superscript iii kit  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Thermo Fisher superscript iii kit
    Autophagosome formation and ATG 9a trafficking are impaired upon loss of retromer Parental HeLa cells and VPS35 KO cells were transduced with mCherry‐Parkin and GFP‐LC3b and incubated with CCCP for 2 and 4 h. Co‐localization of GFP‐LC3b and endogenous TOM20 (blue) was quantified over two independent experiments. Parental HeLa cells and <t>VPS29</t> and VPS35 KO cells transduced with mCherry‐Parkin were treated with CCCP for the indicated time points, followed by staining of endogenous ATG16L1 (green) and endogenous TOM20 (blue). HeLa cells were transfected with humanized Cas9 and a mix of <t>three</t> distinct gRNAs targeting the ATG9a gene. Note that the vesicular ATG9a antibody signal (green) completely disappears in the CRISPR‐treated cells, indicating a high degree of specificity. Parental HeLa cells and VPS29 and VPS35 KO cells transduced with mCherry‐Parkin were treated with CCCP for the indicated time points, followed by staining of endogenous ATG9a (green) and endogenous TOM20 (blue). Data information: All scale bars = 10 μm, all error bars = SD, and * P
    Superscript Iii Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 291 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript iii kit/product/Thermo Fisher
    Average 99 stars, based on 291 article reviews
    Price from $9.99 to $1999.99
    superscript iii kit - by Bioz Stars, 2019-12
    99/100 stars

    Images

    1) Product Images from "Control of RAB7 activity and localization through the retromer‐TBC1D5 complex enables RAB7‐dependent mitophagy"

    Article Title: Control of RAB7 activity and localization through the retromer‐TBC1D5 complex enables RAB7‐dependent mitophagy

    Journal: The EMBO Journal

    doi: 10.15252/embj.201797128

    Autophagosome formation and ATG 9a trafficking are impaired upon loss of retromer Parental HeLa cells and VPS35 KO cells were transduced with mCherry‐Parkin and GFP‐LC3b and incubated with CCCP for 2 and 4 h. Co‐localization of GFP‐LC3b and endogenous TOM20 (blue) was quantified over two independent experiments. Parental HeLa cells and VPS29 and VPS35 KO cells transduced with mCherry‐Parkin were treated with CCCP for the indicated time points, followed by staining of endogenous ATG16L1 (green) and endogenous TOM20 (blue). HeLa cells were transfected with humanized Cas9 and a mix of three distinct gRNAs targeting the ATG9a gene. Note that the vesicular ATG9a antibody signal (green) completely disappears in the CRISPR‐treated cells, indicating a high degree of specificity. Parental HeLa cells and VPS29 and VPS35 KO cells transduced with mCherry‐Parkin were treated with CCCP for the indicated time points, followed by staining of endogenous ATG9a (green) and endogenous TOM20 (blue). Data information: All scale bars = 10 μm, all error bars = SD, and * P
    Figure Legend Snippet: Autophagosome formation and ATG 9a trafficking are impaired upon loss of retromer Parental HeLa cells and VPS35 KO cells were transduced with mCherry‐Parkin and GFP‐LC3b and incubated with CCCP for 2 and 4 h. Co‐localization of GFP‐LC3b and endogenous TOM20 (blue) was quantified over two independent experiments. Parental HeLa cells and VPS29 and VPS35 KO cells transduced with mCherry‐Parkin were treated with CCCP for the indicated time points, followed by staining of endogenous ATG16L1 (green) and endogenous TOM20 (blue). HeLa cells were transfected with humanized Cas9 and a mix of three distinct gRNAs targeting the ATG9a gene. Note that the vesicular ATG9a antibody signal (green) completely disappears in the CRISPR‐treated cells, indicating a high degree of specificity. Parental HeLa cells and VPS29 and VPS35 KO cells transduced with mCherry‐Parkin were treated with CCCP for the indicated time points, followed by staining of endogenous ATG9a (green) and endogenous TOM20 (blue). Data information: All scale bars = 10 μm, all error bars = SD, and * P

    Techniques Used: Gene Knockout, Transduction, Incubation, Staining, Transfection, CRISPR

    Mitophagy is defective upon loss of retromer mCherry‐Parkin‐transduced parental HeLa cells, VPS35 KO cells, VPS29 KO cells, and VPS29 KO cells transduced with the indicated VPS29 rescue constructs were treated with CCCP over 16 h, followed by PFA fixation and staining of endogenous TOM20 (green). Residual TOM20 after CCCP treatment was quantified over two independent experiments. The cells described for panel (A) were lysed after 16‐h CCCP treatment, and residual TOM20 was detected by Western blotting (left) and quantified over three independent experiments (right). SHSY‐5Y cells that had been transduced with a construct expressing tandem mCherry‐eGFP‐FIS1TM (mitochondria‐anchored mCherry‐GFP tandem) were transfected with control and VPS35‐specific siRNA and treated with the iron chelator deferiprone for 24 h. The cells were then assessed for red‐shifted dots representing mitophagy events by confocal microscopy. Efficiency of the siRNA treatment was confirmed by Western blotting against endogenous VPS35. Mitophagy events were counted in 20 images per condition, acquired in two independent experiments. Parental HeLa cells and VPS29 and VPS35 KO cells were transduced with mCherry–Parkin, and mitophagy was induced for the indicated time points with the proton uncoupler CCCP. The cells were then fixed in methanol and co‐stained for endogenous LC3b (green) and TOM20 (blue). (D′) Co‐localization between LC3b and TOM20 was analyzed over 12 images per condition acquired in two independent experiments. Data information: All scale bars = 10 μm, all error bars = SD, and * P
    Figure Legend Snippet: Mitophagy is defective upon loss of retromer mCherry‐Parkin‐transduced parental HeLa cells, VPS35 KO cells, VPS29 KO cells, and VPS29 KO cells transduced with the indicated VPS29 rescue constructs were treated with CCCP over 16 h, followed by PFA fixation and staining of endogenous TOM20 (green). Residual TOM20 after CCCP treatment was quantified over two independent experiments. The cells described for panel (A) were lysed after 16‐h CCCP treatment, and residual TOM20 was detected by Western blotting (left) and quantified over three independent experiments (right). SHSY‐5Y cells that had been transduced with a construct expressing tandem mCherry‐eGFP‐FIS1TM (mitochondria‐anchored mCherry‐GFP tandem) were transfected with control and VPS35‐specific siRNA and treated with the iron chelator deferiprone for 24 h. The cells were then assessed for red‐shifted dots representing mitophagy events by confocal microscopy. Efficiency of the siRNA treatment was confirmed by Western blotting against endogenous VPS35. Mitophagy events were counted in 20 images per condition, acquired in two independent experiments. Parental HeLa cells and VPS29 and VPS35 KO cells were transduced with mCherry–Parkin, and mitophagy was induced for the indicated time points with the proton uncoupler CCCP. The cells were then fixed in methanol and co‐stained for endogenous LC3b (green) and TOM20 (blue). (D′) Co‐localization between LC3b and TOM20 was analyzed over 12 images per condition acquired in two independent experiments. Data information: All scale bars = 10 μm, all error bars = SD, and * P

    Techniques Used: Gene Knockout, Transduction, Construct, Staining, Western Blot, Expressing, Transfection, Confocal Microscopy

    Loss of retromer leads to a pronounced shift in RAB 7 distribution Parental HeLa cells, two clonal VPS35 knockout cell lines, and one clonal VPS29 KO cell line were fixed in PFA and co‐stained for endogenous RAB7a (green) and endogenous LAMP2 (red). Co‐localization was analyzed across three independent experiments. A clonal RAB7a knockout cell line was mixed 1:1 with parental HeLa cells and seeded onto coverslips. Following PFA fixation, the mixed cells were stained for endogenous RAB7a (green) and endogenous LAMP2 (red). Note that the RAB7a signal completely disappears in the cells not expressing RAB7a. Parental HeLa cells and clonal VPS35 KO cells were co‐stained for endogenous RAB7a (green) and endogenous TOM20 (red, upper panel) or for endogenous RAB7a and a mCherry‐tagged ER marker (red, lower panel), and co‐localization between RAB7a and the respective marker was analyzed across two independent experiments. To show that RAB7a localizes to the ER and mitochondria, endogenous TOM20 (blue) was co‐stained in the lower panel. Parental HeLa cells and clonal VPS35 and VPS29 KO cells were transduced with a lentivirus expressing GFP‐FIS1TM (eGFP with a C‐terminal mitochondrial targeting sequence and transmembrane domain of the mitochondrial protein FIS1) and disrupted through a fine needle in detergent‐free sucrose buffer followed by isolation of the mitochondria from postnuclear supernatants with GFP‐trap agarose beads. The amount of RAB7 precipitating with the mitochondria was quantified over four independent experiments. Data information: All scale bars = 10 μm, all error bars = SD, and * P
    Figure Legend Snippet: Loss of retromer leads to a pronounced shift in RAB 7 distribution Parental HeLa cells, two clonal VPS35 knockout cell lines, and one clonal VPS29 KO cell line were fixed in PFA and co‐stained for endogenous RAB7a (green) and endogenous LAMP2 (red). Co‐localization was analyzed across three independent experiments. A clonal RAB7a knockout cell line was mixed 1:1 with parental HeLa cells and seeded onto coverslips. Following PFA fixation, the mixed cells were stained for endogenous RAB7a (green) and endogenous LAMP2 (red). Note that the RAB7a signal completely disappears in the cells not expressing RAB7a. Parental HeLa cells and clonal VPS35 KO cells were co‐stained for endogenous RAB7a (green) and endogenous TOM20 (red, upper panel) or for endogenous RAB7a and a mCherry‐tagged ER marker (red, lower panel), and co‐localization between RAB7a and the respective marker was analyzed across two independent experiments. To show that RAB7a localizes to the ER and mitochondria, endogenous TOM20 (blue) was co‐stained in the lower panel. Parental HeLa cells and clonal VPS35 and VPS29 KO cells were transduced with a lentivirus expressing GFP‐FIS1TM (eGFP with a C‐terminal mitochondrial targeting sequence and transmembrane domain of the mitochondrial protein FIS1) and disrupted through a fine needle in detergent‐free sucrose buffer followed by isolation of the mitochondria from postnuclear supernatants with GFP‐trap agarose beads. The amount of RAB7 precipitating with the mitochondria was quantified over four independent experiments. Data information: All scale bars = 10 μm, all error bars = SD, and * P

    Techniques Used: Knock-Out, Gene Knockout, Staining, Expressing, Marker, Transduction, Sequencing, Isolation

    RAB 7 localizes to mitochondria and the ER All images show formaldehyde‐fixed HeLa cells. HeLa cells stained for endogenous RAB7a (green) and endogenous LAMP2 (red). White arrows indicate sites of vesicular RAB7 that appears to be budding from a network of RAB7. Immunofluorescent co‐staining of endogenous RAB7a (green) and the mitochondria marker TOM20 (red). Co‐staining of endogenous RAB7 (green) and the trans ‐Golgi network marker TGN46 (red). Co‐staining of endogenous RAB7 (green) and the ER marker protein disulfide isomerase (PDI, red). Co‐staining of lentivirally expressed GFP‐RAB7a and endogenous TOM20 (red). Co‐staining of endogenous RAB7 (green) and TOM20 (red) in cells treated with Cas9 and a mixture of three gRNAs targeting the RAB7a locus. The Western blot of this cell population shows an almost complete loss of RAB7 in the treated cells compared to parental HeLa cells. GFP‐RAB7 was expressed in RAB7a KO HeLa cells and imaged in live cells using a spinning disk confocal microscope. Mitochondria were visualized with MitoTracker Red. Parental HeLa cells and clonal VPS29 KO cells were co‐stained for endogenous RAB7a (green) and endogenous TOM20 (red), and co‐localization was analyzed across two independent experiments. Data information: All scale bars = 10 μm, all error bars = SD, and * P
    Figure Legend Snippet: RAB 7 localizes to mitochondria and the ER All images show formaldehyde‐fixed HeLa cells. HeLa cells stained for endogenous RAB7a (green) and endogenous LAMP2 (red). White arrows indicate sites of vesicular RAB7 that appears to be budding from a network of RAB7. Immunofluorescent co‐staining of endogenous RAB7a (green) and the mitochondria marker TOM20 (red). Co‐staining of endogenous RAB7 (green) and the trans ‐Golgi network marker TGN46 (red). Co‐staining of endogenous RAB7 (green) and the ER marker protein disulfide isomerase (PDI, red). Co‐staining of lentivirally expressed GFP‐RAB7a and endogenous TOM20 (red). Co‐staining of endogenous RAB7 (green) and TOM20 (red) in cells treated with Cas9 and a mixture of three gRNAs targeting the RAB7a locus. The Western blot of this cell population shows an almost complete loss of RAB7 in the treated cells compared to parental HeLa cells. GFP‐RAB7 was expressed in RAB7a KO HeLa cells and imaged in live cells using a spinning disk confocal microscope. Mitochondria were visualized with MitoTracker Red. Parental HeLa cells and clonal VPS29 KO cells were co‐stained for endogenous RAB7a (green) and endogenous TOM20 (red), and co‐localization was analyzed across two independent experiments. Data information: All scale bars = 10 μm, all error bars = SD, and * P

    Techniques Used: Staining, Marker, Western Blot, Gene Knockout, Microscopy

    RAB 7 activity state controls its localization to the ER , mitochondria, and lysosomes Mitochondria were purified from detergent‐free postnuclear supernatants using magnetic beads coated with a TOM22‐specific antibody from parental HeLa cells and from clonal VPS35 KO cells. The purified mitochondria were then subjected to a marker analysis using the indicated organelle markers. Note that only mitochondria (TOM20) and RAB7 are enriched over the inputs, with lower levels of RAB7 precipitating with the mitochondria of VPS35 KO cells. The quantification of RAB7 was done across three independent mitochondria isolations. RAB7a KO cells transduced with the indicated GFP‐RAB7a variants were fixed and co‐stained for endogenous LAMP2. Note that the inactive RAB7 (T22N) does not localize to lysosomes, whereas the hyperactive variant (Q67L) fully localizes to lysosomes. RAB7a KO cells transduced with the indicated GFP‐RAB7a variants and a mCherry‐ER marker were fixed and co‐stained for endogenous TOM20. RAB7a KO cells were infected with the indicated GFP‐RAB7 variants, labeled with MitoTracker Red, and subjected to live cell imaging using a spinning disk confocal microscope. Data information: All scale bars = 10 μm, and all error bars = SD. Source data are available online for this figure.
    Figure Legend Snippet: RAB 7 activity state controls its localization to the ER , mitochondria, and lysosomes Mitochondria were purified from detergent‐free postnuclear supernatants using magnetic beads coated with a TOM22‐specific antibody from parental HeLa cells and from clonal VPS35 KO cells. The purified mitochondria were then subjected to a marker analysis using the indicated organelle markers. Note that only mitochondria (TOM20) and RAB7 are enriched over the inputs, with lower levels of RAB7 precipitating with the mitochondria of VPS35 KO cells. The quantification of RAB7 was done across three independent mitochondria isolations. RAB7a KO cells transduced with the indicated GFP‐RAB7a variants were fixed and co‐stained for endogenous LAMP2. Note that the inactive RAB7 (T22N) does not localize to lysosomes, whereas the hyperactive variant (Q67L) fully localizes to lysosomes. RAB7a KO cells transduced with the indicated GFP‐RAB7a variants and a mCherry‐ER marker were fixed and co‐stained for endogenous TOM20. RAB7a KO cells were infected with the indicated GFP‐RAB7 variants, labeled with MitoTracker Red, and subjected to live cell imaging using a spinning disk confocal microscope. Data information: All scale bars = 10 μm, and all error bars = SD. Source data are available online for this figure.

    Techniques Used: Activity Assay, Purification, Magnetic Beads, Gene Knockout, Marker, Transduction, Staining, Variant Assay, Infection, Labeling, Live Cell Imaging, Microscopy

    A CRISPR /Cas9 screen identifies TBC 1D5 as the retromer‐associated component that controls RAB 7 activity and localization HeLa cells were co‐transfected with CRISPR/Cas9 constructs targeting the indicated genes and a puromycin resistance marker. Five days after puromycin selection of transfected cells, all cell lines were stained for endogenous RAB7a and the lysosomal marker LAMP2, and co‐localization was quantified across 12 images acquired in two independent experiments. The cell lines described above for panel (A) were lysed, and RAB7a activity was assayed with the GST‐RILP activity assay. Western blotting was used to confirm the efficiency of the CRISPR/CAS9 targeting approach. RILP‐bound RAB7a was quantified over three independent experiments. Methanol‐fixed HeLa cells and VPS35 and TBC1D5 KO cells were co‐stained for endogenous RAB7a (green) and endogenous LAMP2 (red). Methanol‐fixed parental HeLa cells and TBC1D5 KO cells were stained for endogenous VPS35 (green) and LAMP2 (red). Methanol‐fixed parental HeLa and TBC1D5 KO cells were co‐stained for endogenous RAB7a (green) and endogenous VPS35 (red), and co‐localization was quantified over two independent experiments. Data information: All scale bars = 10 μm, all error bars = SD, and * P
    Figure Legend Snippet: A CRISPR /Cas9 screen identifies TBC 1D5 as the retromer‐associated component that controls RAB 7 activity and localization HeLa cells were co‐transfected with CRISPR/Cas9 constructs targeting the indicated genes and a puromycin resistance marker. Five days after puromycin selection of transfected cells, all cell lines were stained for endogenous RAB7a and the lysosomal marker LAMP2, and co‐localization was quantified across 12 images acquired in two independent experiments. The cell lines described above for panel (A) were lysed, and RAB7a activity was assayed with the GST‐RILP activity assay. Western blotting was used to confirm the efficiency of the CRISPR/CAS9 targeting approach. RILP‐bound RAB7a was quantified over three independent experiments. Methanol‐fixed HeLa cells and VPS35 and TBC1D5 KO cells were co‐stained for endogenous RAB7a (green) and endogenous LAMP2 (red). Methanol‐fixed parental HeLa cells and TBC1D5 KO cells were stained for endogenous VPS35 (green) and LAMP2 (red). Methanol‐fixed parental HeLa and TBC1D5 KO cells were co‐stained for endogenous RAB7a (green) and endogenous VPS35 (red), and co‐localization was quantified over two independent experiments. Data information: All scale bars = 10 μm, all error bars = SD, and * P

    Techniques Used: CRISPR, Activity Assay, Transfection, Construct, Marker, Selection, Staining, Western Blot, Gene Knockout

    Control of RAB 7 activity is not required for retromer‐based sorting of integral membrane proteins All images show formaldehyde‐fixed cells. Parental HeLa cells, VPS29 KO cells, and VPS29 KO cells transduced with the indicated VPS29 rescue constructs cells were co‐stained for endogenous GLUT1 (green) and endogenous LAMP2 (red), and co‐localization was quantified over three independent experiments. Parental HeLa cells, VPS29 KO cells, and VPS29 KO cells transduced with the indicated VPS29 rescue constructs were surface‐biotinylated, followed by streptavidin isolation and Western blot‐based quantification of biotinylated surface proteins. Surface GLUT1 was quantified over four independent experiments. RAB7a knockout cells and RAB7 KO cells transduced with the indicated GFP‐RAB7 rescue constructs cells were co‐stained for endogenous GLUT1 (red) and endogenous LAMP2 (blue), and co‐localization was quantified over two independent experiments. Parental HeLa cells, RAB7a knockout cells, and RAB7 KO cells transduced with the indicated GFP‐RAB7 rescue constructs were co‐stained for endogenous CI‐MPR (red) and endogenous TGN46 (blue). Data information: All scale bars = 10 μm, all error bars = SD, and * P
    Figure Legend Snippet: Control of RAB 7 activity is not required for retromer‐based sorting of integral membrane proteins All images show formaldehyde‐fixed cells. Parental HeLa cells, VPS29 KO cells, and VPS29 KO cells transduced with the indicated VPS29 rescue constructs cells were co‐stained for endogenous GLUT1 (green) and endogenous LAMP2 (red), and co‐localization was quantified over three independent experiments. Parental HeLa cells, VPS29 KO cells, and VPS29 KO cells transduced with the indicated VPS29 rescue constructs were surface‐biotinylated, followed by streptavidin isolation and Western blot‐based quantification of biotinylated surface proteins. Surface GLUT1 was quantified over four independent experiments. RAB7a knockout cells and RAB7 KO cells transduced with the indicated GFP‐RAB7 rescue constructs cells were co‐stained for endogenous GLUT1 (red) and endogenous LAMP2 (blue), and co‐localization was quantified over two independent experiments. Parental HeLa cells, RAB7a knockout cells, and RAB7 KO cells transduced with the indicated GFP‐RAB7 rescue constructs were co‐stained for endogenous CI‐MPR (red) and endogenous TGN46 (blue). Data information: All scale bars = 10 μm, all error bars = SD, and * P

    Techniques Used: Activity Assay, Gene Knockout, Transduction, Construct, Staining, Isolation, Western Blot, Knock-Out

    Retromer controls RAB 7 activity levels and mobility/membrane turnover GDP‐locked (inactive) GFP‐RAB7‐T22N and GTP‐locked (constitutively active) GFP‐RAB7‐Q67L were lentivirally expressed in RAB7 KO cells and co‐stained with the mitochondrial marker TOM20 (red). Co‐localization was analyzed over two independent experiments with 10 images each. Lysates from parental HeLa cells and clonal VPS35 KO cells were probed with immobilized GST‐RILP protein, and GST‐RILP‐bound (active) RAB7a was detected and quantified by fluorescent Western blotting across three independent experiments. Lysates from parental HeLa cells and clonal VPS29 KO cells were probed with immobilized GST‐RILP protein, and GST‐RILP‐bound (active) RAB7a was detected and quantified by fluorescent Western blotting across three independent experiments. Lysates from parental HeLa cells and clonal VPS29 KO cells and VPS29 KO cells with lentivirally re‐expressed VPS29‐myc were probed with immobilized GST‐RILP protein, and GST‐RILP‐bound (active) RAB7a was detected and quantified by fluorescent Western blotting across three independent experiments. Lentivirally expressed GFP‐RAB7 was precipitated from parental and from VPS35 KO cells, and the precipitates were analyzed for the presence of the endogenous RAB‐chaperone GDI2. Lentivirally expressed GFP‐GDI1 was precipitated from parental and from VPS35 KO cells, and the precipitates were analyzed for the presence of endogenous RAB14 and endogenous RAB7a. GFP‐RAB7 was transduced into parental HeLa cells and VPS35 KO cells and analyzed for its mobility/membrane turnover using FRAP imaging in live cells. The recovery kinetics were obtained by averaging 15 FRAP recoveries acquired in two independent experiments. GFP‐RAB7 was transduced into parental HeLa cells and VPS35 KO cells and analyzed for its mobility/membrane turnover using FLIP imaging in live cells. The depletion kinetics (in area A, as indicated) were obtained by averaging 18 FLIP depletions acquired in two independent experiments. Data information: All scale bars = 10 μm, all error bars = SD, and * P
    Figure Legend Snippet: Retromer controls RAB 7 activity levels and mobility/membrane turnover GDP‐locked (inactive) GFP‐RAB7‐T22N and GTP‐locked (constitutively active) GFP‐RAB7‐Q67L were lentivirally expressed in RAB7 KO cells and co‐stained with the mitochondrial marker TOM20 (red). Co‐localization was analyzed over two independent experiments with 10 images each. Lysates from parental HeLa cells and clonal VPS35 KO cells were probed with immobilized GST‐RILP protein, and GST‐RILP‐bound (active) RAB7a was detected and quantified by fluorescent Western blotting across three independent experiments. Lysates from parental HeLa cells and clonal VPS29 KO cells were probed with immobilized GST‐RILP protein, and GST‐RILP‐bound (active) RAB7a was detected and quantified by fluorescent Western blotting across three independent experiments. Lysates from parental HeLa cells and clonal VPS29 KO cells and VPS29 KO cells with lentivirally re‐expressed VPS29‐myc were probed with immobilized GST‐RILP protein, and GST‐RILP‐bound (active) RAB7a was detected and quantified by fluorescent Western blotting across three independent experiments. Lentivirally expressed GFP‐RAB7 was precipitated from parental and from VPS35 KO cells, and the precipitates were analyzed for the presence of the endogenous RAB‐chaperone GDI2. Lentivirally expressed GFP‐GDI1 was precipitated from parental and from VPS35 KO cells, and the precipitates were analyzed for the presence of endogenous RAB14 and endogenous RAB7a. GFP‐RAB7 was transduced into parental HeLa cells and VPS35 KO cells and analyzed for its mobility/membrane turnover using FRAP imaging in live cells. The recovery kinetics were obtained by averaging 15 FRAP recoveries acquired in two independent experiments. GFP‐RAB7 was transduced into parental HeLa cells and VPS35 KO cells and analyzed for its mobility/membrane turnover using FLIP imaging in live cells. The depletion kinetics (in area A, as indicated) were obtained by averaging 18 FLIP depletions acquired in two independent experiments. Data information: All scale bars = 10 μm, all error bars = SD, and * P

    Techniques Used: Activity Assay, Gene Knockout, Staining, Marker, Western Blot, Imaging

