superscript ii reverse transcriptase  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Thermo Fisher superscript ii reverse transcriptase
    Superscript Ii Reverse Transcriptase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 805 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript ii reverse transcriptase/product/Thermo Fisher
    Average 99 stars, based on 805 article reviews
    Price from $9.99 to $1999.99
    superscript ii reverse transcriptase - by Bioz Stars, 2020-01
    99/100 stars

    Images

    Related Articles

    Cell Isolation:

    Article Title: Inhibition of Inflammatory Signaling in Tet2 Mutant Preleukemic Cells Mitigates Stress Induced Abnormalities and Clonal Hematopoiesis
    Article Snippet: Lin- BM cells (~1 × 106 ) were purified by an EasySep™ Mouse Hematopoietic Progenitor Cell Isolation Kit (StemCell, Cat # 19856) according to manufacturer’s instruction. .. Isolated RNA was quantified by spectrophotometer and RNA concentrations were normalized. cDNA was synthesized by SuperScript II Reverse Transcriptase (ThermoFisher Scientific, Cat # 18064014).

    Amplification:

    Article Title: Reduced DAXX Expression Is Associated with Reduced CD24 Expression in Colorectal Cancer
    Article Snippet: RNA was then reverse transcribed to cDNA using oligo-dT 18 primers by using Superscript II reverse transcriptase (Invitrogen). .. Appropriate dilutions of each cDNA for subsequent PCR amplification were determined with Tag DNA polymerase and 10× Tag reaction buffer (Bio-Van).

    Synthesized:

    Article Title: Transcriptome analysis reveals autophagy as regulator of TGFβ/Smad-induced fibrogenesis in trabecular meshwork cells
    Article Snippet: .. Quantitative real-time PCR qPCR was performed as described in previous studies . cDNA was synthesized from total RNA (1 µg) using oligo(dT) primer and Superscript II reverse transcriptase (Invitrogen, Carlsbad, CA). .. Real-time PCRs were performed in a 20 µL mix reaction [1 µL of cDNA (1:5 dilution), 10 µL iQ SYBR Green Supermix (Bio-Rad, Hercules, CA), 500 nm of each primer], in the BIO-RAD iCycler iQ system (Bio-Rad, Hercules, CA).

    Article Title: The molecular landscape of glioma in patients with Neurofibromatosis 1
    Article Snippet: .. Total RNA was prepared using the AllPrep DNA/RNA/Protein Mini Kit (Qiagen) according to the manufacturer’s instructions, and cDNA was synthesized using SuperScript II Reverse Transcriptase (Invitrogen). .. RT-qPCR was performed with a 7500 Real Time PCR thermal cycler system (Applied Biosystems), using SYBR Green PCR Master Mix (Applied Biosystems).

    Article Title: Inhibition of Inflammatory Signaling in Tet2 Mutant Preleukemic Cells Mitigates Stress Induced Abnormalities and Clonal Hematopoiesis
    Article Snippet: .. Isolated RNA was quantified by spectrophotometer and RNA concentrations were normalized. cDNA was synthesized by SuperScript II Reverse Transcriptase (ThermoFisher Scientific, Cat # 18064014). .. Resulting cDNA was analyzed by SYBR Green master mix (Life Technologies, Cat # 4385612) with indicated primers on a ViiA7 Real-Time PCR instrument.

    Neutralization:

    Article Title: Evolution of the HIV-1 Rev Response Element during Natural Infection Reveals Nucleotide Changes That Correlate with Altered Structure and Increased Activity over Time
    Article Snippet: .. Reverse transcrip tion was performed by first annealing 2 μM RT oligonucleotide to the RNA in a reaction volume of 11 μl by incubation at 65°C for 5 min, followed by cooling on ice. cDNA synthesis was initiated by incubating the annealing mixture with 8 μl of 2.5× RT reaction mixture (2.5×; 125 mM Tris [pH 8.0], 187.5 mM KCl, 15 mM MnCl2 , 25 mM dithiothreitol, 1.25 mM deoxynucleoside triphosphates [dNTPs]) and 1 μl of SuperScript II reverse transcriptase (200 U/μl; Thermo Fisher) for 42°C for 3 h. The RNA template was then hydrolyzed by adding 1 μl 2 N NaOH, followed by neutralization by addition of 1 μl 2 N HCl. .. The cDNA library was purified using G50 spin columns (GE Healthcare).

