superscript iii first strand synthesis system  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    SuperScript III First Strand Synthesis System
    Description:
    The SuperScript III First Strand Synthesis System for RT PCR is optimized to synthesize first strand cDNA from purified poly A or total RNA RNA targets from 100 bp to 12 kb can be detected with this system The amount of starting material can vary from 1 pg 5 µg of total RNA SuperScript III Reverse Transcriptase is a version of M MLV RT that has been engineered to reduce RNase H activity and provide increased thermal stability The enzyme is used to synthesize cDNA at a temperature range of 42 55°C providing increased specificity higher yields of cDNA and more full length product than other reverse transcriptases Because SuperScript III RT is not significantly inhibited by ribosomal and transfer RNA it may be used to synthesize first strand cDNA from a total RNA preparation Using the SuperScript III First Strand SystemcDNA synthesis is performed in the first step using either total RNA or poly A selected RNA primed with oligo dT random primers or a gene specific primer In the second step PCR is performed in a separate tube using primers specific for the gene of interest For the PCR reaction we recommend one of the following DNA polymerases Platinum Taq DNA Polymerase provides automatic hot start conditions for increased specificity up to 4 kb Platinum Taq DNA Polymerase High Fidelity provides increased yield and high fidelity for targets up to 15 kb and Platinum Pfx DNA Polymerase provides maximum fidelity for targets up to 12 kb
    Catalog Number:
    18080051
    Price:
    None
    Applications:
    PCR & Real-Time PCR|Reverse Transcription
    Category:
    Kits and Assays
    Buy from Supplier


    Structured Review

    Thermo Fisher superscript iii first strand synthesis system
    Induction of the GSR system under starvation. B . abortus 2308 wt (black bars) and the isogenic lovhk :: km (dark grey bars) and ∆lovR (light grey bars) mutant strains were grown in TSB medium up to logarithmic phase. First, an aliquot was drawn (time 0 h), then the rest of the culture was washed and resuspended in modified MM1 minimal medium, and aliquots were drawn at 0.5 h, 1 h and 2 h. Expression of phyR gene was analyzed by <t>qRT-PCR.</t> The if-1 housekeeping gene was used as a reference. Data represent the average of <t>three</t> independent experiments and are reported as fold induction relative to wt at time 0 h in TSB ± standard error. p -values between each strain and wt (at each time point) were determined by one-way ANOVA and post-hoc Tukey’s multiple comparisons test (* = p
    The SuperScript III First Strand Synthesis System for RT PCR is optimized to synthesize first strand cDNA from purified poly A or total RNA RNA targets from 100 bp to 12 kb can be detected with this system The amount of starting material can vary from 1 pg 5 µg of total RNA SuperScript III Reverse Transcriptase is a version of M MLV RT that has been engineered to reduce RNase H activity and provide increased thermal stability The enzyme is used to synthesize cDNA at a temperature range of 42 55°C providing increased specificity higher yields of cDNA and more full length product than other reverse transcriptases Because SuperScript III RT is not significantly inhibited by ribosomal and transfer RNA it may be used to synthesize first strand cDNA from a total RNA preparation Using the SuperScript III First Strand SystemcDNA synthesis is performed in the first step using either total RNA or poly A selected RNA primed with oligo dT random primers or a gene specific primer In the second step PCR is performed in a separate tube using primers specific for the gene of interest For the PCR reaction we recommend one of the following DNA polymerases Platinum Taq DNA Polymerase provides automatic hot start conditions for increased specificity up to 4 kb Platinum Taq DNA Polymerase High Fidelity provides increased yield and high fidelity for targets up to 15 kb and Platinum Pfx DNA Polymerase provides maximum fidelity for targets up to 12 kb
    https://www.bioz.com/result/superscript iii first strand synthesis system/product/Thermo Fisher
    Average 99 stars, based on 4953 article reviews
    Price from $9.99 to $1999.99
    superscript iii first strand synthesis system - by Bioz Stars, 2020-08
    99/100 stars

    Images

    1) Product Images from "LOV Histidine Kinase Modulates the General Stress Response System and Affects the virB Operon Expression in Brucella abortus"

    Article Title: LOV Histidine Kinase Modulates the General Stress Response System and Affects the virB Operon Expression in Brucella abortus

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0124058

    Induction of the GSR system under starvation. B . abortus 2308 wt (black bars) and the isogenic lovhk :: km (dark grey bars) and ∆lovR (light grey bars) mutant strains were grown in TSB medium up to logarithmic phase. First, an aliquot was drawn (time 0 h), then the rest of the culture was washed and resuspended in modified MM1 minimal medium, and aliquots were drawn at 0.5 h, 1 h and 2 h. Expression of phyR gene was analyzed by qRT-PCR. The if-1 housekeeping gene was used as a reference. Data represent the average of three independent experiments and are reported as fold induction relative to wt at time 0 h in TSB ± standard error. p -values between each strain and wt (at each time point) were determined by one-way ANOVA and post-hoc Tukey’s multiple comparisons test (* = p
    Figure Legend Snippet: Induction of the GSR system under starvation. B . abortus 2308 wt (black bars) and the isogenic lovhk :: km (dark grey bars) and ∆lovR (light grey bars) mutant strains were grown in TSB medium up to logarithmic phase. First, an aliquot was drawn (time 0 h), then the rest of the culture was washed and resuspended in modified MM1 minimal medium, and aliquots were drawn at 0.5 h, 1 h and 2 h. Expression of phyR gene was analyzed by qRT-PCR. The if-1 housekeeping gene was used as a reference. Data represent the average of three independent experiments and are reported as fold induction relative to wt at time 0 h in TSB ± standard error. p -values between each strain and wt (at each time point) were determined by one-way ANOVA and post-hoc Tukey’s multiple comparisons test (* = p

    Techniques Used: Mutagenesis, Modification, Expressing, Quantitative RT-PCR

    LOVHK modulates the GSR system in B . abortus . B . abortus 2308 wt and in the isogenic lovhk :: km , ∆lovR , ∆phyR and lovhk :: km /pMR_ lovhk strains were cultured in TSB up to logarithmic phase, and expression of lovhk , lovR , dps and rpoH1 genes was analyzed by qRT-PCR. The if-1 housekeeping gene was used as a reference. Data represent the average of three independent experiments, and are reported as fold induction relative to wt ± standard error. p -values between each strain and wt were determined by one-way ANOVA and post-hoc Tukey’s multiple comparisons test (** = p
    Figure Legend Snippet: LOVHK modulates the GSR system in B . abortus . B . abortus 2308 wt and in the isogenic lovhk :: km , ∆lovR , ∆phyR and lovhk :: km /pMR_ lovhk strains were cultured in TSB up to logarithmic phase, and expression of lovhk , lovR , dps and rpoH1 genes was analyzed by qRT-PCR. The if-1 housekeeping gene was used as a reference. Data represent the average of three independent experiments, and are reported as fold induction relative to wt ± standard error. p -values between each strain and wt were determined by one-way ANOVA and post-hoc Tukey’s multiple comparisons test (** = p

    Techniques Used: Cell Culture, Expressing, Quantitative RT-PCR

    PhyR expression is decreased in the lovhk mutant. A. B . abortus 2308 wt and the isogenic lovhk :: km , ∆lovR and lovhk :: km /pMR_ lovhk strains were cultured in TSB up to logarithmic phase, and expression of the phyR gene was analyzed by qRT-PCR. The if-1 housekeeping gene was used as a reference. Data represent the average of three independent experiments, and are reported as fold induction relative to wt ± standard error. p -values between each strain and wt were determined by one-way ANOVA and post-hoc Tukey’s multiple comparisons test (* = p
    Figure Legend Snippet: PhyR expression is decreased in the lovhk mutant. A. B . abortus 2308 wt and the isogenic lovhk :: km , ∆lovR and lovhk :: km /pMR_ lovhk strains were cultured in TSB up to logarithmic phase, and expression of the phyR gene was analyzed by qRT-PCR. The if-1 housekeeping gene was used as a reference. Data represent the average of three independent experiments, and are reported as fold induction relative to wt ± standard error. p -values between each strain and wt were determined by one-way ANOVA and post-hoc Tukey’s multiple comparisons test (* = p

    Techniques Used: Expressing, Mutagenesis, Cell Culture, Quantitative RT-PCR

    2) Product Images from "Regulatory effects and molecular mechanism of Trigonostemon reidioides on lipopolysaccharide-induced inflammatory responses in RAW264.7 cells"

    Article Title: Regulatory effects and molecular mechanism of Trigonostemon reidioides on lipopolysaccharide-induced inflammatory responses in RAW264.7 cells

    Journal: Molecular Medicine Reports

    doi: 10.3892/mmr.2017.7297

    Effect of ETR on the expression of iNOS and proinflammatory cytokines in LPS-stimulated RAW264.7 cells. (A) Expression levels of iNOS mRNA (top) and protein (bottom) were determined by RT-PCR and western blotting. GAPDH and β-actin served as internal controls for RT-PCR and western blotting, respectively. (B) Expression levels of TNF-α, IL-1β and IL-6 mRNA were determined by RT-PCR. (C) Concentrations of IL-1β, TNF-α and IL-6 cytokines in cell culture supernatants were determined by ELISA. Data are presented as the mean ± standard deviation of three independent replicates. *P
    Figure Legend Snippet: Effect of ETR on the expression of iNOS and proinflammatory cytokines in LPS-stimulated RAW264.7 cells. (A) Expression levels of iNOS mRNA (top) and protein (bottom) were determined by RT-PCR and western blotting. GAPDH and β-actin served as internal controls for RT-PCR and western blotting, respectively. (B) Expression levels of TNF-α, IL-1β and IL-6 mRNA were determined by RT-PCR. (C) Concentrations of IL-1β, TNF-α and IL-6 cytokines in cell culture supernatants were determined by ELISA. Data are presented as the mean ± standard deviation of three independent replicates. *P

    Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction, Western Blot, Cell Culture, Enzyme-linked Immunosorbent Assay, Standard Deviation

    3) Product Images from "DDX41 Recognizes RNA/DNA Retroviral Reverse Transcripts and Is Critical for In Vivo Control of Murine Leukemia Virus Infection"

    Article Title: DDX41 Recognizes RNA/DNA Retroviral Reverse Transcripts and Is Critical for In Vivo Control of Murine Leukemia Virus Infection

    Journal: mBio

    doi: 10.1128/mBio.00923-18

    DDX41 and IFI203 work together with cGAS for the maximal antiviral response. (A) Knockdown of STING, DDX41, and IFI203 in cGas / Apobec3 double-knockout BMDMs and BMDCs. Cells were transfected with the indicated siRNAs, and 48 h later, cells were infected with MLV. At 2 hpi, the cells were harvested and examined for IFN-β RNA levels. Knockdown verification of the genes is shown in Fig. S1A in the supplemental material. Values are shown as means ± standard deviations (SDs) from three experiments, each with macrophages and DCs from a different mouse. P values were determined by unpaired t tests (NS, not significant; *, P ≤ 0.05; **, P ≤ 0.01). (B) Diagram shows the cGAS-cGAMP-STING pathway. The arrows labeled a and b represent the possible points of DDX41 action; cGAMP addition would rescue DDX41 knockdown if it acted at point a but not if DDX41 acted at point b in the pathway. The red lines represent viral reverse transcripts. (C) cGAMP rescues cGAS but not STING, DDX41, or IFI203 knockdown. NR9456 macrophages were transfected with the indicated siRNAs and 24 h later transfected with cGAMP. At 18 h post-cGAMP treatment, the cells were infected with MLV; IFN-β RNA levels were measured at 2 hpi. Values are shown as means ± SDs from three experiments. Knockdown verification of the genes is shown in Fig. S1B . Mock indicates mock-infected cells.
    Figure Legend Snippet: DDX41 and IFI203 work together with cGAS for the maximal antiviral response. (A) Knockdown of STING, DDX41, and IFI203 in cGas / Apobec3 double-knockout BMDMs and BMDCs. Cells were transfected with the indicated siRNAs, and 48 h later, cells were infected with MLV. At 2 hpi, the cells were harvested and examined for IFN-β RNA levels. Knockdown verification of the genes is shown in Fig. S1A in the supplemental material. Values are shown as means ± standard deviations (SDs) from three experiments, each with macrophages and DCs from a different mouse. P values were determined by unpaired t tests (NS, not significant; *, P ≤ 0.05; **, P ≤ 0.01). (B) Diagram shows the cGAS-cGAMP-STING pathway. The arrows labeled a and b represent the possible points of DDX41 action; cGAMP addition would rescue DDX41 knockdown if it acted at point a but not if DDX41 acted at point b in the pathway. The red lines represent viral reverse transcripts. (C) cGAMP rescues cGAS but not STING, DDX41, or IFI203 knockdown. NR9456 macrophages were transfected with the indicated siRNAs and 24 h later transfected with cGAMP. At 18 h post-cGAMP treatment, the cells were infected with MLV; IFN-β RNA levels were measured at 2 hpi. Values are shown as means ± SDs from three experiments. Knockdown verification of the genes is shown in Fig. S1B . Mock indicates mock-infected cells.

    Techniques Used: Double Knockout, Transfection, Infection, Labeling

    4) Product Images from "Allele-specific regulation of mutant Huntingtin by Wig1, a downstream target of p53"

    Article Title: Allele-specific regulation of mutant Huntingtin by Wig1, a downstream target of p53

    Journal: Human Molecular Genetics

    doi: 10.1093/hmg/ddw115

    Role for Wig1 in mHtt-elicited pathology in HD models. (A) Suppression of mutant Htt-elicited cell toxicity by knockdown of Wig1 in rat cortical primary neurons. Green, GFP. Inset shows DAPI-stained nucleus. The scale bar represents 20 µm. (B) Amelioration of mutant Htt-elicited aggregate formation by knockdown of Wig1 in rat cortical primary neurons. Red, Htt aggregates; blue, DAPI nuclear staining. The scale bar represents 10 µm. (C) RNA-binding region in Wig1 is critical for its facilitation of mutant Htt-elicited cytotoxicity and aggregate formation. Expression of wt Wig1 in rat cortical primary neurons expressing mutant Htt fragment (N171-Htt-Q82) and RNAi against Wig1 completely suppresses Wig1 RNAi-mediated amelioration of cell death (the left panel) and aggregate formation (the right panel), whereas RNA binding-defective mutant Wig1 (Wig1-H88A) does not. All the graphs represent at least three independent experiments. (D) Reduction of the Htt-positive aggregate formation by knockdown of Wig1 in the striatum of R6/2 mice. Htt-positive aggregates were labeled with an antibody against Htt MAB5374 (EM48; green) at 9 weeks of age. White arrowhead indicates the AAV-infected striatal cells that do not contain Htt-positive aggregates. Con, control AAV; KD, Wig1 KD AAV. Scale bars represent 20 μm. High magnification (High mag.): Scale bars represent 10 μm. Data are represented as mean ± s.e.m. (* P
    Figure Legend Snippet: Role for Wig1 in mHtt-elicited pathology in HD models. (A) Suppression of mutant Htt-elicited cell toxicity by knockdown of Wig1 in rat cortical primary neurons. Green, GFP. Inset shows DAPI-stained nucleus. The scale bar represents 20 µm. (B) Amelioration of mutant Htt-elicited aggregate formation by knockdown of Wig1 in rat cortical primary neurons. Red, Htt aggregates; blue, DAPI nuclear staining. The scale bar represents 10 µm. (C) RNA-binding region in Wig1 is critical for its facilitation of mutant Htt-elicited cytotoxicity and aggregate formation. Expression of wt Wig1 in rat cortical primary neurons expressing mutant Htt fragment (N171-Htt-Q82) and RNAi against Wig1 completely suppresses Wig1 RNAi-mediated amelioration of cell death (the left panel) and aggregate formation (the right panel), whereas RNA binding-defective mutant Wig1 (Wig1-H88A) does not. All the graphs represent at least three independent experiments. (D) Reduction of the Htt-positive aggregate formation by knockdown of Wig1 in the striatum of R6/2 mice. Htt-positive aggregates were labeled with an antibody against Htt MAB5374 (EM48; green) at 9 weeks of age. White arrowhead indicates the AAV-infected striatal cells that do not contain Htt-positive aggregates. Con, control AAV; KD, Wig1 KD AAV. Scale bars represent 20 μm. High magnification (High mag.): Scale bars represent 10 μm. Data are represented as mean ± s.e.m. (* P

    Techniques Used: Mutagenesis, Staining, RNA Binding Assay, Expressing, Mouse Assay, Labeling, Infection

    5) Product Images from "Discovery of Candidate Disease Genes in ENU-Induced Mouse Mutants by Large-Scale Sequencing, Including a Splice-Site Mutation in Nucleoredoxin"

    Article Title: Discovery of Candidate Disease Genes in ENU-Induced Mouse Mutants by Large-Scale Sequencing, Including a Splice-Site Mutation in Nucleoredoxin

    Journal: PLoS Genetics

    doi: 10.1371/journal.pgen.1000759

    Mutation of nucleoredoxin in l11Jus13 (Nxn J13/J13 ) . (A) Haplotype map of 239 unaffected and 83 affected mice used for meiotic mapping. The location of each marker and Nxn is displayed (Ensembl v52). The mutation lies in a 6Mb region located between rs3702197 and rs13481117 . (B) The Nxn locus is depicted with introns 6 and 7 boxed. (C) The boxed region is expanded to illustrate the consequence of splicing in the wild type and mutant. A transversion (T to A) abolishes a consensus splice donor site leading to aberrant RNA splicing. The six base pair cryptic splice site used in the mutant is underlined. (D) Aberrant splicing in Nxn J13/J13 predicts an in frame insertion of 10 amino acids, GMELEGKWKA, (white), which occurs within the acidic region (black) of Nxn. (E) RT–PCR using primers flanking exon 6–7 from pools of three E14.5 heads of wild-type, heterozygous, and homozygous mutants demonstrates aberrant splicing in the mutant allele. (F) Western blots of Nxn and Actin from wild-type, heterozygous and homozygous mutants at E12.5 show reduced protein in the homozygous mutant. A reduction in protein was also observed at E15.5 and E18.5, and a polyclonal antibody against the N-terminus gave similar results (data not shown).
    Figure Legend Snippet: Mutation of nucleoredoxin in l11Jus13 (Nxn J13/J13 ) . (A) Haplotype map of 239 unaffected and 83 affected mice used for meiotic mapping. The location of each marker and Nxn is displayed (Ensembl v52). The mutation lies in a 6Mb region located between rs3702197 and rs13481117 . (B) The Nxn locus is depicted with introns 6 and 7 boxed. (C) The boxed region is expanded to illustrate the consequence of splicing in the wild type and mutant. A transversion (T to A) abolishes a consensus splice donor site leading to aberrant RNA splicing. The six base pair cryptic splice site used in the mutant is underlined. (D) Aberrant splicing in Nxn J13/J13 predicts an in frame insertion of 10 amino acids, GMELEGKWKA, (white), which occurs within the acidic region (black) of Nxn. (E) RT–PCR using primers flanking exon 6–7 from pools of three E14.5 heads of wild-type, heterozygous, and homozygous mutants demonstrates aberrant splicing in the mutant allele. (F) Western blots of Nxn and Actin from wild-type, heterozygous and homozygous mutants at E12.5 show reduced protein in the homozygous mutant. A reduction in protein was also observed at E15.5 and E18.5, and a polyclonal antibody against the N-terminus gave similar results (data not shown).

    Techniques Used: Mutagenesis, Mouse Assay, Marker, Reverse Transcription Polymerase Chain Reaction, Western Blot

    6) Product Images from "Deletion of Snai2 and Snai3 Results in Impaired Physical Development Compounded by Lymphocyte Deficiency"

    Article Title: Deletion of Snai2 and Snai3 Results in Impaired Physical Development Compounded by Lymphocyte Deficiency

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0069216

    Conditional Snai3 deletion strategy. (A) The Snai3 WT genomic DNA region contains the Rnf166 gene 5 kb upstream and the MVD gene 10 kb downstream. The Snai3 gene consists of 5’ and 3’ untranslated regions (white boxes), three exons (black boxes), and two introns. Arrow marks the transcriptional start site (TSS). Primers used for genotyping mice and for QT-PCR of Snai3 transcript are labeled as P1-P4 and QT, respectfully, and listed in Supplemental Table 1 . The Targeting Construct had a LoxP site inserted into the PacI site of intron one and the PL451 cassette inserted into the SalI site 2kb upstream of the TSS. (B) Homologous recombination created the Snai3 targeted genome containing unique 5’ PL451 and Knockin LoxP PCR products. The Neomycin (Neo) cassette was deleted via FLP-mediated recombination of Frt sites. (C) Cre recombinase activity deleted the Snai3 genomic region and created a new PCR product by bringing together primers P1 and P4, which are normally 6kb apart and unable to make a PCR product. Figure is not to scale.
    Figure Legend Snippet: Conditional Snai3 deletion strategy. (A) The Snai3 WT genomic DNA region contains the Rnf166 gene 5 kb upstream and the MVD gene 10 kb downstream. The Snai3 gene consists of 5’ and 3’ untranslated regions (white boxes), three exons (black boxes), and two introns. Arrow marks the transcriptional start site (TSS). Primers used for genotyping mice and for QT-PCR of Snai3 transcript are labeled as P1-P4 and QT, respectfully, and listed in Supplemental Table 1 . The Targeting Construct had a LoxP site inserted into the PacI site of intron one and the PL451 cassette inserted into the SalI site 2kb upstream of the TSS. (B) Homologous recombination created the Snai3 targeted genome containing unique 5’ PL451 and Knockin LoxP PCR products. The Neomycin (Neo) cassette was deleted via FLP-mediated recombination of Frt sites. (C) Cre recombinase activity deleted the Snai3 genomic region and created a new PCR product by bringing together primers P1 and P4, which are normally 6kb apart and unable to make a PCR product. Figure is not to scale.