    TBC 1D5 and retromer cooperate in the control of RAB 7 activity and mobility GFP‐trap IPs of the indicated GFP‐tagged VPS29 (upper panel) or TBC1D5 (lower panel) constructs confirm that the VPS29‐L152E and the TBC1D5‐L142E mutant lose binding to each other. Parental HeLa cells, VPS29 KO cells, and VPS29 KO cells transduced with the indicated VPS29 rescue constructs were lysed, and the activity of RAB7a was analyzed with the GST‐RILP assay. RAB7a activity was quantified over four independent experiments. Note that re‐expression of both VPS29 variants fully restores the level of endogenous VPS35. PFA‐fixed parental HeLa cells, VPS29 KO cells, and VPS29 KO cells transduced with the indicated VPS29 rescue constructs were co‐stained for endogenous RAB7a (green) and endogenous LAMP2 (red), and co‐localization was quantified over three independent experiments. Parental HeLa cells and VPS29 KO cells as well as VPS29 KO cells transduced with the indicated VPS29 rescue constructs were transduced with GFP‐RAB7, and RAB7 mobility/turnover was analyzed by FRAP in living cells. The displayed recovery kinetics were obtained by averaging kinetics from fifteen FRAP recoveries per condition acquired in two independent experiments. Parental HeLa cells, VPS29 KO cells, and VPS29 KO cells transduced with the indicated VPS29 rescue constructs cells were lysed, and the activity of RAB7a was analyzed with the GST‐RILP assay. RAB7a activity was quantified over four independent experiments. Parental HeLa cells and clonal TBC1D5 KO cells and TBC1D5 KO cells transduced with the indicated GFP‐TBC1D5 rescue constructs cells were lysed, and the activity of RAB7a was analyzed with the GST‐RILP assay. Data information: All scale bars = 10 μm, all error bars = SD, and * P
    Figure Legend Snippet: TBC 1D5 and retromer cooperate in the control of RAB 7 activity and mobility GFP‐trap IPs of the indicated GFP‐tagged VPS29 (upper panel) or TBC1D5 (lower panel) constructs confirm that the VPS29‐L152E and the TBC1D5‐L142E mutant lose binding to each other. Parental HeLa cells, VPS29 KO cells, and VPS29 KO cells transduced with the indicated VPS29 rescue constructs were lysed, and the activity of RAB7a was analyzed with the GST‐RILP assay. RAB7a activity was quantified over four independent experiments. Note that re‐expression of both VPS29 variants fully restores the level of endogenous VPS35. PFA‐fixed parental HeLa cells, VPS29 KO cells, and VPS29 KO cells transduced with the indicated VPS29 rescue constructs were co‐stained for endogenous RAB7a (green) and endogenous LAMP2 (red), and co‐localization was quantified over three independent experiments. Parental HeLa cells and VPS29 KO cells as well as VPS29 KO cells transduced with the indicated VPS29 rescue constructs were transduced with GFP‐RAB7, and RAB7 mobility/turnover was analyzed by FRAP in living cells. The displayed recovery kinetics were obtained by averaging kinetics from fifteen FRAP recoveries per condition acquired in two independent experiments. Parental HeLa cells, VPS29 KO cells, and VPS29 KO cells transduced with the indicated VPS29 rescue constructs cells were lysed, and the activity of RAB7a was analyzed with the GST‐RILP assay. RAB7a activity was quantified over four independent experiments. Parental HeLa cells and clonal TBC1D5 KO cells and TBC1D5 KO cells transduced with the indicated GFP‐TBC1D5 rescue constructs cells were lysed, and the activity of RAB7a was analyzed with the GST‐RILP assay. Data information: All scale bars = 10 μm, all error bars = SD, and * P

    Techniques Used: Activity Assay, Construct, Mutagenesis, Binding Assay, Gene Knockout, Transduction, Expressing, Staining

    Loss of TBC 1D5 does not perturb retromer‐mediated sorting of GLUT 1 and CI ‐ MPR HeLa, SNX5/6 double KO, and TBC1D5 KO cells were fixed in PFA and stained for CI‐MPR (red) and the trans ‐Golgi network marker TGN46. Note that knockout of SNX5/6 results in dispersal of CI‐MPR from the TGN. HeLa, VPS29, and TBC1D5 KO cells were fixed in PFA and stained for GLUT1 (green) and LAMP2 (red). Co‐localization between GLUT1 and LAMP2 was quantified over ten images for each condition. HeLa cells were transfected with a pool of three distinct CRISPR/Cas9 plasmids targeting the RAB7a gene at three sites together with a puromycin resistance plasmid. Following puromycin selection and 5 days of incubation, the RAB7a KO cells were transduced with lentiviruses expressing the indicated GFP‐RAB7 proteins. A Western blot for RAB7 confirms high knockout efficiency and demonstrates that the GFP‐RAB7 variants are expressed at low endogenous levels. Parental HeLa cells and clonal VPS29 and VPS35 KO cells transduced with GFP‐LC3b were starved in EBSS for 4 h without (EBSS) or with addition of bafilomycin A1 to the EBSS (EBSS + Bafi) to assess autophagic flux. Autophagic flux was calculated from the increase in lipidated GFP‐LC3 in the EBSS + bafilomycin samples compared to the EBSS‐only sample. The quantification was done across four independent experiments. Data information: All scale bars = 10 μm, all error bars = SD, and * P
    Figure Legend Snippet: Loss of TBC 1D5 does not perturb retromer‐mediated sorting of GLUT 1 and CI ‐ MPR HeLa, SNX5/6 double KO, and TBC1D5 KO cells were fixed in PFA and stained for CI‐MPR (red) and the trans ‐Golgi network marker TGN46. Note that knockout of SNX5/6 results in dispersal of CI‐MPR from the TGN. HeLa, VPS29, and TBC1D5 KO cells were fixed in PFA and stained for GLUT1 (green) and LAMP2 (red). Co‐localization between GLUT1 and LAMP2 was quantified over ten images for each condition. HeLa cells were transfected with a pool of three distinct CRISPR/Cas9 plasmids targeting the RAB7a gene at three sites together with a puromycin resistance plasmid. Following puromycin selection and 5 days of incubation, the RAB7a KO cells were transduced with lentiviruses expressing the indicated GFP‐RAB7 proteins. A Western blot for RAB7 confirms high knockout efficiency and demonstrates that the GFP‐RAB7 variants are expressed at low endogenous levels. Parental HeLa cells and clonal VPS29 and VPS35 KO cells transduced with GFP‐LC3b were starved in EBSS for 4 h without (EBSS) or with addition of bafilomycin A1 to the EBSS (EBSS + Bafi) to assess autophagic flux. Autophagic flux was calculated from the increase in lipidated GFP‐LC3 in the EBSS + bafilomycin samples compared to the EBSS‐only sample. The quantification was done across four independent experiments. Data information: All scale bars = 10 μm, all error bars = SD, and * P

    Techniques Used: Gene Knockout, Staining, Marker, Knock-Out, Transfection, CRISPR, Plasmid Preparation, Selection, Incubation, Transduction, Expressing, Western Blot

    2) Product Images from "HIV-1 exploits importin 7 to maximize nuclear import of its DNA genome"

    Article Title: HIV-1 exploits importin 7 to maximize nuclear import of its DNA genome

    Journal: Retrovirology

    doi: 10.1186/1742-4690-6-11

    Generation of stable imp7 knock down (KD) cells . (A) Left panels: Western blot with an anti-imp7 antibody and an anti-Ran antibody on total cell extracts obtained from a low passage polyclonal population of DxR KD (lane 1) and imp7 KD HeLa cells (lane 2), a polyclonal population of DxR KD (lane 3), imp7KD (lane 4) and the same imp7 KD population expressing an imp7 cDNA with two silent mutations making it resistant to the shRNA (imp7+7R) (lane 5). Note that cells in lanes 3 to 5 were grown for 4 weeks to allow for selection of the imp7+7R line. Right panel: Western blot with an anti-imp7 antibody and an anti-Ran antibody on total cell extracts obtained from a polyclonal population of DxR KD cells (lane 1) and imp7 KD Jurkat cells (lane 2). (B) DxR KD (shDxR), imp7 KD (shimp7) and imp7 back complemented (shimp7+7R) HeLa cells were plated onto 24-well plates to have the same confluency by the next day and infected with five fold serial dilutions of a VSV-G pseudotyped HIV-1 vector (pHR') expressing GFP. Twenty-four hours after infection the percentage of GFP+ cells was measured by flow cytometry. (C) Cells were infected with three fold serial dilutions of a VSV-G pseudotyped SIVmac vector expressing GFP and analysed as in (B). Similar results were obtained in least three independent experiments using different virus stocks. (D) Western blot with an anti-imp7 antibody and an anti-Ran antibody on total cell extracts obtained from a polyclonal population of DxR KD HeLa cells (lane 1) and three different imp7 KD clones (lane 2, clone 2; lane 3, clone 4; lane 4, clone 8). The bands were scanned and the intensity of the imp7 band relative to Ran is shown below each sample. (E) DxR KD cells and imp7 KD clonal cell populations were infected with a VSV-G pseudotyped HIV-1 vector (pHR') or SIVmac vector expressing GFP at an MOI of 0.03 and the percentage of GFP+ cells counted 24 hours after infection by flow cytometry. Data are expressed as average percentage of infection relative the parent line control (shDxR) ± SD of three independent experiments. (F) DxR KD and imp7 KD Jurkat cells were infected with three fold serial dilutions of a VSV-G pseudotyped HIV-1 vector (pCSGW) expressing GFP and the percentage of GFP+ cells counted 24 hours after infection by flow cytometry. Similar results were obtained in two additional experiments using different virus stocks.
    Figure Legend Snippet: Generation of stable imp7 knock down (KD) cells . (A) Left panels: Western blot with an anti-imp7 antibody and an anti-Ran antibody on total cell extracts obtained from a low passage polyclonal population of DxR KD (lane 1) and imp7 KD HeLa cells (lane 2), a polyclonal population of DxR KD (lane 3), imp7KD (lane 4) and the same imp7 KD population expressing an imp7 cDNA with two silent mutations making it resistant to the shRNA (imp7+7R) (lane 5). Note that cells in lanes 3 to 5 were grown for 4 weeks to allow for selection of the imp7+7R line. Right panel: Western blot with an anti-imp7 antibody and an anti-Ran antibody on total cell extracts obtained from a polyclonal population of DxR KD cells (lane 1) and imp7 KD Jurkat cells (lane 2). (B) DxR KD (shDxR), imp7 KD (shimp7) and imp7 back complemented (shimp7+7R) HeLa cells were plated onto 24-well plates to have the same confluency by the next day and infected with five fold serial dilutions of a VSV-G pseudotyped HIV-1 vector (pHR') expressing GFP. Twenty-four hours after infection the percentage of GFP+ cells was measured by flow cytometry. (C) Cells were infected with three fold serial dilutions of a VSV-G pseudotyped SIVmac vector expressing GFP and analysed as in (B). Similar results were obtained in least three independent experiments using different virus stocks. (D) Western blot with an anti-imp7 antibody and an anti-Ran antibody on total cell extracts obtained from a polyclonal population of DxR KD HeLa cells (lane 1) and three different imp7 KD clones (lane 2, clone 2; lane 3, clone 4; lane 4, clone 8). The bands were scanned and the intensity of the imp7 band relative to Ran is shown below each sample. (E) DxR KD cells and imp7 KD clonal cell populations were infected with a VSV-G pseudotyped HIV-1 vector (pHR') or SIVmac vector expressing GFP at an MOI of 0.03 and the percentage of GFP+ cells counted 24 hours after infection by flow cytometry. Data are expressed as average percentage of infection relative the parent line control (shDxR) ± SD of three independent experiments. (F) DxR KD and imp7 KD Jurkat cells were infected with three fold serial dilutions of a VSV-G pseudotyped HIV-1 vector (pCSGW) expressing GFP and the percentage of GFP+ cells counted 24 hours after infection by flow cytometry. Similar results were obtained in two additional experiments using different virus stocks.

    Techniques Used: Western Blot, Expressing, shRNA, Selection, Infection, Plasmid Preparation, Flow Cytometry, Cytometry, Clone Assay

    3) Product Images from "Large-scale identification of wheat genes resistant to cereal cyst nematode Heterodera avenae using comparative transcriptomic analysis"

    Article Title: Large-scale identification of wheat genes resistant to cereal cyst nematode Heterodera avenae using comparative transcriptomic analysis

    Journal: BMC Genomics

    doi: 10.1186/s12864-015-2037-8

    Production of ROS and induction of ROS-producing genes within VP1620 respond to H. avenae infestation: a ROS contents within infected and uninfected roots of VP1620 at three time points after CCN infection. The ROS content was determined by a luminol-chemiluminescence assay (_0, no CCN inoculation; _CN, CCN inoculated lines; error bars represent the SE ( n = 3)). b Identification of ROS-producing genes in VP1620 significantly induced after H. avenae infestation and relative expression detection assayed by qRT-PCR. The expression level of each ROS-producing gene in I_0 was arbitrarily set to 1. Abbreviations: POX, Class III Peroxidase; LOX, Lipoxygenase. Mean and standard errors were determined using data from three independent replicates
    Figure Legend Snippet: Production of ROS and induction of ROS-producing genes within VP1620 respond to H. avenae infestation: a ROS contents within infected and uninfected roots of VP1620 at three time points after CCN infection. The ROS content was determined by a luminol-chemiluminescence assay (_0, no CCN inoculation; _CN, CCN inoculated lines; error bars represent the SE ( n = 3)). b Identification of ROS-producing genes in VP1620 significantly induced after H. avenae infestation and relative expression detection assayed by qRT-PCR. The expression level of each ROS-producing gene in I_0 was arbitrarily set to 1. Abbreviations: POX, Class III Peroxidase; LOX, Lipoxygenase. Mean and standard errors were determined using data from three independent replicates

    Techniques Used: Infection, Chemiluminescence Immunoassay, Expressing, Quantitative RT-PCR

    4) Product Images from "Evolutionarily Conserved Roles of the Dicer Helicase Domain in Regulating RNA Interference Processing"

    Article Title: Evolutionarily Conserved Roles of the Dicer Helicase Domain in Regulating RNA Interference Processing

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M114.589051

    Domain architecture and alignment of StDicer-1 and StDicer-2 with other eukaryotic Dicers. A, schematic representation of the domain organization and phylogenetic relationship of StDicer-1 and StDicer-2 to other eukaryotic Dicers. The left side of the panel is the phylogenetic relationship between Dicers from S. thermophile (StDicer) and Dicers from humans (HsDicer), D. melanogaster (DmDicer), S. pombe (SpDicer). On the right side of the panel is the domain architecture of human and StDicer. The helicase domain is organized into three lobes termed HEL1, HEL2i, and HEL2. The gray dashed lines represented large regions of HsDicer that are absent in StDicer. B, multiple sequence alignment output from ClustalX comparing the amino acid sequence of S. thermophile dicer-1 ( St_Dicer1 ) and dicer-2 ( St_Dicer2 ), which are outlined in red , and closely related proteins from human ( Hs_Dicer ), D. melanogaster ( Dm_Dicer1 , Dm_Dicer2 ), N. crassa ( Nc_Dicer1 , Nc_Dicer2 ), S. pombe ( Sp_Dicer ), and Giardia intestinalis ( Gi_Dicer ). Dark blue represents positions that have a single, fully conserved residue with the two lighter blue colors indicating strongly conserved and weakly conserved residues. The helicase domain is one of the most conserved regions among full-length Dicers. The highlighted motifs are involved in binding an NTP, typically ATP, and the energy of hydrolysis is used to dynamically interact with RNA. S. thermophile Dicers contain intact RNase III domains and the residues highlighted by the red asterisks are involved in coordinating Mg2+ in the G. intestinalis structure.
    Figure Legend Snippet: Domain architecture and alignment of StDicer-1 and StDicer-2 with other eukaryotic Dicers. A, schematic representation of the domain organization and phylogenetic relationship of StDicer-1 and StDicer-2 to other eukaryotic Dicers. The left side of the panel is the phylogenetic relationship between Dicers from S. thermophile (StDicer) and Dicers from humans (HsDicer), D. melanogaster (DmDicer), S. pombe (SpDicer). On the right side of the panel is the domain architecture of human and StDicer. The helicase domain is organized into three lobes termed HEL1, HEL2i, and HEL2. The gray dashed lines represented large regions of HsDicer that are absent in StDicer. B, multiple sequence alignment output from ClustalX comparing the amino acid sequence of S. thermophile dicer-1 ( St_Dicer1 ) and dicer-2 ( St_Dicer2 ), which are outlined in red , and closely related proteins from human ( Hs_Dicer ), D. melanogaster ( Dm_Dicer1 , Dm_Dicer2 ), N. crassa ( Nc_Dicer1 , Nc_Dicer2 ), S. pombe ( Sp_Dicer ), and Giardia intestinalis ( Gi_Dicer ). Dark blue represents positions that have a single, fully conserved residue with the two lighter blue colors indicating strongly conserved and weakly conserved residues. The helicase domain is one of the most conserved regions among full-length Dicers. The highlighted motifs are involved in binding an NTP, typically ATP, and the energy of hydrolysis is used to dynamically interact with RNA. S. thermophile Dicers contain intact RNase III domains and the residues highlighted by the red asterisks are involved in coordinating Mg2+ in the G. intestinalis structure.

    Techniques Used: Sequencing, Binding Assay

    5) Product Images from "Extragenic Accumulation of RNA Polymerase II Enhances Transcription by RNA Polymerase III"

    Article Title: Extragenic Accumulation of RNA Polymerase II Enhances Transcription by RNA Polymerase III

    Journal: PLoS Genetics

    doi: 10.1371/journal.pgen.0030212

    Low α-Amanitin Concentrations Inhibit U6 snRNA Maxigene Expression HeLa cells were transiently transfected with 1 μg U6–1 , U6–8 , and U6–9 maxigenes carrying a 9 bp insertion and treated simultaneously with 50 nM α-amanitin oleate for 20 h or left untreated. Expression of U6 maxigenes, LDHA, 28S rRNA, 5S rRNA and pre-tRNA Tyr was measured by gene-specific reverse transcription, followed by conventional PCR and agarose gel electrophoresis (A) or qPCR (B). qPCR values were normalized to 28S rRNA and expression levels are expressed relative to untreated controls. Error bars represent the SEM. The data represents the average of at least three independent experiments.
    Figure Legend Snippet: Low α-Amanitin Concentrations Inhibit U6 snRNA Maxigene Expression HeLa cells were transiently transfected with 1 μg U6–1 , U6–8 , and U6–9 maxigenes carrying a 9 bp insertion and treated simultaneously with 50 nM α-amanitin oleate for 20 h or left untreated. Expression of U6 maxigenes, LDHA, 28S rRNA, 5S rRNA and pre-tRNA Tyr was measured by gene-specific reverse transcription, followed by conventional PCR and agarose gel electrophoresis (A) or qPCR (B). qPCR values were normalized to 28S rRNA and expression levels are expressed relative to untreated controls. Error bars represent the SEM. The data represents the average of at least three independent experiments.

    Techniques Used: Expressing, Transfection, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Electrophoresis, Real-time Polymerase Chain Reaction

    Pol III Transcribes U6–1 Maxigene Primer extension analysis of RNA from HeLa cells cotransfected with GFP expression plasmid and U6–1 maxigene. (A) Design of the two U6–1 maxigenes with insertions at +66 and +87 bp (white boxes) to allow for maxigene-specific reverse transcription. Construct “U6–1 maxiT” harbors five thymidine residues directly downstream of the linker insertion; “U6–1 MaxiC” harbors the same primer binding site but lacks the T's. The cross-hatched box represents the reverse primer specific for the downstream insertion, yielding extension products of either 114 bp (U6–1 maxiT) or 109 bp (U6–1 maxiC). Grey filled box and black filled box represent reverse primers specific for upstream insertion with or without T residues, respectively, leading to extension products of 83 bp (U6–1 maxiT) or 79 bp (U6–1 maxiC). Primer extension of mRNA derived from cotransfected GFP plasmid yields a 158 bp product. Primer extension products were separated on a denaturing polyacrylamide gel and exposed on a PhosphorImager. (B) A representative gel is shown.
    Figure Legend Snippet: Pol III Transcribes U6–1 Maxigene Primer extension analysis of RNA from HeLa cells cotransfected with GFP expression plasmid and U6–1 maxigene. (A) Design of the two U6–1 maxigenes with insertions at +66 and +87 bp (white boxes) to allow for maxigene-specific reverse transcription. Construct “U6–1 maxiT” harbors five thymidine residues directly downstream of the linker insertion; “U6–1 MaxiC” harbors the same primer binding site but lacks the T's. The cross-hatched box represents the reverse primer specific for the downstream insertion, yielding extension products of either 114 bp (U6–1 maxiT) or 109 bp (U6–1 maxiC). Grey filled box and black filled box represent reverse primers specific for upstream insertion with or without T residues, respectively, leading to extension products of 83 bp (U6–1 maxiT) or 79 bp (U6–1 maxiC). Primer extension of mRNA derived from cotransfected GFP plasmid yields a 158 bp product. Primer extension products were separated on a denaturing polyacrylamide gel and exposed on a PhosphorImager. (B) A representative gel is shown.

    Techniques Used: Expressing, Plasmid Preparation, Construct, Binding Assay, Derivative Assay

    α-Amanitin Reduces Endogenous U6 snRNA Expression HeLa cells were transfected with a tRNA Arg maxigene and 16 h later treated with 10 μg/ml α-amanitin or left untreated. After 3 h, 250 μCi [ 32 P] orthophosphate was added to the medium for 6 h. Total RNA was collected and 5S rRNA along with tRNA Arg , U2 and U6 snRNAs were hybrid selected with biotinylated complementary oligos. Hybrid-selected RNA was separated on a denaturating polyacrylamide gel and exposed to PhosphorImager plates. The 5S rRNA bands served as a loading control. Three biological replicates were analyzed and a representative gel is shown.
    Figure Legend Snippet: α-Amanitin Reduces Endogenous U6 snRNA Expression HeLa cells were transfected with a tRNA Arg maxigene and 16 h later treated with 10 μg/ml α-amanitin or left untreated. After 3 h, 250 μCi [ 32 P] orthophosphate was added to the medium for 6 h. Total RNA was collected and 5S rRNA along with tRNA Arg , U2 and U6 snRNAs were hybrid selected with biotinylated complementary oligos. Hybrid-selected RNA was separated on a denaturating polyacrylamide gel and exposed to PhosphorImager plates. The 5S rRNA bands served as a loading control. Three biological replicates were analyzed and a representative gel is shown.

    Techniques Used: Expressing, Transfection

    6) Product Images from "Chemotherapy resistance and metastasis-promoting effects of thyroid hormone in hepatocarcinoma cells are mediated by suppression of FoxO1 and Bim pathway"

    Article Title: Chemotherapy resistance and metastasis-promoting effects of thyroid hormone in hepatocarcinoma cells are mediated by suppression of FoxO1 and Bim pathway

    Journal: Cell Death & Disease

    doi: 10.1038/cddis.2016.227

    T 3 /TR represses Bim protein expression via downregulation of FoxO1. ( a ) RNA from TR-overexpressing or control J7 cells in the absence or presence of T 3 for 24 or 48 h was prepared prior to qRT-PCR analysis of FoxO1 mRNA expression. Values (means±S.E.M.) are shown as fold induction, compared with 0 nM T 3 . All assays were repeated at least three times (** P
    Figure Legend Snippet: T 3 /TR represses Bim protein expression via downregulation of FoxO1. ( a ) RNA from TR-overexpressing or control J7 cells in the absence or presence of T 3 for 24 or 48 h was prepared prior to qRT-PCR analysis of FoxO1 mRNA expression. Values (means±S.E.M.) are shown as fold induction, compared with 0 nM T 3 . All assays were repeated at least three times (** P

    Techniques Used: Expressing, Quantitative RT-PCR

    Effect of T 3 on Bim mRNA and protein expression in hepatoma cell lines. ( a ) Detection of TR protein in TR-overexpressing or control J7 and Hep3B cell lines. ( b ) RNA from TR-overexpressing or control cell lines maintained in T 3 -depleted ([T 3 ]=0 nM) or supplemented medium ([T 3 ]=1 or 10 nM) for 24 or 48 h was prepared prior to qRT-PCR analysis of Bim mRNA. Values (means±S.E.M.) are shown as fold induction relative to 0 nM T 3 . All assays were repeated at least three times. ** P
    Figure Legend Snippet: Effect of T 3 on Bim mRNA and protein expression in hepatoma cell lines. ( a ) Detection of TR protein in TR-overexpressing or control J7 and Hep3B cell lines. ( b ) RNA from TR-overexpressing or control cell lines maintained in T 3 -depleted ([T 3 ]=0 nM) or supplemented medium ([T 3 ]=1 or 10 nM) for 24 or 48 h was prepared prior to qRT-PCR analysis of Bim mRNA. Values (means±S.E.M.) are shown as fold induction relative to 0 nM T 3 . All assays were repeated at least three times. ** P

    Techniques Used: Expressing, Quantitative RT-PCR

    7) Product Images from "Delineating the structural, functional and evolutionary relationships of sucrose phosphate synthase gene family II in wheat and related grasses"

    Article Title: Delineating the structural, functional and evolutionary relationships of sucrose phosphate synthase gene family II in wheat and related grasses

    Journal: BMC Plant Biology

    doi: 10.1186/1471-2229-10-134

    Relative expression levels of SPSII homoeologues in cv 'Prinz' . Relative expression levels of SPSII shown are based on delta Ct calculation. To compare data from different PCR runs or cDNA samples, C T values for all genes were normalized to the C T value of the housekeeping gene (serine/threonine protein phosphatase, TaPP2A) included in each PCR run. The expression level of each gene of interest (GOI) is presented as 2 -ΔCT , where ΔC T = C TGOI - C TREF . Mean values were assessed from three biological replicates for seedling materials and caryopses sampled four days after anthesis, and from two replicates for caryopses sampled eight days after anthesis. Error bars indicate standard deviations from the mean.
    Figure Legend Snippet: Relative expression levels of SPSII homoeologues in cv 'Prinz' . Relative expression levels of SPSII shown are based on delta Ct calculation. To compare data from different PCR runs or cDNA samples, C T values for all genes were normalized to the C T value of the housekeeping gene (serine/threonine protein phosphatase, TaPP2A) included in each PCR run. The expression level of each gene of interest (GOI) is presented as 2 -ΔCT , where ΔC T = C TGOI - C TREF . Mean values were assessed from three biological replicates for seedling materials and caryopses sampled four days after anthesis, and from two replicates for caryopses sampled eight days after anthesis. Error bars indicate standard deviations from the mean.

