse transcribed (RT) by the Superscript III reverse transcriptase (Invitrogen) using an oligo-T18 primer to generate cDNAs at 50°C for 1 hour. .. The resulting cDNAs was used as templates to perform PCR amplification with primers listed in Additional file : Table S3.

    Article Title: Lysophosphatidic acid via LPA-receptor 5/protein kinase D-dependent pathways induces a motile and pro-inflammatory microglial phenotype
    Article Snippet: .. RNA was reverse-transcribed using the SuperScript® III reverse transcription kit (Invitrogen, Waltham, MA, USA). qPCR was performed on an Applied Biosystems 7900HT Fast Real-Time PCR System using the QuantiTect SYBR® Green PCR kit (Qiagen, Hilden, Germany). .. Amplification of murine hypoxanthine-guanine phosphoribosyltransferase (HPRT) was performed on all samples as internal control for variations in messenger RNA (mRNA) concentration.

    Quantitative RT-PCR:

    Article Title: Spliceozymes: Ribozymes that Remove Introns from Pre-mRNAs in Trans
    Article Snippet: Paragraph title: RT-PCR, sequence analysis, RT-qPCR, and plasmid yield ... In reaction volumes of 20 µL, RNA from the in vitro reaction containing 2 pmol CAT pre-mRNA and 20 pmol spliceozyme, or 3.2 µg of total RNA were incubated with 200 units of Superscript III reverse transcriptase (Invitrogen), for 60 minutes at 55°C, using the primer 5′-ccgtaacacgccacatc-3′ complementary to the CAT 3′ exon.

    Article Title: Allelic methylation levels of the noncoding VTRNA2-1 located on chromosome 5q31.1 predict outcome in AML
    Article Snippet: Paragraph title: RT-qPCR ... RNA was RT using SuperScript III Reverse Transcriptase (Invitrogen) and random hexamers (Promega).

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Spliceozymes: Ribozymes that Remove Introns from Pre-mRNAs in Trans
    Article Snippet: .. In reaction volumes of 20 µL, RNA from the in vitro reaction containing 2 pmol CAT pre-mRNA and 20 pmol spliceozyme, or 3.2 µg of total RNA were incubated with 200 units of Superscript III reverse transcriptase (Invitrogen), for 60 minutes at 55°C, using the primer 5′-ccgtaacacgccacatc-3′ complementary to the CAT 3′ exon. .. DNA sequences were amplified by PCR with primers 5′-cggcctttattcacattct-3′ and 5′-gtgtagaaactgccggaa-3′.

    Rapid Amplification of cDNA Ends:

    Article Title: A Reverse Genetics System for Zika Virus Based on a Simple Molecular Cloning Strategy
    Article Snippet: Viral RNA was isolated from cell lysates using the NucleoSpin RNA II kit (Machery-Nagel, Düren, Germany) and reverse transcribed using SuperScript III RT (Thermo Fisher Scientific Waltham, MA, USA). cDNA was amplified by PCR and amplicons were sequenced by Sanger sequencing (GATC Biotech, Constance, Germany) using primers spanning the complete ZIKV genome. .. Sequences of the 5′ and 3′UTRs were obtained by the rapid amplification of cDNA ends (RACE) using the 5′/3′ RACE second generation kit (Roche, Basel, Switzerland) with a polyA-tail added to the cDNA prior to the 3′ RACE reaction by using the poly(A) polymerase (New England Biolabs, Ipswich, MA, USA).

    Plasmid Preparation:

    Article Title: Revolver is a New Class of Transposon-like Gene Composing the Triticeae Genome
    Article Snippet: The RT–PCR products were purified, ligated to the pGEM-T vector (Promega), and sequenced. .. The single-strand cDNAs were synthesized from CapFishingTM adapter-added total RNA by SuperScript III reverse transcriptase (Invitrogen) using an oligo(dT) primer extended with 23 bp of 3′ Revolver sequence (5′-TTTTTTTTTTTTTTGGCACAACTCATGTAAAAGAGGG-3′).