    Techniques Used: Mouse Assay, Polymerase Chain Reaction, Labeling, Construct, Homologous Recombination, Knock-In, Activity Assay

    Snai1-3 transcripts are differentially expressed in primary and secondary lymphoid organs of wild type mice. RNA was isolated and cDNA synthesized as described in the Materials . Quantitative real-time RT-PCR was performed via LightCycler as described in the Materials . (A) cDNA from testes served as a positive control for all RT-PCR analysis. (B) Snai1-3 transcript analysis of cDNA generated from total thymus, spleen, and bone marrow. (C–E) RT-PCR of specific cell subsets demonstrating the distribution patterns of Snai1 (C), Snai2 (D), and Snai3 (E) expression. Three mice were analyzed for the testes. At least 4 mice were analyzed per immune cell type. Levels of Snai1-3 transcripts are relative to 1000 Actb transcripts per each individual sample. Data are represented by the mean ± SEM. One-way ANOVA with Bonferroni post hoc test: * p
    Figure Legend Snippet: Snai1-3 transcripts are differentially expressed in primary and secondary lymphoid organs of wild type mice. RNA was isolated and cDNA synthesized as described in the Materials . Quantitative real-time RT-PCR was performed via LightCycler as described in the Materials . (A) cDNA from testes served as a positive control for all RT-PCR analysis. (B) Snai1-3 transcript analysis of cDNA generated from total thymus, spleen, and bone marrow. (C–E) RT-PCR of specific cell subsets demonstrating the distribution patterns of Snai1 (C), Snai2 (D), and Snai3 (E) expression. Three mice were analyzed for the testes. At least 4 mice were analyzed per immune cell type. Levels of Snai1-3 transcripts are relative to 1000 Actb transcripts per each individual sample. Data are represented by the mean ± SEM. One-way ANOVA with Bonferroni post hoc test: * p

    Techniques Used: Mouse Assay, Isolation, Synthesized, Quantitative RT-PCR, Positive Control, Reverse Transcription Polymerase Chain Reaction, Generated, Expressing

    7) Product Images from "RNA-Seq Transcriptome Profiling Identifies CRISPLD2 as a Glucocorticoid Responsive Gene that Modulates Cytokine Function in Airway Smooth Muscle Cells"

    Article Title: RNA-Seq Transcriptome Profiling Identifies CRISPLD2 as a Glucocorticoid Responsive Gene that Modulates Cytokine Function in Airway Smooth Muscle Cells

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0099625

    Validation of GC responsive genes. After cells from three individual ASM lines were treated with 1 µM DEX for 18 h, the mRNA levels of indicated genes were measured by qRT-PCR and the folds of change induced by DEX were calculated. Each column bar represents an individual cell line; experiments for each cell line were performed in triplicate. Error bars are SE values corresponding to a cell line's replicates.
    Figure Legend Snippet: Validation of GC responsive genes. After cells from three individual ASM lines were treated with 1 µM DEX for 18 h, the mRNA levels of indicated genes were measured by qRT-PCR and the folds of change induced by DEX were calculated. Each column bar represents an individual cell line; experiments for each cell line were performed in triplicate. Error bars are SE values corresponding to a cell line's replicates.

    Techniques Used: Quantitative RT-PCR

    CRISPLD2 regulates the response to inflammatory cytokines. A ) Effect of CRISPLD2 -specific siRNA on CRISPLD2 mRNA and protein levels. ASM cells were transfected with CRISPLD2 -specific siRNA or non-targeting (NT) siRNA, and 72 h later, CRISPLD2 mRNA and protein levels were determined by qRT-PCR (levels normalized to those in control cells transfected with NT siRNA) and immuno-blotting, respectively. The effect of CRISPLD2 knockdown on IL1β-induced cytokine expression was assessed by transfecting ASM cells with CRISPLD2 -specific or NT siRNA, and 72 h later, treating cells for 24 h with B ) 5 ng/mL IL1β, C ) 100 nM DEX, or D ) 5 ng/mL IL1β and 100 nM DEX. IL6 expression was determined by qRT-PCR. Normalized mRNA levels are shown. Experiments were performed in triplicate, and the error bars are SE values for three samples. * P
    Figure Legend Snippet: CRISPLD2 regulates the response to inflammatory cytokines. A ) Effect of CRISPLD2 -specific siRNA on CRISPLD2 mRNA and protein levels. ASM cells were transfected with CRISPLD2 -specific siRNA or non-targeting (NT) siRNA, and 72 h later, CRISPLD2 mRNA and protein levels were determined by qRT-PCR (levels normalized to those in control cells transfected with NT siRNA) and immuno-blotting, respectively. The effect of CRISPLD2 knockdown on IL1β-induced cytokine expression was assessed by transfecting ASM cells with CRISPLD2 -specific or NT siRNA, and 72 h later, treating cells for 24 h with B ) 5 ng/mL IL1β, C ) 100 nM DEX, or D ) 5 ng/mL IL1β and 100 nM DEX. IL6 expression was determined by qRT-PCR. Normalized mRNA levels are shown. Experiments were performed in triplicate, and the error bars are SE values for three samples. * P

    Techniques Used: Transfection, Quantitative RT-PCR, Expressing

    CRISPLD2 is a GC- and IL1β-responsive gene. ASM cells were treated with 100 A ) increased CRISPLD2 mRNA expression as measured by qRT-PCR, B ) increased CRISPLD2 protein expression as measured by immuno-blotting. ASM cells were treated with 5 ng/mL IL1β for 24 h, resulting in C ) increased CRISPLD2 mRNA expression as measured by qRT-PCR, and D ) increased CRISPLD2 protein expression as measured by immuno-blotting. CRISPLD2 mRNA levels were measured in triplicate. CRISPLD2 protein levels are shown as normalized blot densitometry values, and the error bars are SE values across three independent experiments. * P
    Figure Legend Snippet: CRISPLD2 is a GC- and IL1β-responsive gene. ASM cells were treated with 100 A ) increased CRISPLD2 mRNA expression as measured by qRT-PCR, B ) increased CRISPLD2 protein expression as measured by immuno-blotting. ASM cells were treated with 5 ng/mL IL1β for 24 h, resulting in C ) increased CRISPLD2 mRNA expression as measured by qRT-PCR, and D ) increased CRISPLD2 protein expression as measured by immuno-blotting. CRISPLD2 mRNA levels were measured in triplicate. CRISPLD2 protein levels are shown as normalized blot densitometry values, and the error bars are SE values across three independent experiments. * P

    Techniques Used: Expressing, Quantitative RT-PCR

    8) Product Images from "Isolation of Progenitors that Exhibit Myogenic/Osteogenic Bipotency In Vitro by Fluorescence-Activated Cell Sorting from Human Fetal Muscle"

    Article Title: Isolation of Progenitors that Exhibit Myogenic/Osteogenic Bipotency In Vitro by Fluorescence-Activated Cell Sorting from Human Fetal Muscle

    Journal: Stem Cell Reports

    doi: 10.1016/j.stemcr.2013.12.006

    Distinct Transcriptional Signatures of Fetal CD34 − CD56 int ITGA7 hi and CD34 + hMFA Cells (A and B) PCA (A) and hierarchical clustering (B) demonstrate distinct gene expression signatures of CD34 + cells (blue, CD34 + ), CD34 − CD56 int ITGA7 hi cells (red, CD34 − CD56 int ITGA7 hi ), and unfractionated hMFA cells (green). Microarray analysis was performed using three to four (see B) biologically independent, freshly sorted CD34 − CD56 int ITGA7 hi , CD34 + , and unfractionated hMFA cell samples. (C) Microarray analyses demonstrated increased expression of muscle-lineage genes ( PAX7 , MYF5 , CDH15 , MYOD , MYOG ) in CD34 − CD56 int ITGA7 hi cells and adipocyte-lineage genes ( PPARG and FABP4 ) in CD34 + cells. Osteolineage genes ( COL1A1 , ALPL , BGLAP , and RUNX2 ) were present in fetal CD34 − CD56 int ITGA7 hi cells and CD34 + cells (blue, downregulated genes; red, upregulated genes). (D) Expression of PAX7 , MYF5 , PPARG , FABP4 , BGLAP , and RUNX2 (relative to GAPDH ) was evaluated by qRT-PCR in fetal CD34 − CD56 int ITGA7 hi cells compared to CD34 + cells obtained from two biologically independent fetal CD34 − CD56 int ITGA7 hi and three biologically independent CD34 + cells samples. PAX7 and MYF5 levels are 512- to 670-fold greater, and PPARG , FABP4 , BGLAP , and RUNX2 levels are 8- to 60-fold lower, in CD34 − CD56 int ITGA7 hi hMFA cells as compared to CD34 + cells. Data are mean ± SD. See also Figure S6 .
    Figure Legend Snippet: Distinct Transcriptional Signatures of Fetal CD34 − CD56 int ITGA7 hi and CD34 + hMFA Cells (A and B) PCA (A) and hierarchical clustering (B) demonstrate distinct gene expression signatures of CD34 + cells (blue, CD34 + ), CD34 − CD56 int ITGA7 hi cells (red, CD34 − CD56 int ITGA7 hi ), and unfractionated hMFA cells (green). Microarray analysis was performed using three to four (see B) biologically independent, freshly sorted CD34 − CD56 int ITGA7 hi , CD34 + , and unfractionated hMFA cell samples. (C) Microarray analyses demonstrated increased expression of muscle-lineage genes ( PAX7 , MYF5 , CDH15 , MYOD , MYOG ) in CD34 − CD56 int ITGA7 hi cells and adipocyte-lineage genes ( PPARG and FABP4 ) in CD34 + cells. Osteolineage genes ( COL1A1 , ALPL , BGLAP , and RUNX2 ) were present in fetal CD34 − CD56 int ITGA7 hi cells and CD34 + cells (blue, downregulated genes; red, upregulated genes). (D) Expression of PAX7 , MYF5 , PPARG , FABP4 , BGLAP , and RUNX2 (relative to GAPDH ) was evaluated by qRT-PCR in fetal CD34 − CD56 int ITGA7 hi cells compared to CD34 + cells obtained from two biologically independent fetal CD34 − CD56 int ITGA7 hi and three biologically independent CD34 + cells samples. PAX7 and MYF5 levels are 512- to 670-fold greater, and PPARG , FABP4 , BGLAP , and RUNX2 levels are 8- to 60-fold lower, in CD34 − CD56 int ITGA7 hi hMFA cells as compared to CD34 + cells. Data are mean ± SD. See also Figure S6 .

    Techniques Used: Expressing, Microarray, Quantitative RT-PCR

    9) Product Images from "Comparison of two neurotrophic serpins reveals a small fragment with cell survival activity"

    Article Title: Comparison of two neurotrophic serpins reveals a small fragment with cell survival activity

    Journal: Molecular Vision

    doi:

    Antiapoptotic Bcl2 expression. Reverse-transcription PCR (RT–PCR) for Bcl2 in R28 cells treated for 6 h with PN-1, PN-1[R346A], PN-1-17mer, PEDF-44mer, PEDF-17mer, and PEDF at the indicated concentrations, as well as with 10% fetal bovine serum (FBS; positive control) and in serum-free medium (None, untreated control). Bar graphs depict the average Bcl2 transcript values obtained relative to their respective 18S RNA values. Shown is the average from three independent experiments (n = 2 for each experiment) each performed with a different batch of cells. The dotted line corresponds to the value of None (untreated control), as reference, ± standard error of the mean (SEM; error bars). *, p
    Figure Legend Snippet: Antiapoptotic Bcl2 expression. Reverse-transcription PCR (RT–PCR) for Bcl2 in R28 cells treated for 6 h with PN-1, PN-1[R346A], PN-1-17mer, PEDF-44mer, PEDF-17mer, and PEDF at the indicated concentrations, as well as with 10% fetal bovine serum (FBS; positive control) and in serum-free medium (None, untreated control). Bar graphs depict the average Bcl2 transcript values obtained relative to their respective 18S RNA values. Shown is the average from three independent experiments (n = 2 for each experiment) each performed with a different batch of cells. The dotted line corresponds to the value of None (untreated control), as reference, ± standard error of the mean (SEM; error bars). *, p

    Techniques Used: Expressing, Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Positive Control

    10) Product Images from "LDB1-mediated enhancer looping can be established independent of mediator and cohesin"

    Article Title: LDB1-mediated enhancer looping can be established independent of mediator and cohesin

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkx433

    β maj globin gene expression affects β min globin gene activation by a looped enhancer. ( A ) Interaction frequency determined by chromatin conformation capture (3C) between locations across β-globin locus using HS2 enhancer as the anchor (gray bar) observed for induced ΔCore, ΔCore/GATA and ΔCore/GATA/KLF1 MEL cell lines and uninduced and induced control MEL cells. Yellow triangles along bottom of X axis indicate BglII restriction sites. ( B ) Primary transcripts of β maj and β min globin genes were examined by RT-qPCR after deletion of Core, Core/GATA or ΔCore/GATA/KLF1 elements in the β maj globin gene promoter in induced MEL cells. ( C ) RNA PolII occupancy at β maj and β min globin genes in control, ΔCore, ΔCore/GATA and ΔCore/GATA/KLF1 induced MEL cell lines determined by ChIP-qPCR. ( D ) KLF1 occupancy at β maj and β min globin genes in control, ΔCore, ΔCore/GATA and ΔCore/GATA/KLF1 induced MEL cell lines determined by ChIP-qPCR. Error bars indicate SEM of three biological replicates. (*) P
    Figure Legend Snippet: β maj globin gene expression affects β min globin gene activation by a looped enhancer. ( A ) Interaction frequency determined by chromatin conformation capture (3C) between locations across β-globin locus using HS2 enhancer as the anchor (gray bar) observed for induced ΔCore, ΔCore/GATA and ΔCore/GATA/KLF1 MEL cell lines and uninduced and induced control MEL cells. Yellow triangles along bottom of X axis indicate BglII restriction sites. ( B ) Primary transcripts of β maj and β min globin genes were examined by RT-qPCR after deletion of Core, Core/GATA or ΔCore/GATA/KLF1 elements in the β maj globin gene promoter in induced MEL cells. ( C ) RNA PolII occupancy at β maj and β min globin genes in control, ΔCore, ΔCore/GATA and ΔCore/GATA/KLF1 induced MEL cell lines determined by ChIP-qPCR. ( D ) KLF1 occupancy at β maj and β min globin genes in control, ΔCore, ΔCore/GATA and ΔCore/GATA/KLF1 induced MEL cell lines determined by ChIP-qPCR. Error bars indicate SEM of three biological replicates. (*) P

    Techniques Used: Expressing, Activation Assay, Quantitative RT-PCR, Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction

    11) Product Images from "MEG3-4 is a miRNA decoy that regulates IL-1β abundance to initiate and then limit inflammation to prevent sepsis during lung infection"

    Article Title: MEG3-4 is a miRNA decoy that regulates IL-1β abundance to initiate and then limit inflammation to prevent sepsis during lung infection

    Journal: Science signaling

    doi: 10.1126/scisignal.aao2387

    MEG3–4 modulates IL-1β and subsequent inflammatory responses by tightly modulating miR-138 expression. ( A ) MH-S cells were infected with PAO1 at 20:1 for 2 hours. Copies of IL-1β mRNA, miR-138, and MEG3–4 in each MH-S cell were detected by absolute qRT-PCR. ( B ) Normal AMs ( n = 3) transfected with IL-1β CRISPR-Cas activation plasmids or control plasmids (50 ng) or for 48 hours. TNF-α, IL-1β, and IL-6 were detected by qRT-PCR. ( C and D ) MEG3–4 and miR-138 in transfected AMs were measured by qRT-PCR. ( E ) Mice were intravenously injected with vehicle containing either NS-m or 138-m (50 μg per mouse) 24 and 48 hours (two time points in different animals) before PAO1 challenge. Kaplan-Meier survival curves of PAO1-infected NS-m– or 138-m–injected mice ( n = 6, two independent experiments). Survival was determined up to 96 hours ( P = 0.0177, log-rank test). ( F ) 138-m– and NS-m–injected mice ( n = 3) were infected with PAO1 at 5 × 10 6 CFU per mouse for 24 hours. Expression of cytokines in mouse lungs was detected by immunoblotting. ( G ) qRT-PCR analysis of MEG3–4 expression in the lung from PAO1-infected NS-m– and 138-m–injected mice. ( H ) Proposed model for the role of lncRNA MEG3–4 in regulating IL-1β expression by competitively binding miR-138. Data in (A) to (D) are means ± SD for three independent mice or cell samples (Kruskal-Wallis test; * P ≤ 0.05 and ** P ≤ 0.01). Error bars represent SD. Data in (F) and (G) are representative of three independent mice or cell samples.
    Figure Legend Snippet: MEG3–4 modulates IL-1β and subsequent inflammatory responses by tightly modulating miR-138 expression. ( A ) MH-S cells were infected with PAO1 at 20:1 for 2 hours. Copies of IL-1β mRNA, miR-138, and MEG3–4 in each MH-S cell were detected by absolute qRT-PCR. ( B ) Normal AMs ( n = 3) transfected with IL-1β CRISPR-Cas activation plasmids or control plasmids (50 ng) or for 48 hours. TNF-α, IL-1β, and IL-6 were detected by qRT-PCR. ( C and D ) MEG3–4 and miR-138 in transfected AMs were measured by qRT-PCR. ( E ) Mice were intravenously injected with vehicle containing either NS-m or 138-m (50 μg per mouse) 24 and 48 hours (two time points in different animals) before PAO1 challenge. Kaplan-Meier survival curves of PAO1-infected NS-m– or 138-m–injected mice ( n = 6, two independent experiments). Survival was determined up to 96 hours ( P = 0.0177, log-rank test). ( F ) 138-m– and NS-m–injected mice ( n = 3) were infected with PAO1 at 5 × 10 6 CFU per mouse for 24 hours. Expression of cytokines in mouse lungs was detected by immunoblotting. ( G ) qRT-PCR analysis of MEG3–4 expression in the lung from PAO1-infected NS-m– and 138-m–injected mice. ( H ) Proposed model for the role of lncRNA MEG3–4 in regulating IL-1β expression by competitively binding miR-138. Data in (A) to (D) are means ± SD for three independent mice or cell samples (Kruskal-Wallis test; * P ≤ 0.05 and ** P ≤ 0.01). Error bars represent SD. Data in (F) and (G) are representative of three independent mice or cell samples.

    Techniques Used: Expressing, Infection, Quantitative RT-PCR, Affinity Magnetic Separation, Transfection, CRISPR, Activation Assay, Mouse Assay, Injection, Binding Assay

    MEG3–4 binds miR-138 to compete the binding to IL-1β. ( A ). ( B ) Mice ( n = 3) were intranasally infected with 5 × 10 6 CFU PAO1 for 24 hours, and the lungs were lysed to assess miR-129–5p, miR-138, and miR-136. ( C ) In situ analysis with a digoxigenin (DIG)–labeled miR-138 probe (brown) in PAO1-infected and control lungs. Nuclei were stained by hematoxylin (blue). Scale bar, 100 μm. ( D ) Northern blots of miR-138 in lungs after PAO1, PAK, and KP infection. ( E ) Duplex formations between MEG3–4 (bottom) and miR-138 (middle). Target mutagenesis sites (top) are indicated. ( F ) MEG3–4 WT and mutant cloned to downstream of the luciferase coding region in pGL3 and cotransfected in MH-S with 138-m. Luciferase activities were determined using Luciferase Reporter Assay. ( G ) IL-1β 3′UTRs contain miR-138 binding sequence. Predicted duplex formations between IL-1β 3′UTR (bottom) and miR-138 (middle). ( H ) IL-1β 3′UTR and its mutant cloned to pGL3 and cotransfected into MH-S cells with 138-m. Luciferase activities were determined by Luciferase Reporter Assay. ( I ) IL-1β 3′UTR and its mutant cloned to pGL3 and cotransfected into MH-S cells with 138-m and pWT-MEG3 or with 138-m and pMU-MEG3 [mutant (mu)]. Luciferase activities were determined by Luciferase Reporter Assay. Empty pcDNA3-EGFP vector was used as a control. ( J ) Binding of Ago2 with MEG3–4, miR-138, and IL-1β mRNA was detected by individual cross-linking immunoprecipitation (iCLIP) using anti-Ago2 antibody and qRT-PCR. ( K ) Plasmids pWT-MEG3 and empty pcDNA3-EGFP transfected into MH-S. Binding of miR-138 to MEG3–4 or IL-1β mRNA in MEG3–4–overexpressing and EV cells was detected by LAMP assay and endpoint gel PCR. miRNA alone without DIG labeling was used as a negative control, whereas these transcripts in total MH-S cell extracts (input) were used as a positive control. In (J) and (K), binding of miR-320b and IL-1 receptor–associated kinase 4 (IRAK4) was used as a positive control. In (K), glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as a negative control, and 18 S and 28 S rRNAs were used as loading controls. Data in (C), (D), (J), and (K) show one representative of three independent mice or cell samples. Data in (B), (F), and (H) are means ± SD for three independent mice or cell samples (Kruskal-Wallis test; * P ≤ 0.05 and ** P ≤ 0.01). IP, immunoprecipitation.
    Figure Legend Snippet: MEG3–4 binds miR-138 to compete the binding to IL-1β. ( A ). ( B ) Mice ( n = 3) were intranasally infected with 5 × 10 6 CFU PAO1 for 24 hours, and the lungs were lysed to assess miR-129–5p, miR-138, and miR-136. ( C ) In situ analysis with a digoxigenin (DIG)–labeled miR-138 probe (brown) in PAO1-infected and control lungs. Nuclei were stained by hematoxylin (blue). Scale bar, 100 μm. ( D ) Northern blots of miR-138 in lungs after PAO1, PAK, and KP infection. ( E ) Duplex formations between MEG3–4 (bottom) and miR-138 (middle). Target mutagenesis sites (top) are indicated. ( F ) MEG3–4 WT and mutant cloned to downstream of the luciferase coding region in pGL3 and cotransfected in MH-S with 138-m. Luciferase activities were determined using Luciferase Reporter Assay. ( G ) IL-1β 3′UTRs contain miR-138 binding sequence. Predicted duplex formations between IL-1β 3′UTR (bottom) and miR-138 (middle). ( H ) IL-1β 3′UTR and its mutant cloned to pGL3 and cotransfected into MH-S cells with 138-m. Luciferase activities were determined by Luciferase Reporter Assay. ( I ) IL-1β 3′UTR and its mutant cloned to pGL3 and cotransfected into MH-S cells with 138-m and pWT-MEG3 or with 138-m and pMU-MEG3 [mutant (mu)]. Luciferase activities were determined by Luciferase Reporter Assay. Empty pcDNA3-EGFP vector was used as a control. ( J ) Binding of Ago2 with MEG3–4, miR-138, and IL-1β mRNA was detected by individual cross-linking immunoprecipitation (iCLIP) using anti-Ago2 antibody and qRT-PCR. ( K ) Plasmids pWT-MEG3 and empty pcDNA3-EGFP transfected into MH-S. Binding of miR-138 to MEG3–4 or IL-1β mRNA in MEG3–4–overexpressing and EV cells was detected by LAMP assay and endpoint gel PCR. miRNA alone without DIG labeling was used as a negative control, whereas these transcripts in total MH-S cell extracts (input) were used as a positive control. In (J) and (K), binding of miR-320b and IL-1 receptor–associated kinase 4 (IRAK4) was used as a positive control. In (K), glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as a negative control, and 18 S and 28 S rRNAs were used as loading controls. Data in (C), (D), (J), and (K) show one representative of three independent mice or cell samples. Data in (B), (F), and (H) are means ± SD for three independent mice or cell samples (Kruskal-Wallis test; * P ≤ 0.05 and ** P ≤ 0.01). IP, immunoprecipitation.