    Quantitative RT-PCR:

    Article Title: C5aR agonist enhances phagocytosis of fibrillar and non-fibrillar Aβ amyloid and preserves memory in a mouse model of familial Alzheimer’s disease
    Article Snippet: Gene expression assay in brain tissue Two-step RT-qPCR was carried out to quantify the expression of various phagocyte markers in the brain. .. The Invitrogen SuperScript™ II Reverse Transcriptase (18064–022) was used to synthesize first-strand cDNA according to the manufacturer’s instructions.

    Article Title: Interleukin-37 Inhibits Colon Carcinogensis During Chronic Colitis
    Article Snippet: RNA samples (1 μg) were reverse transcribed using SuperScript™ II Reverse Transcriptase (Invitrogen, Carlsbad, CA, USA). .. Gene specific primers were designed using PrimerExpress and ordered from Eurofins MWG (Ebersberg, Germany) with purification grade HPLC. qRT-PCR reactions were performed in triplets in a 96-well format (BioRad iCycler).

    Article Title: The molecular landscape of glioma in patients with Neurofibromatosis 1
    Article Snippet: Paragraph title: RT-qPCR. ... Total RNA was prepared using the AllPrep DNA/RNA/Protein Mini Kit (Qiagen) according to the manufacturer’s instructions, and cDNA was synthesized using SuperScript II Reverse Transcriptase (Invitrogen).

    Article Title: Arl13b Regulates Breast Cancer Cell Migration and Invasion by Controlling Integrin-Mediated Signaling
    Article Snippet: RNA was used as template for cDNA synthesis using SuperScript II Reverse Transcriptase (Invitrogen), according to the manufacturer’s instructions. .. Real-time quantitative PCR (RT-qPCR) was performed using the FastStart Essential DNA Green Master kit (Roche, Basel, Switzerland) and a LightCycler 96 System (Roche), according to the manufacturer’s instructions.

    Article Title: Inhibition of Inflammatory Signaling in Tet2 Mutant Preleukemic Cells Mitigates Stress Induced Abnormalities and Clonal Hematopoiesis
    Article Snippet: Paragraph title: Isolation of Lin-negative BM cells, LSK cells and qRT-PCR assays ... Isolated RNA was quantified by spectrophotometer and RNA concentrations were normalized. cDNA was synthesized by SuperScript II Reverse Transcriptase (ThermoFisher Scientific, Cat # 18064014).

    Real-time Polymerase Chain Reaction:

    Article Title: T-bet optimizes CD4 T-cell responses against influenza through CXCR3-dependent lung trafficking but not functional programming
    Article Snippet: Paragraph title: Real Time-PCR. ... 2.5 μg of RNA was reverse transcribed into cDNA using random hexamer primers and Superscript II Reverse Transcriptase (Invitrogen).

    Article Title: Shenqi Jiangtang Granule Ameliorates Kidney Function by Inhibiting Apoptosis in a Diabetic Rat Model
    Article Snippet: .. Real-Time PCR Total RNA from the kidney cortex was used to synthesize cDNA using SuperScript II reverse transcriptase (Life Technologies, Carlsbad, CA). ..

    Article Title: Transcriptome analysis reveals autophagy as regulator of TGFβ/Smad-induced fibrogenesis in trabecular meshwork cells
    Article Snippet: .. Quantitative real-time PCR qPCR was performed as described in previous studies . cDNA was synthesized from total RNA (1 µg) using oligo(dT) primer and Superscript II reverse transcriptase (Invitrogen, Carlsbad, CA). .. Real-time PCRs were performed in a 20 µL mix reaction [1 µL of cDNA (1:5 dilution), 10 µL iQ SYBR Green Supermix (Bio-Rad, Hercules, CA), 500 nm of each primer], in the BIO-RAD iCycler iQ system (Bio-Rad, Hercules, CA).