    Techniques Used: Expressing, Polymerase Chain Reaction

    8) Product Images from "Interferon alpha impairs insulin production in human beta cells via endoplasmic reticulum stress"

    Article Title: Interferon alpha impairs insulin production in human beta cells via endoplasmic reticulum stress

    Journal:

    doi: 10.1016/j.jaut.2017.02.002

    Effect of IFNα on BiP induction in human islets and EndoC-βH1 cells (A–D) Human islets and EndoC-βH1 cells were pretreated overnight with 2.5 mM PBA or with 1 mM TUDCA or with medium only (negative control) and then cultured in presence of IFNα 1000 U/ml for 48 hours. (A) The expression levels of mRNAs for BiP were determined by real-time RT-PCR analysis of total RNA from three different preparations of human islets or EndoC-βH1 cells treated as above. mRNA levels in treated cells are relative to those in vehicle-treated cells (CTRL). Bars represent means ± SEM from three independent experiments. ***p < 0.001 compared to CTRL cells. (B–D) Human islets and EndoC-βH1 cells (from five different preparations) were solubilized and equal amount of proteins (50 μg per sample) were analyzed by immunoblotting. Filters were probed with antibodies against BiP. Representative images are shown. Band intensities were quantified by densitometry using ImageJ software.
    Figure Legend Snippet: Effect of IFNα on BiP induction in human islets and EndoC-βH1 cells (A–D) Human islets and EndoC-βH1 cells were pretreated overnight with 2.5 mM PBA or with 1 mM TUDCA or with medium only (negative control) and then cultured in presence of IFNα 1000 U/ml for 48 hours. (A) The expression levels of mRNAs for BiP were determined by real-time RT-PCR analysis of total RNA from three different preparations of human islets or EndoC-βH1 cells treated as above. mRNA levels in treated cells are relative to those in vehicle-treated cells (CTRL). Bars represent means ± SEM from three independent experiments. ***p < 0.001 compared to CTRL cells. (B–D) Human islets and EndoC-βH1 cells (from five different preparations) were solubilized and equal amount of proteins (50 μg per sample) were analyzed by immunoblotting. Filters were probed with antibodies against BiP. Representative images are shown. Band intensities were quantified by densitometry using ImageJ software.

    Techniques Used: Negative Control, Cell Culture, Expressing, Quantitative RT-PCR, Software

    9) Product Images from "Wnt signaling controls pro-regenerative Collagen XII in functional spinal cord regeneration in zebrafish"

    Article Title: Wnt signaling controls pro-regenerative Collagen XII in functional spinal cord regeneration in zebrafish

    Journal: Nature Communications

    doi: 10.1038/s41467-017-00143-0

    CRISPR/Cas9-mediated disruption of col12a1a/b leads to depletion of mRNA and impaired axonal regeneration. a Cartoon showing strategy used for CRISPR/Cas9-mediated col12a1a/b gene disruption. cas9 mRNA and small guide-RNA (gRNA) targeting col12a1a and col12a1b were co-injected into the zygote. Crispants were analysed for col12a1a/b mRNA levels and axonal regeneration as indicated in the timeline. b Restriction fragment length polymorphisms (RFLP) analysis reveals efficient somatic mutation in the gRNA target site (indicated by resistance to restriction endonuclease digest; arrowheads) in both col12a1 paralogs after microinjection. c col12a1a/b Crispants exhibit reduced developmental col12a1a and col12a1b mRNA expression, determined by quantitative RT-PCR. Representative plot from three independent experiments for each mRNA are shown. mRNA levels in gfp gRNA-injected control animals were set to 100%. d col12a1a/b Crispants exhibit reduced col12a1a and col12a1b mRNA levels after lesion, determined by quantification of fluorescent in situ hybridization signal in the lesion site ( t -test: ** P
    Figure Legend Snippet: CRISPR/Cas9-mediated disruption of col12a1a/b leads to depletion of mRNA and impaired axonal regeneration. a Cartoon showing strategy used for CRISPR/Cas9-mediated col12a1a/b gene disruption. cas9 mRNA and small guide-RNA (gRNA) targeting col12a1a and col12a1b were co-injected into the zygote. Crispants were analysed for col12a1a/b mRNA levels and axonal regeneration as indicated in the timeline. b Restriction fragment length polymorphisms (RFLP) analysis reveals efficient somatic mutation in the gRNA target site (indicated by resistance to restriction endonuclease digest; arrowheads) in both col12a1 paralogs after microinjection. c col12a1a/b Crispants exhibit reduced developmental col12a1a and col12a1b mRNA expression, determined by quantitative RT-PCR. Representative plot from three independent experiments for each mRNA are shown. mRNA levels in gfp gRNA-injected control animals were set to 100%. d col12a1a/b Crispants exhibit reduced col12a1a and col12a1b mRNA levels after lesion, determined by quantification of fluorescent in situ hybridization signal in the lesion site ( t -test: ** P

    Techniques Used: CRISPR, Injection, Mutagenesis, Expressing, Quantitative RT-PCR, In Situ Hybridization

    10) Product Images from "Cargo-selective SNX-BAR proteins mediate retromer trimer independent retrograde transport"

    Article Title: Cargo-selective SNX-BAR proteins mediate retromer trimer independent retrograde transport

    Journal: The Journal of Cell Biology

    doi: 10.1083/jcb.201702137

    The SNX-BAR proteins are needed to prevent lysosomal degradation of the activated IGF1R. (A) HeLa cells, clonal SNX1/2 and SNX5/6 double-KO cells, and two VPS35-KO cell lines were serum starved and treated with 10 nM IGF-1 for the indicated periods. The level of endogenous IGF1R and the INSR were detected by Western blotting, and the IGF1R degradation kinetics were quantified over four independent experiments. (B) HeLa cells, clonal SNX1/2, and SNX5/6 double-KO cells as well as VPS35-KO cell lines were transduced with a lentiviruses expressing human IGF1R-myc, serum starved, and then treated with 10 nM IGF-1 for 1 h. The IGF1R and endogenous LAMP1 were stained by immunofluorescence, and the colocalization was quantified across 16 images acquired in two independent experiments. (C) HeLa cells and SNX1/2 and SNX5/6 double-KO cell lines were serum starved and treated with 5 µg/ml insulin for the indicated periods, and the level of the endogenous INSR was quantified by Western blotting over three independent experiments. (D) SNX5/6 double-KO cells were transduced with lentiviruses expressing GFP-SNX5 or GFP-SNX6 and with GFP only as a control. The cells were serum starved and treated with 10 nM IGF-1 for the indicated periods, followed by Western blot–based detection of the levels of the endogenous IGF1R. The level of the endogenous IGF1R in starved cells (top bar graph) as well as the degradation kinetics in IGF-1–treated cells were quantified over four independent experiments. (E) HeLa cells and clonal SNX5/6 double-KO cells were serum starved and treated with 10 nM IGF-1 for the indicated periods. One set of the SNX5/6 KO cells was treated with the lysosomal inhibitor bafilomycin-A1. The degradation kinetics were quantified over four independent experiments. Bars, 10 µm. Error bars indicate SD. *, P
    Figure Legend Snippet: The SNX-BAR proteins are needed to prevent lysosomal degradation of the activated IGF1R. (A) HeLa cells, clonal SNX1/2 and SNX5/6 double-KO cells, and two VPS35-KO cell lines were serum starved and treated with 10 nM IGF-1 for the indicated periods. The level of endogenous IGF1R and the INSR were detected by Western blotting, and the IGF1R degradation kinetics were quantified over four independent experiments. (B) HeLa cells, clonal SNX1/2, and SNX5/6 double-KO cells as well as VPS35-KO cell lines were transduced with a lentiviruses expressing human IGF1R-myc, serum starved, and then treated with 10 nM IGF-1 for 1 h. The IGF1R and endogenous LAMP1 were stained by immunofluorescence, and the colocalization was quantified across 16 images acquired in two independent experiments. (C) HeLa cells and SNX1/2 and SNX5/6 double-KO cell lines were serum starved and treated with 5 µg/ml insulin for the indicated periods, and the level of the endogenous INSR was quantified by Western blotting over three independent experiments. (D) SNX5/6 double-KO cells were transduced with lentiviruses expressing GFP-SNX5 or GFP-SNX6 and with GFP only as a control. The cells were serum starved and treated with 10 nM IGF-1 for the indicated periods, followed by Western blot–based detection of the levels of the endogenous IGF1R. The level of the endogenous IGF1R in starved cells (top bar graph) as well as the degradation kinetics in IGF-1–treated cells were quantified over four independent experiments. (E) HeLa cells and clonal SNX5/6 double-KO cells were serum starved and treated with 10 nM IGF-1 for the indicated periods. One set of the SNX5/6 KO cells was treated with the lysosomal inhibitor bafilomycin-A1. The degradation kinetics were quantified over four independent experiments. Bars, 10 µm. Error bars indicate SD. *, P

    Techniques Used: Gene Knockout, Western Blot, Transduction, Expressing, Staining, Immunofluorescence

    The CI-MPR accumulates in VPS35-positive sorting endosomes but does not localize to the VPS35-decorated subdomain. (A) Immunofluorescent staining of endogenous CI-MPR (red) and endogenous EEA1 (green) in HeLa cells and clonal VPS35, SNX1/2, and SNX5/6 double-KO cell lines. The colocalization was quantified over three independent experiments. (B) Immunofluorescent staining of endogenous CI-MPR (red) and endogenous VPS35 (green) in HeLa cells and clonal SNX1/2 and SNX5/6 double-KO cell lines. The colocalization was quantified over three independent experiments. (C) Costaining of indicated endogenous proteins in WT HeLa cells and analysis of colocalization by conventional confocal microscopy and STED superresolution microscopy. The colocalization between CI-MPR and VPS35 and CI-MPR and SNX1 was quantified across 12 images acquired in two independent experiments with conventional confocal microscopy. Bars: (main images) 10 µm; (insets) 3 µm. Error bars indicate SD. *, P
    Figure Legend Snippet: The CI-MPR accumulates in VPS35-positive sorting endosomes but does not localize to the VPS35-decorated subdomain. (A) Immunofluorescent staining of endogenous CI-MPR (red) and endogenous EEA1 (green) in HeLa cells and clonal VPS35, SNX1/2, and SNX5/6 double-KO cell lines. The colocalization was quantified over three independent experiments. (B) Immunofluorescent staining of endogenous CI-MPR (red) and endogenous VPS35 (green) in HeLa cells and clonal SNX1/2 and SNX5/6 double-KO cell lines. The colocalization was quantified over three independent experiments. (C) Costaining of indicated endogenous proteins in WT HeLa cells and analysis of colocalization by conventional confocal microscopy and STED superresolution microscopy. The colocalization between CI-MPR and VPS35 and CI-MPR and SNX1 was quantified across 12 images acquired in two independent experiments with conventional confocal microscopy. Bars: (main images) 10 µm; (insets) 3 µm. Error bars indicate SD. *, P

    Techniques Used: Staining, Gene Knockout, Confocal Microscopy, Microscopy

    KO of the SNX-BAR proteins causes a complete loss of retrograde sorting of the CI-MPR in HeLa cells. (A) Immunofluorescent analysis of the endogenous CI-MPR (red) and endogenous TGN46 (green) in clonal VPS35 and SNX1/2 and SNX5/6 double-KO cells. The colocalization was quantified over three independent experiments. (B) Uptake assay with an antibody against the extracellular domain of the endogenous CI-MPR over 30 and 60 min of uptake at 37°C. Delivery of the antibody/receptor duplex to the TGN was analyzed through costaining of the internalized antibody (red) with endogenous TGN46 (green). The colocalization was quantified over three independent experiments. (C) GFP-tagged SNX5 and GFP-tagged SNX6 were lentivirally expressed in SNX5/6 double-KO cells lines, and localization of endogenous CI-MPR (red) and endogenous TGN46 (blue) was quantified over three independent experiments. Bars, 10 µm. Error bars indicate SD. *, P
    Figure Legend Snippet: KO of the SNX-BAR proteins causes a complete loss of retrograde sorting of the CI-MPR in HeLa cells. (A) Immunofluorescent analysis of the endogenous CI-MPR (red) and endogenous TGN46 (green) in clonal VPS35 and SNX1/2 and SNX5/6 double-KO cells. The colocalization was quantified over three independent experiments. (B) Uptake assay with an antibody against the extracellular domain of the endogenous CI-MPR over 30 and 60 min of uptake at 37°C. Delivery of the antibody/receptor duplex to the TGN was analyzed through costaining of the internalized antibody (red) with endogenous TGN46 (green). The colocalization was quantified over three independent experiments. (C) GFP-tagged SNX5 and GFP-tagged SNX6 were lentivirally expressed in SNX5/6 double-KO cells lines, and localization of endogenous CI-MPR (red) and endogenous TGN46 (blue) was quantified over three independent experiments. Bars, 10 µm. Error bars indicate SD. *, P

    Techniques Used: Gene Knockout

    TALEN-mediated deletion of VPS35 in U2OS and knockdown of VPS35 in HeLa cells does not cause retrograde sorting defects of CI-MPR. (A) Western blot analysis of clonal U2OS osteosarcoma cells with a TALEN-mediated disruption of exon 4 of the VPS35 gene. The graph displays the level of endogenous CI-MPR/GAPDH quantified over three independent experiments. (B) Immunofluorescent staining of endogenous CI-MPR and endogenous TGN46 in human U2OS, with colocalization quantified over three independent experiments. (C) CI-MPR degradation experiment in U2OS cells treated with the ribosome inhibitor cycloheximide for the indicated periods. The abundance of CI-MPR was adjusted by the GAPDH signal and quantified over three independent experiments. (D) Immunofluorescent staining of endogenous GLUT1 (red) and endogenous LAMP1 (green) in HeLa cells treated with scrambled and VPS35-specific siRNA. The colocalization between LAMP1 and GLUT1 was quantified across 12 images acquired in two independent experiments. The knockdown (KD) efficiency was verified by Western blotting. (E) Immunofluorescent staining of endogenous CI-MPR (red) with the lysosomal marker LAMP1 (blue) and the TGN marker TGN46 (green). The colocalization of CI-MPR with the two markers was quantified over three independent experiments. Bars, 10 µm. Error bars indicate SD. *, P
    Figure Legend Snippet: TALEN-mediated deletion of VPS35 in U2OS and knockdown of VPS35 in HeLa cells does not cause retrograde sorting defects of CI-MPR. (A) Western blot analysis of clonal U2OS osteosarcoma cells with a TALEN-mediated disruption of exon 4 of the VPS35 gene. The graph displays the level of endogenous CI-MPR/GAPDH quantified over three independent experiments. (B) Immunofluorescent staining of endogenous CI-MPR and endogenous TGN46 in human U2OS, with colocalization quantified over three independent experiments. (C) CI-MPR degradation experiment in U2OS cells treated with the ribosome inhibitor cycloheximide for the indicated periods. The abundance of CI-MPR was adjusted by the GAPDH signal and quantified over three independent experiments. (D) Immunofluorescent staining of endogenous GLUT1 (red) and endogenous LAMP1 (green) in HeLa cells treated with scrambled and VPS35-specific siRNA. The colocalization between LAMP1 and GLUT1 was quantified across 12 images acquired in two independent experiments. The knockdown (KD) efficiency was verified by Western blotting. (E) Immunofluorescent staining of endogenous CI-MPR (red) with the lysosomal marker LAMP1 (blue) and the TGN marker TGN46 (green). The colocalization of CI-MPR with the two markers was quantified over three independent experiments. Bars, 10 µm. Error bars indicate SD. *, P

    Techniques Used: Western Blot, Staining, Marker

    Genomic deletion of VPS35 does not cause retrograde sorting defects of CI-MPR. (A) Western blot of lysates from clonal HeLa cell lines with a disruption of the VPS35 gene in exon 5 or exon 8 (left). Immunofluorescent staining of endogenous GLUT1 (red) and endogenous LAMP1 (green) in HeLa cells and in two distinct VPS35-KO cell lines (right). (B) Staining of endogenous CI-MPR (red) and TGN46 (green) in parental HeLa cells and two VPS35-KO cell lines. The colocalization (coloc) between the TGN marker TGN46 and CI-MPR was quantified over three independent experiments. (C) Uptake assay with an antibody against the extracellular domain of CI-MPR in HeLa and VPS35-KO cell lines. Delivery of the CI-MPR–antibody complex (red) to the TGN46 (green)-labeled TGN was quantified after 30 and 60 min of uptake at 37°C over three independent experiments. (D) CI-MPR degradation assays in parental HeLa and VPS35-KO cells treated with the ribosomal inhibitor cycloheximide for indicated time points (left). Graph shows the degradation kinetics averaged over four independent experiments. Immunofluorescence of endogenous CI-MPR (red) and endogenous LAMP1 (green) in HeLa and VPS35-KO cell lines quantified over three independent experiments (right). Bars, 10 µm. Error bars indicate SD. *, P
    Figure Legend Snippet: Genomic deletion of VPS35 does not cause retrograde sorting defects of CI-MPR. (A) Western blot of lysates from clonal HeLa cell lines with a disruption of the VPS35 gene in exon 5 or exon 8 (left). Immunofluorescent staining of endogenous GLUT1 (red) and endogenous LAMP1 (green) in HeLa cells and in two distinct VPS35-KO cell lines (right). (B) Staining of endogenous CI-MPR (red) and TGN46 (green) in parental HeLa cells and two VPS35-KO cell lines. The colocalization (coloc) between the TGN marker TGN46 and CI-MPR was quantified over three independent experiments. (C) Uptake assay with an antibody against the extracellular domain of CI-MPR in HeLa and VPS35-KO cell lines. Delivery of the CI-MPR–antibody complex (red) to the TGN46 (green)-labeled TGN was quantified after 30 and 60 min of uptake at 37°C over three independent experiments. (D) CI-MPR degradation assays in parental HeLa and VPS35-KO cells treated with the ribosomal inhibitor cycloheximide for indicated time points (left). Graph shows the degradation kinetics averaged over four independent experiments. Immunofluorescence of endogenous CI-MPR (red) and endogenous LAMP1 (green) in HeLa and VPS35-KO cell lines quantified over three independent experiments (right). Bars, 10 µm. Error bars indicate SD. *, P

    Techniques Used: Western Blot, Staining, Gene Knockout, Marker, Labeling, Immunofluorescence

    Genomic deletion of the SNX-BAR binding site abrogates retrograde transport of endogenous as well as reexpressed CI-MPR. (A) CRISPR-Cas9 was used to introduce a 6-aa deletion of the WLM SNX-BAR binding motif into the endogenous CI-MPR locus of a HeLa cell line. The immunofluorescence shows the colocalization between endogenous CI-MPR and the TGN marker TGN46. (B) 3D reconstruction of the CI-MPR and TGN46 staining in a HeLa cell and in a cell carrying the SNX-BAR–binding site deletion. The colocalization between CI-MPR and TGN46 was quantified over three independent experiments. (C) Reexpression of WT and WLM-AAA CI-MPR in a CI-MPR–KO HeLa cell line. The transfected cells were stained for CI-MPR and endogenous TGN46, and colocalization was quantified over three independent experiments. Bars, 10 µm. Error bars indicate SD. *, P
    Figure Legend Snippet: Genomic deletion of the SNX-BAR binding site abrogates retrograde transport of endogenous as well as reexpressed CI-MPR. (A) CRISPR-Cas9 was used to introduce a 6-aa deletion of the WLM SNX-BAR binding motif into the endogenous CI-MPR locus of a HeLa cell line. The immunofluorescence shows the colocalization between endogenous CI-MPR and the TGN marker TGN46. (B) 3D reconstruction of the CI-MPR and TGN46 staining in a HeLa cell and in a cell carrying the SNX-BAR–binding site deletion. The colocalization between CI-MPR and TGN46 was quantified over three independent experiments. (C) Reexpression of WT and WLM-AAA CI-MPR in a CI-MPR–KO HeLa cell line. The transfected cells were stained for CI-MPR and endogenous TGN46, and colocalization was quantified over three independent experiments. Bars, 10 µm. Error bars indicate SD. *, P

    Techniques Used: Binding Assay, CRISPR, Introduce, Immunofluorescence, Marker, Staining, Gene Knockout, Transfection

    11) Product Images from "Enhanced Cardiac Function in Gravin Mutant Mice Involves Alterations in the ?-Adrenergic Receptor Signaling Cascade"

    Article Title: Enhanced Cardiac Function in Gravin Mutant Mice Involves Alterations in the ?-Adrenergic Receptor Signaling Cascade

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0074784

    Phosphorylation of cardiac Myosin Binding Protein C in response to acute ISO stimulation in WT and gravin-t/t mice. ( A ) Representative western blots of the three phosphorylation sites of cardiac myosin binding protein C (cMyBPC) as well as total cMyBPC in heart homogenates isolated from WT and gravin-t/t mice following acute vehicle or ISO infusion (10µg/g/min); (Lane 1: WT VEH; Lane 2: WT ISO; Lane 3: gravin-t/t VEH; Lane 4: gravin-t/t ISO). ( B - D ) The bar graphs show the ratio of phosphorylated to total protein for p273, p282 and p302 respectively normalized to WT vehicle. Data are expressed as the mean ± S.E.M.; n= 4 to 6 samples; *p
    Figure Legend Snippet: Phosphorylation of cardiac Myosin Binding Protein C in response to acute ISO stimulation in WT and gravin-t/t mice. ( A ) Representative western blots of the three phosphorylation sites of cardiac myosin binding protein C (cMyBPC) as well as total cMyBPC in heart homogenates isolated from WT and gravin-t/t mice following acute vehicle or ISO infusion (10µg/g/min); (Lane 1: WT VEH; Lane 2: WT ISO; Lane 3: gravin-t/t VEH; Lane 4: gravin-t/t ISO). ( B - D ) The bar graphs show the ratio of phosphorylated to total protein for p273, p282 and p302 respectively normalized to WT vehicle. Data are expressed as the mean ± S.E.M.; n= 4 to 6 samples; *p

    Techniques Used: Binding Assay, Mouse Assay, Western Blot, Isolation

    12) Product Images from "Dermal fibroblasts induce cell cycle arrest and block epithelial–mesenchymal transition to inhibit the early stage melanoma development"

    Article Title: Dermal fibroblasts induce cell cycle arrest and block epithelial–mesenchymal transition to inhibit the early stage melanoma development

    Journal: Cancer Medicine

    doi: 10.1002/cam4.707

    Loss of β ‐catenin in dermal fibroblasts suppresses cell growth and reduces the production of chemical factors and ECM proteins. Dermal fibroblasts were separated from the dermis of 4‐day‐old Ctnnb1 fl/fl , Col1a2‐CreER (Bcat/Fb), and control Ctnnb1 +/fl ; Col1α2‐CreER (Fb) mice and cultured in Dulbecco's Modified Eagle's Medium (DMEM) medium for 2 passages. Purified fibroblasts were then seeded at a density of 3 × 10 5 cells/dish in 10 cm tissue culture dish and treated with 100 ng/mL 4‐OHT for 48 h. (A) Left: Greatly decreased β ‐catenin expression in mutant Ctnnb1 fl/fl , Col1a2‐CreER fibroblasts (Bcat/Fb) was confirmed by western blot analysis. Right: The intensity of β ‐catenin band was shown by scanning X‐ray film and normalized to β ‐actin band. (B) immunostaining with an anti‐ β ‐catenin antibody showed the loss of β ‐catenin expression in a majority of Bcat/Fb fibroblasts. (C) Growth of Bcat/Fb and control Fb fibroblasts was compared by cell number counting. Briefly, 20,000 control or mutant cells were seeded in one well of 24‐well plate (3 repeats) and grew for a period of 4 days. Cells were collected at 24, 48, and 96 h to count numbers using hemocytometer. Data are representative of three independent experiments. (D) Cell cycle analysis of Fb and Bcat/Fb fibroblasts after 48‐h culture by flow cytometry indicating percentages of cells at different phases of cell cycle based on DNA content. n = 3. (E) Gene expression analysis of chemical factor and extracellular matrix (ECM) protein genes produced by Fb and Bcat/Fb dermal fibroblasts. Data are representative of at least three independent experiments. Fibroblasts isolated from individual P40 mice were analyzed for gene expression by qPCR (mean ± SEM, n = 5). The Y ‐axis represents fold change in expression with wild‐type levels set to 1.
    Figure Legend Snippet: Loss of β ‐catenin in dermal fibroblasts suppresses cell growth and reduces the production of chemical factors and ECM proteins. Dermal fibroblasts were separated from the dermis of 4‐day‐old Ctnnb1 fl/fl , Col1a2‐CreER (Bcat/Fb), and control Ctnnb1 +/fl ; Col1α2‐CreER (Fb) mice and cultured in Dulbecco's Modified Eagle's Medium (DMEM) medium for 2 passages. Purified fibroblasts were then seeded at a density of 3 × 10 5 cells/dish in 10 cm tissue culture dish and treated with 100 ng/mL 4‐OHT for 48 h. (A) Left: Greatly decreased β ‐catenin expression in mutant Ctnnb1 fl/fl , Col1a2‐CreER fibroblasts (Bcat/Fb) was confirmed by western blot analysis. Right: The intensity of β ‐catenin band was shown by scanning X‐ray film and normalized to β ‐actin band. (B) immunostaining with an anti‐ β ‐catenin antibody showed the loss of β ‐catenin expression in a majority of Bcat/Fb fibroblasts. (C) Growth of Bcat/Fb and control Fb fibroblasts was compared by cell number counting. Briefly, 20,000 control or mutant cells were seeded in one well of 24‐well plate (3 repeats) and grew for a period of 4 days. Cells were collected at 24, 48, and 96 h to count numbers using hemocytometer. Data are representative of three independent experiments. (D) Cell cycle analysis of Fb and Bcat/Fb fibroblasts after 48‐h culture by flow cytometry indicating percentages of cells at different phases of cell cycle based on DNA content. n = 3. (E) Gene expression analysis of chemical factor and extracellular matrix (ECM) protein genes produced by Fb and Bcat/Fb dermal fibroblasts. Data are representative of at least three independent experiments. Fibroblasts isolated from individual P40 mice were analyzed for gene expression by qPCR (mean ± SEM, n = 5). The Y ‐axis represents fold change in expression with wild‐type levels set to 1.