    Techniques Used: Binding Assay, Mouse Assay, Infection, In Situ, Labeling, Staining, Northern Blot, Mutagenesis, Clone Assay, Luciferase, Reporter Assay, Sequencing, Plasmid Preparation, Cross-linking Immunoprecipitation, Quantitative RT-PCR, Transfection, Lamp Assay, Polymerase Chain Reaction, Negative Control, Positive Control, Immunoprecipitation

    12) Product Images from "Functional characterization of an allatotropin receptor expressed in the corpora allata of mosquitoes"

    Article Title: Functional characterization of an allatotropin receptor expressed in the corpora allata of mosquitoes

    Journal: Peptides

    doi: 10.1016/j.peptides.2011.07.025

    Tissue specific expression of AT receptor mRNA All tissues were dissected from three-day old sugar-fed females, except for testis (TE) and accessory glands (AGL) dissected from three-day old sugar-fed males. CA: corpora allata-corpora cardiaca; BR: brain; AG: abdominal ganglia; VG: ventral ganglia; TG: thoracic ganglia; OV: ovaries; HT: heart; HG: hindgut; FB: fat body; MG: midgut and MT: Malpighian tubules. The insert shows the males tissues analyzed. Receptor mRNA is expressed as copy number of receptor mRNA/10,000 copies of rpL32 mRNA. Each RT-PCR data point is mean ± SD of two independent biological replicates of 10–20 tissue samples.
    Figure Legend Snippet: Tissue specific expression of AT receptor mRNA All tissues were dissected from three-day old sugar-fed females, except for testis (TE) and accessory glands (AGL) dissected from three-day old sugar-fed males. CA: corpora allata-corpora cardiaca; BR: brain; AG: abdominal ganglia; VG: ventral ganglia; TG: thoracic ganglia; OV: ovaries; HT: heart; HG: hindgut; FB: fat body; MG: midgut and MT: Malpighian tubules. The insert shows the males tissues analyzed. Receptor mRNA is expressed as copy number of receptor mRNA/10,000 copies of rpL32 mRNA. Each RT-PCR data point is mean ± SD of two independent biological replicates of 10–20 tissue samples.

    Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction

    13) Product Images from "Expansion and Divergence of Argonaute Genes in the Oomycete Genus Phytophthora"

    Article Title: Expansion and Divergence of Argonaute Genes in the Oomycete Genus Phytophthora

    Journal: Frontiers in Microbiology

    doi: 10.3389/fmicb.2018.02841

    Transcript levels of AGO and other small RNA biogenesis genes. Three different life stages (myc, mycelium; zoo, zoospores; gc, germinated cysts) and an infection time series (3, 6, 12, 24, and 48 h post infection) were assayed in replicate by qRT-PCR to determine transcript levels of (A) DCL 1, DCL 2, RDR , and (B,C) the AGO homologs in P. sojae as compared to housekeeping genes b-tubulin and WS41 . Each life stage or time series point is normalized to the housekeeping gene(s). Standard error bars are included, but in most cases the standard error bars are blocked by the symbol due to low value.
    Figure Legend Snippet: Transcript levels of AGO and other small RNA biogenesis genes. Three different life stages (myc, mycelium; zoo, zoospores; gc, germinated cysts) and an infection time series (3, 6, 12, 24, and 48 h post infection) were assayed in replicate by qRT-PCR to determine transcript levels of (A) DCL 1, DCL 2, RDR , and (B,C) the AGO homologs in P. sojae as compared to housekeeping genes b-tubulin and WS41 . Each life stage or time series point is normalized to the housekeeping gene(s). Standard error bars are included, but in most cases the standard error bars are blocked by the symbol due to low value.

    Techniques Used: Infection, Quantitative RT-PCR

    14) Product Images from "RNA sequencing reveals a diverse and dynamic repertoire of the Xenopus tropicalis transcriptome over development"

    Article Title: RNA sequencing reveals a diverse and dynamic repertoire of the Xenopus tropicalis transcriptome over development

    Journal: Genome Research

    doi: 10.1101/gr.141424.112

    Many genes are transcribed before the midblastula transition despite a general state of transcriptional repression. ( A ) Heatmap showing distinct expression profiles of all RefSeq genes that were detected before the midblastula transition in our RNA-seq experiments. To focus on the stages before embryonic genome activation, only the RPKM values from the two-cell stage to Stage 8 were used for mean-centering, normalization, and clustering. Each row in the heatmap represents a different gene. ( B ) GO analysis of the 150 early transcribed genes that passed the following three criteria: (1) the transcript level at Stage 6 is at least twofold higher than that at the two-cell stage; (2) the average RPKM at each developmental stage is at least 1; and (3) the expression profile is monotonically increasing. ( C ) Validations of the RNA-seq results. The RT-qPCR expression profiles (blue bars) match the RNA-seq data (red lines) closely for 13 out of the 20 genes we tested. The nodal-related gene, xnr5 , serves as a positive control (its expression is activated before EGA), while xbra serves as a negative control (its expression is activated after EGA). There is no RNA-seq data for xnr5 because it is duplicated in the Xenopus genome, and the corresponding reads cannot be uniquely mapped. We also note that for the majority of the validated genes, the fold changes obtained from our RT-qPCR experiments are relatively small (two- to threefold) compared to the fold changes observed for xnr5 and xbra (greater than 100-fold).
    Figure Legend Snippet: Many genes are transcribed before the midblastula transition despite a general state of transcriptional repression. ( A ) Heatmap showing distinct expression profiles of all RefSeq genes that were detected before the midblastula transition in our RNA-seq experiments. To focus on the stages before embryonic genome activation, only the RPKM values from the two-cell stage to Stage 8 were used for mean-centering, normalization, and clustering. Each row in the heatmap represents a different gene. ( B ) GO analysis of the 150 early transcribed genes that passed the following three criteria: (1) the transcript level at Stage 6 is at least twofold higher than that at the two-cell stage; (2) the average RPKM at each developmental stage is at least 1; and (3) the expression profile is monotonically increasing. ( C ) Validations of the RNA-seq results. The RT-qPCR expression profiles (blue bars) match the RNA-seq data (red lines) closely for 13 out of the 20 genes we tested. The nodal-related gene, xnr5 , serves as a positive control (its expression is activated before EGA), while xbra serves as a negative control (its expression is activated after EGA). There is no RNA-seq data for xnr5 because it is duplicated in the Xenopus genome, and the corresponding reads cannot be uniquely mapped. We also note that for the majority of the validated genes, the fold changes obtained from our RT-qPCR experiments are relatively small (two- to threefold) compared to the fold changes observed for xnr5 and xbra (greater than 100-fold).

    Techniques Used: Expressing, RNA Sequencing Assay, Activation Assay, Quantitative RT-PCR, Positive Control, Negative Control

    15) Product Images from "Transcriptional Organization and Regulation of Magnetosome Operons in Magnetospirillum gryphiswaldense †"

    Article Title: Transcriptional Organization and Regulation of Magnetosome Operons in Magnetospirillum gryphiswaldense †

    Journal:

    doi: 10.1128/AEM.00201-06

    Expression levels of selected genes under standard, iron-limited, and aerobic conditions, as determined with qPCR. Error bars represent data from three independent qRT-PCR experiments. The data given in the table are mean values.
    Figure Legend Snippet: Expression levels of selected genes under standard, iron-limited, and aerobic conditions, as determined with qPCR. Error bars represent data from three independent qRT-PCR experiments. The data given in the table are mean values.

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction, Quantitative RT-PCR

    16) Product Images from "A seven-helix protein constitutes stress granules crucial for regulating translation during human-to-mosquito transmission of Plasmodium falciparum"

    Article Title: A seven-helix protein constitutes stress granules crucial for regulating translation during human-to-mosquito transmission of Plasmodium falciparum

    Journal: PLoS Pathogens

    doi: 10.1371/journal.ppat.1007249

    Complex formation of 7-Helix-1 with Puf2 and repressed pfs25 mRNA and Pfs25 synthesis. (A) Co-immunoprecipitation of 7-Helix-1 with Puf2. Co-immunoprecipitation assays on lysates of 7-Helix-1-HA or WT NF54 gametocytes were employed using either polyclonal mouse anti-Puf2 or anti-Pf39 antisera, followed by WB using rabbit anti-HA antibodies or mouse anti-Pf39 antibody to detect precipitated proteins. Black arrows indicate precipitated proteins, grey arrows indicate expected running lines in the negative controls. Asterisks indicate bands corresponding to the precipitation antibodies. Results are representative of three independent experiments. (B) Association of repressed transcript with 7-Helix-1. RIP assays on lysates of 7-Helix-1-HA gametocytes were employed using either rabbit anti-CITH or rabbit anti-HA antibodies, followed by RNA isolation. RT-PCR was performed amplifying co-eluted transcripts of ccp2 (198 bp), pfs25 (459 bp) and pfs28 (494 bp). cDNA preparation lacking the reverse transcriptase (-RT) was used to prove absence of gDNA contamination. (C, D) Quantitative expression analysis of gametocyte-specific adhesion proteins. (C) Expression of Pfs25 and Pfs230 in activated gametocytes. WT NF54 and 7-Helix-1-KO 2E6 gametocytes at 30 min p.a. were immunolabeled with rabbit anti-Pfs25 (green) and mouse anti-Pfs230 antibodies (red). Nuclei were highlighted by Hoechst33342 nuclear stain (blue). Bar, 5 μm. (D) Quantitative IFA analysis of Pfs25 and Pfs230. IFAs were employed as described above and the fluorescence intensities for Pfs25 and Pfs230 of 20 immunolabeled activated gametocytes were measured in triplicate using ImageJ (mean ± SD). The respective signal in WT lysates was set to 1. *** p ≤ 0.001 (Student‘s t-test). Results (in A-C) are representative of two to three independent experiments.
    Figure Legend Snippet: Complex formation of 7-Helix-1 with Puf2 and repressed pfs25 mRNA and Pfs25 synthesis. (A) Co-immunoprecipitation of 7-Helix-1 with Puf2. Co-immunoprecipitation assays on lysates of 7-Helix-1-HA or WT NF54 gametocytes were employed using either polyclonal mouse anti-Puf2 or anti-Pf39 antisera, followed by WB using rabbit anti-HA antibodies or mouse anti-Pf39 antibody to detect precipitated proteins. Black arrows indicate precipitated proteins, grey arrows indicate expected running lines in the negative controls. Asterisks indicate bands corresponding to the precipitation antibodies. Results are representative of three independent experiments. (B) Association of repressed transcript with 7-Helix-1. RIP assays on lysates of 7-Helix-1-HA gametocytes were employed using either rabbit anti-CITH or rabbit anti-HA antibodies, followed by RNA isolation. RT-PCR was performed amplifying co-eluted transcripts of ccp2 (198 bp), pfs25 (459 bp) and pfs28 (494 bp). cDNA preparation lacking the reverse transcriptase (-RT) was used to prove absence of gDNA contamination. (C, D) Quantitative expression analysis of gametocyte-specific adhesion proteins. (C) Expression of Pfs25 and Pfs230 in activated gametocytes. WT NF54 and 7-Helix-1-KO 2E6 gametocytes at 30 min p.a. were immunolabeled with rabbit anti-Pfs25 (green) and mouse anti-Pfs230 antibodies (red). Nuclei were highlighted by Hoechst33342 nuclear stain (blue). Bar, 5 μm. (D) Quantitative IFA analysis of Pfs25 and Pfs230. IFAs were employed as described above and the fluorescence intensities for Pfs25 and Pfs230 of 20 immunolabeled activated gametocytes were measured in triplicate using ImageJ (mean ± SD). The respective signal in WT lysates was set to 1. *** p ≤ 0.001 (Student‘s t-test). Results (in A-C) are representative of two to three independent experiments.

    Techniques Used: Immunoprecipitation, Western Blot, Isolation, Reverse Transcription Polymerase Chain Reaction, Expressing, Immunolabeling, Staining, Immunofluorescence, Fluorescence

    17) Product Images from "Identification of cancer cytotoxic modulators of PDE3A by predictive chemogenomics"

    Article Title: Identification of cancer cytotoxic modulators of PDE3A by predictive chemogenomics

    Journal: Nature chemical biology

    doi: 10.1038/nchembio.1984

    Cell lines with dual expression of SLFN12 and PDE3A are significantly enriched for DNMDP-sensitive cell lines ( a ) mRNA RMA expression values for PDE3A and SLFN12 from the CCLE database with sensitive cell lines indicated 8 . 21 sensitive cell lines were binned in three groups of 7 based on AUC rank. ( b ) Fisher’s exact test on DNMDP sensitivity of cell lines with high expression of both SLFN12 and PDE3A (RMA Log2 > 5) compared to other cell lines. Light blue indicates melanoma cell lines. ( c ) qPCR expression changes of SLFN12 in HeLa cells transduced with shSLFN12 normalized to GAPDH. ( d ) HeLa cells were transduced with indicated shRNA reagents and treated with indicated concentrations of DNMDP for 72 hours. Data represent values of single data points.
    Figure Legend Snippet: Cell lines with dual expression of SLFN12 and PDE3A are significantly enriched for DNMDP-sensitive cell lines ( a ) mRNA RMA expression values for PDE3A and SLFN12 from the CCLE database with sensitive cell lines indicated 8 . 21 sensitive cell lines were binned in three groups of 7 based on AUC rank. ( b ) Fisher’s exact test on DNMDP sensitivity of cell lines with high expression of both SLFN12 and PDE3A (RMA Log2 > 5) compared to other cell lines. Light blue indicates melanoma cell lines. ( c ) qPCR expression changes of SLFN12 in HeLa cells transduced with shSLFN12 normalized to GAPDH. ( d ) HeLa cells were transduced with indicated shRNA reagents and treated with indicated concentrations of DNMDP for 72 hours. Data represent values of single data points.

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction, Transduction, shRNA

    18) Product Images from "Tetherin Inhibits Nipah Virus but Not Ebola Virus Replication in Fruit Bat Cells"

    Article Title: Tetherin Inhibits Nipah Virus but Not Ebola Virus Replication in Fruit Bat Cells

    Journal: Journal of Virology

    doi: 10.1128/JVI.01821-18

    Expression of fruit bat tetherin is IFN-inducible and required for robust IFN-mediated inhibition of VSV infection. (A) A549 cells and the indicated fruit bat cell lines were incubated with increasing amounts of pan-IFN-α, inoculated with a single-cycle VSV vector bearing VSV-G and encoding luciferase (VSV*ΔG-FLuc), and the luciferase activity in cell lysates was quantified. The luciferase activity measured for cells treated with medium without pan-IFN-α was set as 100%. The results of a representative experiment performed with triplicate samples are shown and were confirmed in a separate experiment. Error bars indicate the SEM. The 50% inhibitory concentration (IC 50 ) was calculated for each cell line and is indicated. (B) Human (A549) and fruit bat (EpoNi/22.1) cells were pan-IFN-α or mock treated, and cellular RNA was extracted, reverse transcribed into cDNA, and analyzed for transcript levels of β-actin, Mx1 (myxovirus resistance protein), and tetherin by qRT-PCR. Shown are combined data (given as the fold change in expression upon IFN treatment, normalized to β-actin) of three independent experiments. Error bars indicate the SEM. (C) Human (A549) and fruit bat (EpoNi/22.1) cells were transfected with the indicated siRNAs (ns, nonsense = control) or left untransfected and then either treated with pan-IFN-α or mock treated, followed by inoculation with replication-competent VSV encoding eGFP. Finally, infected cells (as determined by the expression of eGFP) were detected via fluorescence microscopy. Similar results were obtained in five separate experiments. (D) Viral titers in the cellular supernatants of the untransfected, IFN-α- or mock-treated cells described in panel C were quantified. The relative (x-fold) differences between viral titers in the supernatants of pan-IFN-α- and mock-treated cells were calculated. The average of six independent experiments performed with triplicate samples is shown. Error bars indicate the SEM. (E) Viral titers in the cellular supernatants of the siRNA-transfected and IFN-treated cells described in panel C were quantified. The relative (x-fold) differences between viral titers of pan-IFN-α-treated cells transfected with control or tetherin-specific siRNA were calculated. The average of six independent experiments performed with triplicate samples is shown. Error bars indicate the SEM. (F) Relative tetherin transcript levels in IFN-treated fruit bat cells (EpoNi/22.1), which were previously transfected with either control (ns) or fruit bat tetherin-specific (batTetherin) siRNA, were compared by qRT-PCR (normalized against β-actin transcript levels). Shown are the combined results of three independent experiments performed with triplicate samples, in which tetherin transcript levels of IFN-treated cells that received control siRNA were set as 100%. Error bars indicate the SEM. (G) Human (A549) and fruit bat (EpoNi/22.1) cells were transfected with control or tetherin-specific siRNA prior to treatment with pan-IFN-α. At 48 h posttransfection, the cells were inoculated with single-cycle VSV vector pseudotyped with VSV-G (VSV*ΔG-FLuc). After incubation for 1 h, the cells were washed and further incubated for 8 h before virus-encoded luciferase activity was quantified in the cell lysates. Shown are normalized data from three independent experiments performed with quadruplicate samples in which transduction of cells without prior IFN treatment was set as 100%. Error bars indicate the SEM. The statistical significance of the data presented in panels D and E was analyzed by using a Mann-Whitney U test, while the data presented in panels F and G were analyzed by using a paired, two-tailed Student t test (ns, P > 0.05; **, P ≤ 0.01).
    Figure Legend Snippet: Expression of fruit bat tetherin is IFN-inducible and required for robust IFN-mediated inhibition of VSV infection. (A) A549 cells and the indicated fruit bat cell lines were incubated with increasing amounts of pan-IFN-α, inoculated with a single-cycle VSV vector bearing VSV-G and encoding luciferase (VSV*ΔG-FLuc), and the luciferase activity in cell lysates was quantified. The luciferase activity measured for cells treated with medium without pan-IFN-α was set as 100%. The results of a representative experiment performed with triplicate samples are shown and were confirmed in a separate experiment. Error bars indicate the SEM. The 50% inhibitory concentration (IC 50 ) was calculated for each cell line and is indicated. (B) Human (A549) and fruit bat (EpoNi/22.1) cells were pan-IFN-α or mock treated, and cellular RNA was extracted, reverse transcribed into cDNA, and analyzed for transcript levels of β-actin, Mx1 (myxovirus resistance protein), and tetherin by qRT-PCR. Shown are combined data (given as the fold change in expression upon IFN treatment, normalized to β-actin) of three independent experiments. Error bars indicate the SEM. (C) Human (A549) and fruit bat (EpoNi/22.1) cells were transfected with the indicated siRNAs (ns, nonsense = control) or left untransfected and then either treated with pan-IFN-α or mock treated, followed by inoculation with replication-competent VSV encoding eGFP. Finally, infected cells (as determined by the expression of eGFP) were detected via fluorescence microscopy. Similar results were obtained in five separate experiments. (D) Viral titers in the cellular supernatants of the untransfected, IFN-α- or mock-treated cells described in panel C were quantified. The relative (x-fold) differences between viral titers in the supernatants of pan-IFN-α- and mock-treated cells were calculated. The average of six independent experiments performed with triplicate samples is shown. Error bars indicate the SEM. (E) Viral titers in the cellular supernatants of the siRNA-transfected and IFN-treated cells described in panel C were quantified. The relative (x-fold) differences between viral titers of pan-IFN-α-treated cells transfected with control or tetherin-specific siRNA were calculated. The average of six independent experiments performed with triplicate samples is shown. Error bars indicate the SEM. (F) Relative tetherin transcript levels in IFN-treated fruit bat cells (EpoNi/22.1), which were previously transfected with either control (ns) or fruit bat tetherin-specific (batTetherin) siRNA, were compared by qRT-PCR (normalized against β-actin transcript levels). Shown are the combined results of three independent experiments performed with triplicate samples, in which tetherin transcript levels of IFN-treated cells that received control siRNA were set as 100%. Error bars indicate the SEM. (G) Human (A549) and fruit bat (EpoNi/22.1) cells were transfected with control or tetherin-specific siRNA prior to treatment with pan-IFN-α. At 48 h posttransfection, the cells were inoculated with single-cycle VSV vector pseudotyped with VSV-G (VSV*ΔG-FLuc). After incubation for 1 h, the cells were washed and further incubated for 8 h before virus-encoded luciferase activity was quantified in the cell lysates. Shown are normalized data from three independent experiments performed with quadruplicate samples in which transduction of cells without prior IFN treatment was set as 100%. Error bars indicate the SEM. The statistical significance of the data presented in panels D and E was analyzed by using a Mann-Whitney U test, while the data presented in panels F and G were analyzed by using a paired, two-tailed Student t test (ns, P > 0.05; **, P ≤ 0.01).