    Article Title: HNF4? and NF-E2 are key transcriptional regulators of the murine Abcc6 gene expression
    Article Snippet: Total RNA isolated (1μg) from mouse liver was reversely transcribed with the Superscript III reverse transcriptase kit primed with Oligo(dT) (Invitrogen). cDNAs were then PCR-amplified with the specific primers (see ), using the PCR Platinum Supermix (Invitrogen). .. Each PCR product was cloned into an expression vector, pTarget (Promega), using TA-cloning.

    Article Title: Spliceozymes: Ribozymes that Remove Introns from Pre-mRNAs in Trans
    Article Snippet: Paragraph title: RT-PCR, sequence analysis, RT-qPCR, and plasmid yield ... In reaction volumes of 20 µL, RNA from the in vitro reaction containing 2 pmol CAT pre-mRNA and 20 pmol spliceozyme, or 3.2 µg of total RNA were incubated with 200 units of Superscript III reverse transcriptase (Invitrogen), for 60 minutes at 55°C, using the primer 5′-ccgtaacacgccacatc-3′ complementary to the CAT 3′ exon.

    Software:

    Article Title: Lysophosphatidic acid via LPA-receptor 5/protein kinase D-dependent pathways induces a motile and pro-inflammatory microglial phenotype
    Article Snippet: RNA was reverse-transcribed using the SuperScript® III reverse transcription kit (Invitrogen, Waltham, MA, USA). qPCR was performed on an Applied Biosystems 7900HT Fast Real-Time PCR System using the QuantiTect SYBR® Green PCR kit (Qiagen, Hilden, Germany). .. Expression profiles and associated statistical parameters were analyzed using the relative expression software tool (REST; http://www.gene-quantification.de/rest-index.html ) using a pairwise re-allocation test.

    SYBR Green Assay:

    Article Title: RNA sequencing analysis reveals quiescent microglia isolation methods from postnatal mouse brains and limitations of BV2 cells
    Article Snippet: Quantitative real-time PCR RNA was reverse-transcribed into cDNA using Superscript III Reverse Transcriptase (Invitrogen) with random hexamer primers. .. Transcript abundance was determined by quantitative PCR using SYBR Green PCR Mix (Applied Biosystems) with the following primer pairs: Tspo : GCCTACTTTGTACGTGGCGAG (F), CCTCCCAGCTCTTTCCAGAC (R); Ptgs2 : TTCAACACACTCTATCACTGGC (F), AGAAGCGTTTGCGGTACTCAT (R); Cd86 : TGTTTCCGTGGAGACGCAAG (F), TTGAGCCTTTGTAAATGGGCA (R); Tnfa : CCCTCACACTCAGATCATCTTCT (F), GCTACGACGTGGGCTACAG (R); Il6 : TAGTCCTTCCTACCCCAATTTCC (F), TTGGTCCTTAGCCACTCCTTC (R); Il1b : GCAACTGTTCCTGAACTCAACT (F), ATCTTTTGGGGTCCGTCAACT (R); Tgfb1 : CTCCCGTGGCTTCTAGTGC (F), GCCTTAGTTTGGACAGGATCTG (R); Tgfbr1 : TCTGCATTGCACTTATGCTGA (F), AAAGGGCGATCTAGTGATGGA (R); Tgfbr2 : CCGCTGCATATCGTCCTGTG (F), AGTGGATGGATGGTCCTATTACA (R); Serpine1 : TTCAGCCCTTGCTTGCCTC (F), ACACTTTTACTCCGAAGTCGGT (R); C5a : GAACAAACCTACGTCATTTCAGC (F), GTCAACAGTGCCGCGTTTT (R); C5ar1 : TACCATTAGTGCCGACCGTTT (F), CCGGTACACGAAGGATGGAAT (R); C5ar2 : CTGCTGTCTACCGTAGGCTG (F), AGAGGAATCGAACAGTGGTGA (R); Gapdh : AGGTCGGTGTGAACGGATTTG (F), TGTAGACCATGTAGTTGAGGTCA (R).