    Article Title: Targeting Glutathione and Cystathionine β-Synthase in Ovarian Cancer Treatment by Selenium–Chrysin Polyurea Dendrimer Nanoformulation
    Article Snippet: Paragraph title: 2.2. Quantitative Real-Time PCR ... The complementary DNA (cDNA) synthesis from 1 µg of RNA was performed using SuperScript II Reverse Transcriptase (18080e44, Invitrogen, Waltham, MA, USA).

    Article Title: Interleukin-37 Inhibits Colon Carcinogensis During Chronic Colitis
    Article Snippet: RNA samples (1 μg) were reverse transcribed using SuperScript™ II Reverse Transcriptase (Invitrogen, Carlsbad, CA, USA). .. Gene expression levels were measured by quantitative PCR (SYBR Green Supermix, Biorad).

    Article Title: Chondroitin sulfate proteoglycans as novel drivers of leucocyte infiltration in multiple sclerosis
    Article Snippet: Paragraph title: Real-time polymerase chain reaction ... RNA was reverse transcribed to cDNA using SuperScript™ II Reverse Transcriptase (Invitrogen).

    Article Title: The molecular landscape of glioma in patients with Neurofibromatosis 1
    Article Snippet: Total RNA was prepared using the AllPrep DNA/RNA/Protein Mini Kit (Qiagen) according to the manufacturer’s instructions, and cDNA was synthesized using SuperScript II Reverse Transcriptase (Invitrogen). .. RT-qPCR was performed with a 7500 Real Time PCR thermal cycler system (Applied Biosystems), using SYBR Green PCR Master Mix (Applied Biosystems).

    Article Title: Arl13b Regulates Breast Cancer Cell Migration and Invasion by Controlling Integrin-Mediated Signaling
    Article Snippet: Paragraph title: 4.3. RNA Extraction, cDNA Synthesis and Real-Time Quantitative PCR ... RNA was used as template for cDNA synthesis using SuperScript II Reverse Transcriptase (Invitrogen), according to the manufacturer’s instructions.

    Article Title: Inhibition of Inflammatory Signaling in Tet2 Mutant Preleukemic Cells Mitigates Stress Induced Abnormalities and Clonal Hematopoiesis
    Article Snippet: Isolated RNA was quantified by spectrophotometer and RNA concentrations were normalized. cDNA was synthesized by SuperScript II Reverse Transcriptase (ThermoFisher Scientific, Cat # 18064014). .. Resulting cDNA was analyzed by SYBR Green master mix (Life Technologies, Cat # 4385612) with indicated primers on a ViiA7 Real-Time PCR instrument.

    Random Hexamer Labeling:

    Article Title: T-bet optimizes CD4 T-cell responses against influenza through CXCR3-dependent lung trafficking but not functional programming
    Article Snippet: .. 2.5 μg of RNA was reverse transcribed into cDNA using random hexamer primers and Superscript II Reverse Transcriptase (Invitrogen). .. Quantitative PCR was performed to amplify the polymerase (PA) gene of PR8 and A/Phil using an ABI Prism 7700 Sequence Detector (Applied Biosystems) with 50 ng of cDNA per reaction and the following primers and probe: forward primer, 5′-CGGTCCAAATTCCTGCTGA-3′; reverse primer, 5′CATTGGGTTCCTTCCATCCA-3′; probe, 5′-6-FAMCCAAGTCATGAAGGAGAGGGAATACCGCT-3′.