    Techniques Used: Expressing, Inhibition, Infection, Incubation, Plasmid Preparation, Luciferase, Activity Assay, Concentration Assay, Quantitative RT-PCR, Transfection, Fluorescence, Microscopy, Transduction, MANN-WHITNEY, Two Tailed Test

    19) Product Images from "Formin-mediated actin polymerization at cell–cell junctions stabilizes E-cadherin and maintains monolayer integrity during wound repair"

    Article Title: Formin-mediated actin polymerization at cell–cell junctions stabilizes E-cadherin and maintains monolayer integrity during wound repair

    Journal: Molecular Biology of the Cell

    doi: 10.1091/mbc.E16-06-0429

    Fmnl3 expression is elevated in response to epithelial wounding and is lost in cells that underwent EMT. (A) Time series after wound closure over 14 h (10× magnification). Arrowheads indicate regions where cell fronts establish contact(s) and form de novo AJs. (B) PCR analysis for detection of Fmnl3 expression levels corresponding to time points illustrated in A. GAPDH was used as a control. Note the increase in intensity of bands, particularly between the 6- and 10-h time points. C, control, unwounded monolayer. (C) Quantification of Fmnl3 expression level in B, compared with percentage wound sealed at the corresponding time point. Note the increase in Fmnl3 expression coincident with the phase of active migration. Two independent experiments, with mean ± SEM. (D) Representative images of Eph4 monolayers labeled to visualize α-catenin α18, Fmnl3, and F-actin after treatment with nocodazole or blebbistatin. Note the increased junctional localization of Fmnl3 upon nocodazole treatment (middle) and loss of junctional Fmnl3 after blebbistatin treatment (bottom). (E) Quantification of α18 and Fmnl3 fluorescence intensities at cell–cell junctions for control and nocodazole-treated monolayers in D; > 50 junctions from three independent experiments, with mean ± SD. (F) PCR analysis for detection of FMNL3 expression in human ovarian cancer cell lines. GAPDH was used as a control. NT, nontransformed; Epi., epithelial; Mes., mesenchymal. (G) Quantification of FMNL3 expression level from F. Two independent experiments, with mean ± SEM. Statistical significance assessed using Student’s t test in E. Scale bar, 20 μm (D).
    Figure Legend Snippet: Fmnl3 expression is elevated in response to epithelial wounding and is lost in cells that underwent EMT. (A) Time series after wound closure over 14 h (10× magnification). Arrowheads indicate regions where cell fronts establish contact(s) and form de novo AJs. (B) PCR analysis for detection of Fmnl3 expression levels corresponding to time points illustrated in A. GAPDH was used as a control. Note the increase in intensity of bands, particularly between the 6- and 10-h time points. C, control, unwounded monolayer. (C) Quantification of Fmnl3 expression level in B, compared with percentage wound sealed at the corresponding time point. Note the increase in Fmnl3 expression coincident with the phase of active migration. Two independent experiments, with mean ± SEM. (D) Representative images of Eph4 monolayers labeled to visualize α-catenin α18, Fmnl3, and F-actin after treatment with nocodazole or blebbistatin. Note the increased junctional localization of Fmnl3 upon nocodazole treatment (middle) and loss of junctional Fmnl3 after blebbistatin treatment (bottom). (E) Quantification of α18 and Fmnl3 fluorescence intensities at cell–cell junctions for control and nocodazole-treated monolayers in D; > 50 junctions from three independent experiments, with mean ± SD. (F) PCR analysis for detection of FMNL3 expression in human ovarian cancer cell lines. GAPDH was used as a control. NT, nontransformed; Epi., epithelial; Mes., mesenchymal. (G) Quantification of FMNL3 expression level from F. Two independent experiments, with mean ± SEM. Statistical significance assessed using Student’s t test in E. Scale bar, 20 μm (D).

    Techniques Used: Expressing, Polymerase Chain Reaction, Migration, Labeling, Fluorescence

    Src kinase and Cdc42 are upstream activators of formin activity at the AJ. (A) Src kinase inhibition via PP2 treatment or siRNA-mediated KD phenocopies mDia1 or Fmnl3 KD. (B) PCR analysis for efficiency of Src KD. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as control. (C) Dispase assay for PP2-treated monolayers. Three independent experiments, with mean ± SD. (D) Activation of endogenous mDia1 via DAD expression (mVenus fluorescence in inset) rescues the Src-inhibition phenotype. Note the dramatic augmentation of the AJ in transfected cells in comparison to nontransfected neighbors. (E) Quantification of E-cadherin fluorescence intensity at the junction for D. Control monolayers were transfected with a GFP vector; ≥30 junctions from transfected cells for each condition from three experiments, with mean ± SEM. (F) Full-length Src-GFP localizes to the AJ, resulting in elevated levels of F-actin and E-cadherin (arrowheads, top). Src-GFP expression combined with Fmnl3 KD abrogates junctional F-actin and E-cadherin augmentation (bottom). (G, H) Quantification of F-actin and E-cadherin fluorescence intensities for F; ≥35 junctions from transfected cells for each condition from three experiments, with mean ± SEM. (I) Expression of constitutively active Cdc42 (GFP shown in inset) rescues the Src-inhibition phenotype. Note the restoration of lateral junctions (white arrowheads) in transfected cells vs. nontransfected neighbors. (J) Quantification of E-cadherin fluorescence intensity for I. Control monolayers were transfected with a GFP vector; ≥ 28 junctions from transfected cells for each condition from three experiments, with mean ± SEM. (K) Fmnl3-GFP (I111D) does not localize to AJ, with no effect on F-actin or E-cadherin. (L, M) Quantification of F-actin and E-cadherin fluorescence intensities for K; ≥26 junctions from transfected cells per condition from three experiments, with mean ± SEM. Statistical significance assessed using one-way ANOVA in C, E, G, H, and J; Student’s t test in L and M. Scale bars, 20 μm (A, D, F, and K), 10 μm (I).
    Figure Legend Snippet: Src kinase and Cdc42 are upstream activators of formin activity at the AJ. (A) Src kinase inhibition via PP2 treatment or siRNA-mediated KD phenocopies mDia1 or Fmnl3 KD. (B) PCR analysis for efficiency of Src KD. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as control. (C) Dispase assay for PP2-treated monolayers. Three independent experiments, with mean ± SD. (D) Activation of endogenous mDia1 via DAD expression (mVenus fluorescence in inset) rescues the Src-inhibition phenotype. Note the dramatic augmentation of the AJ in transfected cells in comparison to nontransfected neighbors. (E) Quantification of E-cadherin fluorescence intensity at the junction for D. Control monolayers were transfected with a GFP vector; ≥30 junctions from transfected cells for each condition from three experiments, with mean ± SEM. (F) Full-length Src-GFP localizes to the AJ, resulting in elevated levels of F-actin and E-cadherin (arrowheads, top). Src-GFP expression combined with Fmnl3 KD abrogates junctional F-actin and E-cadherin augmentation (bottom). (G, H) Quantification of F-actin and E-cadherin fluorescence intensities for F; ≥35 junctions from transfected cells for each condition from three experiments, with mean ± SEM. (I) Expression of constitutively active Cdc42 (GFP shown in inset) rescues the Src-inhibition phenotype. Note the restoration of lateral junctions (white arrowheads) in transfected cells vs. nontransfected neighbors. (J) Quantification of E-cadherin fluorescence intensity for I. Control monolayers were transfected with a GFP vector; ≥ 28 junctions from transfected cells for each condition from three experiments, with mean ± SEM. (K) Fmnl3-GFP (I111D) does not localize to AJ, with no effect on F-actin or E-cadherin. (L, M) Quantification of F-actin and E-cadherin fluorescence intensities for K; ≥26 junctions from transfected cells per condition from three experiments, with mean ± SEM. Statistical significance assessed using one-way ANOVA in C, E, G, H, and J; Student’s t test in L and M. Scale bars, 20 μm (A, D, F, and K), 10 μm (I).

    Techniques Used: Activity Assay, Inhibition, Polymerase Chain Reaction, Activation Assay, Expressing, Fluorescence, Transfection, Plasmid Preparation

    20) Product Images from "Correlation of Circulating CD64+/CD163+ Monocyte Ratio and stroma/peri-tumoral CD163+ Monocyte Density with Human Papillomavirus Infected Cervical Lesion Severity"

    Article Title: Correlation of Circulating CD64+/CD163+ Monocyte Ratio and stroma/peri-tumoral CD163+ Monocyte Density with Human Papillomavirus Infected Cervical Lesion Severity

    Journal: Cancer Microenvironment

    doi: 10.1007/s12307-017-0200-2

    Expression of CD163 and Arg1 in fresh-frozen cervical biopsy samples and CD163 + macrophages in cervical FFPE tissues. Quantification of ( a ) Arg1 and ( b ) CD163 mRNA expression was done using real time RT-PCR analysis and expression standardized relative to that of the internal control, GAPDH. ( c–h ) IHC using mouse anti-human CD163 antibody in cervical FFPE tissues. CD163 + macrophages are indicated with black arrows. Cell density was scored into three levels; ( c–d ) score I shows no CD163 + macrophage infiltration, ( e–f ) score II shows rare or slight infiltration and ( g–h ) score III show moderate or high infiltration
    Figure Legend Snippet: Expression of CD163 and Arg1 in fresh-frozen cervical biopsy samples and CD163 + macrophages in cervical FFPE tissues. Quantification of ( a ) Arg1 and ( b ) CD163 mRNA expression was done using real time RT-PCR analysis and expression standardized relative to that of the internal control, GAPDH. ( c–h ) IHC using mouse anti-human CD163 antibody in cervical FFPE tissues. CD163 + macrophages are indicated with black arrows. Cell density was scored into three levels; ( c–d ) score I shows no CD163 + macrophage infiltration, ( e–f ) score II shows rare or slight infiltration and ( g–h ) score III show moderate or high infiltration

    Techniques Used: Expressing, Formalin-fixed Paraffin-Embedded, Quantitative RT-PCR, Immunohistochemistry

    21) Product Images from "Angiotensin II type 1 receptor-associated protein deficiency attenuates sirtuin1 expression in an immortalised human renal proximal tubule cell line"

    Article Title: Angiotensin II type 1 receptor-associated protein deficiency attenuates sirtuin1 expression in an immortalised human renal proximal tubule cell line

    Journal: Scientific Reports

    doi: 10.1038/s41598-019-52566-y

    mRNA expression levels of ATRAP and SIRT1 in ciRPTEC in response to angiotensin II (Ang II) treatment or serum withdrawal. The ciRPTEC were treated with 10 −6 M of Ang II (+) for 24 hours ( a,b ) or serum withdrawal (−) for 24 hours ( c,d ). The relative mRNA levels of ATRAP and SIRT1 in the ciRPTEC were determined by RT-qPCR, normalized to 18 S ribosomal RNA. mRNA levels in the absence of Ang II treatment (−; for a,b ) or presence of serum (+; for c,d ) were set to 1. All data were obtained with three biologically independent experiments. Values represent the means ± standard error. ( a ) **p
    Figure Legend Snippet: mRNA expression levels of ATRAP and SIRT1 in ciRPTEC in response to angiotensin II (Ang II) treatment or serum withdrawal. The ciRPTEC were treated with 10 −6 M of Ang II (+) for 24 hours ( a,b ) or serum withdrawal (−) for 24 hours ( c,d ). The relative mRNA levels of ATRAP and SIRT1 in the ciRPTEC were determined by RT-qPCR, normalized to 18 S ribosomal RNA. mRNA levels in the absence of Ang II treatment (−; for a,b ) or presence of serum (+; for c,d ) were set to 1. All data were obtained with three biologically independent experiments. Values represent the means ± standard error. ( a ) **p

    Techniques Used: Expressing, Quantitative RT-PCR

    Effect of ATRAP knockdown on SIRT1 mRNA and protein expression with or without serum-withdrawal. The ciRPTEC were treated with negative control siRNA (ATRAP-control, a–f ), ATRAP siRNA #1 (ATRAP-KD1, a–f ) for 48 hours, followed by serum withdrawal for 24 hours ( a–e ). ( a,c ) The relative mRNA levels of ATRAP ( a ) or SIRT1 ( c ) on ciRPTEC were determined by RT-qPCR, normalized to 18 S ribosomal RNA. mRNA levels in the presence of serum (+) and the control siRNA were set to 1. ( b,d ) The relative protein expression of ATRAP and SIRT1 in the ciRPTEC was determined by western blot analysis, normalized to β-actin expression. Protein levels in the presence of serum (+) and control siRNA were set to 100. SIRT1 proteins were detected with an antibody towards the N-terminal 1–131 amino acids (SIRT1_N lot 2465249). ( e ) SIRT1 protein detected with an antibody recognising the C-terminal region (SIRT1_C). ( f ) Half-life analysis of the SIRT1 protein was performed 48 hours after siRNA transfection of ciRPTEC cells and treatment with emetine to repress de-novo protein synthesis. Cell lysates were collected at 0, 2, 4 and 8 hours after emetine treatment. SIRT1 proteins were detected with the SIRT1_C antibody. Since the SIRT1 expression level at time 0 was decreased in ATRAP-KD1, the signal intensities of the SIRT1 proteins at 0 hours were set to similar levels visually between the ATRAP-control and ATRAP-KD1 by showing the short exposure (ATRAP-control) and the long exposure (ATRAP-KD1) images. Original gel images are presented in Supplementary Fig. S12 . All data were obtained with three biologically independent experiments (except for ( h ) where two replicates were used) and were analysed by two-way ANOVA. Values represent the means ± standard error. ( a,c ) **p
    Figure Legend Snippet: Effect of ATRAP knockdown on SIRT1 mRNA and protein expression with or without serum-withdrawal. The ciRPTEC were treated with negative control siRNA (ATRAP-control, a–f ), ATRAP siRNA #1 (ATRAP-KD1, a–f ) for 48 hours, followed by serum withdrawal for 24 hours ( a–e ). ( a,c ) The relative mRNA levels of ATRAP ( a ) or SIRT1 ( c ) on ciRPTEC were determined by RT-qPCR, normalized to 18 S ribosomal RNA. mRNA levels in the presence of serum (+) and the control siRNA were set to 1. ( b,d ) The relative protein expression of ATRAP and SIRT1 in the ciRPTEC was determined by western blot analysis, normalized to β-actin expression. Protein levels in the presence of serum (+) and control siRNA were set to 100. SIRT1 proteins were detected with an antibody towards the N-terminal 1–131 amino acids (SIRT1_N lot 2465249). ( e ) SIRT1 protein detected with an antibody recognising the C-terminal region (SIRT1_C). ( f ) Half-life analysis of the SIRT1 protein was performed 48 hours after siRNA transfection of ciRPTEC cells and treatment with emetine to repress de-novo protein synthesis. Cell lysates were collected at 0, 2, 4 and 8 hours after emetine treatment. SIRT1 proteins were detected with the SIRT1_C antibody. Since the SIRT1 expression level at time 0 was decreased in ATRAP-KD1, the signal intensities of the SIRT1 proteins at 0 hours were set to similar levels visually between the ATRAP-control and ATRAP-KD1 by showing the short exposure (ATRAP-control) and the long exposure (ATRAP-KD1) images. Original gel images are presented in Supplementary Fig. S12 . All data were obtained with three biologically independent experiments (except for ( h ) where two replicates were used) and were analysed by two-way ANOVA. Values represent the means ± standard error. ( a,c ) **p

    Techniques Used: Expressing, Negative Control, Quantitative RT-PCR, Western Blot, Transfection

    mRNA expression of the proximal tubule markers, AT1R and ATRAP , in clonal immortalised cells. ( a–d ) The relative mRNA levels of SGLT2 , DPP4 , ATRAP and AT1R in 12 clonal immortalized cell (ciRPTEC) clones were determined by RT-qPCR, normalized to 18S ribosomal RNA. The mRNA levels of the original RPTEC (RPTEC-Ori) were set to 1. Data were obtained with three biologically independent experiments. Values represent the means ± standard error.
    Figure Legend Snippet: mRNA expression of the proximal tubule markers, AT1R and ATRAP , in clonal immortalised cells. ( a–d ) The relative mRNA levels of SGLT2 , DPP4 , ATRAP and AT1R in 12 clonal immortalized cell (ciRPTEC) clones were determined by RT-qPCR, normalized to 18S ribosomal RNA. The mRNA levels of the original RPTEC (RPTEC-Ori) were set to 1. Data were obtained with three biologically independent experiments. Values represent the means ± standard error.

    Techniques Used: Expressing, Quantitative RT-PCR

    Effect of ATRAP knockout generated using CRISPR-CAS9 on SIRT1 mRNA and protein expression levels under serum-starvation. ATRAP-KO (ciRPTEC expressing CAS9 and gRNA targeted towards ATRAP) or ATRAP-control (ciRPTEC expressing only CAS9) cells were cultured with or without serum for 24 hours. ( a,c ) The relative protein expression of ATRAP and SIRT1 in the ciRPTEC was determined by western blot analysis, normalized to β-actin expression. Protein levels of ATRAP-control with serum (+) were set to 100. ( b ) The relative mRNA levels of SIRT1 in the ciRPTEC was determined by RT-qPCR, normalized to 18 S ribosomal RNA. The mRNA level of ATRAP-control with serum (+) was set to 1. All data were obtained with three biologically independent experiments. Values represent the means ± standard error. All data were analysed by two-way ANOVA. ( a ) # p
    Figure Legend Snippet: Effect of ATRAP knockout generated using CRISPR-CAS9 on SIRT1 mRNA and protein expression levels under serum-starvation. ATRAP-KO (ciRPTEC expressing CAS9 and gRNA targeted towards ATRAP) or ATRAP-control (ciRPTEC expressing only CAS9) cells were cultured with or without serum for 24 hours. ( a,c ) The relative protein expression of ATRAP and SIRT1 in the ciRPTEC was determined by western blot analysis, normalized to β-actin expression. Protein levels of ATRAP-control with serum (+) were set to 100. ( b ) The relative mRNA levels of SIRT1 in the ciRPTEC was determined by RT-qPCR, normalized to 18 S ribosomal RNA. The mRNA level of ATRAP-control with serum (+) was set to 1. All data were obtained with three biologically independent experiments. Values represent the means ± standard error. All data were analysed by two-way ANOVA. ( a ) # p

    Techniques Used: Knock-Out, Generated, CRISPR, Expressing, Cell Culture, Western Blot, Quantitative RT-PCR

    Comparison of mRNA expression levels of distal and proximal tubule markers in the ciRPTEC 2B-1 cell line, and reactivity of NHE3 in this cell line to angiotensin II (Ang II) treatment. ( a,b ) The relative mRNA levels of CALB1 and AQP2 in the original RPTEC (RPTEC-Ori) cell line and the clonal immortalized cell line 2B1 (ciRPTEC 2B1) were determined by RT-qPCR, normalized to 18S ribosomal RNA. mRNA levels of SGLT2 were set to 1. ( c ) The relative mRNA levels of NHE3 in ciRPTEC 2B1 after 24 hours of treatment with a range of Ang II concentrations were determined by RT-qPCR, normalized to 18S ribosomal RNA. mRNA levels obtained without Ang II (concentration 0 M) were set to 1. Data were obtained with three biologically independent experiments. Values represent the means ± standard error. *p
    Figure Legend Snippet: Comparison of mRNA expression levels of distal and proximal tubule markers in the ciRPTEC 2B-1 cell line, and reactivity of NHE3 in this cell line to angiotensin II (Ang II) treatment. ( a,b ) The relative mRNA levels of CALB1 and AQP2 in the original RPTEC (RPTEC-Ori) cell line and the clonal immortalized cell line 2B1 (ciRPTEC 2B1) were determined by RT-qPCR, normalized to 18S ribosomal RNA. mRNA levels of SGLT2 were set to 1. ( c ) The relative mRNA levels of NHE3 in ciRPTEC 2B1 after 24 hours of treatment with a range of Ang II concentrations were determined by RT-qPCR, normalized to 18S ribosomal RNA. mRNA levels obtained without Ang II (concentration 0 M) were set to 1. Data were obtained with three biologically independent experiments. Values represent the means ± standard error. *p

    Techniques Used: Expressing, Quantitative RT-PCR, Concentration Assay

    22) Product Images from "Abnormally high digestive enzyme activity and gene expression explain the contemporary evolution of a Diabrotica biotype able to feed on soybeans"

    Article Title: Abnormally high digestive enzyme activity and gene expression explain the contemporary evolution of a Diabrotica biotype able to feed on soybeans

    Journal: Ecology and Evolution

    doi: 10.1002/ece3.331

    Quantitative RT-PCR expression analysis for cathepsin B-like (DvRS40) gene in guts of WCR adults. WCR adults fed for 0, 8, and 24 h on soybean foliage. Time points for each population represent three replicates each derived from five beetles. Values represent the band intensity generated by image analysis software for the results of quantitative RT-PCR relative to EF-1a (mean ± SE). Cathepsin B-like (DvRS40) gene accession number AJ583513. Bars bearing the same letter within each time point are not significantly different between populations at P
    Figure Legend Snippet: Quantitative RT-PCR expression analysis for cathepsin B-like (DvRS40) gene in guts of WCR adults. WCR adults fed for 0, 8, and 24 h on soybean foliage. Time points for each population represent three replicates each derived from five beetles. Values represent the band intensity generated by image analysis software for the results of quantitative RT-PCR relative to EF-1a (mean ± SE). Cathepsin B-like (DvRS40) gene accession number AJ583513. Bars bearing the same letter within each time point are not significantly different between populations at P

    Techniques Used: Quantitative RT-PCR, Expressing, Derivative Assay, Generated, Software

    23) Product Images from "Amphiregulin activates regulatory T lymphocytes and suppresses CD8+ T cell-mediated anti-tumor response in hepatocellular carcinoma cells"

    Article Title: Amphiregulin activates regulatory T lymphocytes and suppresses CD8+ T cell-mediated anti-tumor response in hepatocellular carcinoma cells

    Journal: Oncotarget

    doi:

    AR suppresses anti-tumor activity of CD8 + T cells in vivo A. Proportion of each T subset in the Hepa1–6 xenografts was determined by flow cytometry. B. Histograms of the expression of CTLA-4 and ICOS on intratumoral Tregs determined by flow cytometry. This is a representative of three independent experiments. C. AR expression in the xenografts was determined by Western blotting. This is a representative of two independent experiments. D. Intratumoral Tregs proliferation was determined by ki67 staining. Numbers in the plots were the percentages of ki67 + cells presented as mean ± SD. E. Expression of IFN-γ, TNF-α, perforin and granzyme B in intratumoral CD8 + T cells were analyzed using qRT-PCR. Ctrl, xenografts of non-transfected Hepa1–6 cells; shRNA, xenografts of LV-shRNA-transfected Hepa1–6 cells; Scramble, xenografts of LV-scramble-transfected Hepa1–6 cells. N = 7 per group. * p
    Figure Legend Snippet: AR suppresses anti-tumor activity of CD8 + T cells in vivo A. Proportion of each T subset in the Hepa1–6 xenografts was determined by flow cytometry. B. Histograms of the expression of CTLA-4 and ICOS on intratumoral Tregs determined by flow cytometry. This is a representative of three independent experiments. C. AR expression in the xenografts was determined by Western blotting. This is a representative of two independent experiments. D. Intratumoral Tregs proliferation was determined by ki67 staining. Numbers in the plots were the percentages of ki67 + cells presented as mean ± SD. E. Expression of IFN-γ, TNF-α, perforin and granzyme B in intratumoral CD8 + T cells were analyzed using qRT-PCR. Ctrl, xenografts of non-transfected Hepa1–6 cells; shRNA, xenografts of LV-shRNA-transfected Hepa1–6 cells; Scramble, xenografts of LV-scramble-transfected Hepa1–6 cells. N = 7 per group. * p

    Techniques Used: Activity Assay, In Vivo, Flow Cytometry, Cytometry, Expressing, Western Blot, Staining, Quantitative RT-PCR, Transfection, shRNA

    24) Product Images from "Analytical subcloning of a clonal cell line demonstrates cellular heterogeneity that does not impact process consistency or robustness"

    Article Title: Analytical subcloning of a clonal cell line demonstrates cellular heterogeneity that does not impact process consistency or robustness

    Journal: Biotechnology Progress

    doi: 10.1002/btpr.2646

    Heavy chain gene copy analysis . HC gene copy per cell results for the subclones are grouped by presence/absence of the T253I genetic variant, and HC integrant Southern blot result. HC gene copy number for the mAb 1 MCB is ∼3.4 copies per cell; dashed lines represent a three standard deviation range.
    Figure Legend Snippet: Heavy chain gene copy analysis . HC gene copy per cell results for the subclones are grouped by presence/absence of the T253I genetic variant, and HC integrant Southern blot result. HC gene copy number for the mAb 1 MCB is ∼3.4 copies per cell; dashed lines represent a three standard deviation range.