    Article Title: The core genome m5C methyltransferase JHP1050 (M.Hpy99III) plays an important role in orchestrating gene expression in Helicobacter pylori
    Article Snippet: .. Quantitative PCR (qPCR) One μg of RNA was used for cDNA synthesis using the SuperScript™ III Reverse Transcriptase (Thermo Fisher Scientific, Darmstadt, Germany) as described before ( ). qPCR was performed with gene specific primers ( ) and SYBR Green Master Mix (Qiagen, Hilden, Germany). .. Reactions were run in a BioRad CFX96 system.

    Article Title: Lysophosphatidic acid via LPA-receptor 5/protein kinase D-dependent pathways induces a motile and pro-inflammatory microglial phenotype
    Article Snippet: .. RNA was reverse-transcribed using the SuperScript® III reverse transcription kit (Invitrogen, Waltham, MA, USA). qPCR was performed on an Applied Biosystems 7900HT Fast Real-Time PCR System using the QuantiTect SYBR® Green PCR kit (Qiagen, Hilden, Germany). .. Amplification of murine hypoxanthine-guanine phosphoribosyltransferase (HPRT) was performed on all samples as internal control for variations in messenger RNA (mRNA) concentration.

    RNA Extraction:

    Article Title: Transcriptome characterization via 454 pyrosequencing of the annelid Pristina leidyi, an emerging model for studying the evolution of regeneration
    Article Snippet: Paragraph title: Worm culture, sampling, and RNA extraction ... RNA was extracted using TRIReagent (Applied Biosystems), and cDNA was constructed using random oligos and Superscript III reverse transcriptase (Invitrogen).

    In Vitro:

    Article Title: Spliceozymes: Ribozymes that Remove Introns from Pre-mRNAs in Trans
    Article Snippet: .. In reaction volumes of 20 µL, RNA from the in vitro reaction containing 2 pmol CAT pre-mRNA and 20 pmol spliceozyme, or 3.2 µg of total RNA were incubated with 200 units of Superscript III reverse transcriptase (Invitrogen), for 60 minutes at 55°C, using the primer 5′-ccgtaacacgccacatc-3′ complementary to the CAT 3′ exon. .. DNA sequences were amplified by PCR with primers 5′-cggcctttattcacattct-3′ and 5′-gtgtagaaactgccggaa-3′.

    Incubation:

    Article Title: Spliceozymes: Ribozymes that Remove Introns from Pre-mRNAs in Trans
    Article Snippet: .. In reaction volumes of 20 µL, RNA from the in vitro reaction containing 2 pmol CAT pre-mRNA and 20 pmol spliceozyme, or 3.2 µg of total RNA were incubated with 200 units of Superscript III reverse transcriptase (Invitrogen), for 60 minutes at 55°C, using the primer 5′-ccgtaacacgccacatc-3′ complementary to the CAT 3′ exon. .. DNA sequences were amplified by PCR with primers 5′-cggcctttattcacattct-3′ and 5′-gtgtagaaactgccggaa-3′.

    Article Title: Lysophosphatidic acid via LPA-receptor 5/protein kinase D-dependent pathways induces a motile and pro-inflammatory microglial phenotype
    Article Snippet: As negative controls, cells were incubated in serum-free medium in the presence of 0.1% BSA or DMSO. .. RNA was reverse-transcribed using the SuperScript® III reverse transcription kit (Invitrogen, Waltham, MA, USA). qPCR was performed on an Applied Biosystems 7900HT Fast Real-Time PCR System using the QuantiTect SYBR® Green PCR kit (Qiagen, Hilden, Germany).

    Sampling:

    Article Title: Transcriptome characterization via 454 pyrosequencing of the annelid Pristina leidyi, an emerging model for studying the evolution of regeneration
    Article Snippet: Paragraph title: Worm culture, sampling, and RNA extraction ... RNA was extracted using TRIReagent (Applied Biosystems), and cDNA was constructed using random oligos and Superscript III reverse transcriptase (Invitrogen).

    Produced:

    Article Title: The core genome m5C methyltransferase JHP1050 (M.Hpy99III) plays an important role in orchestrating gene expression in Helicobacter pylori
    Article Snippet: Quantitative PCR (qPCR) One μg of RNA was used for cDNA synthesis using the SuperScript™ III Reverse Transcriptase (Thermo Fisher Scientific, Darmstadt, Germany) as described before ( ). qPCR was performed with gene specific primers ( ) and SYBR Green Master Mix (Qiagen, Hilden, Germany). .. Standard curves were produced and samples were run as technical triplicates.