    Techniques Used: Mouse Assay, Cell Culture, Modification, Purification, Expressing, Mutagenesis, Western Blot, Immunostaining, Cell Cycle Assay, Flow Cytometry, Cytometry, Produced, Isolation, Real-time Polymerase Chain Reaction

    13) Product Images from "Human Papillomavirus E2 Regulates SRSF3 (SRp20) To Promote Capsid Protein Expression in Infected Differentiated Keratinocytes"

    Article Title: Human Papillomavirus E2 Regulates SRSF3 (SRp20) To Promote Capsid Protein Expression in Infected Differentiated Keratinocytes

    Journal:

    doi: 10.1128/JVI.03073-15

    SRSF3 controls levels of the E4^ L1 mRNA. (A) Schematic diagram of the HPV16 genome. Open reading frames are represented with light gray boxes with the gene names beneath. Promoters are indicated with arrowheads. Polyadenylation sites are indicated with downward arrows [Poly(A)E/L ]. The major late mRNA splicing events with the open reading frames (dark gray boxes), and introns (dark gray lines) are indicated below the genome map. Each mRNA is shown truncated at the 5′ end to indicate the presence of several possible initiation sites for the transcription of these mRNAs . The open reading frames in each mRNA are indicated on the right-hand side. (B) Western blot analysis of levels of SRSF1 and SRSF3 in NIKS16 cells following siRNA knockdown. siSRSF1, siRNA against SRSF1; siSRSF3, siRNA against SRSF3; siCntrl, control siRNA. GAPDH was detected as a protein loading control. (C) RT-PCR detection of HPV late mRNAs type B (upper gel) or type C (lower gel) in cDNA synthesized from RNA isolated from the same cell populations analyzed in panel B. Cntrl, control siRNA; SRSF1, siRNA against SRSF1; SRSF3, siRNA against SRSF3; RT, reverse transcriptase; M, 1-kb DNA marker ladder. GAPDH was amplified as an internal control for RNA concentrations. (D) Relative levels of E4^ L1 spliced mRNA B compared to GAPDH mRNA determined by qPCR. The means and standard deviations from three separate experiments are shown. (E) Relative levels of unspliced L2L1 mRNAs compared to GAPDH mRNA, as determined by qPCR. The means and standard deviations from three separate experiments are shown. P values were calculated using a Student t test.
    Figure Legend Snippet: SRSF3 controls levels of the E4^ L1 mRNA. (A) Schematic diagram of the HPV16 genome. Open reading frames are represented with light gray boxes with the gene names beneath. Promoters are indicated with arrowheads. Polyadenylation sites are indicated with downward arrows [Poly(A)E/L ]. The major late mRNA splicing events with the open reading frames (dark gray boxes), and introns (dark gray lines) are indicated below the genome map. Each mRNA is shown truncated at the 5′ end to indicate the presence of several possible initiation sites for the transcription of these mRNAs . The open reading frames in each mRNA are indicated on the right-hand side. (B) Western blot analysis of levels of SRSF1 and SRSF3 in NIKS16 cells following siRNA knockdown. siSRSF1, siRNA against SRSF1; siSRSF3, siRNA against SRSF3; siCntrl, control siRNA. GAPDH was detected as a protein loading control. (C) RT-PCR detection of HPV late mRNAs type B (upper gel) or type C (lower gel) in cDNA synthesized from RNA isolated from the same cell populations analyzed in panel B. Cntrl, control siRNA; SRSF1, siRNA against SRSF1; SRSF3, siRNA against SRSF3; RT, reverse transcriptase; M, 1-kb DNA marker ladder. GAPDH was amplified as an internal control for RNA concentrations. (D) Relative levels of E4^ L1 spliced mRNA B compared to GAPDH mRNA determined by qPCR. The means and standard deviations from three separate experiments are shown. (E) Relative levels of unspliced L2L1 mRNAs compared to GAPDH mRNA, as determined by qPCR. The means and standard deviations from three separate experiments are shown. P values were calculated using a Student t test.

    Techniques Used: Western Blot, Reverse Transcription Polymerase Chain Reaction, Synthesized, Isolation, Marker, Amplification, Real-time Polymerase Chain Reaction

    14) Product Images from ""

    Article Title:

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M900519200

    Host acylation of AvrPphB is required for avirulence activity in Arabidopsis plants carrying PBS1 . A , adult Col-0 leaves were syringe infiltrated (opposite to the marked leaf half) with ∼3.75 × 10 7 cfu/ml P. syringae pv. tomato DC3000 ( Pst ) or P. fluorescens pLN1965 ( Pf ) strains expressing AvrPphB or ORF4. Also, plants were inoculated with 10 m m MgCl 2 ( Mock ) or strains carrying the pVSP61 empty vector ( EV ). Ratios below each leaf indicate the number of HR positive leaves/total number of leaves inoculated. B , transgenic pbs1–1 : PBS1-HA plants were inoculated as in A with the indicated Pst strains. Leaf tissue was harvested 14 h.p.i., homogenized, and 10 μg of total protein was subjected to SDS-PAGE. Blots were analyzed by anti-HA Western blotting ( WB ). Three individual T 2 plants were assayed for each infection condition and produced identical results. C , Col-0 or pbs1-1 plants were inoculated as described in A with Pst strains carrying the indicated avrPphB alleles (Gly-63, myristoylation site; Cys-64, palmitoylation site; Cys-98, catalytic cysteine). Data were collected 20 h.p.i. and are representative of two independent experiments. D , Pst strains carrying the indicated alleles were grown in Hrp-inducing minimal media. Cultures were partitioned into cell-bound and secreted fractions by centrifugation. Protein samples were subjected to SDS-PAGE, blotted, and probed with antibodies against AvrPphB or NPTII (control for nonspecific lysis). E , Arabidopsis seedlings were inoculated by dipping with Pst strains (∼2.5 × 10 7 cfu/ml) carrying the indicated effector alleles. At day 0 ( white bars ) or day 3 ( black bars ) the bacteria were extracted and quantified. Data are represented as the mean ± S.E. of four technical replicates. The experiment was repeated twice with similar results. F , Arabidopsis seedlings were inoculated as described in E with the indicated Pst strains. Tissue was harvested 24 h.p.i. and RNA was subjected to reverse transcriptase-qPCR analysis using PR1 and TUBULIN3 specific primers. PR1 mRNA levels (relative to TUB3 ) were calibrated to mock-treated samples (2 −ΔΔCt ). Data are represented as the mean ± S.E. of at least 5 biological replicates from two independent experiments.
    Figure Legend Snippet: Host acylation of AvrPphB is required for avirulence activity in Arabidopsis plants carrying PBS1 . A , adult Col-0 leaves were syringe infiltrated (opposite to the marked leaf half) with ∼3.75 × 10 7 cfu/ml P. syringae pv. tomato DC3000 ( Pst ) or P. fluorescens pLN1965 ( Pf ) strains expressing AvrPphB or ORF4. Also, plants were inoculated with 10 m m MgCl 2 ( Mock ) or strains carrying the pVSP61 empty vector ( EV ). Ratios below each leaf indicate the number of HR positive leaves/total number of leaves inoculated. B , transgenic pbs1–1 : PBS1-HA plants were inoculated as in A with the indicated Pst strains. Leaf tissue was harvested 14 h.p.i., homogenized, and 10 μg of total protein was subjected to SDS-PAGE. Blots were analyzed by anti-HA Western blotting ( WB ). Three individual T 2 plants were assayed for each infection condition and produced identical results. C , Col-0 or pbs1-1 plants were inoculated as described in A with Pst strains carrying the indicated avrPphB alleles (Gly-63, myristoylation site; Cys-64, palmitoylation site; Cys-98, catalytic cysteine). Data were collected 20 h.p.i. and are representative of two independent experiments. D , Pst strains carrying the indicated alleles were grown in Hrp-inducing minimal media. Cultures were partitioned into cell-bound and secreted fractions by centrifugation. Protein samples were subjected to SDS-PAGE, blotted, and probed with antibodies against AvrPphB or NPTII (control for nonspecific lysis). E , Arabidopsis seedlings were inoculated by dipping with Pst strains (∼2.5 × 10 7 cfu/ml) carrying the indicated effector alleles. At day 0 ( white bars ) or day 3 ( black bars ) the bacteria were extracted and quantified. Data are represented as the mean ± S.E. of four technical replicates. The experiment was repeated twice with similar results. F , Arabidopsis seedlings were inoculated as described in E with the indicated Pst strains. Tissue was harvested 24 h.p.i. and RNA was subjected to reverse transcriptase-qPCR analysis using PR1 and TUBULIN3 specific primers. PR1 mRNA levels (relative to TUB3 ) were calibrated to mock-treated samples (2 −ΔΔCt ). Data are represented as the mean ± S.E. of at least 5 biological replicates from two independent experiments.

    Techniques Used: Activity Assay, Expressing, Plasmid Preparation, Transgenic Assay, Hemagglutination Assay, SDS Page, Western Blot, Infection, Produced, Centrifugation, Lysis, Real-time Polymerase Chain Reaction

    15) Product Images from "Role of HCV Core gene of genotype 1a and 3a and host gene Cox-2 in HCV-induced pathogenesis"

    Article Title: Role of HCV Core gene of genotype 1a and 3a and host gene Cox-2 in HCV-induced pathogenesis

    Journal: Virology Journal

    doi: 10.1186/1743-422X-8-155

    Combined effect of Cox-2 and HCV 3a Core siRNAs on Cox-2, iNOS, VEGF and p-Akt gene expression . (A) Huh-7 cells were transfected with HCV 3a Core expression vector (C) or mock-treated (M) along with or without siRNAs (Csi27 and COXsi) alone or in combination (Csi27+COXsi) for 48 hrs. Total RNA was quantified by Real-Time PCR and is shown as fold induction for Cox-2, iNOS and VEGF genes using their gene specific primers. (B) Western blot analysis of Huh-7 cells treated with and without Core, Cox-2 and combined siRNA was carried out using specific antibodies. Three independent experiments with triplicate determinations were performed. Error bars indicate mean S.D, * p
    Figure Legend Snippet: Combined effect of Cox-2 and HCV 3a Core siRNAs on Cox-2, iNOS, VEGF and p-Akt gene expression . (A) Huh-7 cells were transfected with HCV 3a Core expression vector (C) or mock-treated (M) along with or without siRNAs (Csi27 and COXsi) alone or in combination (Csi27+COXsi) for 48 hrs. Total RNA was quantified by Real-Time PCR and is shown as fold induction for Cox-2, iNOS and VEGF genes using their gene specific primers. (B) Western blot analysis of Huh-7 cells treated with and without Core, Cox-2 and combined siRNA was carried out using specific antibodies. Three independent experiments with triplicate determinations were performed. Error bars indicate mean S.D, * p

    Techniques Used: Expressing, Transfection, Plasmid Preparation, Real-time Polymerase Chain Reaction, Western Blot

    HCV 3a Core-specific siRNA inhibit expression of genes involved in HCV pathogenesis . Huh-7 cells were transfected with HCV 3a Core expression vector or mock along with or without siRNA. (A) Dose dependent mRNA expression of HCV 3a Core gene as a result of 10 μM, 20 μM and 40 μM of siRNAs for 48 hrs. Cells were harvested and relative RNA levels in PCR Csi27 and Csi352 siRNAs tranfected cells were determined using semi-quantitative PCR. Expression levels for mock-transfected (M), HCV 3a Core expression plasmid (C), scramble siRNA (SC) and GAPDH are also shown. (B) Silencing effect of HCV 3a Core gene on the RNA expression levels of cellular genes (Cox-2, iNOS and VEGF) 48 hrs post transfection on Real-Time PCR using gene specific primers in comparison to mock was performed. GAPDH was used as internal control. Three independent experiments were performed having triplicate samples. Error bars indicate, mean S.D, *p
    Figure Legend Snippet: HCV 3a Core-specific siRNA inhibit expression of genes involved in HCV pathogenesis . Huh-7 cells were transfected with HCV 3a Core expression vector or mock along with or without siRNA. (A) Dose dependent mRNA expression of HCV 3a Core gene as a result of 10 μM, 20 μM and 40 μM of siRNAs for 48 hrs. Cells were harvested and relative RNA levels in PCR Csi27 and Csi352 siRNAs tranfected cells were determined using semi-quantitative PCR. Expression levels for mock-transfected (M), HCV 3a Core expression plasmid (C), scramble siRNA (SC) and GAPDH are also shown. (B) Silencing effect of HCV 3a Core gene on the RNA expression levels of cellular genes (Cox-2, iNOS and VEGF) 48 hrs post transfection on Real-Time PCR using gene specific primers in comparison to mock was performed. GAPDH was used as internal control. Three independent experiments were performed having triplicate samples. Error bars indicate, mean S.D, *p

    Techniques Used: Expressing, Transfection, Plasmid Preparation, Polymerase Chain Reaction, Real-time Polymerase Chain Reaction, RNA Expression

    16) Product Images from "Differential ratio amplicons (Ramp) for the evaluation of RNA integrity extracted from complex environmental samples"

    Article Title: Differential ratio amplicons (Ramp) for the evaluation of RNA integrity extracted from complex environmental samples

    Journal: Environmental Microbiology

    doi: 10.1111/1462-2920.14516

    Effect of UV degradation on RNA integrity measured via the RIN (A), with RT‐Q‐PCR (B) and RIN versus R amp (C). For RIN, RNA integrity visualized in virtual gels (A; left) and electropherogram (A; right) are displayed against incubation period under UV. RNA ladder shows size in nucleotides (nt). B. Effect of degradation on transcript quantification; Amp 1–3: average Ct ( n = 3) of one of the three possible glnA amplicons; amoA : average amoA Ct ( n = 3) of the Bacterial amoA transcript; 16S rRNA : average 16S rRNA Ct ( n = 3) of the bacterial 16S rRNA transcript. Effect of RNA degradation on R amp index is presented in figure C; for comparison, RIN values were also plotted. Greek Letters indicate the result of TukeyHSD tests (points with different letters had values significantly different from each other using 0.05 as threshold for the p value).
    Figure Legend Snippet: Effect of UV degradation on RNA integrity measured via the RIN (A), with RT‐Q‐PCR (B) and RIN versus R amp (C). For RIN, RNA integrity visualized in virtual gels (A; left) and electropherogram (A; right) are displayed against incubation period under UV. RNA ladder shows size in nucleotides (nt). B. Effect of degradation on transcript quantification; Amp 1–3: average Ct ( n = 3) of one of the three possible glnA amplicons; amoA : average amoA Ct ( n = 3) of the Bacterial amoA transcript; 16S rRNA : average 16S rRNA Ct ( n = 3) of the bacterial 16S rRNA transcript. Effect of RNA degradation on R amp index is presented in figure C; for comparison, RIN values were also plotted. Greek Letters indicate the result of TukeyHSD tests (points with different letters had values significantly different from each other using 0.05 as threshold for the p value).

    Techniques Used: Polymerase Chain Reaction, Incubation

    Effect of heat degradation on RNA integrity measured via the RIN (A), with RT‐Q‐PCR (B) and RIN versus R amp (C). For RIN, RNA integrity visualized in virtual gels (A; left) and electropherogram (A; right) are displayed against incubation period at 90°C. RNA ladder shows size in nucleotides (nt). B. Effect of degradation on transcript quantification; Amp 1–3: average Ct ( n = 3) of one of the three possible glnA amplicons; amoA : average amoA Ct ( n = 3) of the Bacterial amoA transcript; 16S rRNA : average 16S rRNA Ct ( n = 3) of the bacterial 16S rRNA transcript. Effect of RNA degradation on R amp index is presented in figure C; for comparison, RIN values were also plotted. Greek Letters indicate the result of TukeyHSD tests (points with different letters had values significantly different from each other using 0.05 as threshold for the p value).
    Figure Legend Snippet: Effect of heat degradation on RNA integrity measured via the RIN (A), with RT‐Q‐PCR (B) and RIN versus R amp (C). For RIN, RNA integrity visualized in virtual gels (A; left) and electropherogram (A; right) are displayed against incubation period at 90°C. RNA ladder shows size in nucleotides (nt). B. Effect of degradation on transcript quantification; Amp 1–3: average Ct ( n = 3) of one of the three possible glnA amplicons; amoA : average amoA Ct ( n = 3) of the Bacterial amoA transcript; 16S rRNA : average 16S rRNA Ct ( n = 3) of the bacterial 16S rRNA transcript. Effect of RNA degradation on R amp index is presented in figure C; for comparison, RIN values were also plotted. Greek Letters indicate the result of TukeyHSD tests (points with different letters had values significantly different from each other using 0.05 as threshold for the p value).

    Techniques Used: Polymerase Chain Reaction, Incubation

    Effect of RNase I degradation on RNA integrity measured via the RIN (A), with RT‐Q‐PCR (B) and RIN versus R amp (C). For RIN, RNA integrity visualized in virtual gels (A; left) and electropherogram (A; right) are displayed against incubation period with RNase I . RNA ladder shows size in nucleotides (nt). B. Effect of degradation on transcript quantification; Amp 1–3: average Ct ( n = 3) of one of the three possible glnA amplicons; amoA : average amoA Ct ( n = 3) of the Bacterial amoA transcript; 16S rRNA : average 16S rRNA Ct ( n = 3) of the bacterial 16S rRNA transcript. Effect of RNA degradation on R amp index is presented in figure C; for comparison, RIN values were also plotted. Greek letters indicate the result of TukeyHSD tests (points with different letters had values significantly different from each other using 0.05 as threshold for the p value).
    Figure Legend Snippet: Effect of RNase I degradation on RNA integrity measured via the RIN (A), with RT‐Q‐PCR (B) and RIN versus R amp (C). For RIN, RNA integrity visualized in virtual gels (A; left) and electropherogram (A; right) are displayed against incubation period with RNase I . RNA ladder shows size in nucleotides (nt). B. Effect of degradation on transcript quantification; Amp 1–3: average Ct ( n = 3) of one of the three possible glnA amplicons; amoA : average amoA Ct ( n = 3) of the Bacterial amoA transcript; 16S rRNA : average 16S rRNA Ct ( n = 3) of the bacterial 16S rRNA transcript. Effect of RNA degradation on R amp index is presented in figure C; for comparison, RIN values were also plotted. Greek letters indicate the result of TukeyHSD tests (points with different letters had values significantly different from each other using 0.05 as threshold for the p value).

    Techniques Used: Polymerase Chain Reaction, Incubation

    17) Product Images from "Inactivation of group 2 σ factors upregulates production of transcription and translation machineries in the cyanobacterium Synechocystis sp. PCC 6803"

    Article Title: Inactivation of group 2 σ factors upregulates production of transcription and translation machineries in the cyanobacterium Synechocystis sp. PCC 6803

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-28736-9

    The RNA polymerase and RNA contents of the Δ sigBCDE and control (CS) strains. ( A ) Cells were grown is standard conditions, total proteins were isolated and separated by SDS-PAGE, and RNA polymerase core proteins and the primary σ factor SigA were detected by western blotting. As a loading control the amount of the β subunit of ATPase was detected as well. Original Western blots are shown in Supplementary Fig. . ( B , C ) Cells were grown is standard growth conditions, proteins were isolated and samples containing 60 μg of soluble proteins were separated by blue native gel electrophoresis, transferred to the membrane and the α subunit of the RNA polymerase core ( B ) and the primary σ factor SigA ( C ) were detected with specific antibodies. ( D ) The number of cells in mL of cell culture with OD730 of 1. Three independent cell cultures were analyzed, bars denote SD. Student’s t-test P = 0.175. ( E ) Total RNAs were isolated from the same amount of the cells and the RNA concentration was detected. Six independent samples were analyzed. Student’s t-test P = 4.5 × 10−9 F) A 5 μL-sample of isolated RNA was separated by 1.2% agarose gel electrophoresis and stained with ethidium bromide.
    Figure Legend Snippet: The RNA polymerase and RNA contents of the Δ sigBCDE and control (CS) strains. ( A ) Cells were grown is standard conditions, total proteins were isolated and separated by SDS-PAGE, and RNA polymerase core proteins and the primary σ factor SigA were detected by western blotting. As a loading control the amount of the β subunit of ATPase was detected as well. Original Western blots are shown in Supplementary Fig. . ( B , C ) Cells were grown is standard growth conditions, proteins were isolated and samples containing 60 μg of soluble proteins were separated by blue native gel electrophoresis, transferred to the membrane and the α subunit of the RNA polymerase core ( B ) and the primary σ factor SigA ( C ) were detected with specific antibodies. ( D ) The number of cells in mL of cell culture with OD730 of 1. Three independent cell cultures were analyzed, bars denote SD. Student’s t-test P = 0.175. ( E ) Total RNAs were isolated from the same amount of the cells and the RNA concentration was detected. Six independent samples were analyzed. Student’s t-test P = 4.5 × 10−9 F) A 5 μL-sample of isolated RNA was separated by 1.2% agarose gel electrophoresis and stained with ethidium bromide.