    Techniques Used: Variant Assay, Southern Blot, Standard Deviation

    25) Product Images from "Autophagy inhibition enhances RAD001-induced cytotoxicity in human bladder cancer cells"

    Article Title: Autophagy inhibition enhances RAD001-induced cytotoxicity in human bladder cancer cells

    Journal: Drug Design, Development and Therapy

    doi: 10.2147/DDDT.S95900

    Inhibition of mTOR-related genes and mTORC1 downstream effectors by RAD001. Notes: qPCR detection of mTOR-related genes, including ( A ) mTOR complexes, ( B ) mTORC1-positive regulation, and ( C ) mTORC2-positive regulation in T24 cells treated with 1 or 5 µM RAD001. Cells were seeded 24 hours before RAD001 treatment. Total RNA samples were extracted at 24 hours posttreatment, reverse transcribed, and subjected to the detection of genes involved in mTOR signaling. The values are shown as the mean ± SD of three independent experiments; * P
    Figure Legend Snippet: Inhibition of mTOR-related genes and mTORC1 downstream effectors by RAD001. Notes: qPCR detection of mTOR-related genes, including ( A ) mTOR complexes, ( B ) mTORC1-positive regulation, and ( C ) mTORC2-positive regulation in T24 cells treated with 1 or 5 µM RAD001. Cells were seeded 24 hours before RAD001 treatment. Total RNA samples were extracted at 24 hours posttreatment, reverse transcribed, and subjected to the detection of genes involved in mTOR signaling. The values are shown as the mean ± SD of three independent experiments; * P

    Techniques Used: Inhibition, Real-time Polymerase Chain Reaction

    26) Product Images from "The RNA Complement of Outer Membrane Vesicles From Salmonella enterica Serovar Typhimurium Under Distinct Culture Conditions"

    Article Title: The RNA Complement of Outer Membrane Vesicles From Salmonella enterica Serovar Typhimurium Under Distinct Culture Conditions

    Journal: Frontiers in Microbiology

    doi: 10.3389/fmicb.2018.02015

    Visualization of intracellular and OMV-related read coverage plots of distinct sRNAs in distinct culture conditions. RNA coverage from sequencing data was visualized with the Integrative Genomics Viewer software (v2.4.8) using default parameters ( Robinson et al., 2011 ). Each plot represents the raw number of reads mapped along the observed sequence, automatically scaled relatively to the highest number of read existing in this portion of the genome. The three plots in dark colors at the top of each window represents the sequencing coverage of OMV-associated fracti ons, in biological triplicate for each condition. On the contrary, the three plots in lighter colors at the bottom of each window show the coverage for the same RNA but from the corresponding intracellular fractions. The arrows under each window precise the genes positions and orientations, according to the data extracted from the Salmonella LT2 genome annotation (NCBI accession number AE006468.2 ) or pSLT plasmid annotation (NCBI accession number AE006471.2 ). The identical coverage patterns observed in both fractions for the displayed genes stand for a native export through OMVs without specific processing or degradation.
    Figure Legend Snippet: Visualization of intracellular and OMV-related read coverage plots of distinct sRNAs in distinct culture conditions. RNA coverage from sequencing data was visualized with the Integrative Genomics Viewer software (v2.4.8) using default parameters ( Robinson et al., 2011 ). Each plot represents the raw number of reads mapped along the observed sequence, automatically scaled relatively to the highest number of read existing in this portion of the genome. The three plots in dark colors at the top of each window represents the sequencing coverage of OMV-associated fracti ons, in biological triplicate for each condition. On the contrary, the three plots in lighter colors at the bottom of each window show the coverage for the same RNA but from the corresponding intracellular fractions. The arrows under each window precise the genes positions and orientations, according to the data extracted from the Salmonella LT2 genome annotation (NCBI accession number AE006468.2 ) or pSLT plasmid annotation (NCBI accession number AE006471.2 ). The identical coverage patterns observed in both fractions for the displayed genes stand for a native export through OMVs without specific processing or degradation.

    Techniques Used: Sequencing, Software, Plasmid Preparation

    27) Product Images from "Lysophosphatidic Acid Promotes Cell Migration through STIM1- and Orai1-Mediated Ca2+i Mobilization and NFAT2 Activation"

    Article Title: Lysophosphatidic Acid Promotes Cell Migration through STIM1- and Orai1-Mediated Ca2+i Mobilization and NFAT2 Activation

    Journal: The Journal of Investigative Dermatology

    doi: 10.1038/jid.2012.370

    Lysophosphatidic acid (LPA)-induced keratinocyte migration requires STIM1, calcineurin activity, and sufficient levels of nuclear factor of activated T cell 2 (NFAT2). ( a – d , h , i ) Keratinocyte cultures were subjected to three-dimensional (3D) chemotactic migration assays, which were performed in medium containing 60 μℳ or 1.2 mℳ Ca 2+ . The average numbers of migrated cells are represented as bar graphs±SEM. Keratinocytes were treated with scrambled (scr) or STIM1-targeted small interfering RNA (siRNA) ( a , b ) or NFAT2-targeted siRNA ( h , i ) for 24 hours prior to 3D chemotactic migration assays. In both Ca 2+ conditions, 10 μℳ LPA significantly increased migration rates. RNA interference (RNAi)-mediated knockdown of STIM1 and NFAT2 resulted in a significant impairment of LPA-induced keratinocyte motility ( a , b , h , i , *** P
    Figure Legend Snippet: Lysophosphatidic acid (LPA)-induced keratinocyte migration requires STIM1, calcineurin activity, and sufficient levels of nuclear factor of activated T cell 2 (NFAT2). ( a – d , h , i ) Keratinocyte cultures were subjected to three-dimensional (3D) chemotactic migration assays, which were performed in medium containing 60 μℳ or 1.2 mℳ Ca 2+ . The average numbers of migrated cells are represented as bar graphs±SEM. Keratinocytes were treated with scrambled (scr) or STIM1-targeted small interfering RNA (siRNA) ( a , b ) or NFAT2-targeted siRNA ( h , i ) for 24 hours prior to 3D chemotactic migration assays. In both Ca 2+ conditions, 10 μℳ LPA significantly increased migration rates. RNA interference (RNAi)-mediated knockdown of STIM1 and NFAT2 resulted in a significant impairment of LPA-induced keratinocyte motility ( a , b , h , i , *** P

    Techniques Used: Migration, Activity Assay, Small Interfering RNA

    28) Product Images from "SB203580 Modulates p38 MAPK Signaling and Dengue Virus-Induced Liver Injury by Reducing MAPKAPK2, HSP27, and ATF2 Phosphorylation"

    Article Title: SB203580 Modulates p38 MAPK Signaling and Dengue Virus-Induced Liver Injury by Reducing MAPKAPK2, HSP27, and ATF2 Phosphorylation

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0149486

    SB203580 modulates the cytokine and chemokine gene expressions in DENV infection Mice were infected with 4 × 10 5 FFU/ml of DENV and treated with 2%DMSO (v/v) or SB203580 dissolved in 2%DMSO. The control (uninfected) group was treated with 2%DMSO (v/v) alone. Treatments were given 1 h before and after DENV infection and again at 24 h after infection. On day 7 after infection, the liver tissues were collected, and RNA was extracted, cDNA were prepared and which undergone Real-time RT PCR analysis with individual primer set. GAPDH is used as the house keeping gene. The mRNA expression of (A) TNF-α (B) IL-6 (C) IL-10 (D) CCL-5 (E) CXCL-10 are shown. Results were represented in the graph by three independent experiments for at least 3 independent mice from each group. Statistical analysis is conducted by One Way ANOVA using GraphPad Prism Software Version 5. The asterisks indicate statistically significant differences between groups ( p
    Figure Legend Snippet: SB203580 modulates the cytokine and chemokine gene expressions in DENV infection Mice were infected with 4 × 10 5 FFU/ml of DENV and treated with 2%DMSO (v/v) or SB203580 dissolved in 2%DMSO. The control (uninfected) group was treated with 2%DMSO (v/v) alone. Treatments were given 1 h before and after DENV infection and again at 24 h after infection. On day 7 after infection, the liver tissues were collected, and RNA was extracted, cDNA were prepared and which undergone Real-time RT PCR analysis with individual primer set. GAPDH is used as the house keeping gene. The mRNA expression of (A) TNF-α (B) IL-6 (C) IL-10 (D) CCL-5 (E) CXCL-10 are shown. Results were represented in the graph by three independent experiments for at least 3 independent mice from each group. Statistical analysis is conducted by One Way ANOVA using GraphPad Prism Software Version 5. The asterisks indicate statistically significant differences between groups ( p

    Techniques Used: Infection, Mouse Assay, Quantitative RT-PCR, Expressing, Software

    29) Product Images from "Genome-scale analysis of syngas fermenting acetogenic bacteria reveals the translational regulation for its autotrophic growth"

    Article Title: Genome-scale analysis of syngas fermenting acetogenic bacteria reveals the translational regulation for its autotrophic growth

    Journal: BMC Genomics

    doi: 10.1186/s12864-018-5238-0

    Different gene expression profiles in metabolic pathways of E. limosum ATCC 8486. ( a ) Embden-Meyerhof-Parnas glycolytic pathway (blue circle), incomplete tricarboxylic acid cycle (brown circle), Wood-Ljungdahl pathway (green circle), and pentose phosphate pathway (purple circle) are shown. ( b ) Ethanol producing pathway (red circle), hydrogenase complex (grey circle), Rnf complex (dark circle), ETF complex (blue circle), and ATP synthase complex (orange circle) are shown. Metabolites are shown as circles and reactions are shown as arrows. All gene numbers and enzyme reactions are provided next to the arrows. Transcriptional dynamics of E. limosum ATCC 8486 are described in the heatmap with three columns; the left and middle boxes indicate normalized RNA reads from heterotrophic and autotrophic conditions, respectively. The right box indicates RNA fold change, as autotrophic expression over heterotrophic expression. In addition, gene numbers responsible for the expression are located under the bottom box of the heatmap. A full list and expression data can be found in Additional file 1 : Table S1
    Figure Legend Snippet: Different gene expression profiles in metabolic pathways of E. limosum ATCC 8486. ( a ) Embden-Meyerhof-Parnas glycolytic pathway (blue circle), incomplete tricarboxylic acid cycle (brown circle), Wood-Ljungdahl pathway (green circle), and pentose phosphate pathway (purple circle) are shown. ( b ) Ethanol producing pathway (red circle), hydrogenase complex (grey circle), Rnf complex (dark circle), ETF complex (blue circle), and ATP synthase complex (orange circle) are shown. Metabolites are shown as circles and reactions are shown as arrows. All gene numbers and enzyme reactions are provided next to the arrows. Transcriptional dynamics of E. limosum ATCC 8486 are described in the heatmap with three columns; the left and middle boxes indicate normalized RNA reads from heterotrophic and autotrophic conditions, respectively. The right box indicates RNA fold change, as autotrophic expression over heterotrophic expression. In addition, gene numbers responsible for the expression are located under the bottom box of the heatmap. A full list and expression data can be found in Additional file 1 : Table S1

    Techniques Used: Expressing

    30) Product Images from "Systemic Delivery of Anti-miRNA for Suppression of Triple Negative Breast Cancer Utilizing RNA Nanotechnology"

    Article Title: Systemic Delivery of Anti-miRNA for Suppression of Triple Negative Breast Cancer Utilizing RNA Nanotechnology

    Journal: ACS Nano

    doi: 10.1021/acsnano.5b02471

    Design and physicochemical characterization of 3WJ-EGFRapt/anti-miR-21 nanoparticles. (A) 2D sequence of the nanoparticle harboring three functional modules: EGFR RNA aptamer for targeted delivery, anti-miR-21 LNA for therapy, and Alexa-647 dye for imaging. (B) Native PAGE showing stepwise highly efficient assembly of the RNA nanoparticle. (C) DLS measurements showing the hydrodynamic size. (D) Zeta potential. (E) Serum stability assay. (F) Apparent T m extracted from temperature gradient gel electrophoresis (TGGE, insert).
    Figure Legend Snippet: Design and physicochemical characterization of 3WJ-EGFRapt/anti-miR-21 nanoparticles. (A) 2D sequence of the nanoparticle harboring three functional modules: EGFR RNA aptamer for targeted delivery, anti-miR-21 LNA for therapy, and Alexa-647 dye for imaging. (B) Native PAGE showing stepwise highly efficient assembly of the RNA nanoparticle. (C) DLS measurements showing the hydrodynamic size. (D) Zeta potential. (E) Serum stability assay. (F) Apparent T m extracted from temperature gradient gel electrophoresis (TGGE, insert).

    Techniques Used: Sequencing, Functional Assay, Imaging, Clear Native PAGE, Stability Assay, Temperature Gradient Gel Electrophoresis

    31) Product Images from "Pseudomonas aeruginosa toxin ExoU induces a PAF-dependent impairment of alveolar fibrin turnover secondary to enhanced activation of coagulation and increased expression of plasminogen activator inhibitor-1 in the course of mice pneumosepsis"

    Article Title: Pseudomonas aeruginosa toxin ExoU induces a PAF-dependent impairment of alveolar fibrin turnover secondary to enhanced activation of coagulation and increased expression of plasminogen activator inhibitor-1 in the course of mice pneumosepsis

    Journal: Respiratory Research

    doi: 10.1186/1465-9921-12-104

    Effects of anti-PAFR antibody on PAI-1 expression by PA103-infected cells . In (A), a representative agarose gel shows the expression of PAI-1 and β-actin mRNA transcripts in control and infected A549 cells pretreated or not with the anti-PAFR antibody, assessed by semiquantitative RT-PCR. In (B), mean ± SD values of the ratio of PAI-1 to β-actin transcript densities obtained in 2 RT-PCR assays carried out in duplicate. In (C), mean values ± SE of PAI-1 concentration in cell supernatants from control and infected cultures, pretreated (anti-PAFR +) or not (anti-PAFR -) with the anti-PAFR antibody, obtained in three different assays carried out in quintuplicate. *** p
    Figure Legend Snippet: Effects of anti-PAFR antibody on PAI-1 expression by PA103-infected cells . In (A), a representative agarose gel shows the expression of PAI-1 and β-actin mRNA transcripts in control and infected A549 cells pretreated or not with the anti-PAFR antibody, assessed by semiquantitative RT-PCR. In (B), mean ± SD values of the ratio of PAI-1 to β-actin transcript densities obtained in 2 RT-PCR assays carried out in duplicate. In (C), mean values ± SE of PAI-1 concentration in cell supernatants from control and infected cultures, pretreated (anti-PAFR +) or not (anti-PAFR -) with the anti-PAFR antibody, obtained in three different assays carried out in quintuplicate. *** p

    Techniques Used: Expressing, Infection, Agarose Gel Electrophoresis, Reverse Transcription Polymerase Chain Reaction, Concentration Assay

    32) Product Images from "The maize fused leaves1 (fdl1) gene controls organ separation in the embryo and seedling shoot and promotes coleoptile opening"

    Article Title: The maize fused leaves1 (fdl1) gene controls organ separation in the embryo and seedling shoot and promotes coleoptile opening

    Journal: Journal of Experimental Botany

    doi: 10.1093/jxb/erv278

    ZmMYB94 gene structure and expression analysis. Southern analysis of fdl1-1 and wild-type alleles (A, B). DNAs from homozygous wild-type (+/+), heterozygous (+/-) and homozygous mutant (-/-) seedlings were cleaved with BamH1. Filters were hybridized with the En/Spm -specific probe (A) or the 78bp fragment flanking the En/Spm insertion (B). (C) Schematic representation of the ZmMYB94 gene showing the position of the three exons, indicated as grey rectangles, and the two introns, indicated as black lines. The En/Spm element inserted in the mutant allele is designated as a triangle, the 78bp genomic DNA flanking the insertion site, which was cloned after co-segregation analysis, is designed as a black rectangle and the region containing the MYB domain is highlighted in grey. The putative translational start (ATG) and stop (TAG) codons and polyA signal are reported. Exact positions are indicated with respect to the putative transcription initiation site. Names and positions of primers used for gene sequence analysis and qRT-PCR are also reported. The En/Spm element is not drawn to scale. (D) Relative expression level in different wild-type tissue samples from plants of the B73 inbred line. Expression level was established by qRT-PCR and the 18S gene was used as internal control. Bars represent means ±SD. DAP, days after pollination; cc, inside the closed coleoptile; co, emerging from the open coleoptile; i, immature. Tissue samples are listed in Supplementary Table S2 .
    Figure Legend Snippet: ZmMYB94 gene structure and expression analysis. Southern analysis of fdl1-1 and wild-type alleles (A, B). DNAs from homozygous wild-type (+/+), heterozygous (+/-) and homozygous mutant (-/-) seedlings were cleaved with BamH1. Filters were hybridized with the En/Spm -specific probe (A) or the 78bp fragment flanking the En/Spm insertion (B). (C) Schematic representation of the ZmMYB94 gene showing the position of the three exons, indicated as grey rectangles, and the two introns, indicated as black lines. The En/Spm element inserted in the mutant allele is designated as a triangle, the 78bp genomic DNA flanking the insertion site, which was cloned after co-segregation analysis, is designed as a black rectangle and the region containing the MYB domain is highlighted in grey. The putative translational start (ATG) and stop (TAG) codons and polyA signal are reported. Exact positions are indicated with respect to the putative transcription initiation site. Names and positions of primers used for gene sequence analysis and qRT-PCR are also reported. The En/Spm element is not drawn to scale. (D) Relative expression level in different wild-type tissue samples from plants of the B73 inbred line. Expression level was established by qRT-PCR and the 18S gene was used as internal control. Bars represent means ±SD. DAP, days after pollination; cc, inside the closed coleoptile; co, emerging from the open coleoptile; i, immature. Tissue samples are listed in Supplementary Table S2 .