    Concentration Assay:

    Article Title: Lysophosphatidic acid via LPA-receptor 5/protein kinase D-dependent pathways induces a motile and pro-inflammatory microglial phenotype
    Article Snippet: RNA was reverse-transcribed using the SuperScript® III reverse transcription kit (Invitrogen, Waltham, MA, USA). qPCR was performed on an Applied Biosystems 7900HT Fast Real-Time PCR System using the QuantiTect SYBR® Green PCR kit (Qiagen, Hilden, Germany). .. Amplification of murine hypoxanthine-guanine phosphoribosyltransferase (HPRT) was performed on all samples as internal control for variations in messenger RNA (mRNA) concentration.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher superscript iii reverse transcriptase kit
    Impact of MyD88 reactivation on the expression of factors that govern MO/DC function in infection and inflammation. (A, B) WT, MyD OFF , CD11c-MyD ON and LysM-MyD ON mice were infected orally with C . rodentium . On day 4 p.i. leukocytes were isolated from the cLP and sorted for DC (lin − CD64 − MHC-II + CD26 + CD11c + ) and MO (lin − CD64 + F4/80 + MHC-II + ). As lineage marker, antibodies against CD3, CD19, B220 and NK1.1 were included (A) Heat map displaying expression of genes involved in MNP function in infection and inflammation analyzed by real-time PCR from sorted DC/MO fractions. Data presented as mean log2 value of relative <t>mRNA</t> expression (see color scale). (B) Bar graphs show mean expression of selected genes in sorted DC/MO fractions relative to the expression of 5 housekeeping genes ( Actb , B2m , Gapdh , Gusb , Hsp90ab1 ). Data were pooled from <t>three</t> individual experiments with n = 4–6 mice per group. Error bar represents +SEM. One-Way ANOVA with Bonferroni’s Multiple Comparison test; *p
    Superscript Iii Reverse Transcriptase Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 373 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript iii reverse transcriptase kit/product/Thermo Fisher
    Average 99 stars, based on 373 article reviews
    Price from $9.99 to $1999.99
    superscript iii reverse transcriptase kit - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results


    Impact of MyD88 reactivation on the expression of factors that govern MO/DC function in infection and inflammation. (A, B) WT, MyD OFF , CD11c-MyD ON and LysM-MyD ON mice were infected orally with C . rodentium . On day 4 p.i. leukocytes were isolated from the cLP and sorted for DC (lin − CD64 − MHC-II + CD26 + CD11c + ) and MO (lin − CD64 + F4/80 + MHC-II + ). As lineage marker, antibodies against CD3, CD19, B220 and NK1.1 were included (A) Heat map displaying expression of genes involved in MNP function in infection and inflammation analyzed by real-time PCR from sorted DC/MO fractions. Data presented as mean log2 value of relative mRNA expression (see color scale). (B) Bar graphs show mean expression of selected genes in sorted DC/MO fractions relative to the expression of 5 housekeeping genes ( Actb , B2m , Gapdh , Gusb , Hsp90ab1 ). Data were pooled from three individual experiments with n = 4–6 mice per group. Error bar represents +SEM. One-Way ANOVA with Bonferroni’s Multiple Comparison test; *p

    Journal: PLoS Pathogens

    Article Title: MyD88 signaling in dendritic cells and the intestinal epithelium controls immunity against intestinal infection with C. rodentium

    doi: 10.1371/journal.ppat.1006357

    Figure Lengend Snippet: Impact of MyD88 reactivation on the expression of factors that govern MO/DC function in infection and inflammation. (A, B) WT, MyD OFF , CD11c-MyD ON and LysM-MyD ON mice were infected orally with C . rodentium . On day 4 p.i. leukocytes were isolated from the cLP and sorted for DC (lin − CD64 − MHC-II + CD26 + CD11c + ) and MO (lin − CD64 + F4/80 + MHC-II + ). As lineage marker, antibodies against CD3, CD19, B220 and NK1.1 were included (A) Heat map displaying expression of genes involved in MNP function in infection and inflammation analyzed by real-time PCR from sorted DC/MO fractions. Data presented as mean log2 value of relative mRNA expression (see color scale). (B) Bar graphs show mean expression of selected genes in sorted DC/MO fractions relative to the expression of 5 housekeeping genes ( Actb , B2m , Gapdh , Gusb , Hsp90ab1 ). Data were pooled from three individual experiments with n = 4–6 mice per group. Error bar represents +SEM. One-Way ANOVA with Bonferroni’s Multiple Comparison test; *p