    Techniques Used: Isolation, SDS Page, Western Blot, Nucleic Acid Electrophoresis, Cell Culture, Concentration Assay, Agarose Gel Electrophoresis, Staining

    18) Product Images from "Conservation of tRNA and rRNA 5-methylcytosine in the kingdom Plantae"

    Article Title: Conservation of tRNA and rRNA 5-methylcytosine in the kingdom Plantae

    Journal: BMC Plant Biology

    doi: 10.1186/s12870-015-0580-8

    NSUN5 methylates C2268 in Arabidopsis nuclear LSU 25S rRNA. a Genomic origins of methylated and non-methylated rRNA species. Methylated rRNAs were detected from all three genomes (3 biological replicates). b Left: Heatmap showing percentage methylation of cytosines in nuclear (N), chloroplast (C) and mitochondrial (M) rRNA sequences in wild type and mutants nop2a-2 , nsun5-1 , nop2b-1 and nop2c-1 . Cytosine positions are indicated next to rRNAs (3 biological replicates). Right: Partial secondary structure of 25S nuclear LSU rRNA helix 70 (domain IV) showing the cytosine position 2268 in red, which is methylated by NSUN5. c Genomic structure of nop2b , nop2c and nsun5 mutants showing T-DNA insertions (triangles) in exons (filled boxes). d Analysis of RNA methylation by NSUN5 at position C2268 on BS treated nuclear LSU 25S rRNA template. Above: Restriction maps of dCAPS amplified products showing the expected digest patterns of methylated and non-methylated template. The 25S_rRNA_F dCAPS primer contains a G mismatch at position four to generate a HinfI restriction site when C2268 is methylated. Below: Cleavage of PCR amplified product by HinfI confirms C2268 methylation in wild type as opposed to non-methylated C2268 in nsun5-1 results in loss of HinfI restriction site. Loading control is undigested PCR product
    Figure Legend Snippet: NSUN5 methylates C2268 in Arabidopsis nuclear LSU 25S rRNA. a Genomic origins of methylated and non-methylated rRNA species. Methylated rRNAs were detected from all three genomes (3 biological replicates). b Left: Heatmap showing percentage methylation of cytosines in nuclear (N), chloroplast (C) and mitochondrial (M) rRNA sequences in wild type and mutants nop2a-2 , nsun5-1 , nop2b-1 and nop2c-1 . Cytosine positions are indicated next to rRNAs (3 biological replicates). Right: Partial secondary structure of 25S nuclear LSU rRNA helix 70 (domain IV) showing the cytosine position 2268 in red, which is methylated by NSUN5. c Genomic structure of nop2b , nop2c and nsun5 mutants showing T-DNA insertions (triangles) in exons (filled boxes). d Analysis of RNA methylation by NSUN5 at position C2268 on BS treated nuclear LSU 25S rRNA template. Above: Restriction maps of dCAPS amplified products showing the expected digest patterns of methylated and non-methylated template. The 25S_rRNA_F dCAPS primer contains a G mismatch at position four to generate a HinfI restriction site when C2268 is methylated. Below: Cleavage of PCR amplified product by HinfI confirms C2268 methylation in wild type as opposed to non-methylated C2268 in nsun5-1 results in loss of HinfI restriction site. Loading control is undigested PCR product

    Techniques Used: Methylation, Amplification, Polymerase Chain Reaction

    19) Product Images from "Inhibition of endocytic lipid antigen presentation by common lipophilic environmental pollutants"

    Article Title: Inhibition of endocytic lipid antigen presentation by common lipophilic environmental pollutants

    Journal: Scientific Reports

    doi: 10.1038/s41598-017-02229-7

    Altered gene expression profiles upon BaP exposure. Human monocyte-derived DCs from each donor (n = 3) were incubated with BaP and sorted for labeled conventional DCs, which were further used for RNA extraction and transcriptomic analysis. A volcano plot shows the number of differentially expressed genes (vertical lines = two-fold intensity difference, horizontal line = 0.05 false discovery rate-adjusted p-value) ( a ). The altered genes were clustered by functions ( b ). The expression level of some targeted genes was confirmed using RT-qPCR by normalization to B2M gene expression ( c ). Gene expression in BaP-exposed and non-exposed DCs was compared in three individual donors. The standard errors were calculated from triplicate reactions. The p-values were calculated using Student’s t-tests and are shown as **(p
    Figure Legend Snippet: Altered gene expression profiles upon BaP exposure. Human monocyte-derived DCs from each donor (n = 3) were incubated with BaP and sorted for labeled conventional DCs, which were further used for RNA extraction and transcriptomic analysis. A volcano plot shows the number of differentially expressed genes (vertical lines = two-fold intensity difference, horizontal line = 0.05 false discovery rate-adjusted p-value) ( a ). The altered genes were clustered by functions ( b ). The expression level of some targeted genes was confirmed using RT-qPCR by normalization to B2M gene expression ( c ). Gene expression in BaP-exposed and non-exposed DCs was compared in three individual donors. The standard errors were calculated from triplicate reactions. The p-values were calculated using Student’s t-tests and are shown as **(p

    Techniques Used: Expressing, Derivative Assay, Incubation, Labeling, RNA Extraction, Quantitative RT-PCR

    20) Product Images from "Characterization of the microRNAome in Porcine Reproductive and Respiratory Syndrome Virus Infected Macrophages"

    Article Title: Characterization of the microRNAome in Porcine Reproductive and Respiratory Syndrome Virus Infected Macrophages

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0082054

    Differentially expressed cellular miRNAs in PRRSV-infected PAMs. PAMs from three 7-week old pigs were infected with PRRSV (strain VR-2332) at M.O.I. 10 and small RNA expression was determined at 12 hpi, 24 hpi, and 48 hpi using Illumina deep sequencing. A total of forty cellular miRNA were significantly differentially expressed within the first 48 hpi (p
    Figure Legend Snippet: Differentially expressed cellular miRNAs in PRRSV-infected PAMs. PAMs from three 7-week old pigs were infected with PRRSV (strain VR-2332) at M.O.I. 10 and small RNA expression was determined at 12 hpi, 24 hpi, and 48 hpi using Illumina deep sequencing. A total of forty cellular miRNA were significantly differentially expressed within the first 48 hpi (p

    Techniques Used: Infection, RNA Expression, Sequencing

    Related Articles

    Clone Assay:

    Article Title: Control of RAB7 activity and localization through the retromer‐TBC1D5 complex enables RAB7‐dependent mitophagy
    Article Snippet: The respective band intensities were measured using the automatic background subtraction (average top and bottom setting) of the Odyssey software. .. RILP, TBC1D5, RAB7, and VPS29 cDNA was cloned from HeLa cell cDNA prepared with the Superscript III kit (Invitrogen) using Kapa HiFi DNA polymerase. .. All site‐directed mutagenesis was performed using the QuikChange method (Promega) of fully overlapping primers combined with the Kapa HiFi polymerase.

    Article Title: Opsin Expression in Human Epidermal Skin
    Article Snippet: RNA extraction, reverse transcription, and PCR HEM and KER cDNA was obtained by reverse transcription (RT) using SuperScript III kit (Invitrogen) with total RNA extracted from cultured cells using the RNeasy Plus kit (Qiagen). .. In some cases we obtained a faint ˜1 kb band that was purified and reamplified using the same protocol.

    Article Title: Cargo-selective SNX-BAR proteins mediate retromer trimer independent retrograde transport
    Article Snippet: The respective band intensities were measured using the automatic background subtraction (mean top and bottom setting) of the Odyssey software. .. The SNX-BAR cDNA as well as the IGF1R and IGF2R cDNA was cloned from HeLa cell cDNA prepared with the Superscript-III kit (Invitrogen) using KAPA HiFi DNA polymerase (Kapa Biosystems). .. All site-directed mutagenesis was performed using the QuikChange method (Promega) of fully overlapping primers combined with the KAPA HiFi polymerase.

    Article Title: Different Mutant/Wild-Type p53 Combinations Cause a Spectrum of Increased Invasive Potential in Nonmalignant Immortalized Human Mammary Epithelial Cells
    Article Snippet: Paragraph title: Mutant p53 Cloning ... The p53 sequences were reverse-transcribed using a gene-specific primer and the Superscript III kit (Invitrogen).

    Amplification:

    Article Title: A Petunia Homeodomain-Leucine Zipper Protein, PhHD-Zip, Plays an Important Role in Flower Senescence
    Article Snippet: 2 µg total RNA was used to synthesis first-strand cDNA using the SuperScript III kit (Invitrogen, CA, USA). .. The PhHD-Zip gene was amplified and cloned using PhHD-Zip specific primers ( ) under the following PCR conditions: 94°C, 5 min; 94°C 30 s, 58°C 30 s, 72°C 30 s, 35 cycles; 72°C 7 min.

    Article Title: Opsin Expression in Human Epidermal Skin
    Article Snippet: RNA extraction, reverse transcription, and PCR HEM and KER cDNA was obtained by reverse transcription (RT) using SuperScript III kit (Invitrogen) with total RNA extracted from cultured cells using the RNeasy Plus kit (Qiagen). .. RNA extraction, reverse transcription, and PCR HEM and KER cDNA was obtained by reverse transcription (RT) using SuperScript III kit (Invitrogen) with total RNA extracted from cultured cells using the RNeasy Plus kit (Qiagen).

    Article Title: A BCR-ABL Mutant Lacking Direct Binding Sites for the GRB2, CBL and CRKL Adapter Proteins Fails to Induce Leukemia in Mice
    Article Snippet: Genomic DNA was isolated from myeloid colonies as described above. .. RNA was isolated from frozen tissue sections of spleens using the RNeasy isolation kit (Qiagen). cDNA was amplified using the Superscript III kit (Invitrogen) and used in PCR to amplify GFP from individual animals as described by Zhang, et al . .. The GAPDH gene was amplified as a housekeeping control gene as described Results were visualized on agarose gels.

    Article Title:
    Article Snippet: NIH3T3 cells were grown in DMEM supplemented with 10% FBS, 100 units/ml penicillin, and 100 μg/ml streptomycin. .. ITGB1 cDNA was generated by mRNA extracted from DU145 cells and reverse-transcribed with a SuperScript III kit (Invitrogen). cDNA was amplified by PCR human ITGB1 gene ( ) primers: forward, 5′-GGTACT GGATCC ATGAATTTACAACCAATTTTCTGGA-3′ (BamHI underlined) and reverse, 5′-GTAGA CTCGAG TCATTTTCCCTCATACTTCGGATTGA-3′ (XhoI underlined). .. PCR conditions were 94 °C for 2 min, 30 cycles of denaturation at 94 °C for 30 s, annealing and extension at 68 °C for 4 min, and a final extension at 72 °C for 7 min.

    Article Title: Occurrence and expression of novel methyl-coenzyme M reductase gene (mcrA) variants in hot spring sediments
    Article Snippet: Paragraph title: DNA and RNA extraction and amplification ... The remaining RNA was reverse-transcribed by first strand synthesis with archaeal SSU rRNA primers mentioned above and the SuperScript III kit from Thermo Fisher Scientific according to the manufacturer’s protocol, with the exception that RNasin (Promega, Madison, WI, USA) was used instead of RNaseOUT but at the same suggested concentration.

    Article Title: A novel synthetic compound MCAP suppresses LPS-induced murine microglial activation in vitro via inhibiting NF-kB and p38 MAPK pathways
    Article Snippet: RNA (2.5 μg) was reverse-transcribed using the Superscript™ III kit (Invitrogen) according to the manufacturer's instructions. .. The iNOS, COX-2, tumor necrosis factor-α (TNF-α), IL-1β, IL-6 and GAPDH genes were amplified from the cDNA by polymerase chain reaction (PCR).

    Synthesized:

    Article Title: Large-scale identification of wheat genes resistant to cereal cyst nematode Heterodera avenae using comparative transcriptomic analysis
    Article Snippet: A total of 12 RNAs were treated with DNase to remove contaminating gDNA. .. First-strand cDNA was synthesized using the Invitrogen Superscript III Kit [ , ], and qRT-PCR assay was performed using the iQ5 real-time PCR detection system (Bio-Rad). .. The actin gene was used as endogenous reference [ ], and relative expression was determined as previously described [ ].

    Article Title:
    Article Snippet: In the presence of TACE, the peptide was cleaved, and fluorescence of the cleaved substrate, which was directly proportional to the amount of TACE activity, was measured. .. RNA was isolated from cultured cells using the RNeasy kit (Qiagen) according to the instructions of the manufacturer, and cDNA was synthesized using the SuperScript III kit (Invitrogen) from 1 μg of RNA. .. Quantitative PCR was performed on the cDNA using TaqMan gene expression assays (Applied Biosystems) with probes for mouse TNFα (Mn00443258_m1), mouse TLR9 (Mn00446193_m1), and mouse GAPDH (Mn99999915_g1).

    Article Title: The Alternative Splicing of Cytoplasmic Polyadenylation Element Binding Protein 2 Drives Anoikis Resistance and the Metastasis of Triple Negative Breast Cancer
    Article Snippet: Primer/probe sets were designed for CPEB2A (forward, 5′-GTGTTCAGAACAGACAACAATAG-3′; reverse, AATATCGATAAGGGAATTTTCC; Probe, 5′-CCCTTACAGGATCGAAGTAGAATGTATGACAG-3′) and CPEB2B (forward, 5′-CCTGGTCTATTCTGGATGTTCC-3′; reverse, 5′-ACCCTTACAGGTGAGATCTAGT-3′; probe, 5′-TCACTCCAAGATAGTTGGTGCACTGC-3′) and purchased from Integrated DNA Technologies. .. Quantitative reverse transcriptase-PCR was performed as described ( ). cDNA was synthesized using the Superscript III kit (Life Technologies) and the manufacturer's instructions. .. Samples were then amplified using a Bio-Rad CFX Connect quantitative PCR machine and calculated using the standard curve method.

    Article Title: Chemotherapy resistance and metastasis-promoting effects of thyroid hormone in hepatocarcinoma cells are mediated by suppression of FoxO1 and Bim pathway
    Article Snippet: T3 was purchased from Sigma-Aldrich (St. Louis, MO, USA). .. Total RNA of hepatoma cells was extracted using TRIzol reagent (Life Technologies Inc., Carlsbad, CA, USA), and cDNA strands were synthesized using the Superscript III Kit for RT-PCR (Life Technologies). .. Real-time quantitative RT-PCR was performed using SYBR Green reaction mix (Applied Biosystems, Carlsbad, CA, USA), and products detected using the ABI PRISM 7500 system (Applied Biosystems, Foster City, CA, USA).

    Article Title: Evaluation of diversity among common beans (Phaseolus vulgaris L.) from two centers of domestication using 'omics' technologies
    Article Snippet: Twenty-five μg of RNA was used to prepare complimentary DNA for spotted 2-color microarray analysis. .. Complimentary DNA (cDNA) was synthesized using the Superscript III kit (Invitrogen, Carlsbad, CA) and hybridized to a microarray developed for soybean [ ] using the Genisphere Array 50 kit (Genisphere, Hatfield, PA). .. Briefly, RNA (29.5 μL) was mixed with dye-appropriate RT primer (1.5 μL) and heated to 80°C for 10 min, and transferred to ice for 2 min. Superase-in RNase inhibitor (1 μL) was added before 18 μL of reaction mix composed of 5× Superscript III first strand buffer (10 μL), 10 mM dNTP mix (2 μL), 0.1 M dithiotreitol (4 μL) and Superscript III enzyme (4 μL).

    Quantitative RT-PCR:

    Article Title: Lipid transfer from plants to arbuscular mycorrhiza fungi
    Article Snippet: RNA was extracted using the Spectrum Plant Total RNA Kit ( www.sigmaaldrich.com ). .. The RNA was treated with Invitrogen DNAse I amp. grade ( www.invitrogen.com ) and tested for purity by PCR. cDNA synthesis was performed with 500 ng RNA using the Superscript III kit ( www.invitrogen.com ). qRT-PCR was performed with GoTaq G2 DNA polymerase (Promega), 5 x colorless GoTaq Buffer (Promega) and SYBR Green I (Invitrogen S7563, 10.000x concentrated, 500 µl) - diluted to 100x in DMSO. .. Primers ( ) were designed with primer3 (58).

    Article Title: Factors of early protective action of live influenza vaccine combined with recombinant bacterial polypeptides against homologous and heterologous influenza infection
    Article Snippet: The RNA was eluted in 50 μl of RNAse-free water and was used as the template for rRT-PCR. .. For cDNA synthesis, reverse transcription (RT) with 100 pg of total RNA was performed using oligo(dt) primers and random hexamers mix and the SuperScript III kit (Invitrogen, Carlsbad, CA, USA).

    Article Title: Large-scale identification of wheat genes resistant to cereal cyst nematode Heterodera avenae using comparative transcriptomic analysis
    Article Snippet: A total of 12 RNAs were treated with DNase to remove contaminating gDNA. .. First-strand cDNA was synthesized using the Invitrogen Superscript III Kit [ , ], and qRT-PCR assay was performed using the iQ5 real-time PCR detection system (Bio-Rad). .. The actin gene was used as endogenous reference [ ], and relative expression was determined as previously described [ ].

    Article Title: Chemotherapy resistance and metastasis-promoting effects of thyroid hormone in hepatocarcinoma cells are mediated by suppression of FoxO1 and Bim pathway
    Article Snippet: Paragraph title: Real-time PCR (qRT-PCR) ... Total RNA of hepatoma cells was extracted using TRIzol reagent (Life Technologies Inc., Carlsbad, CA, USA), and cDNA strands were synthesized using the Superscript III Kit for RT-PCR (Life Technologies).

    Article Title: A preliminary analysis of hepatitis C virus in pancreatic islet cells
    Article Snippet: Total RNA from 3 different human islets donors was isolated using TRIzol reagent (Thermo Scientific) in combination with the RNeasy Mini kit (Qiagen) followed by DNase treatment. .. Five hundred nanograms of total RNA were retrotranscribed using the Superscript III kit (Thermo Scientific), and the cDNAs obtained were utilized as templates for quantitative real-time RT-PCR analysis of CD81 (72 base pair [bp]), occludin (63 bp), claudin-1 (101 bp), and SR-B1 (50 bp), as well as the housekeeping gene GAPDH (94 bp). cDNA was run on an AbiPRISM 7300 fast real-time cycler using the power SYBR Green real-time PCR master mix kit and quantified by built-in SYBR Green Analysis. .. All samples were evaluated in triplicate with the average relative amount of specific mRNA being normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH ) expression.

    Real-time Polymerase Chain Reaction:

    Article Title: Lipid transfer from plants to arbuscular mycorrhiza fungi
    Article Snippet: The RNA was treated with Invitrogen DNAse I amp. grade ( www.invitrogen.com ) and tested for purity by PCR. cDNA synthesis was performed with 500 ng RNA using the Superscript III kit ( www.invitrogen.com ). qRT-PCR was performed with GoTaq G2 DNA polymerase (Promega), 5 x colorless GoTaq Buffer (Promega) and SYBR Green I (Invitrogen S7563, 10.000x concentrated, 500 µl) - diluted to 100x in DMSO. .. The RNA was treated with Invitrogen DNAse I amp. grade ( www.invitrogen.com ) and tested for purity by PCR. cDNA synthesis was performed with 500 ng RNA using the Superscript III kit ( www.invitrogen.com ). qRT-PCR was performed with GoTaq G2 DNA polymerase (Promega), 5 x colorless GoTaq Buffer (Promega) and SYBR Green I (Invitrogen S7563, 10.000x concentrated, 500 µl) - diluted to 100x in DMSO.

    Article Title: Large-scale identification of wheat genes resistant to cereal cyst nematode Heterodera avenae using comparative transcriptomic analysis
    Article Snippet: A total of 12 RNAs were treated with DNase to remove contaminating gDNA. .. First-strand cDNA was synthesized using the Invitrogen Superscript III Kit [ , ], and qRT-PCR assay was performed using the iQ5 real-time PCR detection system (Bio-Rad). .. The actin gene was used as endogenous reference [ ], and relative expression was determined as previously described [ ].

    Article Title:
    Article Snippet: Paragraph title: Preparation of RNA for Real-time PCR ... RNA was isolated from cultured cells using the RNeasy kit (Qiagen) according to the instructions of the manufacturer, and cDNA was synthesized using the SuperScript III kit (Invitrogen) from 1 μg of RNA.

    Article Title: Chemotherapy resistance and metastasis-promoting effects of thyroid hormone in hepatocarcinoma cells are mediated by suppression of FoxO1 and Bim pathway
    Article Snippet: Paragraph title: Real-time PCR (qRT-PCR) ... Total RNA of hepatoma cells was extracted using TRIzol reagent (Life Technologies Inc., Carlsbad, CA, USA), and cDNA strands were synthesized using the Superscript III Kit for RT-PCR (Life Technologies).

    Article Title: A preliminary analysis of hepatitis C virus in pancreatic islet cells
    Article Snippet: Total RNA from 3 different human islets donors was isolated using TRIzol reagent (Thermo Scientific) in combination with the RNeasy Mini kit (Qiagen) followed by DNase treatment. .. Five hundred nanograms of total RNA were retrotranscribed using the Superscript III kit (Thermo Scientific), and the cDNAs obtained were utilized as templates for quantitative real-time RT-PCR analysis of CD81 (72 base pair [bp]), occludin (63 bp), claudin-1 (101 bp), and SR-B1 (50 bp), as well as the housekeeping gene GAPDH (94 bp). cDNA was run on an AbiPRISM 7300 fast real-time cycler using the power SYBR Green real-time PCR master mix kit and quantified by built-in SYBR Green Analysis. .. All samples were evaluated in triplicate with the average relative amount of specific mRNA being normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH ) expression.

    Article Title: Interferon-α inducible protein 6 impairs EGFR activation by CD81 and inhibits hepatitis C virus infection
    Article Snippet: To quantify virus infectivity in cells expressing ISGs, IFI6 or IFI27, a predetermined titer (moi of ~1) of HCVcc (clone JFH1) were incubated with cells for 5 hours at 37°C. .. Cells were rinsed, lysed, and RNA was isolated using the RNAeasy Miniprep kit (Qiagen). cDNA was generated using a Superscript III kit (Invitrogen), followed by real-time PCR to quantify viral RNA titer . .. A curve of virus dilutions was used as a comparative control, and 18S RNA was used as an internal control.

    Article Title: Cell type specificity of chromatin organization mediated by CTCF and cohesin
    Article Snippet: RNA was isolated with TRIzol reagent (Invitrogen). .. One microgram of RNA was treated with RNase-free DNaseI before reverse transcription with SuperScript III kit (Invitrogen). cDNA was diluted 10-fold, and 5 μl was used as template for real-time PCR. .. We thank Elissa Lei for helpful comments and Qihui Gong for assistance with ChIP experiments.

    Microarray:

    Article Title: Evaluation of diversity among common beans (Phaseolus vulgaris L.) from two centers of domestication using 'omics' technologies
    Article Snippet: Twenty-five μg of RNA was used to prepare complimentary DNA for spotted 2-color microarray analysis. .. Complimentary DNA (cDNA) was synthesized using the Superscript III kit (Invitrogen, Carlsbad, CA) and hybridized to a microarray developed for soybean [ ] using the Genisphere Array 50 kit (Genisphere, Hatfield, PA). .. Briefly, RNA (29.5 μL) was mixed with dye-appropriate RT primer (1.5 μL) and heated to 80°C for 10 min, and transferred to ice for 2 min. Superase-in RNase inhibitor (1 μL) was added before 18 μL of reaction mix composed of 5× Superscript III first strand buffer (10 μL), 10 mM dNTP mix (2 μL), 0.1 M dithiotreitol (4 μL) and Superscript III enzyme (4 μL).

    Incubation:

    Article Title: Factors of early protective action of live influenza vaccine combined with recombinant bacterial polypeptides against homologous and heterologous influenza infection
    Article Snippet: The cells were further incubated for 3, and 24 hours in RPMI. .. For cDNA synthesis, reverse transcription (RT) with 100 pg of total RNA was performed using oligo(dt) primers and random hexamers mix and the SuperScript III kit (Invitrogen, Carlsbad, CA, USA).

    Article Title: Evaluation of diversity among common beans (Phaseolus vulgaris L.) from two centers of domestication using 'omics' technologies
    Article Snippet: Complimentary DNA (cDNA) was synthesized using the Superscript III kit (Invitrogen, Carlsbad, CA) and hybridized to a microarray developed for soybean [ ] using the Genisphere Array 50 kit (Genisphere, Hatfield, PA). .. Complimentary DNA (cDNA) was synthesized using the Superscript III kit (Invitrogen, Carlsbad, CA) and hybridized to a microarray developed for soybean [ ] using the Genisphere Array 50 kit (Genisphere, Hatfield, PA).

    Article Title: Interferon-α inducible protein 6 impairs EGFR activation by CD81 and inhibits hepatitis C virus infection
    Article Snippet: To quantify virus infectivity in cells expressing ISGs, IFI6 or IFI27, a predetermined titer (moi of ~1) of HCVcc (clone JFH1) were incubated with cells for 5 hours at 37°C. .. Cells were rinsed, lysed, and RNA was isolated using the RNAeasy Miniprep kit (Qiagen). cDNA was generated using a Superscript III kit (Invitrogen), followed by real-time PCR to quantify viral RNA titer .

    Article Title: Occurrence and expression of novel methyl-coenzyme M reductase gene (mcrA) variants in hot spring sediments
    Article Snippet: The remaining RNA was reverse-transcribed by first strand synthesis with archaeal SSU rRNA primers mentioned above and the SuperScript III kit from Thermo Fisher Scientific according to the manufacturer’s protocol, with the exception that RNasin (Promega, Madison, WI, USA) was used instead of RNaseOUT but at the same suggested concentration. .. The remaining RNA was reverse-transcribed by first strand synthesis with archaeal SSU rRNA primers mentioned above and the SuperScript III kit from Thermo Fisher Scientific according to the manufacturer’s protocol, with the exception that RNasin (Promega, Madison, WI, USA) was used instead of RNaseOUT but at the same suggested concentration.

    Article Title: Protocol Dependence of Sequencing-Based Gene Expression Measurements
    Article Snippet: 100–400 ng of DNase I -treated RNA, except where noted, was mixed with the following reagents from the SuperScript III kit (Invitrogen). .. 100–400 ng of DNase I -treated RNA, except where noted, was mixed with the following reagents from the SuperScript III kit (Invitrogen).

    Article Title: A novel synthetic compound MCAP suppresses LPS-induced murine microglial activation in vitro via inhibiting NF-kB and p38 MAPK pathways
    Article Snippet: The BV2 microglia cells were plated overnight in 6-well culture plates at a density of 5×105 cells/mL and pretreated for 1 h with various concentrations of MCAP, including 0.1, 1 and 10 μmol/L, before incubation in a medium containing LPS (100 ng/mL). .. RNA (2.5 μg) was reverse-transcribed using the Superscript™ III kit (Invitrogen) according to the manufacturer's instructions.