    Techniques Used: Expressing, Mutagenesis, Clone Assay, Sequencing, Quantitative RT-PCR

    33) Product Images from "LIM domains-containing protein 1 (LIMD1), a tumor suppressor encoded at chromosome 3p21.3, binds pRB and represses E2F-driven transcription"

    Article Title: LIM domains-containing protein 1 (LIMD1), a tumor suppressor encoded at chromosome 3p21.3, binds pRB and represses E2F-driven transcription

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    doi: 10.1073/pnas.0407123101

    pRB binds to LIMD1, a member of the zyxin LIM domain family of proteins. ( A ) A yeast two-hybrid screen of a HeLa cDNA library with GAL4 DNA-binding domain pRB obtained a cDNA encoding amino acids 326–608 of LIMD1. The predicted protein structure of the human LIMD1 gene reveals three LIM domains located at the C terminus and a unique N-terminal region (amino acids 1–68) that encodes a LEM domain (amino acids 18–68) as previously reported (bioinformatics analyses of both the LIMD1 ). ( B ). Numbers indicate relative distances of branches. ( C ). The specificity of the pRB–LIMD1 interaction in the yeast two-hybrid assay was confirmed by combining these two proteins with positive and negative controls and then assayed by prototrophy for histidine (His) and adenine (Ade). The indicated GAL4 binding domain (BD) and GAL4 activation domain (AD) fusion or VO plasmids were cotransformed into yeast strain PJ69-4a. Growth on medium lacking histidine and adenine (–His–Ade) is indicative of specific interactions. LAMINC, lamin C. ( D ) Amino acids 326–608 of LIMD1 interact directly with the C terminus of pRB (amino acids 763–928). [ 35 S]Methionine-labeled LIMD1 (amino acids 326–608) was produced by using the Promega in vitro ). ( E ) Endogenous pRB and transfected Xpress-tagged LIMD1 interact in vivo . IP, immunoprecipitation. ( F ) pRB binds to amino acids 404–442 of LIMD1 in vivo . U2OS cells were transfected with VO, full-length LIMD1 (WT), or the indicated deletion mutant (Δ). Immunoprecipitations were performed as above. Anti-human pRB mAb, clone G99-549, was from BD Biosciences Pharmingen, and anti-Xpress mAb was from Invitrogen. ( G ) Graphical summary of the pRB-binding domain as determined by in vivo coimmunoprecipitations.
    Figure Legend Snippet: pRB binds to LIMD1, a member of the zyxin LIM domain family of proteins. ( A ) A yeast two-hybrid screen of a HeLa cDNA library with GAL4 DNA-binding domain pRB obtained a cDNA encoding amino acids 326–608 of LIMD1. The predicted protein structure of the human LIMD1 gene reveals three LIM domains located at the C terminus and a unique N-terminal region (amino acids 1–68) that encodes a LEM domain (amino acids 18–68) as previously reported (bioinformatics analyses of both the LIMD1 ). ( B ). Numbers indicate relative distances of branches. ( C ). The specificity of the pRB–LIMD1 interaction in the yeast two-hybrid assay was confirmed by combining these two proteins with positive and negative controls and then assayed by prototrophy for histidine (His) and adenine (Ade). The indicated GAL4 binding domain (BD) and GAL4 activation domain (AD) fusion or VO plasmids were cotransformed into yeast strain PJ69-4a. Growth on medium lacking histidine and adenine (–His–Ade) is indicative of specific interactions. LAMINC, lamin C. ( D ) Amino acids 326–608 of LIMD1 interact directly with the C terminus of pRB (amino acids 763–928). [ 35 S]Methionine-labeled LIMD1 (amino acids 326–608) was produced by using the Promega in vitro ). ( E ) Endogenous pRB and transfected Xpress-tagged LIMD1 interact in vivo . IP, immunoprecipitation. ( F ) pRB binds to amino acids 404–442 of LIMD1 in vivo . U2OS cells were transfected with VO, full-length LIMD1 (WT), or the indicated deletion mutant (Δ). Immunoprecipitations were performed as above. Anti-human pRB mAb, clone G99-549, was from BD Biosciences Pharmingen, and anti-Xpress mAb was from Invitrogen. ( G ) Graphical summary of the pRB-binding domain as determined by in vivo coimmunoprecipitations.

    Techniques Used: Two Hybrid Screening, cDNA Library Assay, Binding Assay, Y2H Assay, Activation Assay, Labeling, Produced, In Vitro, Transfection, In Vivo, Immunoprecipitation, Mutagenesis

    34) Product Images from "siRNA Screen for Phosphatases Involved in IgE-mediated Mast Cell Degranulation"

    Article Title: siRNA Screen for Phosphatases Involved in IgE-mediated Mast Cell Degranulation

    Journal: Journal of immunology (Baltimore, Md. : 1950)

    doi: 10.4049/jimmunol.0904169

    The validation of positive pools with BMMC (A) Comparison of FcεRI-induced degranulation between MMC-1 and BMMC transfected by different positive siRNA pools. Cells transfected with scrambled or the indicated siRNA were stimulated with IgE plus antigen, and their degranulation were detected by β-hexosaminidase assay. The changes of antigen-induced release in the different siRNA transfected cells are expressed as the % of inhibition or enhancement of the release in controls. Values are mean of at least 3 separate experiments. (B) Lysates were prepared from the cells transfected by scramble and Ppp3r1 siRNA, and immunoblotted with anti-calcinurin B and anti-Syk antibodies respectively. Data are representative of at least three different experiments.
    Figure Legend Snippet: The validation of positive pools with BMMC (A) Comparison of FcεRI-induced degranulation between MMC-1 and BMMC transfected by different positive siRNA pools. Cells transfected with scrambled or the indicated siRNA were stimulated with IgE plus antigen, and their degranulation were detected by β-hexosaminidase assay. The changes of antigen-induced release in the different siRNA transfected cells are expressed as the % of inhibition or enhancement of the release in controls. Values are mean of at least 3 separate experiments. (B) Lysates were prepared from the cells transfected by scramble and Ppp3r1 siRNA, and immunoblotted with anti-calcinurin B and anti-Syk antibodies respectively. Data are representative of at least three different experiments.

    Techniques Used: Transfection, Beta Hexosaminidase Assay, Inhibition

    Confirmation of “on target” effect of positive hits by testing of the four individual siRNAs from each pool ( A ) FcεRI-induced degranulation in the cells transfected by individual siRNA. Four individual siRNAs included in the original siRNA pools for Inpp5b , Pppp3r1 , Pten , Mtmr4 , Ptpn4 , Ptpn9 and Ptpn14 was separately tested for their effects on IgE-antigen-induced degranulation at 24, 48 and 72 h (individual siRNA indicated by 1,2,3,4 while pool of the four by “P”). The results are the average of at least 3 different experiments. The antigen-induced release for control scrambled siRNA transfected cells was 29.2% ± 1.9% (SD) at 24 hr, 27% ± 2.9% (SD) at 48 hr, and 25.5% ± 3.2% (SD) at 72 hr. ( B ) Cell lysates were prepared from the same cells used in ( A ) and blotted with the corresponding antibodies to show the targeted protein knockdown. Anti-Syk or anti-FcεRIβ was used as loading controls. Data are representative of at least three separate experiments.
    Figure Legend Snippet: Confirmation of “on target” effect of positive hits by testing of the four individual siRNAs from each pool ( A ) FcεRI-induced degranulation in the cells transfected by individual siRNA. Four individual siRNAs included in the original siRNA pools for Inpp5b , Pppp3r1 , Pten , Mtmr4 , Ptpn4 , Ptpn9 and Ptpn14 was separately tested for their effects on IgE-antigen-induced degranulation at 24, 48 and 72 h (individual siRNA indicated by 1,2,3,4 while pool of the four by “P”). The results are the average of at least 3 different experiments. The antigen-induced release for control scrambled siRNA transfected cells was 29.2% ± 1.9% (SD) at 24 hr, 27% ± 2.9% (SD) at 48 hr, and 25.5% ± 3.2% (SD) at 72 hr. ( B ) Cell lysates were prepared from the same cells used in ( A ) and blotted with the corresponding antibodies to show the targeted protein knockdown. Anti-Syk or anti-FcεRIβ was used as loading controls. Data are representative of at least three separate experiments.

    Techniques Used: Transfection

    The calcineurin-B (Ppp3r1) deficiency reduced FcεRI-initiated phosphorylation of MAP kinases and PKC Cells transfected with the specified siRNA were stimulated by IgE plus antigen for the indicated times. The cell lysates were blotted with anti-phosphotyrosine antibody, anti-phospho-p44/42 MAP kinase and anti-p44/42 MAP kinase antibodies, anti-phospho-p38 and anti-p38 antibodies, anti-phospho-JNK and anti-JNK antibodies, anti-phospho-PKCδ (Thr505), anti-phospho-PKCδ (Ser643) and anti-PKCδantibodies, and anti-phospho-PKD/PKCμ (Ser916) and anti-PKD/PKCμ antibodies. Data are representative of at least three separate experiments.
    Figure Legend Snippet: The calcineurin-B (Ppp3r1) deficiency reduced FcεRI-initiated phosphorylation of MAP kinases and PKC Cells transfected with the specified siRNA were stimulated by IgE plus antigen for the indicated times. The cell lysates were blotted with anti-phosphotyrosine antibody, anti-phospho-p44/42 MAP kinase and anti-p44/42 MAP kinase antibodies, anti-phospho-p38 and anti-p38 antibodies, anti-phospho-JNK and anti-JNK antibodies, anti-phospho-PKCδ (Thr505), anti-phospho-PKCδ (Ser643) and anti-PKCδantibodies, and anti-phospho-PKD/PKCμ (Ser916) and anti-PKD/PKCμ antibodies. Data are representative of at least three separate experiments.

    Techniques Used: Transfection

    siRNA screening of FcεRI-stimulated degranulation in mast cells ( A ) Experimental scheme for functional analysis of genes involved in FcεRI-signaling. After transfection, cells were divided into three aliquots as indicated, cultured with IgE and at 24, 48 and 72 hours tested for antigen induced β-hexosaminidase release. ( B ) Syk was used as positive control. Cells transfected with control scrambled “C” or Syk “E” siRNA were sensitized with IgE and then stimulated by antigen as outlined in A . The supernatants were used for β-hexosaminidase assay and the cell pellets for immunoblotting. Values are mean ± SEM. (n > 20), and immunoblots are representative of more than 10 separate experiments. The fraction of the protein left in the transfected cells compared to the controls was determined by densitometry after normalization for gel loading. The antigen-induced β-hexosaminidase release in the Syk transfected cells is expressed as a percentage of that in the control cells. The release for control scrambled siRNA transfected cells was 36.8% ± 5.5% (SD) at 24 hr, 31.4% ± 4.4% (SD) at 48 hr, and 30.7% ± 3.5% (SD) at 72 hr. ( C ) Distribution of degranulation indices of library screening. The degranulation indices in transfected cells were calculated as described in Methods ; with that of control cells as 0 and inhibition (−) or enhancement (+) expressed as a fraction of the control release. The result was sorted from negative to positive and includes all data from the 3 day of assays (24h, 48h, and 72h) for each siRNA pool. The antigen-induced β-hexosaminidase release for control cells transfected with scrambled siRNA were 37% ± 5.5% (SD) at 24 hr, 31% ± 4.4% (SD) at 48 hr, and 31% ± 3.5% (SD) at 72 hr.
    Figure Legend Snippet: siRNA screening of FcεRI-stimulated degranulation in mast cells ( A ) Experimental scheme for functional analysis of genes involved in FcεRI-signaling. After transfection, cells were divided into three aliquots as indicated, cultured with IgE and at 24, 48 and 72 hours tested for antigen induced β-hexosaminidase release. ( B ) Syk was used as positive control. Cells transfected with control scrambled “C” or Syk “E” siRNA were sensitized with IgE and then stimulated by antigen as outlined in A . The supernatants were used for β-hexosaminidase assay and the cell pellets for immunoblotting. Values are mean ± SEM. (n > 20), and immunoblots are representative of more than 10 separate experiments. The fraction of the protein left in the transfected cells compared to the controls was determined by densitometry after normalization for gel loading. The antigen-induced β-hexosaminidase release in the Syk transfected cells is expressed as a percentage of that in the control cells. The release for control scrambled siRNA transfected cells was 36.8% ± 5.5% (SD) at 24 hr, 31.4% ± 4.4% (SD) at 48 hr, and 30.7% ± 3.5% (SD) at 72 hr. ( C ) Distribution of degranulation indices of library screening. The degranulation indices in transfected cells were calculated as described in Methods ; with that of control cells as 0 and inhibition (−) or enhancement (+) expressed as a fraction of the control release. The result was sorted from negative to positive and includes all data from the 3 day of assays (24h, 48h, and 72h) for each siRNA pool. The antigen-induced β-hexosaminidase release for control cells transfected with scrambled siRNA were 37% ± 5.5% (SD) at 24 hr, 31% ± 4.4% (SD) at 48 hr, and 31% ± 3.5% (SD) at 72 hr.

    Techniques Used: Functional Assay, Transfection, Cell Culture, Positive Control, Beta Hexosaminidase Assay, Western Blot, Library Screening, Inhibition

    35) Product Images from "Suppression of the Nrf2-Dependent Antioxidant Response by Glucocorticoids and 11?-HSD1-Mediated Glucocorticoid Activation in Hepatic Cells"

    Article Title: Suppression of the Nrf2-Dependent Antioxidant Response by Glucocorticoids and 11?-HSD1-Mediated Glucocorticoid Activation in Hepatic Cells

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0036774

    11β-HSD1-mediated suppression of Nrf2-induced NQO1 expression in H4H1 cells. H4H1 cells were incubated for 24 h at 37°C with 10 µM sulforaphane in the absence or presence of 100 nM cortisone and 1 µM glycyrrhetinic acid (GA), followed by quantification of mRNA levels by real-time RT-PCR. Data (mean ± S.D. from three independent experiments performed in triplicate) represent ratios of NQO1 mRNA to GAPDH control mRNA from treated cells normalized to the values obtained from cells incubated vehicle (DMSO). *, p
    Figure Legend Snippet: 11β-HSD1-mediated suppression of Nrf2-induced NQO1 expression in H4H1 cells. H4H1 cells were incubated for 24 h at 37°C with 10 µM sulforaphane in the absence or presence of 100 nM cortisone and 1 µM glycyrrhetinic acid (GA), followed by quantification of mRNA levels by real-time RT-PCR. Data (mean ± S.D. from three independent experiments performed in triplicate) represent ratios of NQO1 mRNA to GAPDH control mRNA from treated cells normalized to the values obtained from cells incubated vehicle (DMSO). *, p

    Techniques Used: Expressing, Incubation, Quantitative RT-PCR

    Inhibition of Nrf2-induced mRNA expression of NQO1 and GSTA2 by cortisol. H4IIE cells were incubated for 24 h at 37°C with 10 µM sulforaphane in the absence or presence of 100 nM cortisol or cortisone, respectively, followed by determination of NQO1 (A) and GSTA2 mRNA levels (B) by real-time RT-PCR. Data (mean ± S.D. from three independent experiments performed in triplicate) represent ratios of NQO1 and GSTA2 mRNA to GAPDH control mRNA from treated cells normalized to the values obtained from cells incubated with vehicle (DMSO). *, p
    Figure Legend Snippet: Inhibition of Nrf2-induced mRNA expression of NQO1 and GSTA2 by cortisol. H4IIE cells were incubated for 24 h at 37°C with 10 µM sulforaphane in the absence or presence of 100 nM cortisol or cortisone, respectively, followed by determination of NQO1 (A) and GSTA2 mRNA levels (B) by real-time RT-PCR. Data (mean ± S.D. from three independent experiments performed in triplicate) represent ratios of NQO1 and GSTA2 mRNA to GAPDH control mRNA from treated cells normalized to the values obtained from cells incubated with vehicle (DMSO). *, p

    Techniques Used: Inhibition, Expressing, Incubation, Quantitative RT-PCR

    Influence of oxidative stress on Nrf2 pathway and GR transactivation. The activation of the GR-dependent TAT3-TATA-reporter by 100 µM cortisol was measured in rat H4IIE hepatoma cells with endogenous GR expression ( A ). CMV-LacZ plasmid served as transfection control to normalize luciferase values. Cells were treated with vehicle (DMSO) or cortisol (100 µM), with or without H 2 O 2 (2 mM) for 24 h at 37°C. Data represent mean ± SD from at least three independent experiments performed in triplicate. The influence of oxidative stress induced by H 2 O 2 on Nrf2-dependent transactivation was measured in ARECS3 cells stably expressing the ARE8L-reporter ( B ). Cells were treated with vehicle (DMSO) or sulforaphane (10 µM) in the presence or absence of H 2 O 2 (2 mM) for 24 h. Data represent mean ± SD from three independent experiments measured in triplicate. Activation of NQO1 mRNA expression by H 2 O 2 was measured in H4IIE cells ( C ). Cells were incubated for 24 h at 37°C with vehicle (0.05% DMSO) or sulforaphane (10 µM) in the presence or absence of H 2 O 2 (2 mM), followed by determination of NQO1 mRNA levels by real-time RT-PCR. Data (mean ± SD from two independent experiments measured in triplicate) represent ratios of NQO1 mRNA to GAPDH control mRNA from treated cells normalized to the values obtained from cells incubated with vehicle (DMSO).
    Figure Legend Snippet: Influence of oxidative stress on Nrf2 pathway and GR transactivation. The activation of the GR-dependent TAT3-TATA-reporter by 100 µM cortisol was measured in rat H4IIE hepatoma cells with endogenous GR expression ( A ). CMV-LacZ plasmid served as transfection control to normalize luciferase values. Cells were treated with vehicle (DMSO) or cortisol (100 µM), with or without H 2 O 2 (2 mM) for 24 h at 37°C. Data represent mean ± SD from at least three independent experiments performed in triplicate. The influence of oxidative stress induced by H 2 O 2 on Nrf2-dependent transactivation was measured in ARECS3 cells stably expressing the ARE8L-reporter ( B ). Cells were treated with vehicle (DMSO) or sulforaphane (10 µM) in the presence or absence of H 2 O 2 (2 mM) for 24 h. Data represent mean ± SD from three independent experiments measured in triplicate. Activation of NQO1 mRNA expression by H 2 O 2 was measured in H4IIE cells ( C ). Cells were incubated for 24 h at 37°C with vehicle (0.05% DMSO) or sulforaphane (10 µM) in the presence or absence of H 2 O 2 (2 mM), followed by determination of NQO1 mRNA levels by real-time RT-PCR. Data (mean ± SD from two independent experiments measured in triplicate) represent ratios of NQO1 mRNA to GAPDH control mRNA from treated cells normalized to the values obtained from cells incubated with vehicle (DMSO).

    Techniques Used: Activation Assay, Expressing, Plasmid Preparation, Transfection, Luciferase, Stable Transfection, Incubation, Quantitative RT-PCR

    36) Product Images from "Toll like Receptor 2 engagement on CD4+ T cells promotes TH9 differentiation and function"

    Article Title: Toll like Receptor 2 engagement on CD4+ T cells promotes TH9 differentiation and function

    Journal: European journal of immunology

    doi: 10.1002/eji.201646846

    Effect of TLR2 engagement on the expression of TH9, TH1 and TH2 transcription factors under non-polarizing or TH9− polarizing conditions. Naïve CD4 + T cells were stimulated with anti-CD3 and anti-CD28 mAbs alone (non-polarizing) or combined with TGF-β and IL-4 (TH9− polarizing) and with or without P3CSK4. Batf (A), Pu.1 (B), Tbx21 (C) and Gata3 (D) mRNA expression was determined by RT-PCR and normalized to actin. Bars represent means ± SD of three independent experiments. * p
    Figure Legend Snippet: Effect of TLR2 engagement on the expression of TH9, TH1 and TH2 transcription factors under non-polarizing or TH9− polarizing conditions. Naïve CD4 + T cells were stimulated with anti-CD3 and anti-CD28 mAbs alone (non-polarizing) or combined with TGF-β and IL-4 (TH9− polarizing) and with or without P3CSK4. Batf (A), Pu.1 (B), Tbx21 (C) and Gata3 (D) mRNA expression was determined by RT-PCR and normalized to actin. Bars represent means ± SD of three independent experiments. * p

    Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction

    37) Product Images from "Extracellular Collagen VI Has Prosurvival and Autophagy Instructive Properties in Mouse Fibroblasts"

    Article Title: Extracellular Collagen VI Has Prosurvival and Autophagy Instructive Properties in Mouse Fibroblasts

    Journal: Frontiers in Physiology

    doi: 10.3389/fphys.2018.01129

    Collagen VI ablation leads to defects in autolysosome formation and TFEB translocation. (A) Immunofluorescence for LAMP-2, showing normal lysosomes in WT fibroblasts and enlarged lysosomes in Col6a1 -/- fibroblasts. The insets show a magnification of the respective boxed areas. Scale bar, 25 μm. (B) Quantification of cells containing at least two enlarged lysosomes. Data represent the mean percentages ± SEM of cells with enlarged lysosomes, ad determined from thirty images per condition. (C) Western blot analysis of LAMP-2 in WT and Col6a1 -/- fibroblasts, in complete medium (S+) or following serum withdrawal for 3 h (S–). (D) Densitometric quantification of the relative LAMP-2/β-actin ratio of three independent western blot experiments, as in (C) . The value for WT fibroblasts in complete medium was arbitrarily set to 1. (E) qRT-PCR analysis of Lamp2 mRNA levels. (F) Co-immunostaining for LAMP-2 and LC3 in WT and Col6a1 -/- fibroblasts, following 3 h serum withdrawal. The right panels show a higher magnification of the boxed area of the respective merged image. Col6a1 -/- fibroblasts display impaired autophagosome (green puncta) fusion with lysosomes (red) (arrowheads). Scale bar, 25 μm. (G) Co-localization rate of LC3 and LAMP-2 staining in complete medium (S+) or following serum withdrawal for 3 h (S–). Mean percentages ± SEM were calculated for at least fifteen images per condition. (H) Representative fluorescence microscopy images of WT and Col6a1 -/- fibroblasts in complete medium and after 3 h serum withdrawal, following transfection with a GFP-TFEB expression construct (green). Nuclei were stained with Hoechst (blue). Scale bar, 25 μm. (I) Quantification of transfected WT and Col6a1 -/- fibroblasts showing either cytosolic or nuclear GFP-TFEB, as shown in (G) . Data represents the mean of at least three independent experiments, and were analyzed by ANOVA test with Bonferroni correction. ∗ P
    Figure Legend Snippet: Collagen VI ablation leads to defects in autolysosome formation and TFEB translocation. (A) Immunofluorescence for LAMP-2, showing normal lysosomes in WT fibroblasts and enlarged lysosomes in Col6a1 -/- fibroblasts. The insets show a magnification of the respective boxed areas. Scale bar, 25 μm. (B) Quantification of cells containing at least two enlarged lysosomes. Data represent the mean percentages ± SEM of cells with enlarged lysosomes, ad determined from thirty images per condition. (C) Western blot analysis of LAMP-2 in WT and Col6a1 -/- fibroblasts, in complete medium (S+) or following serum withdrawal for 3 h (S–). (D) Densitometric quantification of the relative LAMP-2/β-actin ratio of three independent western blot experiments, as in (C) . The value for WT fibroblasts in complete medium was arbitrarily set to 1. (E) qRT-PCR analysis of Lamp2 mRNA levels. (F) Co-immunostaining for LAMP-2 and LC3 in WT and Col6a1 -/- fibroblasts, following 3 h serum withdrawal. The right panels show a higher magnification of the boxed area of the respective merged image. Col6a1 -/- fibroblasts display impaired autophagosome (green puncta) fusion with lysosomes (red) (arrowheads). Scale bar, 25 μm. (G) Co-localization rate of LC3 and LAMP-2 staining in complete medium (S+) or following serum withdrawal for 3 h (S–). Mean percentages ± SEM were calculated for at least fifteen images per condition. (H) Representative fluorescence microscopy images of WT and Col6a1 -/- fibroblasts in complete medium and after 3 h serum withdrawal, following transfection with a GFP-TFEB expression construct (green). Nuclei were stained with Hoechst (blue). Scale bar, 25 μm. (I) Quantification of transfected WT and Col6a1 -/- fibroblasts showing either cytosolic or nuclear GFP-TFEB, as shown in (G) . Data represents the mean of at least three independent experiments, and were analyzed by ANOVA test with Bonferroni correction. ∗ P