    Article Snippet: 50–100 ng of amplified mRNA was transcribed into cDNA using SuperScript III Reverse Transcriptase Kit (Thermo Fisher Scientific).

    Techniques: Expressing, Infection, Mouse Assay, Isolation, Marker, Real-time Polymerase Chain Reaction

    Cxcl8/cxcr1 signaling in endothelial cells induces gene expression changes favoring HSPC colonization . (a) Kdrl:cxcr1;kdrl:mCherry zebrafish and kdrl:mCherry clutchmates (WT) were dissociated at 72 hpf, and mCherry + endothelial cells were FACS sorted. Quantitative PCR for cxcr1 is shown. The experiment was repeated three times with similar results. (b–d) Kdrl:cxcr1;Runx1:mCherry zebrafish were imaged at 72 hpf for HSPC colonization of the CHT (a and b). Bars, 20 µm. (d) Plot showing increased HSPC colonization in kdrl:cxcr1 animals (P = 0.001, Wilcoxon’s rank sum test; n = 35 for WT control; n = 28 for kdrl:cxcr1 ) The experiment was repeated twice with similar results; combined results are shown. (e) Mpx:GFP (WT) and kdrl:cxcr1;mpx:GFP zebrafish were imaged at 72 hpf, and neutrophil numbers in the CHT were quantified (p = NS, Student’s t test; n = 47 for WT control; n = 35 for kdrl:cxcr1 ). The experiment was repeated three times with similar results. Combined results are shown. (f–k) Kdrl:cxcr1 and WT clutchmates were fixed at 72 hpf and WISH was performed for cxcl12a (f–h) and cxcl12b (i–k). Bar, 100 µm. h and k show the results of blinded semiquantitative scoring of CHT staining for each probe ( cxcl12a: P = 0.03, Wilcoxon’s rank sum test, n = 26 for WT control and n = 34 for kdrl:cxcr1 ; cxcl12b : p = NS, Wilcoxon’s rank sum test, n = 19 for WT control and n = 22 for kdrl:cxcr1 ). The experiment was performed three times with similar results; combined results are shown. (l) HUVECs were serum starved for 12 h, and then treated with 10 ng/ml rhCXCL8 or vehicle control. Quantitative RT-PCR was performed for expression of CXCL12, CXCL8, and survivin and VEGFA. (m) RNA sequencing was performed on HUVEC RNA. IPA analysis identifying the top enriched molecular and cellular functions is shown. The HUVEC experiments were performed with biological duplicates.

    Journal: The Journal of Experimental Medicine

    Article Title: CXCR1 remodels the vascular niche to promote hematopoietic stem and progenitor cell engraftment