    Formalin-fixed Paraffin-Embedded:

    Article Title: C5aR agonist enhances phagocytosis of fibrillar and non-fibrillar Aβ amyloid and preserves memory in a mouse model of familial Alzheimer’s disease
    Article Snippet: 5mm brain sections from the paraffin embedded fixed hemisphere also used during immunohistochemistry were used to extract total RNA (QIAGEN RNeasy FFPE Kit 73504 used according to manufacturer’s instructions). .. The Invitrogen SuperScript™ II Reverse Transcriptase (18064–022) was used to synthesize first-strand cDNA according to the manufacturer’s instructions.

    Expressing:

    Article Title: C5aR agonist enhances phagocytosis of fibrillar and non-fibrillar Aβ amyloid and preserves memory in a mouse model of familial Alzheimer’s disease
    Article Snippet: Paragraph title: Gene expression assay in brain tissue ... The Invitrogen SuperScript™ II Reverse Transcriptase (18064–022) was used to synthesize first-strand cDNA according to the manufacturer’s instructions.

    Article Title: Systematic Characterization of Stress-Induced RNA Granulation.
    Article Snippet: After centrifuging the cell lysate at 20,000g in 4°C for 10 min, the supernatant was divided into two groups for generating the ribosome profiling library and mRNA expression profiling library. .. After reverse transcription using Superscript II reverse transcriptase (Invitrogen), rRNA products were depleted by hybridization to biotinylated sense-strand oligonucleotides, followed by removal of the duplexes through streptavidin bead affinity.

    Article Title: Shenqi Jiangtang Granule Ameliorates Kidney Function by Inhibiting Apoptosis in a Diabetic Rat Model
    Article Snippet: Real-Time PCR Total RNA from the kidney cortex was used to synthesize cDNA using SuperScript II reverse transcriptase (Life Technologies, Carlsbad, CA). .. Relative expression levels were calculated with the 2−ΔΔCt method.

    Article Title: Targeting Glutathione and Cystathionine β-Synthase in Ovarian Cancer Treatment by Selenium–Chrysin Polyurea Dendrimer Nanoformulation
    Article Snippet: The complementary DNA (cDNA) synthesis from 1 µg of RNA was performed using SuperScript II Reverse Transcriptase (18080e44, Invitrogen, Waltham, MA, USA). .. The xCT/SLC7A11 expression was quantified (forward 5’–GGTCCTGTCACTATTTGGAGC–3’ and reverse 5’–GAGGAGTTCCACCCAGACTC–3’), and hypoxanthine–guanine phosphoribosyltransferase 1 (HPRT1 ) was used as a housekeeping gene (forward 5’–TGACACTGGCAAAACAATG–3’ and reverse 5’–GGTCGTTTTTCACCAGCAA–3’).

    Article Title: Interleukin-37 Inhibits Colon Carcinogensis During Chronic Colitis
    Article Snippet: RNA samples (1 μg) were reverse transcribed using SuperScript™ II Reverse Transcriptase (Invitrogen, Carlsbad, CA, USA). .. Gene expression levels were measured by quantitative PCR (SYBR Green Supermix, Biorad).

    Article Title: Chondroitin sulfate proteoglycans as novel drivers of leucocyte infiltration in multiple sclerosis
    Article Snippet: RNA was reverse transcribed to cDNA using SuperScript™ II Reverse Transcriptase (Invitrogen). .. The relative expression levels between genes were calculated using a comparative cycle threshold method, with expression levels normalized to GAPDH .

    Article Title: Non-typeable Haemophilus influenzae isolates from patients with chronic obstructive pulmonary disease contain new phase-variable modA methyltransferase alleles controlling phasevarions
    Article Snippet: RNA Seq analysis Triplicate biological replicates of total RNA were prepared using Trizol (Thermo Fisher) according to manufacturer’s instructions from mid-log cultures of NTHi modA15 and modA18 ON/OFF pairs (OD600 = 0.5) as previously used for modA ON vs OFF expression analysis . .. Briefly, RNA was fragmented, and randomly primed first strand cDNA synthesis carried out using SuperScript II Reverse Transcriptase (Invitrogen) according to manufacturer’s protocols.