    Infection:

    Article Title: Interferon-α inducible protein 6 impairs EGFR activation by CD81 and inhibits hepatitis C virus infection
    Article Snippet: Paragraph title: Assay for infectivity of cell culture grown HCV ... Cells were rinsed, lysed, and RNA was isolated using the RNAeasy Miniprep kit (Qiagen). cDNA was generated using a Superscript III kit (Invitrogen), followed by real-time PCR to quantify viral RNA titer .

    Expressing:

    Article Title: Lipid transfer from plants to arbuscular mycorrhiza fungi
    Article Snippet: The RNA was treated with Invitrogen DNAse I amp. grade ( www.invitrogen.com ) and tested for purity by PCR. cDNA synthesis was performed with 500 ng RNA using the Superscript III kit ( www.invitrogen.com ). qRT-PCR was performed with GoTaq G2 DNA polymerase (Promega), 5 x colorless GoTaq Buffer (Promega) and SYBR Green I (Invitrogen S7563, 10.000x concentrated, 500 µl) - diluted to 100x in DMSO. .. The RNA was treated with Invitrogen DNAse I amp. grade ( www.invitrogen.com ) and tested for purity by PCR. cDNA synthesis was performed with 500 ng RNA using the Superscript III kit ( www.invitrogen.com ). qRT-PCR was performed with GoTaq G2 DNA polymerase (Promega), 5 x colorless GoTaq Buffer (Promega) and SYBR Green I (Invitrogen S7563, 10.000x concentrated, 500 µl) - diluted to 100x in DMSO.

    Article Title: Factors of early protective action of live influenza vaccine combined with recombinant bacterial polypeptides against homologous and heterologous influenza infection
    Article Snippet: Paragraph title: Early cytokines expression and secretion in THP-1 cells ... For cDNA synthesis, reverse transcription (RT) with 100 pg of total RNA was performed using oligo(dt) primers and random hexamers mix and the SuperScript III kit (Invitrogen, Carlsbad, CA, USA).

    Article Title: A preliminary analysis of hepatitis C virus in pancreatic islet cells
    Article Snippet: Paragraph title: mRNA expression of HCV entry factors ... Five hundred nanograms of total RNA were retrotranscribed using the Superscript III kit (Thermo Scientific), and the cDNAs obtained were utilized as templates for quantitative real-time RT-PCR analysis of CD81 (72 base pair [bp]), occludin (63 bp), claudin-1 (101 bp), and SR-B1 (50 bp), as well as the housekeeping gene GAPDH (94 bp). cDNA was run on an AbiPRISM 7300 fast real-time cycler using the power SYBR Green real-time PCR master mix kit and quantified by built-in SYBR Green Analysis.

    Article Title: Interferon-α inducible protein 6 impairs EGFR activation by CD81 and inhibits hepatitis C virus infection
    Article Snippet: To quantify virus infectivity in cells expressing ISGs, IFI6 or IFI27, a predetermined titer (moi of ~1) of HCVcc (clone JFH1) were incubated with cells for 5 hours at 37°C. .. Cells were rinsed, lysed, and RNA was isolated using the RNAeasy Miniprep kit (Qiagen). cDNA was generated using a Superscript III kit (Invitrogen), followed by real-time PCR to quantify viral RNA titer .

    Article Title:
    Article Snippet: ITGB1 cDNA was generated by mRNA extracted from DU145 cells and reverse-transcribed with a SuperScript III kit (Invitrogen). cDNA was amplified by PCR human ITGB1 gene ( ) primers: forward, 5′-GGTACT GGATCC ATGAATTTACAACCAATTTTCTGGA-3′ (BamHI underlined) and reverse, 5′-GTAGA CTCGAG TCATTTTCCCTCATACTTCGGATTGA-3′ (XhoI underlined). .. ITGB1 cDNA was generated by mRNA extracted from DU145 cells and reverse-transcribed with a SuperScript III kit (Invitrogen). cDNA was amplified by PCR human ITGB1 gene ( ) primers: forward, 5′-GGTACT GGATCC ATGAATTTACAACCAATTTTCTGGA-3′ (BamHI underlined) and reverse, 5′-GTAGA CTCGAG TCATTTTCCCTCATACTTCGGATTGA-3′ (XhoI underlined).

    Touchdown PCR:

    Article Title: Opsin Expression in Human Epidermal Skin
    Article Snippet: RNA extraction, reverse transcription, and PCR HEM and KER cDNA was obtained by reverse transcription (RT) using SuperScript III kit (Invitrogen) with total RNA extracted from cultured cells using the RNeasy Plus kit (Qiagen). .. RNA extraction, reverse transcription, and PCR HEM and KER cDNA was obtained by reverse transcription (RT) using SuperScript III kit (Invitrogen) with total RNA extracted from cultured cells using the RNeasy Plus kit (Qiagen).

    Hybridization:

    Article Title: Evaluation of diversity among common beans (Phaseolus vulgaris L.) from two centers of domestication using 'omics' technologies
    Article Snippet: Paragraph title: Microarray hybridization ... Complimentary DNA (cDNA) was synthesized using the Superscript III kit (Invitrogen, Carlsbad, CA) and hybridized to a microarray developed for soybean [ ] using the Genisphere Array 50 kit (Genisphere, Hatfield, PA).

    Gas Chromatography:

    Article Title: Opsin Expression in Human Epidermal Skin
    Article Snippet: RNA extraction, reverse transcription, and PCR HEM and KER cDNA was obtained by reverse transcription (RT) using SuperScript III kit (Invitrogen) with total RNA extracted from cultured cells using the RNeasy Plus kit (Qiagen). .. RNA extraction, reverse transcription, and PCR HEM and KER cDNA was obtained by reverse transcription (RT) using SuperScript III kit (Invitrogen) with total RNA extracted from cultured cells using the RNeasy Plus kit (Qiagen).

    Activation Assay:

    Article Title: Factors of early protective action of live influenza vaccine combined with recombinant bacterial polypeptides against homologous and heterologous influenza infection
    Article Snippet: For cDNA synthesis, reverse transcription (RT) with 100 pg of total RNA was performed using oligo(dt) primers and random hexamers mix and the SuperScript III kit (Invitrogen, Carlsbad, CA, USA). .. The rRT-PCR was performed in a CFX96 (Biorad, Hercules, CA, USA) thermocycler using SybrGreen as fluorogenic probe in 25 μl reactions containing 5 μl cDNA sample, 10 supermix (Thermo Scientific, Waltham, MA, USA), 50 pMol of forward and reverse primer and nuclease free water (Applied Biosystems, USA).

    Genomic Sequencing:

    Article Title: Different Mutant/Wild-Type p53 Combinations Cause a Spectrum of Increased Invasive Potential in Nonmalignant Immortalized Human Mammary Epithelial Cells
    Article Snippet: Extensive genomic sequencing analysis of MDA-MB-231 cells conducted by our laboratory show they express only mutant p53 R280K. .. The p53 sequences were reverse-transcribed using a gene-specific primer and the Superscript III kit (Invitrogen).

    Cell Culture:

    Article Title:
    Article Snippet: In the presence of TACE, the peptide was cleaved, and fluorescence of the cleaved substrate, which was directly proportional to the amount of TACE activity, was measured. .. RNA was isolated from cultured cells using the RNeasy kit (Qiagen) according to the instructions of the manufacturer, and cDNA was synthesized using the SuperScript III kit (Invitrogen) from 1 μg of RNA. .. Quantitative PCR was performed on the cDNA using TaqMan gene expression assays (Applied Biosystems) with probes for mouse TNFα (Mn00443258_m1), mouse TLR9 (Mn00446193_m1), and mouse GAPDH (Mn99999915_g1).

    Article Title: Opsin Expression in Human Epidermal Skin
    Article Snippet: Human Umbilical Vein Endothelial Cells (HUVEC) were cultured in EGM-2 (Lonza) and HL60 cells in IMDM with 20% FBS. .. RNA extraction, reverse transcription, and PCR HEM and KER cDNA was obtained by reverse transcription (RT) using SuperScript III kit (Invitrogen) with total RNA extracted from cultured cells using the RNeasy Plus kit (Qiagen). .. PCR reactions were performed with the primers shown below: For PCR amplification of full-length OPN2 transcripts we used 30–35 cycles of the following protocol: 95°C for 30 s, 58°C for 45 s and 72°C for 2 min.

    Article Title: Interferon-α inducible protein 6 impairs EGFR activation by CD81 and inhibits hepatitis C virus infection
    Article Snippet: Paragraph title: Assay for infectivity of cell culture grown HCV ... Cells were rinsed, lysed, and RNA was isolated using the RNAeasy Miniprep kit (Qiagen). cDNA was generated using a Superscript III kit (Invitrogen), followed by real-time PCR to quantify viral RNA titer .

    Mutagenesis:

    Article Title: Different Mutant/Wild-Type p53 Combinations Cause a Spectrum of Increased Invasive Potential in Nonmalignant Immortalized Human Mammary Epithelial Cells
    Article Snippet: Paragraph title: Mutant p53 Cloning ... The p53 sequences were reverse-transcribed using a gene-specific primer and the Superscript III kit (Invitrogen).

    Generated:

    Article Title: Interferon-α inducible protein 6 impairs EGFR activation by CD81 and inhibits hepatitis C virus infection
    Article Snippet: To quantify virus infectivity in cells expressing ISGs, IFI6 or IFI27, a predetermined titer (moi of ~1) of HCVcc (clone JFH1) were incubated with cells for 5 hours at 37°C. .. Cells were rinsed, lysed, and RNA was isolated using the RNAeasy Miniprep kit (Qiagen). cDNA was generated using a Superscript III kit (Invitrogen), followed by real-time PCR to quantify viral RNA titer . .. A curve of virus dilutions was used as a comparative control, and 18S RNA was used as an internal control.

    Article Title:
    Article Snippet: NIH3T3 cells were grown in DMEM supplemented with 10% FBS, 100 units/ml penicillin, and 100 μg/ml streptomycin. .. ITGB1 cDNA was generated by mRNA extracted from DU145 cells and reverse-transcribed with a SuperScript III kit (Invitrogen). cDNA was amplified by PCR human ITGB1 gene ( ) primers: forward, 5′-GGTACT GGATCC ATGAATTTACAACCAATTTTCTGGA-3′ (BamHI underlined) and reverse, 5′-GTAGA CTCGAG TCATTTTCCCTCATACTTCGGATTGA-3′ (XhoI underlined). .. PCR conditions were 94 °C for 2 min, 30 cycles of denaturation at 94 °C for 30 s, annealing and extension at 68 °C for 4 min, and a final extension at 72 °C for 7 min.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Factors of early protective action of live influenza vaccine combined with recombinant bacterial polypeptides against homologous and heterologous influenza infection
    Article Snippet: The levels of cytokines genes expression were determined by real-time reverse transcription polymerase chain reaction (rRT-PCR). .. For cDNA synthesis, reverse transcription (RT) with 100 pg of total RNA was performed using oligo(dt) primers and random hexamers mix and the SuperScript III kit (Invitrogen, Carlsbad, CA, USA).

    Article Title: A novel synthetic compound MCAP suppresses LPS-induced murine microglial activation in vitro via inhibiting NF-kB and p38 MAPK pathways
    Article Snippet: Paragraph title: Reverse transcription–polymerase chain reaction (RT-PCR) ... RNA (2.5 μg) was reverse-transcribed using the Superscript™ III kit (Invitrogen) according to the manufacturer's instructions.

    Immunofluorescence:

    Article Title: Interferon-α inducible protein 6 impairs EGFR activation by CD81 and inhibits hepatitis C virus infection
    Article Snippet: Cells were rinsed, lysed, and RNA was isolated using the RNAeasy Miniprep kit (Qiagen). cDNA was generated using a Superscript III kit (Invitrogen), followed by real-time PCR to quantify viral RNA titer . .. Cells were rinsed, lysed, and RNA was isolated using the RNAeasy Miniprep kit (Qiagen). cDNA was generated using a Superscript III kit (Invitrogen), followed by real-time PCR to quantify viral RNA titer .

    Multiple Displacement Amplification:

    Article Title: Different Mutant/Wild-Type p53 Combinations Cause a Spectrum of Increased Invasive Potential in Nonmalignant Immortalized Human Mammary Epithelial Cells
    Article Snippet: According to the International Agency for Research on Cancer mutant p53 database, the MDA-MB-468 cells lost the wild-type allele and expressed only mutant p53 R273H. .. The p53 sequences were reverse-transcribed using a gene-specific primer and the Superscript III kit (Invitrogen).

    Isolation:

    Article Title:
    Article Snippet: In the presence of TACE, the peptide was cleaved, and fluorescence of the cleaved substrate, which was directly proportional to the amount of TACE activity, was measured. .. RNA was isolated from cultured cells using the RNeasy kit (Qiagen) according to the instructions of the manufacturer, and cDNA was synthesized using the SuperScript III kit (Invitrogen) from 1 μg of RNA. .. Quantitative PCR was performed on the cDNA using TaqMan gene expression assays (Applied Biosystems) with probes for mouse TNFα (Mn00443258_m1), mouse TLR9 (Mn00446193_m1), and mouse GAPDH (Mn99999915_g1).

    Article Title: A preliminary analysis of hepatitis C virus in pancreatic islet cells
    Article Snippet: Total RNA from 3 different human islets donors was isolated using TRIzol reagent (Thermo Scientific) in combination with the RNeasy Mini kit (Qiagen) followed by DNase treatment. .. Five hundred nanograms of total RNA were retrotranscribed using the Superscript III kit (Thermo Scientific), and the cDNAs obtained were utilized as templates for quantitative real-time RT-PCR analysis of CD81 (72 base pair [bp]), occludin (63 bp), claudin-1 (101 bp), and SR-B1 (50 bp), as well as the housekeeping gene GAPDH (94 bp). cDNA was run on an AbiPRISM 7300 fast real-time cycler using the power SYBR Green real-time PCR master mix kit and quantified by built-in SYBR Green Analysis.

    Article Title: Interferon-α inducible protein 6 impairs EGFR activation by CD81 and inhibits hepatitis C virus infection
    Article Snippet: To quantify virus infectivity in cells expressing ISGs, IFI6 or IFI27, a predetermined titer (moi of ~1) of HCVcc (clone JFH1) were incubated with cells for 5 hours at 37°C. .. Cells were rinsed, lysed, and RNA was isolated using the RNAeasy Miniprep kit (Qiagen). cDNA was generated using a Superscript III kit (Invitrogen), followed by real-time PCR to quantify viral RNA titer . .. A curve of virus dilutions was used as a comparative control, and 18S RNA was used as an internal control.

    Article Title: A BCR-ABL Mutant Lacking Direct Binding Sites for the GRB2, CBL and CRKL Adapter Proteins Fails to Induce Leukemia in Mice
    Article Snippet: Genomic DNA was isolated from myeloid colonies as described above. .. RNA was isolated from frozen tissue sections of spleens using the RNeasy isolation kit (Qiagen). cDNA was amplified using the Superscript III kit (Invitrogen) and used in PCR to amplify GFP from individual animals as described by Zhang, et al . .. The GAPDH gene was amplified as a housekeeping control gene as described Results were visualized on agarose gels.

    Article Title: Cell type specificity of chromatin organization mediated by CTCF and cohesin
    Article Snippet: RNA was isolated with TRIzol reagent (Invitrogen). .. One microgram of RNA was treated with RNase-free DNaseI before reverse transcription with SuperScript III kit (Invitrogen). cDNA was diluted 10-fold, and 5 μl was used as template for real-time PCR.

    Article Title: Occurrence and expression of novel methyl-coenzyme M reductase gene (mcrA) variants in hot spring sediments
    Article Snippet: This RNA isolation method was attempted on multiple replicates of every sediment sample but only yielded quantifiable RNA from the surface sediments of HL10 and the top of the HL9 sediment core. .. The remaining RNA was reverse-transcribed by first strand synthesis with archaeal SSU rRNA primers mentioned above and the SuperScript III kit from Thermo Fisher Scientific according to the manufacturer’s protocol, with the exception that RNasin (Promega, Madison, WI, USA) was used instead of RNaseOUT but at the same suggested concentration.

    Article Title: Different Mutant/Wild-Type p53 Combinations Cause a Spectrum of Increased Invasive Potential in Nonmalignant Immortalized Human Mammary Epithelial Cells
    Article Snippet: Four mutant p53 sequences were isolated from MDA-MB-231 (R280K), MDA-MB-468 (R273H), BT549 (R249S) or the R175H adenovirus. .. The p53 sequences were reverse-transcribed using a gene-specific primer and the Superscript III kit (Invitrogen).

    Sequencing:

    Article Title: A Petunia Homeodomain-Leucine Zipper Protein, PhHD-Zip, Plays an Important Role in Flower Senescence
    Article Snippet: 2 µg total RNA was used to synthesis first-strand cDNA using the SuperScript III kit (Invitrogen, CA, USA). .. The PhHD-Zip gene was amplified and cloned using PhHD-Zip specific primers ( ) under the following PCR conditions: 94°C, 5 min; 94°C 30 s, 58°C 30 s, 72°C 30 s, 35 cycles; 72°C 7 min.

    Article Title:
    Article Snippet: RNA was isolated from cultured cells using the RNeasy kit (Qiagen) according to the instructions of the manufacturer, and cDNA was synthesized using the SuperScript III kit (Invitrogen) from 1 μg of RNA. .. Quantitative PCR was performed on the cDNA using TaqMan gene expression assays (Applied Biosystems) with probes for mouse TNFα (Mn00443258_m1), mouse TLR9 (Mn00446193_m1), and mouse GAPDH (Mn99999915_g1).

    Article Title: Opsin Expression in Human Epidermal Skin
    Article Snippet: RNA extraction, reverse transcription, and PCR HEM and KER cDNA was obtained by reverse transcription (RT) using SuperScript III kit (Invitrogen) with total RNA extracted from cultured cells using the RNeasy Plus kit (Qiagen). .. In some cases we obtained a faint ˜1 kb band that was purified and reamplified using the same protocol.

    Article Title: Protocol Dependence of Sequencing-Based Gene Expression Measurements
    Article Snippet: Paragraph title: Preparation of RNA for sequencing ... 100–400 ng of DNase I -treated RNA, except where noted, was mixed with the following reagents from the SuperScript III kit (Invitrogen).

    Purification:

    Article Title: Evaluation of diversity among common beans (Phaseolus vulgaris L.) from two centers of domestication using 'omics' technologies
    Article Snippet: Complimentary DNA (cDNA) was synthesized using the Superscript III kit (Invitrogen, Carlsbad, CA) and hybridized to a microarray developed for soybean [ ] using the Genisphere Array 50 kit (Genisphere, Hatfield, PA). .. Complimentary DNA (cDNA) was synthesized using the Superscript III kit (Invitrogen, Carlsbad, CA) and hybridized to a microarray developed for soybean [ ] using the Genisphere Array 50 kit (Genisphere, Hatfield, PA).

    Article Title: Opsin Expression in Human Epidermal Skin
    Article Snippet: RNA extraction, reverse transcription, and PCR HEM and KER cDNA was obtained by reverse transcription (RT) using SuperScript III kit (Invitrogen) with total RNA extracted from cultured cells using the RNeasy Plus kit (Qiagen). .. PCR reactions were performed with the primers shown below: For PCR amplification of full-length OPN2 transcripts we used 30–35 cycles of the following protocol: 95°C for 30 s, 58°C for 45 s and 72°C for 2 min.

    Article Title: Occurrence and expression of novel methyl-coenzyme M reductase gene (mcrA) variants in hot spring sediments
    Article Snippet: From the total RNA/DNA pool, RNA was subsequently purified starting from Step 6 in the manufacturer’s protocol of the FastRNA Pro Soil Direct kit from MP Biomedicals (Santa Ana, CA, USA). .. The remaining RNA was reverse-transcribed by first strand synthesis with archaeal SSU rRNA primers mentioned above and the SuperScript III kit from Thermo Fisher Scientific according to the manufacturer’s protocol, with the exception that RNasin (Promega, Madison, WI, USA) was used instead of RNaseOUT but at the same suggested concentration.

    Polymerase Chain Reaction:

    Article Title: Lipid transfer from plants to arbuscular mycorrhiza fungi
    Article Snippet: RNA was extracted using the Spectrum Plant Total RNA Kit ( www.sigmaaldrich.com ). .. The RNA was treated with Invitrogen DNAse I amp. grade ( www.invitrogen.com ) and tested for purity by PCR. cDNA synthesis was performed with 500 ng RNA using the Superscript III kit ( www.invitrogen.com ). qRT-PCR was performed with GoTaq G2 DNA polymerase (Promega), 5 x colorless GoTaq Buffer (Promega) and SYBR Green I (Invitrogen S7563, 10.000x concentrated, 500 µl) - diluted to 100x in DMSO. .. Primers ( ) were designed with primer3 (58).

    Article Title:
    Article Snippet: RNA was isolated from cultured cells using the RNeasy kit (Qiagen) according to the instructions of the manufacturer, and cDNA was synthesized using the SuperScript III kit (Invitrogen) from 1 μg of RNA. .. Quantitative PCR was performed on the cDNA using TaqMan gene expression assays (Applied Biosystems) with probes for mouse TNFα (Mn00443258_m1), mouse TLR9 (Mn00446193_m1), and mouse GAPDH (Mn99999915_g1).

    Article Title: Opsin Expression in Human Epidermal Skin
    Article Snippet: Human Umbilical Vein Endothelial Cells (HUVEC) were cultured in EGM-2 (Lonza) and HL60 cells in IMDM with 20% FBS. .. RNA extraction, reverse transcription, and PCR HEM and KER cDNA was obtained by reverse transcription (RT) using SuperScript III kit (Invitrogen) with total RNA extracted from cultured cells using the RNeasy Plus kit (Qiagen). .. PCR reactions were performed with the primers shown below: For PCR amplification of full-length OPN2 transcripts we used 30–35 cycles of the following protocol: 95°C for 30 s, 58°C for 45 s and 72°C for 2 min.

    Article Title: A BCR-ABL Mutant Lacking Direct Binding Sites for the GRB2, CBL and CRKL Adapter Proteins Fails to Induce Leukemia in Mice
    Article Snippet: Genomic DNA was isolated from myeloid colonies as described above. .. RNA was isolated from frozen tissue sections of spleens using the RNeasy isolation kit (Qiagen). cDNA was amplified using the Superscript III kit (Invitrogen) and used in PCR to amplify GFP from individual animals as described by Zhang, et al . .. The GAPDH gene was amplified as a housekeeping control gene as described Results were visualized on agarose gels.

    Article Title:
    Article Snippet: NIH3T3 cells were grown in DMEM supplemented with 10% FBS, 100 units/ml penicillin, and 100 μg/ml streptomycin. .. ITGB1 cDNA was generated by mRNA extracted from DU145 cells and reverse-transcribed with a SuperScript III kit (Invitrogen). cDNA was amplified by PCR human ITGB1 gene ( ) primers: forward, 5′-GGTACT GGATCC ATGAATTTACAACCAATTTTCTGGA-3′ (BamHI underlined) and reverse, 5′-GTAGA CTCGAG TCATTTTCCCTCATACTTCGGATTGA-3′ (XhoI underlined). .. PCR conditions were 94 °C for 2 min, 30 cycles of denaturation at 94 °C for 30 s, annealing and extension at 68 °C for 4 min, and a final extension at 72 °C for 7 min.

    Article Title: Occurrence and expression of novel methyl-coenzyme M reductase gene (mcrA) variants in hot spring sediments
    Article Snippet: On RNA from the top of HL9, the absence of DNA was confirmed by performing PCR amplification of SSU rRNA genes on an aliquot of RNA using the previously mentioned protocol and positive controls with DNA. .. The remaining RNA was reverse-transcribed by first strand synthesis with archaeal SSU rRNA primers mentioned above and the SuperScript III kit from Thermo Fisher Scientific according to the manufacturer’s protocol, with the exception that RNasin (Promega, Madison, WI, USA) was used instead of RNaseOUT but at the same suggested concentration.

    Article Title: A novel synthetic compound MCAP suppresses LPS-induced murine microglial activation in vitro via inhibiting NF-kB and p38 MAPK pathways
    Article Snippet: RNA (2.5 μg) was reverse-transcribed using the Superscript™ III kit (Invitrogen) according to the manufacturer's instructions. .. The iNOS, COX-2, tumor necrosis factor-α (TNF-α), IL-1β, IL-6 and GAPDH genes were amplified from the cDNA by polymerase chain reaction (PCR).

    Blocking Assay:

    Article Title: Evaluation of diversity among common beans (Phaseolus vulgaris L.) from two centers of domestication using 'omics' technologies
    Article Snippet: Although Glycine max and Phaseolus vulgaris differ in chromosome number and genome size (the soybean genome is twice as large as common dry bean), linkage mapping of DNA markers found an average conserved block length of 13.9 cM between the two genomes indicating high conversation and preservation [ , ]. .. Complimentary DNA (cDNA) was synthesized using the Superscript III kit (Invitrogen, Carlsbad, CA) and hybridized to a microarray developed for soybean [ ] using the Genisphere Array 50 kit (Genisphere, Hatfield, PA).