    doi: 10.1084/jem.20161616

    Figure Lengend Snippet: Cxcl8/cxcr1 signaling in endothelial cells induces gene expression changes favoring HSPC colonization . (a) Kdrl:cxcr1;kdrl:mCherry zebrafish and kdrl:mCherry clutchmates (WT) were dissociated at 72 hpf, and mCherry + endothelial cells were FACS sorted. Quantitative PCR for cxcr1 is shown. The experiment was repeated three times with similar results. (b–d) Kdrl:cxcr1;Runx1:mCherry zebrafish were imaged at 72 hpf for HSPC colonization of the CHT (a and b). Bars, 20 µm. (d) Plot showing increased HSPC colonization in kdrl:cxcr1 animals (P = 0.001, Wilcoxon’s rank sum test; n = 35 for WT control; n = 28 for kdrl:cxcr1 ) The experiment was repeated twice with similar results; combined results are shown. (e) Mpx:GFP (WT) and kdrl:cxcr1;mpx:GFP zebrafish were imaged at 72 hpf, and neutrophil numbers in the CHT were quantified (p = NS, Student’s t test; n = 47 for WT control; n = 35 for kdrl:cxcr1 ). The experiment was repeated three times with similar results. Combined results are shown. (f–k) Kdrl:cxcr1 and WT clutchmates were fixed at 72 hpf and WISH was performed for cxcl12a (f–h) and cxcl12b (i–k). Bar, 100 µm. h and k show the results of blinded semiquantitative scoring of CHT staining for each probe ( cxcl12a: P = 0.03, Wilcoxon’s rank sum test, n = 26 for WT control and n = 34 for kdrl:cxcr1 ; cxcl12b : p = NS, Wilcoxon’s rank sum test, n = 19 for WT control and n = 22 for kdrl:cxcr1 ). The experiment was performed three times with similar results; combined results are shown. (l) HUVECs were serum starved for 12 h, and then treated with 10 ng/ml rhCXCL8 or vehicle control. Quantitative RT-PCR was performed for expression of CXCL12, CXCL8, and survivin and VEGFA. (m) RNA sequencing was performed on HUVEC RNA. IPA analysis identifying the top enriched molecular and cellular functions is shown. The HUVEC experiments were performed with biological duplicates.

    Article Snippet: Transgenesis Candidate zebrafish coding sequences were amplified from kidney marrow total RNA using the Superscript III RT kit (Thermo Fisher Scientific) and gene-specific primers.

    Techniques: Expressing, FACS, Real-time Polymerase Chain Reaction, Staining, Quantitative RT-PCR, RNA Sequencing Assay, Indirect Immunoperoxidase Assay

    RNase R treatments of dsRNA samples, where three consecutive digests were carried out, with 10 μL samples saved at each step for RT-PCR screening ( lower branch ), and a parallel no-enzyme control series ( upper branch ) to validate the procedure. Denaturation at 95 °C for 8 min was carried out before each RNase R treatment.

    Journal: Viruses

    Article Title: Blackcurrant Leaf Chlorosis Associated Virus: Evidence of the Presence of Circular RNA during Infections

    doi: 10.3390/v10050260

    Figure Lengend Snippet: RNase R treatments of dsRNA samples, where three consecutive digests were carried out, with 10 μL samples saved at each step for RT-PCR screening ( lower branch ), and a parallel no-enzyme control series ( upper branch ) to validate the procedure. Denaturation at 95 °C for 8 min was carried out before each RNase R treatment.

    Article Snippet: The RT-PCR tests were performed as two-step reactions, with the cDNA synthesis steps using SuperScript III reverse transcriptase kits, and PCR steps using Platinum Hi-Fi Taq DNA polymerase (Thermo-Fisher, Waltham, MA, USA).

    Techniques: Reverse Transcription Polymerase Chain Reaction

    Heterogeneous expression pattern of YFP + and YFP - signals within the aneuploid population was not due to the karyotypic variations. ( A ) A schematic representation of the genetic manipulations used to generate isogenic diploid and triploid strains from the parental WT haploid strain, which has nuclear localization sequence-tagged YFP inserted into the HML locus. ( B ) FACS sorting of YFP - vs YFP + cells from the strain with 2x Chr III and 1x Chr X gain. Red and yellow line outlines the population of YFP - and YFP + cells sorted for the qPCR analysis in C and D, respectively. ( C–D ) qPCR karyotyping of YFP - ( C ) and YFP + ( D ) cell population sorted from the strain with 2x Chr III and 1x Chr X gain. Chromosome copy numbers of sixteen yeast chromosomes are plotted as mean and SD of three technical replicates. ( E–G ) Confocal images of YFP fluorescence, taken at the indicated time points during time-lapse imaging, show transitions between repression and derepression of the HML locus in proliferating lineages of aneuploid yeast cells with the following karyotypes: ( E ) Gain of III, III, X; ( F ) Loss of I, V, VII, VIII, XI (basal ploidy, 2N); and ( G ) Gain of I, X, XII, XIII. Arrows point to mother cells that switched from the silenced to the desilenced state. The circle outlines the boundary of the cell. Scale bar, 4 µm.