    Article Title: Arl13b Regulates Breast Cancer Cell Migration and Invasion by Controlling Integrin-Mediated Signaling
    Article Snippet: RNA was used as template for cDNA synthesis using SuperScript II Reverse Transcriptase (Invitrogen), according to the manufacturer’s instructions. .. All ARL13B expression levels were normalized to the level of GAPDH expression, which was used as a housekeeping gene.

    Article Title: Inhibition of Inflammatory Signaling in Tet2 Mutant Preleukemic Cells Mitigates Stress Induced Abnormalities and Clonal Hematopoiesis
    Article Snippet: Isolated RNA was quantified by spectrophotometer and RNA concentrations were normalized. cDNA was synthesized by SuperScript II Reverse Transcriptase (ThermoFisher Scientific, Cat # 18064014). .. Expression of Actin-b was used as an internal control (Forward, 5’-GACGGCCAGGTCATCACTATTG-3’ and Reverse 5’-AGGAAGGCTGGAAAAGAGCC-3’) for calculating fold changes of indicated genes.

    Modification:

    Article Title: Evolution of the HIV-1 Rev Response Element during Natural Infection Reveals Nucleotide Changes That Correlate with Altered Structure and Increased Activity over Time
    Article Snippet: Paragraph title: Mutational profiling of modified RNA. ... Reverse transcrip tion was performed by first annealing 2 μM RT oligonucleotide to the RNA in a reaction volume of 11 μl by incubation at 65°C for 5 min, followed by cooling on ice. cDNA synthesis was initiated by incubating the annealing mixture with 8 μl of 2.5× RT reaction mixture (2.5×; 125 mM Tris [pH 8.0], 187.5 mM KCl, 15 mM MnCl2 , 25 mM dithiothreitol, 1.25 mM deoxynucleoside triphosphates [dNTPs]) and 1 μl of SuperScript II reverse transcriptase (200 U/μl; Thermo Fisher) for 42°C for 3 h. The RNA template was then hydrolyzed by adding 1 μl 2 N NaOH, followed by neutralization by addition of 1 μl 2 N HCl.

    Hybridization:

    Article Title: Systematic Characterization of Stress-Induced RNA Granulation.
    Article Snippet: .. After reverse transcription using Superscript II reverse transcriptase (Invitrogen), rRNA products were depleted by hybridization to biotinylated sense-strand oligonucleotides, followed by removal of the duplexes through streptavidin bead affinity. .. Finally, through PCR and gel extraction, the library was generated using the size range 150–160 bp.

    High Performance Liquid Chromatography:

    Article Title: Interleukin-37 Inhibits Colon Carcinogensis During Chronic Colitis
    Article Snippet: RNA samples (1 μg) were reverse transcribed using SuperScript™ II Reverse Transcriptase (Invitrogen, Carlsbad, CA, USA). .. Gene specific primers were designed using PrimerExpress and ordered from Eurofins MWG (Ebersberg, Germany) with purification grade HPLC. qRT-PCR reactions were performed in triplets in a 96-well format (BioRad iCycler).

    Immunohistochemistry:

    Article Title: C5aR agonist enhances phagocytosis of fibrillar and non-fibrillar Aβ amyloid and preserves memory in a mouse model of familial Alzheimer’s disease
    Article Snippet: 5mm brain sections from the paraffin embedded fixed hemisphere also used during immunohistochemistry were used to extract total RNA (QIAGEN RNeasy FFPE Kit 73504 used according to manufacturer’s instructions). .. The Invitrogen SuperScript™ II Reverse Transcriptase (18064–022) was used to synthesize first-strand cDNA according to the manufacturer’s instructions.

    Incubation:

    Article Title: Systematic Characterization of Stress-Induced RNA Granulation.
    Article Snippet: For the ribosome profiling library, lysates were treated with RNase I (100 U/μl) and incubated at room temperature for 45 min. After nuclease digestion, ribosome footprinted RNAs were purified by sedimentation through a 1 M sucrose cushion and excising the urea gel between 26–34 nucleotides. .. After reverse transcription using Superscript II reverse transcriptase (Invitrogen), rRNA products were depleted by hybridization to biotinylated sense-strand oligonucleotides, followed by removal of the duplexes through streptavidin bead affinity.