    Plasmid Preparation:

    Article Title: Opsin Expression in Human Epidermal Skin
    Article Snippet: RNA extraction, reverse transcription, and PCR HEM and KER cDNA was obtained by reverse transcription (RT) using SuperScript III kit (Invitrogen) with total RNA extracted from cultured cells using the RNeasy Plus kit (Qiagen). .. In some cases we obtained a faint ˜1 kb band that was purified and reamplified using the same protocol.

    Article Title:
    Article Snippet: Paragraph title: Plasmid Construction ... ITGB1 cDNA was generated by mRNA extracted from DU145 cells and reverse-transcribed with a SuperScript III kit (Invitrogen). cDNA was amplified by PCR human ITGB1 gene ( ) primers: forward, 5′-GGTACT GGATCC ATGAATTTACAACCAATTTTCTGGA-3′ (BamHI underlined) and reverse, 5′-GTAGA CTCGAG TCATTTTCCCTCATACTTCGGATTGA-3′ (XhoI underlined).

    Software:

    Article Title: A Petunia Homeodomain-Leucine Zipper Protein, PhHD-Zip, Plays an Important Role in Flower Senescence
    Article Snippet: 2 µg total RNA was used to synthesis first-strand cDNA using the SuperScript III kit (Invitrogen, CA, USA). .. The amplified gene was sequenced by the sequencing service of the College of Biological Sciences at UC Davis.

    SYBR Green Assay:

    Article Title: Lipid transfer from plants to arbuscular mycorrhiza fungi
    Article Snippet: RNA was extracted using the Spectrum Plant Total RNA Kit ( www.sigmaaldrich.com ). .. The RNA was treated with Invitrogen DNAse I amp. grade ( www.invitrogen.com ) and tested for purity by PCR. cDNA synthesis was performed with 500 ng RNA using the Superscript III kit ( www.invitrogen.com ). qRT-PCR was performed with GoTaq G2 DNA polymerase (Promega), 5 x colorless GoTaq Buffer (Promega) and SYBR Green I (Invitrogen S7563, 10.000x concentrated, 500 µl) - diluted to 100x in DMSO. .. Primers ( ) were designed with primer3 (58).

    Article Title: A preliminary analysis of hepatitis C virus in pancreatic islet cells
    Article Snippet: Total RNA from 3 different human islets donors was isolated using TRIzol reagent (Thermo Scientific) in combination with the RNeasy Mini kit (Qiagen) followed by DNase treatment. .. Five hundred nanograms of total RNA were retrotranscribed using the Superscript III kit (Thermo Scientific), and the cDNAs obtained were utilized as templates for quantitative real-time RT-PCR analysis of CD81 (72 base pair [bp]), occludin (63 bp), claudin-1 (101 bp), and SR-B1 (50 bp), as well as the housekeeping gene GAPDH (94 bp). cDNA was run on an AbiPRISM 7300 fast real-time cycler using the power SYBR Green real-time PCR master mix kit and quantified by built-in SYBR Green Analysis. .. All samples were evaluated in triplicate with the average relative amount of specific mRNA being normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH ) expression.

    RNA Extraction:

    Article Title: Factors of early protective action of live influenza vaccine combined with recombinant bacterial polypeptides against homologous and heterologous influenza infection
    Article Snippet: RNA extraction was performed using RNeasy Mini Spin Column (QIAGEN, Hilden, Germany). .. For cDNA synthesis, reverse transcription (RT) with 100 pg of total RNA was performed using oligo(dt) primers and random hexamers mix and the SuperScript III kit (Invitrogen, Carlsbad, CA, USA).

    Article Title: Opsin Expression in Human Epidermal Skin
    Article Snippet: Human Umbilical Vein Endothelial Cells (HUVEC) were cultured in EGM-2 (Lonza) and HL60 cells in IMDM with 20% FBS. .. RNA extraction, reverse transcription, and PCR HEM and KER cDNA was obtained by reverse transcription (RT) using SuperScript III kit (Invitrogen) with total RNA extracted from cultured cells using the RNeasy Plus kit (Qiagen). .. PCR reactions were performed with the primers shown below: For PCR amplification of full-length OPN2 transcripts we used 30–35 cycles of the following protocol: 95°C for 30 s, 58°C for 45 s and 72°C for 2 min.

    Article Title: Occurrence and expression of novel methyl-coenzyme M reductase gene (mcrA) variants in hot spring sediments
    Article Snippet: Paragraph title: DNA and RNA extraction and amplification ... The remaining RNA was reverse-transcribed by first strand synthesis with archaeal SSU rRNA primers mentioned above and the SuperScript III kit from Thermo Fisher Scientific according to the manufacturer’s protocol, with the exception that RNasin (Promega, Madison, WI, USA) was used instead of RNaseOUT but at the same suggested concentration.

    Preserving:

    Article Title: Evaluation of diversity among common beans (Phaseolus vulgaris L.) from two centers of domestication using 'omics' technologies
    Article Snippet: Although Glycine max and Phaseolus vulgaris differ in chromosome number and genome size (the soybean genome is twice as large as common dry bean), linkage mapping of DNA markers found an average conserved block length of 13.9 cM between the two genomes indicating high conversation and preservation [ , ]. .. Complimentary DNA (cDNA) was synthesized using the Superscript III kit (Invitrogen, Carlsbad, CA) and hybridized to a microarray developed for soybean [ ] using the Genisphere Array 50 kit (Genisphere, Hatfield, PA).

    Concentration Assay:

    Article Title: Occurrence and expression of novel methyl-coenzyme M reductase gene (mcrA) variants in hot spring sediments
    Article Snippet: On RNA from the top of HL9, the absence of DNA was confirmed by performing PCR amplification of SSU rRNA genes on an aliquot of RNA using the previously mentioned protocol and positive controls with DNA. .. The remaining RNA was reverse-transcribed by first strand synthesis with archaeal SSU rRNA primers mentioned above and the SuperScript III kit from Thermo Fisher Scientific according to the manufacturer’s protocol, with the exception that RNasin (Promega, Madison, WI, USA) was used instead of RNaseOUT but at the same suggested concentration. .. PCR amplification of reverse-transcribed cDNA was then performed as it was for DNA extractions (above) with the exception that MgSO4 was added to a final concentration of 1.5 mM to offset the removal of Mg2+ ions by EDTA during DNase treatment.

    Construct:

    Article Title: Control of RAB7 activity and localization through the retromer‐TBC1D5 complex enables RAB7‐dependent mitophagy
    Article Snippet: Paragraph title: cDNA constructs ... RILP, TBC1D5, RAB7, and VPS29 cDNA was cloned from HeLa cell cDNA prepared with the Superscript III kit (Invitrogen) using Kapa HiFi DNA polymerase.

    Article Title: Cargo-selective SNX-BAR proteins mediate retromer trimer independent retrograde transport
    Article Snippet: Paragraph title: cDNA constructs ... The SNX-BAR cDNA as well as the IGF1R and IGF2R cDNA was cloned from HeLa cell cDNA prepared with the Superscript-III kit (Invitrogen) using KAPA HiFi DNA polymerase (Kapa Biosystems).

    Article Title:
    Article Snippet: ITGB1 cDNA was generated by mRNA extracted from DU145 cells and reverse-transcribed with a SuperScript III kit (Invitrogen). cDNA was amplified by PCR human ITGB1 gene ( ) primers: forward, 5′-GGTACT GGATCC ATGAATTTACAACCAATTTTCTGGA-3′ (BamHI underlined) and reverse, 5′-GTAGA CTCGAG TCATTTTCCCTCATACTTCGGATTGA-3′ (XhoI underlined). .. The PCR-amplified product was ligated into pcDNA3 expression vector (Invitrogen).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher superscript iii kit
    The FEN1 inhibitor, PTPD, reduces cccDNA production. Effect of FEN1 inhibition on HBV-replicating cells. Hep38.7-Tet cells were treated with dimethylsulfoxide (DMSO) as a vehicle control, PTPD (5 μM), or 3TC (50 μM) in the absence of tetracycline for 5 days. At day 5, levels of HBV DNA, HBV RNA (pgRNA normalized by HPRT) and pre-C mRNA were analyzed. <t>qPCR</t> analysis of HBV DNA in (A) culture supernatant, (B) cytoplasmic NC-DNA, (C) cccDNA, and (D) pgRNA. Each result represents the mean ± SEM of <t>three</t> independent experiments. Asterisks indicate statistically significant differences; * P
    Superscript Iii Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 328 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript iii kit/product/Thermo Fisher
    Average 99 stars, based on 328 article reviews
    Price from $9.99 to $1999.99
    superscript iii kit - by Bioz Stars, 2019-12
    99/100 stars
      Buy from Supplier

    80
    Thermo Fisher superscript iii first strand synthesis system
    BRCA2 deficiency causes <t>DNA</t> under replication that results in abnormal mitoses. a – c BRCA2 ∆Ex3-4/– cells were released for 22 h from serum starvation to increase mitotic cells, incubated with EdU for 1 h, and then analyzed for mitotic DNA synthesis. Early mitotic cells defined as being in prophase, prometaphase, or metaphase were analyzed for EdU foci that co-localize with FANCD2 foci pairs. a Representative images of mitotic DNA synthesis. Scale bars 10 µm. b Percent early mitotic cells containing EdU foci, analyzed by an unpaired two-tailed t -test. n = 3. c FANCD2 foci pairs with or without EdU foci co-localization. Graphs represent the pooled results of <t>three</t> independent experiments, each analyzed by a two-tailed Mann–Whitney test. Median FANCD2 foci pair number, red bars . d FANCD2 foci pair analysis in early mitotic cells. Cells were untreated, or treated with the CDK1 inhibitor RO-3306 (10 µM, 24 h) to delay mitotic entry, and released for 1 h before analysis of FANCD2 foci pairs in early mitotic cells. Analysis is by an unpaired two-tailed t -test. n = 4. e – h Anaphase cells were analyzed for DAPI bridges ( e , g ) and lagging chromosomes ( f , h ). RO-3306 treatment (10 µM, 24 h with release for 1 h) was applied where indicated. Representative deconvolved images are shown on the left of e and f . n = 3. Statistical analysis was by an unpaired two-tailed t -test. FD2, FANCD2. Scale bars 10 µm. i , j . 53BP1 nuclear body analysis with RO-3306 (10 µM, i ) or nocodazole (100 ng ml −1 , j ) treatment and released as in the schematic on the left . The fraction of EdU+ cells in G1 at the time of harvest that contains ≥3 53BP1 nuclear bodies (NBs) is shown in the graph on the right . Analysis is by an unpaired two-tailed t -test. n ≥ 3. Error bars s.d. ns, not significant; * p
    Superscript Iii First Strand Synthesis System, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 80/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript iii first strand synthesis system/product/Thermo Fisher
    Average 80 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    superscript iii first strand synthesis system - by Bioz Stars, 2019-12
    80/100 stars
      Buy from Supplier

    Image Search Results


    The FEN1 inhibitor, PTPD, reduces cccDNA production. Effect of FEN1 inhibition on HBV-replicating cells. Hep38.7-Tet cells were treated with dimethylsulfoxide (DMSO) as a vehicle control, PTPD (5 μM), or 3TC (50 μM) in the absence of tetracycline for 5 days. At day 5, levels of HBV DNA, HBV RNA (pgRNA normalized by HPRT) and pre-C mRNA were analyzed. qPCR analysis of HBV DNA in (A) culture supernatant, (B) cytoplasmic NC-DNA, (C) cccDNA, and (D) pgRNA. Each result represents the mean ± SEM of three independent experiments. Asterisks indicate statistically significant differences; * P

    Journal: PLoS Pathogens

    Article Title: Flap endonuclease 1 is involved in cccDNA formation in the hepatitis B virus

    doi: 10.1371/journal.ppat.1007124

    Figure Lengend Snippet: The FEN1 inhibitor, PTPD, reduces cccDNA production. Effect of FEN1 inhibition on HBV-replicating cells. Hep38.7-Tet cells were treated with dimethylsulfoxide (DMSO) as a vehicle control, PTPD (5 μM), or 3TC (50 μM) in the absence of tetracycline for 5 days. At day 5, levels of HBV DNA, HBV RNA (pgRNA normalized by HPRT) and pre-C mRNA were analyzed. qPCR analysis of HBV DNA in (A) culture supernatant, (B) cytoplasmic NC-DNA, (C) cccDNA, and (D) pgRNA. Each result represents the mean ± SEM of three independent experiments. Asterisks indicate statistically significant differences; * P

    Article Snippet: Total RNA was treated with amplification grade DNase I (Thermo Fisher Scientific) and reverse transcribed using an oligo (dT) primer and the SuperScript III kit (Thermo Fisher Scientific). qPCR analysis of resulting cDNA was performed using SYBR green ROX (Toyobo) with MX3000 (Stratagene) as described previously [ ].

    Techniques: Inhibition, Real-time Polymerase Chain Reaction

    Requirement of nuclease activity and the C-terminus of FEN1 for cccDNA production. (A) Schematic presentation of FEN1 protein. D181A: nuclease-deficient mutant. ΔC: deletion mutant unable to bind WRN protein. (B) FEN assay. Flap endonuclease activity of immunoprecipitated FEN1 protein (wt, D181A, or ΔC) was determined as in Fig 1A . (C) pResQ lentiviral vectors carrying FEN1 shRNA and the FEN1 transgene (wt, D181A, or ΔC, see also S8 Fig ) were transduced into Hep38.7-Tet cells. After puromycin selection, NC-DNA was analyzed by Southern blotting and qPCR, respectively. Each result represents the mean ± SEM of three independent experiments. Asterisks indicate statistically significant differences; **** P

    Journal: PLoS Pathogens

    Article Title: Flap endonuclease 1 is involved in cccDNA formation in the hepatitis B virus

    doi: 10.1371/journal.ppat.1007124

    Figure Lengend Snippet: Requirement of nuclease activity and the C-terminus of FEN1 for cccDNA production. (A) Schematic presentation of FEN1 protein. D181A: nuclease-deficient mutant. ΔC: deletion mutant unable to bind WRN protein. (B) FEN assay. Flap endonuclease activity of immunoprecipitated FEN1 protein (wt, D181A, or ΔC) was determined as in Fig 1A . (C) pResQ lentiviral vectors carrying FEN1 shRNA and the FEN1 transgene (wt, D181A, or ΔC, see also S8 Fig ) were transduced into Hep38.7-Tet cells. After puromycin selection, NC-DNA was analyzed by Southern blotting and qPCR, respectively. Each result represents the mean ± SEM of three independent experiments. Asterisks indicate statistically significant differences; **** P

    Article Snippet: Total RNA was treated with amplification grade DNase I (Thermo Fisher Scientific) and reverse transcribed using an oligo (dT) primer and the SuperScript III kit (Thermo Fisher Scientific). qPCR analysis of resulting cDNA was performed using SYBR green ROX (Toyobo) with MX3000 (Stratagene) as described previously [ ].

    Techniques: Activity Assay, Mutagenesis, Immunoprecipitation, shRNA, Selection, Southern Blot, Real-time Polymerase Chain Reaction

    Deletion of the C-terminus disrupts the nuclear localization and reduces HBV DNA association of FEN1 protein. (A) Expression vectors of FEN1-GFP, FEN1ΔC-GFP, or mock vector (pcDNA4/TO) were transfected into Hep38.7-Tet cells. The nucleus was visualized by co-transfection of the nuclear localization signal (NLS)-tagged DsRed vector. (B–C) Myc-FEN1 or Myc-FEN1ΔC vector was transfected into Hep38.7-Tet cells. (B) Myc-tagged protein expression (before cross linkage) shown by Western blot. Two blots with different protein loadings are shown. (C) Myc-FEN1-transfected Hep38.7-Tet cells were cross-linked, and the lysates were immunoprecipitated with either control IgG or anti-Myc antibody. The immunoprecipitants were subjected to qPCR analysis using a primer pair to detect the core region of HBV. Each result represents the mean ± SEM of three independent experiments. Asterisks indicate statistically significant differences; *** P

    Journal: PLoS Pathogens

    Article Title: Flap endonuclease 1 is involved in cccDNA formation in the hepatitis B virus

    doi: 10.1371/journal.ppat.1007124

    Figure Lengend Snippet: Deletion of the C-terminus disrupts the nuclear localization and reduces HBV DNA association of FEN1 protein. (A) Expression vectors of FEN1-GFP, FEN1ΔC-GFP, or mock vector (pcDNA4/TO) were transfected into Hep38.7-Tet cells. The nucleus was visualized by co-transfection of the nuclear localization signal (NLS)-tagged DsRed vector. (B–C) Myc-FEN1 or Myc-FEN1ΔC vector was transfected into Hep38.7-Tet cells. (B) Myc-tagged protein expression (before cross linkage) shown by Western blot. Two blots with different protein loadings are shown. (C) Myc-FEN1-transfected Hep38.7-Tet cells were cross-linked, and the lysates were immunoprecipitated with either control IgG or anti-Myc antibody. The immunoprecipitants were subjected to qPCR analysis using a primer pair to detect the core region of HBV. Each result represents the mean ± SEM of three independent experiments. Asterisks indicate statistically significant differences; *** P

    Article Snippet: Total RNA was treated with amplification grade DNase I (Thermo Fisher Scientific) and reverse transcribed using an oligo (dT) primer and the SuperScript III kit (Thermo Fisher Scientific). qPCR analysis of resulting cDNA was performed using SYBR green ROX (Toyobo) with MX3000 (Stratagene) as described previously [ ].

    Techniques: Expressing, Plasmid Preparation, Transfection, Cotransfection, Western Blot, Immunoprecipitation, Real-time Polymerase Chain Reaction

    FEN1 protein facilitates cccDNA formation in vitro . (A) Schematic presentation of in vitro cccDNA formation assay. Purified NC-DNA (10 8 copies) was incubated with recombinant FEN1, Bst DNA polymerase, and Taq DNA ligase. Following incubation, the DNA was purified and analyzed (B–F). Regions for qPCR amplification (E and F) were indicated as p. The 5.4-kb PstI fragment in HBV plasmid (Control) has a partial HBV sequence but does not have core and intact P genes. (B) cccDNA-selective qPCR. Each result represents the mean ± SEM of three independent experiments. Asterisks indicate statistically significant differences; *** P

    Journal: PLoS Pathogens

    Article Title: Flap endonuclease 1 is involved in cccDNA formation in the hepatitis B virus

    doi: 10.1371/journal.ppat.1007124

    Figure Lengend Snippet: FEN1 protein facilitates cccDNA formation in vitro . (A) Schematic presentation of in vitro cccDNA formation assay. Purified NC-DNA (10 8 copies) was incubated with recombinant FEN1, Bst DNA polymerase, and Taq DNA ligase. Following incubation, the DNA was purified and analyzed (B–F). Regions for qPCR amplification (E and F) were indicated as p. The 5.4-kb PstI fragment in HBV plasmid (Control) has a partial HBV sequence but does not have core and intact P genes. (B) cccDNA-selective qPCR. Each result represents the mean ± SEM of three independent experiments. Asterisks indicate statistically significant differences; *** P

    Article Snippet: Total RNA was treated with amplification grade DNase I (Thermo Fisher Scientific) and reverse transcribed using an oligo (dT) primer and the SuperScript III kit (Thermo Fisher Scientific). qPCR analysis of resulting cDNA was performed using SYBR green ROX (Toyobo) with MX3000 (Stratagene) as described previously [ ].

    Techniques: In Vitro, Tube Formation Assay, Purification, Incubation, Recombinant, Real-time Polymerase Chain Reaction, Amplification, Plasmid Preparation, Sequencing

    FEN1 siRNA knockdown and CRISPR/Cas9-mediated gene editing reduce cccDNA production. (A–D) Hep38.7-Tet cells were transfected with FEN1 -specific siRNA (siFEN1 #1 or #2) or control (siCtrl), and cultured without tetracycline. Four days after transfection, FEN1 mRNA/protein and HBV DNA were analyzed. (A) FEN1 mRNA quantified by RT-qPCR (normalized by HPRT) (upper panel) and Western blotting of FEN1 protein (lower panel). GAPDH expression is shown as a loading control. FEN1 protein expression gives rise to two bands in our study, which may be due to post-translational modification. (B–C) Levels of HBV DNA in cytoplasmic nucleocapsid (NC) (B) and cccDNA (C). (D) Efficiency of cccDNA formation (cccDNA levels normalized by cytoplasmic NC-DNA) was calculated. Each result represents the mean ± SEM of three independent experiments. Asterisks indicate statistically significant differences; * P

    Journal: PLoS Pathogens

    Article Title: Flap endonuclease 1 is involved in cccDNA formation in the hepatitis B virus

    doi: 10.1371/journal.ppat.1007124

    Figure Lengend Snippet: FEN1 siRNA knockdown and CRISPR/Cas9-mediated gene editing reduce cccDNA production. (A–D) Hep38.7-Tet cells were transfected with FEN1 -specific siRNA (siFEN1 #1 or #2) or control (siCtrl), and cultured without tetracycline. Four days after transfection, FEN1 mRNA/protein and HBV DNA were analyzed. (A) FEN1 mRNA quantified by RT-qPCR (normalized by HPRT) (upper panel) and Western blotting of FEN1 protein (lower panel). GAPDH expression is shown as a loading control. FEN1 protein expression gives rise to two bands in our study, which may be due to post-translational modification. (B–C) Levels of HBV DNA in cytoplasmic nucleocapsid (NC) (B) and cccDNA (C). (D) Efficiency of cccDNA formation (cccDNA levels normalized by cytoplasmic NC-DNA) was calculated. Each result represents the mean ± SEM of three independent experiments. Asterisks indicate statistically significant differences; * P

    Article Snippet: Total RNA was treated with amplification grade DNase I (Thermo Fisher Scientific) and reverse transcribed using an oligo (dT) primer and the SuperScript III kit (Thermo Fisher Scientific). qPCR analysis of resulting cDNA was performed using SYBR green ROX (Toyobo) with MX3000 (Stratagene) as described previously [ ].

    Techniques: CRISPR, Transfection, Cell Culture, Quantitative RT-PCR, Western Blot, Expressing, Modification

    Global changes in infected MDM gene expression. MDMs from four healthy human donors were infected at a 2:1 (parasite:MDM) ratio with each of three isolates of L. braziliensis from clades A, B, or C ( Schriefer et al., 2004 ). The clades A, B, and C isolates were drawn from patients with DL, CL, and ML, respectively. After 4 h, total RNA was extracted and processed for hybridization to Affymetrix human transcript microarrays. Fold changes were calculated by comparing fluorescence data representing the abundance of each transcript in infected versus uninfected MDMs from the same donor. Each dot in the figure represents the average fold change in abundance of each transcript in all four donors. Eighty-nine transcripts were significantly increased, and 471 transcripts were significantly decreased after MDM infection with each of the three L. braziliensis isolates (one-way ANOVA for repressed transcripts among MDM infected with clades A, B, or C, p

    Journal: Frontiers in Microbiology

    Article Title: Early Suppression of Macrophage Gene Expression by Leishmania braziliensis

    doi: 10.3389/fmicb.2018.02464

    Figure Lengend Snippet: Global changes in infected MDM gene expression. MDMs from four healthy human donors were infected at a 2:1 (parasite:MDM) ratio with each of three isolates of L. braziliensis from clades A, B, or C ( Schriefer et al., 2004 ). The clades A, B, and C isolates were drawn from patients with DL, CL, and ML, respectively. After 4 h, total RNA was extracted and processed for hybridization to Affymetrix human transcript microarrays. Fold changes were calculated by comparing fluorescence data representing the abundance of each transcript in infected versus uninfected MDMs from the same donor. Each dot in the figure represents the average fold change in abundance of each transcript in all four donors. Eighty-nine transcripts were significantly increased, and 471 transcripts were significantly decreased after MDM infection with each of the three L. braziliensis isolates (one-way ANOVA for repressed transcripts among MDM infected with clades A, B, or C, p

    Article Snippet: Changes in expression observed on microarrays were validated by reverse transcriptase followed by qPCR to document gene expression in RNA samples from replicate MDM samples incubated without or with the representatives of L. braziliensis clades. cDNA was generated using the Superscript III First Strand Synthesis System kit (Invitrogen/ThermoFisher, Waltham, MA, United States) and random hexamers, followed by RNase H treatment according to the manufacturer’s instructions.