    Journal: eLife

    Article Title: Aneuploidy as a cause of impaired chromatin silencing and mating-type specification in budding yeast

    doi: 10.7554/eLife.27991

    Figure Lengend Snippet: Heterogeneous expression pattern of YFP + and YFP - signals within the aneuploid population was not due to the karyotypic variations. ( A ) A schematic representation of the genetic manipulations used to generate isogenic diploid and triploid strains from the parental WT haploid strain, which has nuclear localization sequence-tagged YFP inserted into the HML locus. ( B ) FACS sorting of YFP - vs YFP + cells from the strain with 2x Chr III and 1x Chr X gain. Red and yellow line outlines the population of YFP - and YFP + cells sorted for the qPCR analysis in C and D, respectively. ( C–D ) qPCR karyotyping of YFP - ( C ) and YFP + ( D ) cell population sorted from the strain with 2x Chr III and 1x Chr X gain. Chromosome copy numbers of sixteen yeast chromosomes are plotted as mean and SD of three technical replicates. ( E–G ) Confocal images of YFP fluorescence, taken at the indicated time points during time-lapse imaging, show transitions between repression and derepression of the HML locus in proliferating lineages of aneuploid yeast cells with the following karyotypes: ( E ) Gain of III, III, X; ( F ) Loss of I, V, VII, VIII, XI (basal ploidy, 2N); and ( G ) Gain of I, X, XII, XIII. Arrows point to mother cells that switched from the silenced to the desilenced state. The circle outlines the boundary of the cell. Scale bar, 4 µm.

    Article Snippet: Quantitative reverse transcriptase-PCR (qPCR) analysis RNA was extracted as described above and cDNA was prepared from 2 µg of the resulting total RNA using the Super-Script III reverse transcriptase kit (Thermo Fisher Scientific, Waltham, MA). qPCR was performed using SYBR Green real-time PCR master mix (Quanta Biosciences, Beverly, MA) and analyzed by standard procedures ( ).

    Techniques: Expressing, Sequencing, FACS, Real-time Polymerase Chain Reaction, Fluorescence, Imaging

    HM desilencing in disome X cells correlates with increased H4K16 acetylation and reduced Sir2 enrichment across HM loci. ( A–B ) Bottom: The plots show levels of H4K16 acetylation across the HML ( A ) and HMR ( B ) loci in disome X and Δsir1 strains relative to WT haploid cells, determined using anti-H4K16ac chromatin immunoprecipitation (ChIP) followed by quantitative RT-PCR (qPCR) analysis. Top: Schematics of the HM loci indicate the genomic positioning of primer sets A to F used for qPCR. Plots show the mean and SD from three biological replicates. *p

    Journal: eLife

    Article Title: Aneuploidy as a cause of impaired chromatin silencing and mating-type specification in budding yeast

    doi: 10.7554/eLife.27991

    Figure Lengend Snippet: HM desilencing in disome X cells correlates with increased H4K16 acetylation and reduced Sir2 enrichment across HM loci. ( A–B ) Bottom: The plots show levels of H4K16 acetylation across the HML ( A ) and HMR ( B ) loci in disome X and Δsir1 strains relative to WT haploid cells, determined using anti-H4K16ac chromatin immunoprecipitation (ChIP) followed by quantitative RT-PCR (qPCR) analysis. Top: Schematics of the HM loci indicate the genomic positioning of primer sets A to F used for qPCR. Plots show the mean and SD from three biological replicates. *p

    Article Snippet: Quantitative reverse transcriptase-PCR (qPCR) analysis RNA was extracted as described above and cDNA was prepared from 2 µg of the resulting total RNA using the Super-Script III reverse transcriptase kit (Thermo Fisher Scientific, Waltham, MA). qPCR was performed using SYBR Green real-time PCR master mix (Quanta Biosciences, Beverly, MA) and analyzed by standard procedures ( ).

    Techniques: Chromatin Immunoprecipitation, Quantitative RT-PCR, Real-time Polymerase Chain Reaction