    Article Title: Evolution of the HIV-1 Rev Response Element during Natural Infection Reveals Nucleotide Changes That Correlate with Altered Structure and Increased Activity over Time
    Article Snippet: .. Reverse transcrip tion was performed by first annealing 2 μM RT oligonucleotide to the RNA in a reaction volume of 11 μl by incubation at 65°C for 5 min, followed by cooling on ice. cDNA synthesis was initiated by incubating the annealing mixture with 8 μl of 2.5× RT reaction mixture (2.5×; 125 mM Tris [pH 8.0], 187.5 mM KCl, 15 mM MnCl2 , 25 mM dithiothreitol, 1.25 mM deoxynucleoside triphosphates [dNTPs]) and 1 μl of SuperScript II reverse transcriptase (200 U/μl; Thermo Fisher) for 42°C for 3 h. The RNA template was then hydrolyzed by adding 1 μl 2 N NaOH, followed by neutralization by addition of 1 μl 2 N HCl. .. The cDNA library was purified using G50 spin columns (GE Healthcare).

    Ligation:

    Article Title: Responses of unicellular predators to cope with the phototoxicity of photosynthetic prey
    Article Snippet: The cleaved RNA fragments were used for first-strand cDNA synthesis using SuperScript II Reverse Transcriptase (Invitrogen) and random primers. .. These cDNA fragments were then subjected to an end repair process and the ligation of adapters.

    Cell Culture:

    Article Title: Systematic Characterization of Stress-Induced RNA Granulation.
    Article Snippet: 7 × 105 cells were seeded in a 10-cm dish, followed by DMSO or thapsigargin (1 μM for 1.5 hr) treatment after 48 h. Cultured cells were washed twice with ice-cold 1x PBS and lysed in lysis buffer (20 mM Tris-Cl (pH7.4), 150 mM NaCl, 5 mM MgCl2 , 1 mM DTT, 100 μg/ml cycloheximide, 1% (v/v) Triton X-100, 25 U/ml Turbo DNase I) by triturating the cells ten times through a 26-gauge needle. .. After reverse transcription using Superscript II reverse transcriptase (Invitrogen), rRNA products were depleted by hybridization to biotinylated sense-strand oligonucleotides, followed by removal of the duplexes through streptavidin bead affinity.

    Article Title: Targeting Glutathione and Cystathionine β-Synthase in Ovarian Cancer Treatment by Selenium–Chrysin Polyurea Dendrimer Nanoformulation
    Article Snippet: Quantitative Real-Time PCR ES2 and OVCAR3 cells (2 × 105 cells/mL) were seeded in 12-well plates (1 mL/well) and cultured in control condition and exposed to cysteine (0.402 mM; 102839, Merck), carboplatin (0.025 mg/mL; IPO’s Pharmacy, Lisbon, Portugal), and cysteine combined with carboplatin. .. The complementary DNA (cDNA) synthesis from 1 µg of RNA was performed using SuperScript II Reverse Transcriptase (18080e44, Invitrogen, Waltham, MA, USA).

    Sedimentation:

    Article Title: Systematic Characterization of Stress-Induced RNA Granulation.
    Article Snippet: For the ribosome profiling library, lysates were treated with RNase I (100 U/μl) and incubated at room temperature for 45 min. After nuclease digestion, ribosome footprinted RNAs were purified by sedimentation through a 1 M sucrose cushion and excising the urea gel between 26–34 nucleotides. .. After reverse transcription using Superscript II reverse transcriptase (Invitrogen), rRNA products were depleted by hybridization to biotinylated sense-strand oligonucleotides, followed by removal of the duplexes through streptavidin bead affinity.