    Techniques Used: Translocation Assay, Immunofluorescence, Western Blot, Quantitative RT-PCR, Immunostaining, Staining, Fluorescence, Microscopy, Transfection, Expressing, Construct

    The autophagic flux is impaired in Col6a1 -/- fibroblasts. (A–D) Western blot analysis of LC3 and p62 in total cell extracts from WT and Col6a1 -/- fibroblasts in complete medium (S+) or following serum withdrawal for 3 h (S–). (B,D) Show respectively the LC3-II/LC3-I ratio (B) and the p62/β-actin ratio (D) , as determined by densitometric quantification of the western blots as in (A,C) . Values for WT fibroblasts in complete medium were arbitrarily set to 1. Data represents the mean of at least three independent experiments. (E) qRT-PCR analysis of Map1lc3b and Sqstm1 mRNA levels. Data represents the mean of at least three independent experiments. (F) Fluorescence microscopy detection of LC3-positive puncta in WT and Col6a1 -/- fibroblasts derived from Col6a1 +/+ ::GFP-LC3 and Col6a1 -/- ::GFP-LC3 mice, respectively, and maintained in complete medium or subjected to serum starvation for 3 h. LC3 puncta (autophagosomes) accumulate in Col6a1 -/- fibroblasts both in complete medium and serum starved conditions. Scale bar, 25 μm. (G) Quantification of GFP-LC3 puncta per cell area, as shown in (F) . (H) Western blot analysis of total cell extracts from WT and Col6a1 -/- fibroblasts in complete medium (S+) or following serum withdrawal for 3 h (S–). The autophagic flux, as determined by the analysis of LC3 lipidation in the absence or presence of 50 μM CQ treatment, is shown. (I) Densitometric quantification of the relative intensity of LC3-II/LC3-I ratio of three independent western blot experiments, as in (H) . Data were analyzed by ANOVA test with Bonferroni correction. ∗ P
    Figure Legend Snippet: The autophagic flux is impaired in Col6a1 -/- fibroblasts. (A–D) Western blot analysis of LC3 and p62 in total cell extracts from WT and Col6a1 -/- fibroblasts in complete medium (S+) or following serum withdrawal for 3 h (S–). (B,D) Show respectively the LC3-II/LC3-I ratio (B) and the p62/β-actin ratio (D) , as determined by densitometric quantification of the western blots as in (A,C) . Values for WT fibroblasts in complete medium were arbitrarily set to 1. Data represents the mean of at least three independent experiments. (E) qRT-PCR analysis of Map1lc3b and Sqstm1 mRNA levels. Data represents the mean of at least three independent experiments. (F) Fluorescence microscopy detection of LC3-positive puncta in WT and Col6a1 -/- fibroblasts derived from Col6a1 +/+ ::GFP-LC3 and Col6a1 -/- ::GFP-LC3 mice, respectively, and maintained in complete medium or subjected to serum starvation for 3 h. LC3 puncta (autophagosomes) accumulate in Col6a1 -/- fibroblasts both in complete medium and serum starved conditions. Scale bar, 25 μm. (G) Quantification of GFP-LC3 puncta per cell area, as shown in (F) . (H) Western blot analysis of total cell extracts from WT and Col6a1 -/- fibroblasts in complete medium (S+) or following serum withdrawal for 3 h (S–). The autophagic flux, as determined by the analysis of LC3 lipidation in the absence or presence of 50 μM CQ treatment, is shown. (I) Densitometric quantification of the relative intensity of LC3-II/LC3-I ratio of three independent western blot experiments, as in (H) . Data were analyzed by ANOVA test with Bonferroni correction. ∗ P

    Techniques Used: Western Blot, Quantitative RT-PCR, Fluorescence, Microscopy, Derivative Assay, Mouse Assay

    38) Product Images from "Transient RUNX1 Expression during Early Mesendodermal Differentiation of hESCs Promotes Epithelial to Mesenchymal Transition through TGFB2 Signaling"

    Article Title: Transient RUNX1 Expression during Early Mesendodermal Differentiation of hESCs Promotes Epithelial to Mesenchymal Transition through TGFB2 Signaling

    Journal: Stem Cell Reports

    doi: 10.1016/j.stemcr.2016.09.006

    Genes that Regulate Epithelial to Mesenchymal Transition Are Affected by RUNX1 Knockdown During mesendoderm differentiation of hESCs, the levels of multiple effectors of EMT (epithelial associated [ CDH1 , OCLN , and CLD7 ] and mesenchymal associated [ VIM , TWIST1 , ZEB2 , SNAI1 , SNAI2 , and CD44 ]) were measured by qRT-PCR under treatment by non-silencing infection, or shRUNX1. During the control (non-silencing) differentiation epithelial marker expression decreases and mesenchymal gene expression increases. However, with shRUNX1 treatment, the epithelial marker genes fail to be suppressed and ZEB2 is not induced. Data shown represent mean ± SEM from three independent experiments. p Values were determined by t test between non-silencing infected and shRUNX1 treatment at each corresponding time point ( ∗ p
    Figure Legend Snippet: Genes that Regulate Epithelial to Mesenchymal Transition Are Affected by RUNX1 Knockdown During mesendoderm differentiation of hESCs, the levels of multiple effectors of EMT (epithelial associated [ CDH1 , OCLN , and CLD7 ] and mesenchymal associated [ VIM , TWIST1 , ZEB2 , SNAI1 , SNAI2 , and CD44 ]) were measured by qRT-PCR under treatment by non-silencing infection, or shRUNX1. During the control (non-silencing) differentiation epithelial marker expression decreases and mesenchymal gene expression increases. However, with shRUNX1 treatment, the epithelial marker genes fail to be suppressed and ZEB2 is not induced. Data shown represent mean ± SEM from three independent experiments. p Values were determined by t test between non-silencing infected and shRUNX1 treatment at each corresponding time point ( ∗ p

    Techniques Used: Quantitative RT-PCR, Infection, Marker, Expressing

    Knockdown of RUNX1 Impairs the Migration Ability, but Not the Proliferation Rate, of hESCs during Mesendoderm Differentiation (A) Principal component analysis of the time points, replicates, and treatments for mesendodermal differentiation of hESCs from transcriptome profiling. Four time points (undifferentiated [0h; red], 8 hr [8h; purple], 1 day [24h; blue], and 3 days [72h; green]) (n = 3 replicates from independent experiments) were analyzed by microarray analysis under three different treatments (uninfected [squares], non-silencing infected [triangles], and shRUNX1 [circles]). (B) Representative western blot comparing the levels of RUNX1 in hESCs treated with either non-silencing shRNA or RUNX1 shRNA differentiating to mesendoderm, confirming that RUNX1 is knocked down in shRUNX1 hESCs. (C) Venn diagram of the number of genes with expression changes greater than 1.5-fold, and p value and FDR p values less than 0.05, at each differentiation time point under shRUNX1 treatment compared with non-silencing infected hESCs. The total number of genes changed at each time point is in brackets. (D) ClueGO analysis of genes with significant expression changes reveals three biological processes that might be affected by RUNX1 knockdown. (E) Growth curves for hESCs either uninfected (blue), non-silencing infected (red), or with shRUNX1 (green) under pluripotent and mesendoderm differentiation conditions. Line graph represents mean ± SEM from three independent experiments. (F) Percentage of cells staining positive for BrdU with a 30-min pulse of labeling. Quantification of BrdU + cells was performed using blind scoring in duplicate of 200 cells from immunofluorescent images. Data represent mean ± SEM from three independent experiments. (G) Representative phase-contrast images from a scratch closure assay. Cells were plated, differentiated for 48 hr, and after 46 hr of differentiation cells were treated with mitomycin C (to inhibit proliferation) after which a scratch was made. Closure was measured 18 hr later. Dotted lines have been added to the phase-contrast images for emphasis along the edge of the scratch after that 18 h period. All phase-contrast images were taken at 10× magnification. (H) Percentage of scratch closure for hESCs uninfected, non-silencing infected, and infected with shRUNX1, as quantitated by ImageJ plug-in. Ten scratches were measured for each condition, two from each of five independent experiments, and data represent mean ± SD. ∗∗∗ p
    Figure Legend Snippet: Knockdown of RUNX1 Impairs the Migration Ability, but Not the Proliferation Rate, of hESCs during Mesendoderm Differentiation (A) Principal component analysis of the time points, replicates, and treatments for mesendodermal differentiation of hESCs from transcriptome profiling. Four time points (undifferentiated [0h; red], 8 hr [8h; purple], 1 day [24h; blue], and 3 days [72h; green]) (n = 3 replicates from independent experiments) were analyzed by microarray analysis under three different treatments (uninfected [squares], non-silencing infected [triangles], and shRUNX1 [circles]). (B) Representative western blot comparing the levels of RUNX1 in hESCs treated with either non-silencing shRNA or RUNX1 shRNA differentiating to mesendoderm, confirming that RUNX1 is knocked down in shRUNX1 hESCs. (C) Venn diagram of the number of genes with expression changes greater than 1.5-fold, and p value and FDR p values less than 0.05, at each differentiation time point under shRUNX1 treatment compared with non-silencing infected hESCs. The total number of genes changed at each time point is in brackets. (D) ClueGO analysis of genes with significant expression changes reveals three biological processes that might be affected by RUNX1 knockdown. (E) Growth curves for hESCs either uninfected (blue), non-silencing infected (red), or with shRUNX1 (green) under pluripotent and mesendoderm differentiation conditions. Line graph represents mean ± SEM from three independent experiments. (F) Percentage of cells staining positive for BrdU with a 30-min pulse of labeling. Quantification of BrdU + cells was performed using blind scoring in duplicate of 200 cells from immunofluorescent images. Data represent mean ± SEM from three independent experiments. (G) Representative phase-contrast images from a scratch closure assay. Cells were plated, differentiated for 48 hr, and after 46 hr of differentiation cells were treated with mitomycin C (to inhibit proliferation) after which a scratch was made. Closure was measured 18 hr later. Dotted lines have been added to the phase-contrast images for emphasis along the edge of the scratch after that 18 h period. All phase-contrast images were taken at 10× magnification. (H) Percentage of scratch closure for hESCs uninfected, non-silencing infected, and infected with shRUNX1, as quantitated by ImageJ plug-in. Ten scratches were measured for each condition, two from each of five independent experiments, and data represent mean ± SD. ∗∗∗ p

    Techniques Used: Migration, Microarray, Infection, Western Blot, shRNA, Expressing, Staining, Labeling

    39) Product Images from "Genome-wide analysis of the regulation of Cu metabolism in Cryptococcus neoformans"

    Article Title: Genome-wide analysis of the regulation of Cu metabolism in Cryptococcus neoformans

    Journal: Molecular microbiology

    doi: 10.1111/mmi.13960

    mRNA-Seq analysis of the C. neoformans transcriptional response to Cu limitation and Cu excess environments A. Expression of MT1, MT2 and CUF1 (left panel) and CTR1, CTR4 and CUF1 (right panel) transcript levels was assessed using qRT-PCR over the course of three hours after treating cells with 1 mM CuSO 4 (left panel) or 1 mM BCS (right panel). Expression was normalized relative to ACT1 expression and t=0 h was set to 1. N=3. B. Global transcriptional changes analyzed from RNA-Seq data are depicted as a volcano plot. Significantly changed transcripts (p adj
    Figure Legend Snippet: mRNA-Seq analysis of the C. neoformans transcriptional response to Cu limitation and Cu excess environments A. Expression of MT1, MT2 and CUF1 (left panel) and CTR1, CTR4 and CUF1 (right panel) transcript levels was assessed using qRT-PCR over the course of three hours after treating cells with 1 mM CuSO 4 (left panel) or 1 mM BCS (right panel). Expression was normalized relative to ACT1 expression and t=0 h was set to 1. N=3. B. Global transcriptional changes analyzed from RNA-Seq data are depicted as a volcano plot. Significantly changed transcripts (p adj

    Techniques Used: Expressing, Quantitative RT-PCR, RNA Sequencing Assay

    40) Product Images from "Arabidopsis genes, AtNPR1, AtTGA2 and AtPR-5, confer partial resistance to soybean cyst nematode (Heterodera glycines) when overexpressed in transgenic soybean roots"

    Article Title: Arabidopsis genes, AtNPR1, AtTGA2 and AtPR-5, confer partial resistance to soybean cyst nematode (Heterodera glycines) when overexpressed in transgenic soybean roots

    Journal: BMC Plant Biology

    doi: 10.1186/1471-2229-14-96

    The number of transcripts of three defense-related genes, GmPR5 , GmCHIB1 , and GmERF1 was determined in roots transformed with (A) AtNPR1 and (B) AtTGA2 using qRT-PCR.
    Figure Legend Snippet: The number of transcripts of three defense-related genes, GmPR5 , GmCHIB1 , and GmERF1 was determined in roots transformed with (A) AtNPR1 and (B) AtTGA2 using qRT-PCR.

    Techniques Used: Transformation Assay, Quantitative RT-PCR

    Expression of transcripts from each gene in transformed roots. RNA was converted to cDNA and used as template for PCR amplification of a fragment of each gene. Agarose gel containing amplicons representing a portion of AtNPR1, AtTGA2, AtPR-5, AtACBP3, AtACD2, AtCM-3, AtMC2, AtCDR1, AtDND1 , respectively. Molecular weight markers (MWt) are shown in the first lane. Each lane represents a transgenic root from an individual plant. The cDNA from RNA extracted from wild type (WT) roots did not produce an amplicon for any of these genes. However, cDNA from the wild type was present, and an amplicon was produced by PCR when the cDNA was used as template with primers for a soybean control gene. RNA was extracted from three roots, individually, and independently made into cDNA. Each was examined by PCR and visualized as above. All samples from transgenic roots produced amplicons according to the appropriate Arabidopsis gene.
    Figure Legend Snippet: Expression of transcripts from each gene in transformed roots. RNA was converted to cDNA and used as template for PCR amplification of a fragment of each gene. Agarose gel containing amplicons representing a portion of AtNPR1, AtTGA2, AtPR-5, AtACBP3, AtACD2, AtCM-3, AtMC2, AtCDR1, AtDND1 , respectively. Molecular weight markers (MWt) are shown in the first lane. Each lane represents a transgenic root from an individual plant. The cDNA from RNA extracted from wild type (WT) roots did not produce an amplicon for any of these genes. However, cDNA from the wild type was present, and an amplicon was produced by PCR when the cDNA was used as template with primers for a soybean control gene. RNA was extracted from three roots, individually, and independently made into cDNA. Each was examined by PCR and visualized as above. All samples from transgenic roots produced amplicons according to the appropriate Arabidopsis gene.

    Techniques Used: Expressing, Transformation Assay, Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis, Molecular Weight, Transgenic Assay, Produced

    Related Articles

    SYBR Green Assay:

    Article Title: RNA-Seq Transcriptome Profiling Identifies CRISPLD2 as a Glucocorticoid Responsive Gene that Modulates Cytokine Function in Airway Smooth Muscle Cells
    Article Snippet: .. Oligo(dT)-primed cDNA was prepared from 50 ng of total RNA by using SuperScript III First-strand Synthesis System (Invitrogen, Life Technologies, Grand Island, NY). qRT-PCR was set up in the presence of 0.5 µM primers by using QuantiTect SYBR Green PCR kit (Qiagen Sciences, Inc., Germantown, MD). qRT-PCR was performed on an StepOne Plus real time PCR machine (Applied Biosystems, Life Technologies, Grand Island, NY). β-actin was used as an internal control for data normalization. .. Immunoblot Analysis Cells were washed with PBS and lysed in NP-40 lysing buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl2 , 0.5% Nonidet P-40) containing protease inhibitor cocktail (Roche, Genentech, Inc., South San Francisco, CA).

    Synthesized:

    Article Title: Deletion of Snai2 and Snai3 Results in Impaired Physical Development Compounded by Lymphocyte Deficiency
    Article Snippet: .. RNA preparation, cDNA synthesis and RT-PCR Total RNA was isolated from cells using Illustra RNAspin Mini kit (GE Healthcare) according to the manufacturer’s instructions. cDNA was synthesized using SuperScript III First-Strand Synthesis System (Invitrogen) and purified with the GeneJET PCR Purification kit (Fermentas). .. Semi-quantitative RT-PCR was performed via incorporation of [32 P] dCTP [ ].

    Isolation:

    Article Title: Deletion of Snai2 and Snai3 Results in Impaired Physical Development Compounded by Lymphocyte Deficiency
    Article Snippet: .. RNA preparation, cDNA synthesis and RT-PCR Total RNA was isolated from cells using Illustra RNAspin Mini kit (GE Healthcare) according to the manufacturer’s instructions. cDNA was synthesized using SuperScript III First-Strand Synthesis System (Invitrogen) and purified with the GeneJET PCR Purification kit (Fermentas). .. Semi-quantitative RT-PCR was performed via incorporation of [32 P] dCTP [ ].

    Quantitative RT-PCR:

    Article Title: RNA-Seq Transcriptome Profiling Identifies CRISPLD2 as a Glucocorticoid Responsive Gene that Modulates Cytokine Function in Airway Smooth Muscle Cells
    Article Snippet: .. Oligo(dT)-primed cDNA was prepared from 50 ng of total RNA by using SuperScript III First-strand Synthesis System (Invitrogen, Life Technologies, Grand Island, NY). qRT-PCR was set up in the presence of 0.5 µM primers by using QuantiTect SYBR Green PCR kit (Qiagen Sciences, Inc., Germantown, MD). qRT-PCR was performed on an StepOne Plus real time PCR machine (Applied Biosystems, Life Technologies, Grand Island, NY). β-actin was used as an internal control for data normalization. .. Immunoblot Analysis Cells were washed with PBS and lysed in NP-40 lysing buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl2 , 0.5% Nonidet P-40) containing protease inhibitor cocktail (Roche, Genentech, Inc., South San Francisco, CA).

    Article Title: LOV Histidine Kinase Modulates the General Stress Response System and Affects the virB Operon Expression in Brucella abortus
    Article Snippet: .. Real Time quantitative RT-PCR assays Reverse transcription was performed with SuperScript III First Strand Synthesis System (Invitrogen) following the manufacturer’s instructions using random decamer primers (Invitrogen) and RNasin ribonuclease inhibitor (Promega). ..

    Purification:

    Article Title: Deletion of Snai2 and Snai3 Results in Impaired Physical Development Compounded by Lymphocyte Deficiency
    Article Snippet: .. RNA preparation, cDNA synthesis and RT-PCR Total RNA was isolated from cells using Illustra RNAspin Mini kit (GE Healthcare) according to the manufacturer’s instructions. cDNA was synthesized using SuperScript III First-Strand Synthesis System (Invitrogen) and purified with the GeneJET PCR Purification kit (Fermentas). .. Semi-quantitative RT-PCR was performed via incorporation of [32 P] dCTP [ ].

    Real-time Polymerase Chain Reaction:

    Article Title: RNA-Seq Transcriptome Profiling Identifies CRISPLD2 as a Glucocorticoid Responsive Gene that Modulates Cytokine Function in Airway Smooth Muscle Cells
    Article Snippet: .. Oligo(dT)-primed cDNA was prepared from 50 ng of total RNA by using SuperScript III First-strand Synthesis System (Invitrogen, Life Technologies, Grand Island, NY). qRT-PCR was set up in the presence of 0.5 µM primers by using QuantiTect SYBR Green PCR kit (Qiagen Sciences, Inc., Germantown, MD). qRT-PCR was performed on an StepOne Plus real time PCR machine (Applied Biosystems, Life Technologies, Grand Island, NY). β-actin was used as an internal control for data normalization. .. Immunoblot Analysis Cells were washed with PBS and lysed in NP-40 lysing buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl2 , 0.5% Nonidet P-40) containing protease inhibitor cocktail (Roche, Genentech, Inc., South San Francisco, CA).

    Article Title: Up-regulation of long non-coding RNA SNHG20 promotes ovarian cancer progression via Wnt/β-catenin signaling
    Article Snippet: .. The total RNA was reverse transcribed into first-strand cDNA using the SuperScript III® (Invitrogen) according to the manufacturer’s guide. q-PCR was performed on the SYBR Premix ExTaq kit (TaKaRa) on ABIPRISM 7000 Fluorescent Quantitative PCR System (Applied Biosystems, FosterCity, CA, U.S.A.) according to the instructions. .. Results were normalized to GAPDH expression levels.

    Polymerase Chain Reaction:

    Article Title: RNA-Seq Transcriptome Profiling Identifies CRISPLD2 as a Glucocorticoid Responsive Gene that Modulates Cytokine Function in Airway Smooth Muscle Cells
    Article Snippet: .. Oligo(dT)-primed cDNA was prepared from 50 ng of total RNA by using SuperScript III First-strand Synthesis System (Invitrogen, Life Technologies, Grand Island, NY). qRT-PCR was set up in the presence of 0.5 µM primers by using QuantiTect SYBR Green PCR kit (Qiagen Sciences, Inc., Germantown, MD). qRT-PCR was performed on an StepOne Plus real time PCR machine (Applied Biosystems, Life Technologies, Grand Island, NY). β-actin was used as an internal control for data normalization. .. Immunoblot Analysis Cells were washed with PBS and lysed in NP-40 lysing buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl2 , 0.5% Nonidet P-40) containing protease inhibitor cocktail (Roche, Genentech, Inc., South San Francisco, CA).