    Techniques: Infection, Expressing, Hybridization, Fluorescence

    Gene expression profiles from the microarrays described and illustrated in Figure 2 were collated according to the number of significantly altered transcripts in MDM infected with isolates from each of the three representatives of L. braziliensis clades (A, B, or C). (A) Venn diagram of the distribution of transcripts with changes in expression that reached statistical significance upon infection of MDMs with each L. braziliensis parasite. Sectors indicate the numbers of transcripts that were uniquely changed due to infection with one parasite clade, or transcripts that were changed by infection with more than one parasite clade (evaluation of gene expression employed ANOVA for detecting transcripts significantly affected by infections, and paired Student’s t -test for comparing the expression elicited by clades of parasites in infected MDM). (B) The magnitude of change in expression of 471 genes in MDM infected with each of the three L. braziliensis isolates is illustrated. Values represent the fold changes in expression of the 471 genes for which transcript abundance was significantly decreased by infection with any of the three parasite isolates tested. L. braziliensis isolates belong to clade A (DL; blue), clade B (CL; green), or clade C (ML; red). Each position on the x-axis corresponds to a single gene, plotted against its fold change in expression on the y-axis (Friedman’s test p

    Journal: Frontiers in Microbiology

    Article Title: Early Suppression of Macrophage Gene Expression by Leishmania braziliensis

    doi: 10.3389/fmicb.2018.02464

    Figure Lengend Snippet: Gene expression profiles from the microarrays described and illustrated in Figure 2 were collated according to the number of significantly altered transcripts in MDM infected with isolates from each of the three representatives of L. braziliensis clades (A, B, or C). (A) Venn diagram of the distribution of transcripts with changes in expression that reached statistical significance upon infection of MDMs with each L. braziliensis parasite. Sectors indicate the numbers of transcripts that were uniquely changed due to infection with one parasite clade, or transcripts that were changed by infection with more than one parasite clade (evaluation of gene expression employed ANOVA for detecting transcripts significantly affected by infections, and paired Student’s t -test for comparing the expression elicited by clades of parasites in infected MDM). (B) The magnitude of change in expression of 471 genes in MDM infected with each of the three L. braziliensis isolates is illustrated. Values represent the fold changes in expression of the 471 genes for which transcript abundance was significantly decreased by infection with any of the three parasite isolates tested. L. braziliensis isolates belong to clade A (DL; blue), clade B (CL; green), or clade C (ML; red). Each position on the x-axis corresponds to a single gene, plotted against its fold change in expression on the y-axis (Friedman’s test p

    Article Snippet: Changes in expression observed on microarrays were validated by reverse transcriptase followed by qPCR to document gene expression in RNA samples from replicate MDM samples incubated without or with the representatives of L. braziliensis clades. cDNA was generated using the Superscript III First Strand Synthesis System kit (Invitrogen/ThermoFisher, Waltham, MA, United States) and random hexamers, followed by RNase H treatment according to the manufacturer’s instructions.

    Techniques: Expressing, Infection

    Changes in LRRK2, TLR8, HSPA1A, and MT1M expression were documented in independent assays of MDMs from eight additional human donors, distinct from those of experiments depicted in Figures 1 – 4 . MDMs were infected with three representative L. braziliensis isolates of each clade (A, B, or C) used in microarray experiments. Data derived from total RNA extracted after 4 h of MDM infection at a MOI of two parasites per macrophage (2:1). The relative abundance of transcripts was assessed by RT-qPCR. p -Values correspond to pair-wise comparisons by one tailed paired Wilcoxon test.

    Journal: Frontiers in Microbiology

    Article Title: Early Suppression of Macrophage Gene Expression by Leishmania braziliensis

    doi: 10.3389/fmicb.2018.02464

    Figure Lengend Snippet: Changes in LRRK2, TLR8, HSPA1A, and MT1M expression were documented in independent assays of MDMs from eight additional human donors, distinct from those of experiments depicted in Figures 1 – 4 . MDMs were infected with three representative L. braziliensis isolates of each clade (A, B, or C) used in microarray experiments. Data derived from total RNA extracted after 4 h of MDM infection at a MOI of two parasites per macrophage (2:1). The relative abundance of transcripts was assessed by RT-qPCR. p -Values correspond to pair-wise comparisons by one tailed paired Wilcoxon test.

    Article Snippet: Changes in expression observed on microarrays were validated by reverse transcriptase followed by qPCR to document gene expression in RNA samples from replicate MDM samples incubated without or with the representatives of L. braziliensis clades. cDNA was generated using the Superscript III First Strand Synthesis System kit (Invitrogen/ThermoFisher, Waltham, MA, United States) and random hexamers, followed by RNase H treatment according to the manufacturer’s instructions.

    Techniques: Expressing, Infection, Microarray, Derivative Assay, Quantitative RT-PCR, One-tailed Test

    BRCA2 deficiency causes DNA under replication that results in abnormal mitoses. a – c BRCA2 ∆Ex3-4/– cells were released for 22 h from serum starvation to increase mitotic cells, incubated with EdU for 1 h, and then analyzed for mitotic DNA synthesis. Early mitotic cells defined as being in prophase, prometaphase, or metaphase were analyzed for EdU foci that co-localize with FANCD2 foci pairs. a Representative images of mitotic DNA synthesis. Scale bars 10 µm. b Percent early mitotic cells containing EdU foci, analyzed by an unpaired two-tailed t -test. n = 3. c FANCD2 foci pairs with or without EdU foci co-localization. Graphs represent the pooled results of three independent experiments, each analyzed by a two-tailed Mann–Whitney test. Median FANCD2 foci pair number, red bars . d FANCD2 foci pair analysis in early mitotic cells. Cells were untreated, or treated with the CDK1 inhibitor RO-3306 (10 µM, 24 h) to delay mitotic entry, and released for 1 h before analysis of FANCD2 foci pairs in early mitotic cells. Analysis is by an unpaired two-tailed t -test. n = 4. e – h Anaphase cells were analyzed for DAPI bridges ( e , g ) and lagging chromosomes ( f , h ). RO-3306 treatment (10 µM, 24 h with release for 1 h) was applied where indicated. Representative deconvolved images are shown on the left of e and f . n = 3. Statistical analysis was by an unpaired two-tailed t -test. FD2, FANCD2. Scale bars 10 µm. i , j . 53BP1 nuclear body analysis with RO-3306 (10 µM, i ) or nocodazole (100 ng ml −1 , j ) treatment and released as in the schematic on the left . The fraction of EdU+ cells in G1 at the time of harvest that contains ≥3 53BP1 nuclear bodies (NBs) is shown in the graph on the right . Analysis is by an unpaired two-tailed t -test. n ≥ 3. Error bars s.d. ns, not significant; * p

    Journal: Nature Communications

    Article Title: BRCA2 suppresses replication stress-induced mitotic and G1 abnormalities through homologous recombination

    doi: 10.1038/s41467-017-00634-0

    Figure Lengend Snippet: BRCA2 deficiency causes DNA under replication that results in abnormal mitoses. a – c BRCA2 ∆Ex3-4/– cells were released for 22 h from serum starvation to increase mitotic cells, incubated with EdU for 1 h, and then analyzed for mitotic DNA synthesis. Early mitotic cells defined as being in prophase, prometaphase, or metaphase were analyzed for EdU foci that co-localize with FANCD2 foci pairs. a Representative images of mitotic DNA synthesis. Scale bars 10 µm. b Percent early mitotic cells containing EdU foci, analyzed by an unpaired two-tailed t -test. n = 3. c FANCD2 foci pairs with or without EdU foci co-localization. Graphs represent the pooled results of three independent experiments, each analyzed by a two-tailed Mann–Whitney test. Median FANCD2 foci pair number, red bars . d FANCD2 foci pair analysis in early mitotic cells. Cells were untreated, or treated with the CDK1 inhibitor RO-3306 (10 µM, 24 h) to delay mitotic entry, and released for 1 h before analysis of FANCD2 foci pairs in early mitotic cells. Analysis is by an unpaired two-tailed t -test. n = 4. e – h Anaphase cells were analyzed for DAPI bridges ( e , g ) and lagging chromosomes ( f , h ). RO-3306 treatment (10 µM, 24 h with release for 1 h) was applied where indicated. Representative deconvolved images are shown on the left of e and f . n = 3. Statistical analysis was by an unpaired two-tailed t -test. FD2, FANCD2. Scale bars 10 µm. i , j . 53BP1 nuclear body analysis with RO-3306 (10 µM, i ) or nocodazole (100 ng ml −1 , j ) treatment and released as in the schematic on the left . The fraction of EdU+ cells in G1 at the time of harvest that contains ≥3 53BP1 nuclear bodies (NBs) is shown in the graph on the right . Analysis is by an unpaired two-tailed t -test. n ≥ 3. Error bars s.d. ns, not significant; * p

    Article Snippet: Complementary DNA was then synthesized from RNA using SuperScript® III First-Strand Synthesis Kit (18080051, Thermo Fisher Scientific) following the manufacturer’s instructions.

    Techniques: Incubation, DNA Synthesis, Two Tailed Test, MANN-WHITNEY

    Fork protection is a minor replication stress suppression pathway. a Analysis of mitotic DNA synthesis in BRCA2 –/– AAVS1 ∆ cells complemented by BRCA2 WT or BRCA2 SE. Cells were released for 22 h from serum starvation to increase mitotic cells, incubated with EdU 1 h, and then analyzed for mitotic DNA synthesis. Early mitotic cells, defined as being in prophase, prometaphase, or metaphase, were analyzed for EdU foci that co-localize with FANCD2 foci pairs. The percent early mitotic cells containing EdU foci ( left , n = 3) or EdU foci distribution in these cells ( right , pooled results of three independent experiments) was quantified. b , c Spontaneous 53BP1 nuclear body analysis in G1 in both BRCA2 ∆Ex3-4/– cells ( b ) and BRCA2 –/– AAVS1 ∆ cells ( c ) complemented by BRCA2 WT or BRCA2 SE. n ≥ 3. d – g HU-induced 53BP1 nuclear body formation analysis, as in Fig. 4d , using complemented BRCA2 ∆Ex3-4/– cells ( d ) or BRCA2 –/ – AAVS1 ∆ cells ( e ), stable MRE11 or PARP1 knockdown BRCA2 ∆Ex3-4/ – cells ( f ), and BRCA2 ∆Ex3-4/ – cells with the indicated PARP1 genotype ( g ). n ≥ 3. Error bars s.d. ns, not significant; * p

    Journal: Nature Communications

    Article Title: BRCA2 suppresses replication stress-induced mitotic and G1 abnormalities through homologous recombination

    doi: 10.1038/s41467-017-00634-0

    Figure Lengend Snippet: Fork protection is a minor replication stress suppression pathway. a Analysis of mitotic DNA synthesis in BRCA2 –/– AAVS1 ∆ cells complemented by BRCA2 WT or BRCA2 SE. Cells were released for 22 h from serum starvation to increase mitotic cells, incubated with EdU 1 h, and then analyzed for mitotic DNA synthesis. Early mitotic cells, defined as being in prophase, prometaphase, or metaphase, were analyzed for EdU foci that co-localize with FANCD2 foci pairs. The percent early mitotic cells containing EdU foci ( left , n = 3) or EdU foci distribution in these cells ( right , pooled results of three independent experiments) was quantified. b , c Spontaneous 53BP1 nuclear body analysis in G1 in both BRCA2 ∆Ex3-4/– cells ( b ) and BRCA2 –/– AAVS1 ∆ cells ( c ) complemented by BRCA2 WT or BRCA2 SE. n ≥ 3. d – g HU-induced 53BP1 nuclear body formation analysis, as in Fig. 4d , using complemented BRCA2 ∆Ex3-4/– cells ( d ) or BRCA2 –/ – AAVS1 ∆ cells ( e ), stable MRE11 or PARP1 knockdown BRCA2 ∆Ex3-4/ – cells ( f ), and BRCA2 ∆Ex3-4/ – cells with the indicated PARP1 genotype ( g ). n ≥ 3. Error bars s.d. ns, not significant; * p

    Article Snippet: Complementary DNA was then synthesized from RNA using SuperScript® III First-Strand Synthesis Kit (18080051, Thermo Fisher Scientific) following the manufacturer’s instructions.

    Techniques: DNA Synthesis, Incubation

    HR proficiency is associated with replication stress suppression and cell viability. a Western blot showing RAD51 knockdown in BRCA2 ∆Ex3-4/ – cells stably expressing BRCA2 WT or BRCA2 SE. NT, non targeting siRNA. b HR analysis. Cells expressing RAD51 siRNAs were infected with I-SceI-expressing lentivirus and the percent GFP+ cells was analyzed by an unpaired two-tailed t -test. n ≥ 3. c Cells expressing RAD51 siRNAs were analyzed for fork protection in the presence of HU. Median CldU/IdU tract length ratios are indicated in the graph ( red bars ). Graphs represent the pooled results of > 300 fibers per genotype from at least three independent experiments, analyzed by a two-tailed Mann–Whitney test. d Cells expressing RAD51 siRNAs were released for 22 h from serum starvation to increase mitotic cells, incubated with EdU 1 h, and then analyzed for mitotic DNA synthesis. Early mitotic cells, defined as being in prophase, prometaphase, or metaphase, were analyzed for EdU foci that co-localize with FANCD2 foci pairs. The percent early mitotic cells containing EdU foci were analyzed by an unpaired two-tailed t -test. n = 3. e HU-induced 53BP1 nuclear body formation analysis, as in Fig. 4d , using cells expressing RAD51 siRNAs. Statistical analysis was by an unpaired two-tailed t -test. n ≥ 4. f RAD51 depletion in BRCA2 ∆Ex3-4/ – cells stably expressing BRCA2 WT or BRCA2 SE leads to a reduction in clonogenic survival. g HU-induced 53BP1 nuclear body formation analysis, as in Fig. 4d , using cells transfected with RAD51 siRNAs. Statistical analysis was by an unpaired two-tailed t -test. n = 4. Error bars s.d. ns, not significant; * p

    Journal: Nature Communications

    Article Title: BRCA2 suppresses replication stress-induced mitotic and G1 abnormalities through homologous recombination

    doi: 10.1038/s41467-017-00634-0

    Figure Lengend Snippet: HR proficiency is associated with replication stress suppression and cell viability. a Western blot showing RAD51 knockdown in BRCA2 ∆Ex3-4/ – cells stably expressing BRCA2 WT or BRCA2 SE. NT, non targeting siRNA. b HR analysis. Cells expressing RAD51 siRNAs were infected with I-SceI-expressing lentivirus and the percent GFP+ cells was analyzed by an unpaired two-tailed t -test. n ≥ 3. c Cells expressing RAD51 siRNAs were analyzed for fork protection in the presence of HU. Median CldU/IdU tract length ratios are indicated in the graph ( red bars ). Graphs represent the pooled results of > 300 fibers per genotype from at least three independent experiments, analyzed by a two-tailed Mann–Whitney test. d Cells expressing RAD51 siRNAs were released for 22 h from serum starvation to increase mitotic cells, incubated with EdU 1 h, and then analyzed for mitotic DNA synthesis. Early mitotic cells, defined as being in prophase, prometaphase, or metaphase, were analyzed for EdU foci that co-localize with FANCD2 foci pairs. The percent early mitotic cells containing EdU foci were analyzed by an unpaired two-tailed t -test. n = 3. e HU-induced 53BP1 nuclear body formation analysis, as in Fig. 4d , using cells expressing RAD51 siRNAs. Statistical analysis was by an unpaired two-tailed t -test. n ≥ 4. f RAD51 depletion in BRCA2 ∆Ex3-4/ – cells stably expressing BRCA2 WT or BRCA2 SE leads to a reduction in clonogenic survival. g HU-induced 53BP1 nuclear body formation analysis, as in Fig. 4d , using cells transfected with RAD51 siRNAs. Statistical analysis was by an unpaired two-tailed t -test. n = 4. Error bars s.d. ns, not significant; * p

    Article Snippet: Complementary DNA was then synthesized from RNA using SuperScript® III First-Strand Synthesis Kit (18080051, Thermo Fisher Scientific) following the manufacturer’s instructions.

    Techniques: Western Blot, Stable Transfection, Expressing, Infection, Two Tailed Test, MANN-WHITNEY, Incubation, DNA Synthesis, Transfection

    Fork protection plays a minor role in cell viability and DNA repair. a DNA fiber analysis to quantify fork protection. Schematic of the experimental design and representative images are shown in the inset . Median CldU/IdU tract length ratios are indicated in the graph ( red bars ). Graphs here and below represent the pooled results of > 200 fibers per genotype from at least two independent experiments, analyzed by a two-tailed Mann–Whitney test. b Cells stably expressing the indicated shRNAs were analyzed for fork protection in the presence of HU by a two-tailed Mann–Whitney test. Scr, scrambled shRNA. c HR analysis. PARP1 knockdown cells were infected with I-SceI-expressing lentivirus and the percent GFP+ cells was analyzed by an unpaired two-tailed t -test. n = 3. d PARP1 knockdown cells were plated for clonogenic survival. Residual colonies from BRCA2 ∆Ex3-4/− plates were all were confirmed by PCR to have maintained the BRCA2 fl/− genotype (i.e., escaped Cre recombination). e Cisplatin-induced γH2AX. PARP1 knockdown cells were treated with 5 µM cisplatin for 5 h and released for another 24 h before analysis. γH2AX mean nuclear intensities of > 1000 individual cells are shown from one experiment, which is representative of three independent experiments, analyzed by a two-tailed Mann–Whitney test. The dotted red line indicates the median of BRCA2 mutant cells treated with the scrambled shRNA exposed to cisplatin. A.U., arbitrary units. Box and whiskers show the 10th and 90th percentiles. f Western blotting of BRCA2 −/− AAVS1 fl cells stably expressing BRCA2 WT or BRCA2 SE. g DNA fiber analysis to quantify fork protection in the presence of HU. Median CldU/IdU tract length ratios are indicated ( red bars ), analyzed by a two-tailed Mann–Whitney test. h HR analysis, as in c . n > 3. i Clonogenic survival analysis using an unpaired two-tailed t -test. n = 3. j Cisplatin-induced γH2AX analysis, as in e . The dotted red line indicates the median of the BRCA2 −/− AAVS1 ∆ cells exposed to cisplatin. Error bars s.d. ns, not significant; * p

    Journal: Nature Communications

    Article Title: BRCA2 suppresses replication stress-induced mitotic and G1 abnormalities through homologous recombination

    doi: 10.1038/s41467-017-00634-0

    Figure Lengend Snippet: Fork protection plays a minor role in cell viability and DNA repair. a DNA fiber analysis to quantify fork protection. Schematic of the experimental design and representative images are shown in the inset . Median CldU/IdU tract length ratios are indicated in the graph ( red bars ). Graphs here and below represent the pooled results of > 200 fibers per genotype from at least two independent experiments, analyzed by a two-tailed Mann–Whitney test. b Cells stably expressing the indicated shRNAs were analyzed for fork protection in the presence of HU by a two-tailed Mann–Whitney test. Scr, scrambled shRNA. c HR analysis. PARP1 knockdown cells were infected with I-SceI-expressing lentivirus and the percent GFP+ cells was analyzed by an unpaired two-tailed t -test. n = 3. d PARP1 knockdown cells were plated for clonogenic survival. Residual colonies from BRCA2 ∆Ex3-4/− plates were all were confirmed by PCR to have maintained the BRCA2 fl/− genotype (i.e., escaped Cre recombination). e Cisplatin-induced γH2AX. PARP1 knockdown cells were treated with 5 µM cisplatin for 5 h and released for another 24 h before analysis. γH2AX mean nuclear intensities of > 1000 individual cells are shown from one experiment, which is representative of three independent experiments, analyzed by a two-tailed Mann–Whitney test. The dotted red line indicates the median of BRCA2 mutant cells treated with the scrambled shRNA exposed to cisplatin. A.U., arbitrary units. Box and whiskers show the 10th and 90th percentiles. f Western blotting of BRCA2 −/− AAVS1 fl cells stably expressing BRCA2 WT or BRCA2 SE. g DNA fiber analysis to quantify fork protection in the presence of HU. Median CldU/IdU tract length ratios are indicated ( red bars ), analyzed by a two-tailed Mann–Whitney test. h HR analysis, as in c . n > 3. i Clonogenic survival analysis using an unpaired two-tailed t -test. n = 3. j Cisplatin-induced γH2AX analysis, as in e . The dotted red line indicates the median of the BRCA2 −/− AAVS1 ∆ cells exposed to cisplatin. Error bars s.d. ns, not significant; * p

    Article Snippet: Complementary DNA was then synthesized from RNA using SuperScript® III First-Strand Synthesis Kit (18080051, Thermo Fisher Scientific) following the manufacturer’s instructions.

    Techniques: Two Tailed Test, MANN-WHITNEY, Stable Transfection, Expressing, shRNA, Infection, Polymerase Chain Reaction, Mutagenesis, Western Blot

    Isogenic ESC–derived neural cell types recapitulate patient-specific phenotypes. (A) CRISPR/Cas9 targeting scheme to introduce patient-specific deletion in WIBR#3 ESC line. (B) PCR assay shows untargeted control line and three heterozygous deletion lines. (C) Genomic DNA sequence of CRISPR target sites flanking the deletion. (D) Immunostaining for control, isogenic deletion, and iPSC lines after NPC differentiation. (E) Quantification of NPC fraction. Normalized data are shown as mean ± SEM (n = 4). (F) Comparative protein analysis of control, isogenic deletion, and iPSC lines upon neuronal differentiation. Arrows indicate three isoforms of SHANK3. (G) Quantification of immunoblots shown in (F). Data are represented as mean ± SEM (n = 3).

    Journal: Life Science Alliance

    Article Title: JIP2 haploinsufficiency contributes to neurodevelopmental abnormalities in human pluripotent stem cell–derived neural progenitors and cortical neurons

    doi: 10.26508/lsa.201800094

    Figure Lengend Snippet: Isogenic ESC–derived neural cell types recapitulate patient-specific phenotypes. (A) CRISPR/Cas9 targeting scheme to introduce patient-specific deletion in WIBR#3 ESC line. (B) PCR assay shows untargeted control line and three heterozygous deletion lines. (C) Genomic DNA sequence of CRISPR target sites flanking the deletion. (D) Immunostaining for control, isogenic deletion, and iPSC lines after NPC differentiation. (E) Quantification of NPC fraction. Normalized data are shown as mean ± SEM (n = 4). (F) Comparative protein analysis of control, isogenic deletion, and iPSC lines upon neuronal differentiation. Arrows indicate three isoforms of SHANK3. (G) Quantification of immunoblots shown in (F). Data are represented as mean ± SEM (n = 3).

    Article Snippet: For qRT–PCR, cDNA was synthesized using SuperScript III First Strand Synthesis Kit (#18080051; Thermo Fisher Scientific).

    Techniques: Derivative Assay, CRISPR, Introduce, Polymerase Chain Reaction, Sequencing, Immunostaining, Western Blot

    PAX6-GFP reporter lines allow specific purification of human PSC-derived neural progenitors. (A) Sequencing of the second allele of three independent clones. (B) FACS purification of three independent clones plus negative control after NPC differentiation. (C) Comparative gene expression profiles: global versus differentially expressed genes. (D) Comparative transcript profiling of a subset of NPC markers. (E) qRT–PCR validation of a subset of NPC markers. Error bars represent SEM. (F) Gene expression upstream and across the 22q13 deletion. Data are represented as log2 RPM values.

    Journal: Life Science Alliance

    Article Title: JIP2 haploinsufficiency contributes to neurodevelopmental abnormalities in human pluripotent stem cell–derived neural progenitors and cortical neurons

    doi: 10.26508/lsa.201800094

    Figure Lengend Snippet: PAX6-GFP reporter lines allow specific purification of human PSC-derived neural progenitors. (A) Sequencing of the second allele of three independent clones. (B) FACS purification of three independent clones plus negative control after NPC differentiation. (C) Comparative gene expression profiles: global versus differentially expressed genes. (D) Comparative transcript profiling of a subset of NPC markers. (E) qRT–PCR validation of a subset of NPC markers. Error bars represent SEM. (F) Gene expression upstream and across the 22q13 deletion. Data are represented as log2 RPM values.

    Article Snippet: For qRT–PCR, cDNA was synthesized using SuperScript III First Strand Synthesis Kit (#18080051; Thermo Fisher Scientific).

    Techniques: Purification, Derivative Assay, Sequencing, FACS, Clone Assay, Negative Control, Expressing, Quantitative RT-PCR

    Pharmacological activation of the NRP1 recues JNK expression in maturing patient neurons. (A) Mechanistic scheme of the semaphorin pathway in neurons. (B) Comparative transcript analysis (RNAseq) of key factors of semaphorin pathway and JNK target genes. (C) Protein analysis of mature neurons derived from control and two independent patient iPSC lines. (D) Quantification of immunoblots shown in (C). Data are represented as mean ± SEM (n = 3). (E) Transcript analysis (qRT–PCR) of key factors of the semaphorin pathway upon treatment with recombinant SEMA3A. Data are represented as mean ± SEM (two biological replicates including three technical replicates each). Two-tailed paired t test, * P

    Journal: Life Science Alliance

    Article Title: JIP2 haploinsufficiency contributes to neurodevelopmental abnormalities in human pluripotent stem cell–derived neural progenitors and cortical neurons

    doi: 10.26508/lsa.201800094

    Figure Lengend Snippet: Pharmacological activation of the NRP1 recues JNK expression in maturing patient neurons. (A) Mechanistic scheme of the semaphorin pathway in neurons. (B) Comparative transcript analysis (RNAseq) of key factors of semaphorin pathway and JNK target genes. (C) Protein analysis of mature neurons derived from control and two independent patient iPSC lines. (D) Quantification of immunoblots shown in (C). Data are represented as mean ± SEM (n = 3). (E) Transcript analysis (qRT–PCR) of key factors of the semaphorin pathway upon treatment with recombinant SEMA3A. Data are represented as mean ± SEM (two biological replicates including three technical replicates each). Two-tailed paired t test, * P

    Article Snippet: For qRT–PCR, cDNA was synthesized using SuperScript III First Strand Synthesis Kit (#18080051; Thermo Fisher Scientific).

    Techniques: Activation Assay, Expressing, Derivative Assay, Western Blot, Quantitative RT-PCR, Recombinant, Two Tailed Test