    Article Title: Deletion of Snai2 and Snai3 Results in Impaired Physical Development Compounded by Lymphocyte Deficiency
    Article Snippet: .. RNA preparation, cDNA synthesis and RT-PCR Total RNA was isolated from cells using Illustra RNAspin Mini kit (GE Healthcare) according to the manufacturer’s instructions. cDNA was synthesized using SuperScript III First-Strand Synthesis System (Invitrogen) and purified with the GeneJET PCR Purification kit (Fermentas). .. Semi-quantitative RT-PCR was performed via incorporation of [32 P] dCTP [ ].

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Regulatory effects and molecular mechanism of Trigonostemon reidioides on lipopolysaccharide-induced inflammatory responses in RAW264.7 cells
    Article Snippet: .. RT-PCR was performed using the SuperScript® III First-Strand Synthesis System (Thermo Fisher Scientific, Inc.) and Taq DNA polymerase (Invitrogen; Thermo Fisher Scientific, Inc.). .. The following conditions were used for each PCR reaction: 95°C for 5 min (1 cycle); 95°C for 30 sec, 55°C for 40 sec and 72°C for 1 min (30 cycles); and a final extension phase at 72°C for 10 min.

    Article Title: Deletion of Snai2 and Snai3 Results in Impaired Physical Development Compounded by Lymphocyte Deficiency
    Article Snippet: .. RNA preparation, cDNA synthesis and RT-PCR Total RNA was isolated from cells using Illustra RNAspin Mini kit (GE Healthcare) according to the manufacturer’s instructions. cDNA was synthesized using SuperScript III First-Strand Synthesis System (Invitrogen) and purified with the GeneJET PCR Purification kit (Fermentas). .. Semi-quantitative RT-PCR was performed via incorporation of [32 P] dCTP [ ].

    Article Title: DDX41 Recognizes RNA/DNA Retroviral Reverse Transcripts and Is Critical for In Vivo Control of Murine Leukemia Virus Infection
    Article Snippet: .. All siRNAs used in this study were previously shown to be on target and to decrease both RNA and protein levels ( ). cDNA was made using the SuperScript III first-strand synthesis system for RT-PCR (Invitrogen). .. RT-PCR was performed using the Power SYBR green PCR master mix kit (Applied Biosystems).

    Article Title: Discovery of Candidate Disease Genes in ENU-Induced Mouse Mutants by Large-Scale Sequencing, Including a Splice-Site Mutation in Nucleoredoxin
    Article Snippet: .. Two micrograms of RNA were reverse transcribed into cDNA using SuperScript III First-Strand Synthesis System for RT-PCR (Invitrogen) with random hexamers following the manufacturer's instructions. .. Gapdh was used as a positive control using the following primers: F- CGGAGTCAACGGATTTGGTCGTAT and R- GCCTTCATGGTGGTGAAGAC .

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    Thermo Fisher superscript iii first strand synthesis supermix for qrt pcr
    Moesin knockdown impacts Aβ phagocytosis and pro-inflammatory cytokine production by microglia. A Overview of in-vitro knockdown studies in primary mouse microglia treated with Msn siRNA or sham siRNA under resting and LPS-stimulated conditions. B Results from <t>qRT‐PCR</t> experiments demonstrating efficiency of Msn knockdown by siRNA as compared to sham siRNA. Y‐axis represents relative mRNA expression (2‐ΔΔCt method) normalized to Gapdh as housekeeping gene <t>(three</t> independent biological replicate experiments were performed per condition). C In‐vitro phagocytic capacity of primary microglia for fAβ42 HiLyte488 following exposure to sham siRNA or Msn siRNA under resting and LPS-stimulated conditions. Phagocytic uptake of fAβ42 was measured as proportion of CD45 + microglia using untreated microglia as negative controls. For each sample, at least 2,000 live CD45 + microglial events were captured. N =□3 independently performed biological replicate experiments. D-I Bar graphs displaying cytokine/chemokine data, shown as fluorescence intensity in arbitrary units (A.U.), obtained from microglial culture supernatants after siRNA sham or siRNA Msn treatment under resting and LPS-stimulated conditions: D IL10, E IL6, F TNF, G G-CSF, H CXCL10, I CCL3. Error bars represent ± SEM. Unpaired t-test: * p
    Superscript Iii First Strand Synthesis Supermix For Qrt Pcr, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript iii first strand synthesis supermix for qrt pcr/product/Thermo Fisher
    Average 93 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    superscript iii first strand synthesis supermix for qrt pcr - by Bioz Stars, 2020-08
    93/100 stars
      Buy from Supplier

    97
    Thermo Fisher superscript iii first strand synthesis system
    <t>RNA-Sequencing</t> analysis. (A) Whole transcriptome analysis was performed for BMSC and ACh cultures treated with TGF-β1 (blue lines) and harvested on day 0, 1, 3, 7 and 21 as indicated by the solid red arrows (BMSC donors 1, 2, and 3, and ACh donor 1 and 2). Additionally, for BMSC donor 1 and ACh donor 2, RNA-seq analysis was performed on day 21 following TGF-β1 withdrawal on day 1, 3, and 7, represented by dashed red arrows. (B) Multidimensional scaling (MDS) plot showing convergence of BMSC gene expression by day 21, despite withdrawal of exogenous TGF-β1 in some samples on day 1, 3, or 7, and dissimilarity to ACh samples treated in the same way. (C) Differentially expressed genes related to osteochondral transcription factors (left), soluble factors and receptor signalling (middle), and ECM molecules and ECM biosynthesis (right). Each timepoint in the heatmap is represented by a color shown on the bottom row of the heatmap, which corresponds to the color key on the bottom left of the figure. Each BMSC timepoint has 3 columns, representing 3 unique BMSC donors, and each ACh timepoint has 2 columns, representing 2 unique ACh donors; only one BMSC donor and one ACh donor was sequenced on day 21 with TGF-β1 withdrawal on day 1, 3, or 7, and are represented by the lighter pink shades; heatmap colors represent the average of <t>three</t> normalized logCPM values.
    Superscript Iii First Strand Synthesis System, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 97/100, based on 4953 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript iii first strand synthesis system/product/Thermo Fisher
    Average 97 stars, based on 4953 article reviews
    Price from $9.99 to $1999.99
    superscript iii first strand synthesis system - by Bioz Stars, 2020-08
    97/100 stars
      Buy from Supplier

    Image Search Results


    Moesin knockdown impacts Aβ phagocytosis and pro-inflammatory cytokine production by microglia. A Overview of in-vitro knockdown studies in primary mouse microglia treated with Msn siRNA or sham siRNA under resting and LPS-stimulated conditions. B Results from qRT‐PCR experiments demonstrating efficiency of Msn knockdown by siRNA as compared to sham siRNA. Y‐axis represents relative mRNA expression (2‐ΔΔCt method) normalized to Gapdh as housekeeping gene (three independent biological replicate experiments were performed per condition). C In‐vitro phagocytic capacity of primary microglia for fAβ42 HiLyte488 following exposure to sham siRNA or Msn siRNA under resting and LPS-stimulated conditions. Phagocytic uptake of fAβ42 was measured as proportion of CD45 + microglia using untreated microglia as negative controls. For each sample, at least 2,000 live CD45 + microglial events were captured. N =□3 independently performed biological replicate experiments. D-I Bar graphs displaying cytokine/chemokine data, shown as fluorescence intensity in arbitrary units (A.U.), obtained from microglial culture supernatants after siRNA sham or siRNA Msn treatment under resting and LPS-stimulated conditions: D IL10, E IL6, F TNF, G G-CSF, H CXCL10, I CCL3. Error bars represent ± SEM. Unpaired t-test: * p

    Journal: bioRxiv

    Article Title: Flow-cytometric microglial sorting coupled with quantitative proteomics identifies moesin as a highly-abundant microglial protein with relevance to Alzheimer’s disease

    doi: 10.1101/802694

    Figure Lengend Snippet: Moesin knockdown impacts Aβ phagocytosis and pro-inflammatory cytokine production by microglia. A Overview of in-vitro knockdown studies in primary mouse microglia treated with Msn siRNA or sham siRNA under resting and LPS-stimulated conditions. B Results from qRT‐PCR experiments demonstrating efficiency of Msn knockdown by siRNA as compared to sham siRNA. Y‐axis represents relative mRNA expression (2‐ΔΔCt method) normalized to Gapdh as housekeeping gene (three independent biological replicate experiments were performed per condition). C In‐vitro phagocytic capacity of primary microglia for fAβ42 HiLyte488 following exposure to sham siRNA or Msn siRNA under resting and LPS-stimulated conditions. Phagocytic uptake of fAβ42 was measured as proportion of CD45 + microglia using untreated microglia as negative controls. For each sample, at least 2,000 live CD45 + microglial events were captured. N =□3 independently performed biological replicate experiments. D-I Bar graphs displaying cytokine/chemokine data, shown as fluorescence intensity in arbitrary units (A.U.), obtained from microglial culture supernatants after siRNA sham or siRNA Msn treatment under resting and LPS-stimulated conditions: D IL10, E IL6, F TNF, G G-CSF, H CXCL10, I CCL3. Error bars represent ± SEM. Unpaired t-test: * p

    Article Snippet: After 48 hours, the efficiency of siRNA-mediated gene silencing was confirmed by quantitative reverse-transcriptase polymerase chain reaction (qRT-PCR) ( ).

    Techniques: In Vitro, Quantitative RT-PCR, Expressing, Fluorescence

    Rsp positively regulates its own expression. (A) The transcript levels of rsp at different growth phases were measured by qRT-PCR. (B) The β-galactosidase activities of the WT and rsp mutant strains with a plasmid pOS rsp were detected in the indicated time points. (C) Analysis of mRNA half-lives of p rsp - lacZ and rsp . Cells were collected after rifampin (200 μg/ml) treatment for RNA isolation, and then the mRNA half-lives were measured by qRT-PCR. (D) SDS-PAGE analysis of Rsp purified from the pRSF-Duet expression vector. The gel was stained with Coomassie blue. (E) EMSA of purified Rsp with the biotin-labelled DNA fragment containing the putative promoter region of rsp . Increasing concentrations of purified Rsp and 4 fmol of the biotin-labelled probe were used in the reactions. The unlabelled probe was added as a specific competitor, and the unlabelled fragment of the hu ORF region was added as a nonspecific competitor. (F) Promoter sequence of the rsp gene. The start points of the truncated probes are marked by arrows. (G) EMSA assay of Rsp with rsp truncated probes. The nonspecific competitor was added to the reactions. The error bars indicate the standard errors of the means of three biological replicates. ** P

    Journal: Emerging Microbes & Infections

    Article Title: Rsp promotes the transcription of virulence factors in an agr-independent manner in Staphylococcus aureus

    doi: 10.1080/22221751.2020.1752116

    Figure Lengend Snippet: Rsp positively regulates its own expression. (A) The transcript levels of rsp at different growth phases were measured by qRT-PCR. (B) The β-galactosidase activities of the WT and rsp mutant strains with a plasmid pOS rsp were detected in the indicated time points. (C) Analysis of mRNA half-lives of p rsp - lacZ and rsp . Cells were collected after rifampin (200 μg/ml) treatment for RNA isolation, and then the mRNA half-lives were measured by qRT-PCR. (D) SDS-PAGE analysis of Rsp purified from the pRSF-Duet expression vector. The gel was stained with Coomassie blue. (E) EMSA of purified Rsp with the biotin-labelled DNA fragment containing the putative promoter region of rsp . Increasing concentrations of purified Rsp and 4 fmol of the biotin-labelled probe were used in the reactions. The unlabelled probe was added as a specific competitor, and the unlabelled fragment of the hu ORF region was added as a nonspecific competitor. (F) Promoter sequence of the rsp gene. The start points of the truncated probes are marked by arrows. (G) EMSA assay of Rsp with rsp truncated probes. The nonspecific competitor was added to the reactions. The error bars indicate the standard errors of the means of three biological replicates. ** P

    Article Snippet: Total RNA isolation, cDNA generation, and real-time quantitative reverse transcription-PCR Overnight cultures of S. aureus were diluted 1:100 in TSB and then grown to the indicated cell density until being collected.

    Techniques: Expressing, Quantitative RT-PCR, Mutagenesis, Plasmid Preparation, Isolation, SDS Page, Purification, Staining, Sequencing

    Rsp positively regulates the transcription of virulence genes. (A) The transcript levels of 7 virulence-related genes were detected by qRT-PCR in the WT and rs p mutant strains. The transcript levels of hla (B), psmα (C), and psmβ (D) in the WT, rs p mutant, and rs p chromosomal-complemented strains at different growth phases. The β-galactosidase activities of hla (E), psmα (F), and psmβ (G) promoter in the WT and rs p mutant strains. Cells were collected at early stationary phase, and the β-galactosidase activity was detected with ONPG. (H) Hla protein levels of the WT, rs p mutant, and rs p chromosomal-complemented strains were measured by Western blot. (I) The transcript levels of hla , psmα , and psmβ in the WT, rs p mutant, and rs p chromosomal-complemented strains in the process of haemolysis. Cells were collected after incubated with 3% sheep red blood cells for 30 min, and the mRNA levels were analysed by qRT-PCR. The error bars indicate the standard errors of the means of three biological replicates. * P

    Journal: Emerging Microbes & Infections

    Article Title: Rsp promotes the transcription of virulence factors in an agr-independent manner in Staphylococcus aureus

    doi: 10.1080/22221751.2020.1752116

    Figure Lengend Snippet: Rsp positively regulates the transcription of virulence genes. (A) The transcript levels of 7 virulence-related genes were detected by qRT-PCR in the WT and rs p mutant strains. The transcript levels of hla (B), psmα (C), and psmβ (D) in the WT, rs p mutant, and rs p chromosomal-complemented strains at different growth phases. The β-galactosidase activities of hla (E), psmα (F), and psmβ (G) promoter in the WT and rs p mutant strains. Cells were collected at early stationary phase, and the β-galactosidase activity was detected with ONPG. (H) Hla protein levels of the WT, rs p mutant, and rs p chromosomal-complemented strains were measured by Western blot. (I) The transcript levels of hla , psmα , and psmβ in the WT, rs p mutant, and rs p chromosomal-complemented strains in the process of haemolysis. Cells were collected after incubated with 3% sheep red blood cells for 30 min, and the mRNA levels were analysed by qRT-PCR. The error bars indicate the standard errors of the means of three biological replicates. * P

    Article Snippet: Total RNA isolation, cDNA generation, and real-time quantitative reverse transcription-PCR Overnight cultures of S. aureus were diluted 1:100 in TSB and then grown to the indicated cell density until being collected.

    Techniques: Quantitative RT-PCR, Mutagenesis, Activity Assay, Western Blot, Incubation

    RNA-Sequencing analysis. (A) Whole transcriptome analysis was performed for BMSC and ACh cultures treated with TGF-β1 (blue lines) and harvested on day 0, 1, 3, 7 and 21 as indicated by the solid red arrows (BMSC donors 1, 2, and 3, and ACh donor 1 and 2). Additionally, for BMSC donor 1 and ACh donor 2, RNA-seq analysis was performed on day 21 following TGF-β1 withdrawal on day 1, 3, and 7, represented by dashed red arrows. (B) Multidimensional scaling (MDS) plot showing convergence of BMSC gene expression by day 21, despite withdrawal of exogenous TGF-β1 in some samples on day 1, 3, or 7, and dissimilarity to ACh samples treated in the same way. (C) Differentially expressed genes related to osteochondral transcription factors (left), soluble factors and receptor signalling (middle), and ECM molecules and ECM biosynthesis (right). Each timepoint in the heatmap is represented by a color shown on the bottom row of the heatmap, which corresponds to the color key on the bottom left of the figure. Each BMSC timepoint has 3 columns, representing 3 unique BMSC donors, and each ACh timepoint has 2 columns, representing 2 unique ACh donors; only one BMSC donor and one ACh donor was sequenced on day 21 with TGF-β1 withdrawal on day 1, 3, or 7, and are represented by the lighter pink shades; heatmap colors represent the average of three normalized logCPM values.

    Journal: bioRxiv

    Article Title: Micro-pellet culture reveals that bone marrow mesenchymal stromal cell (BMSC) chondrogenic induction is triggered by a single day of TGF-β1 exposure

    doi: 10.1101/853556

    Figure Lengend Snippet: RNA-Sequencing analysis. (A) Whole transcriptome analysis was performed for BMSC and ACh cultures treated with TGF-β1 (blue lines) and harvested on day 0, 1, 3, 7 and 21 as indicated by the solid red arrows (BMSC donors 1, 2, and 3, and ACh donor 1 and 2). Additionally, for BMSC donor 1 and ACh donor 2, RNA-seq analysis was performed on day 21 following TGF-β1 withdrawal on day 1, 3, and 7, represented by dashed red arrows. (B) Multidimensional scaling (MDS) plot showing convergence of BMSC gene expression by day 21, despite withdrawal of exogenous TGF-β1 in some samples on day 1, 3, or 7, and dissimilarity to ACh samples treated in the same way. (C) Differentially expressed genes related to osteochondral transcription factors (left), soluble factors and receptor signalling (middle), and ECM molecules and ECM biosynthesis (right). Each timepoint in the heatmap is represented by a color shown on the bottom row of the heatmap, which corresponds to the color key on the bottom left of the figure. Each BMSC timepoint has 3 columns, representing 3 unique BMSC donors, and each ACh timepoint has 2 columns, representing 2 unique ACh donors; only one BMSC donor and one ACh donor was sequenced on day 21 with TGF-β1 withdrawal on day 1, 3, or 7, and are represented by the lighter pink shades; heatmap colors represent the average of three normalized logCPM values.

    Article Snippet: Quantitative-PCR (qPCR) Analysis cDNA was synthesized from total RNA using SuperScript III First-Strand Synthesis System for RT-PCR (Thermo Fisher), as per manufacturer’s instructions. qPCR reactions were prepared using SYBR Green PCR Master Mix (Applied Biosystems).

    Techniques: RNA Sequencing Assay, Expressing

    Characterization of zebrafish Padi2. (A) Citrullination activity of bacterially expressed zebrafish Padi2 201a and 202 splice variants in total lysates with and without calcium. Absorbance of light was measured and expressed as mean (± SEM) relative light units (RLU), normalized for protein level. Data represent 3 independent replicates. (B) Citrullination activity of Padi2 201a and individual point mutations in calcium binding and catalytic amino acids. Fold change of enzymatic activity is shown relative to wild-type Padi2 201a. Data represent 2 independent replicates and wild-type values are also represented in A. (C) Schematic of padi2 gene with exon 7 gRNA sequence highlighted for CRISPR/Cas9 mutagenesis. gRNA sequence in blue, PAM site in red. (D) Sequence alignment of wild-type and padi2 −/− 20 bp mutation in exon 7. MwoI restriction site for genotyping highlighted in pink, predicted early stop codon highlighted in red. (E) RT-qPCR of padi2 exon5/6 on individual larvae from a padi2 +/- incross. Data are from three pooled independent replicates with the means and SEM reported and a one-sample t test performed. (F) Representative western blot for zebrafish Padi2 and Actin from pooled larvae (representative of 4 experiments). (G) Citrullination activity of pooled zebrafish lysates expressed as relative light units (RLU). Data are from 3 independent replicates with the means and SEM reported and an ANOVA performed. (H) Citrullination activity of pooled embryo lysates during development. Fold change of enzymatic activity is shown as a ratio of calcium-treated to no calcium for each condition. Data are from 3 independent replicates. (I) Representative western blot for zebrafish Padi2 and Actin from pooled zebrafish through stages of development (representative of 3 and 2 experiments).

    Journal: bioRxiv

    Article Title: Citrullination regulates wound responses and tissue regeneration in zebrafish

    doi: 10.1101/2019.12.27.889378

    Figure Lengend Snippet: Characterization of zebrafish Padi2. (A) Citrullination activity of bacterially expressed zebrafish Padi2 201a and 202 splice variants in total lysates with and without calcium. Absorbance of light was measured and expressed as mean (± SEM) relative light units (RLU), normalized for protein level. Data represent 3 independent replicates. (B) Citrullination activity of Padi2 201a and individual point mutations in calcium binding and catalytic amino acids. Fold change of enzymatic activity is shown relative to wild-type Padi2 201a. Data represent 2 independent replicates and wild-type values are also represented in A. (C) Schematic of padi2 gene with exon 7 gRNA sequence highlighted for CRISPR/Cas9 mutagenesis. gRNA sequence in blue, PAM site in red. (D) Sequence alignment of wild-type and padi2 −/− 20 bp mutation in exon 7. MwoI restriction site for genotyping highlighted in pink, predicted early stop codon highlighted in red. (E) RT-qPCR of padi2 exon5/6 on individual larvae from a padi2 +/- incross. Data are from three pooled independent replicates with the means and SEM reported and a one-sample t test performed. (F) Representative western blot for zebrafish Padi2 and Actin from pooled larvae (representative of 4 experiments). (G) Citrullination activity of pooled zebrafish lysates expressed as relative light units (RLU). Data are from 3 independent replicates with the means and SEM reported and an ANOVA performed. (H) Citrullination activity of pooled embryo lysates during development. Fold change of enzymatic activity is shown as a ratio of calcium-treated to no calcium for each condition. Data are from 3 independent replicates. (I) Representative western blot for zebrafish Padi2 and Actin from pooled zebrafish through stages of development (representative of 3 and 2 experiments).

    Article Snippet: Embryos were genotyped using GoTaq (Promega) as described above and 2-3 embryos of each genotype were used for cDNA production using Superscript III First Strand Synthesis System with Oligo(dT) (Thermo Fisher Scientific). qPCR was performed using FastStart Essential Green Master (Roche) and a LightCycler96 (Rocher).

    Techniques: Activity Assay, Binding Assay, Sequencing, CRISPR, Mutagenesis, Quantitative RT-PCR, Western Blot