    Generated:

    Article Title: Systematic Characterization of Stress-Induced RNA Granulation.
    Article Snippet: After reverse transcription using Superscript II reverse transcriptase (Invitrogen), rRNA products were depleted by hybridization to biotinylated sense-strand oligonucleotides, followed by removal of the duplexes through streptavidin bead affinity. .. Finally, through PCR and gel extraction, the library was generated using the size range 150–160 bp.

    Gel Extraction:

    Article Title: Systematic Characterization of Stress-Induced RNA Granulation.
    Article Snippet: After reverse transcription using Superscript II reverse transcriptase (Invitrogen), rRNA products were depleted by hybridization to biotinylated sense-strand oligonucleotides, followed by removal of the duplexes through streptavidin bead affinity. .. Finally, through PCR and gel extraction, the library was generated using the size range 150–160 bp.

    Sequencing:

    Article Title: T-bet optimizes CD4 T-cell responses against influenza through CXCR3-dependent lung trafficking but not functional programming
    Article Snippet: 2.5 μg of RNA was reverse transcribed into cDNA using random hexamer primers and Superscript II Reverse Transcriptase (Invitrogen). .. Quantitative PCR was performed to amplify the polymerase (PA) gene of PR8 and A/Phil using an ABI Prism 7700 Sequence Detector (Applied Biosystems) with 50 ng of cDNA per reaction and the following primers and probe: forward primer, 5′-CGGTCCAAATTCCTGCTGA-3′; reverse primer, 5′CATTGGGTTCCTTCCATCCA-3′; probe, 5′-6-FAMCCAAGTCATGAAGGAGAGGGAATACCGCT-3′.

    Article Title: Evolution of the HIV-1 Rev Response Element during Natural Infection Reveals Nucleotide Changes That Correlate with Altered Structure and Increased Activity over Time
    Article Snippet: Reverse transcrip tion was performed by first annealing 2 μM RT oligonucleotide to the RNA in a reaction volume of 11 μl by incubation at 65°C for 5 min, followed by cooling on ice. cDNA synthesis was initiated by incubating the annealing mixture with 8 μl of 2.5× RT reaction mixture (2.5×; 125 mM Tris [pH 8.0], 187.5 mM KCl, 15 mM MnCl2 , 25 mM dithiothreitol, 1.25 mM deoxynucleoside triphosphates [dNTPs]) and 1 μl of SuperScript II reverse transcriptase (200 U/μl; Thermo Fisher) for 42°C for 3 h. The RNA template was then hydrolyzed by adding 1 μl 2 N NaOH, followed by neutralization by addition of 1 μl 2 N HCl. .. For mutational profiling, cDNA was converted to dsDNA with Illumina adapters for high-throughput sequencing on an Illumina platform.

    Article Title: Non-typeable Haemophilus influenzae isolates from patients with chronic obstructive pulmonary disease contain new phase-variable modA methyltransferase alleles controlling phasevarions
    Article Snippet: Briefly, RNA was fragmented, and randomly primed first strand cDNA synthesis carried out using SuperScript II Reverse Transcriptase (Invitrogen) according to manufacturer’s protocols. .. Following second-strand cDNA synthesis, fragments were adenylated at the 3′ end, and polyT containing sequencing adapters ligated.

    Binding Assay:

    Article Title: Interleukin-37 Inhibits Colon Carcinogensis During Chronic Colitis
    Article Snippet: RNA samples (1 μg) were reverse transcribed using SuperScript™ II Reverse Transcriptase (Invitrogen, Carlsbad, CA, USA). .. Fold changes of mRNA expression were calculated and normalized to TATA-box binding protein gene expression using the ΔΔCt-method.

    Marker:

    Article Title: C5aR agonist enhances phagocytosis of fibrillar and non-fibrillar Aβ amyloid and preserves memory in a mouse model of familial Alzheimer’s disease
    Article Snippet: The Invitrogen SuperScript™ II Reverse Transcriptase (18064–022) was used to synthesize first-strand cDNA according to the manufacturer’s instructions. .. TaqMan® Gene Expression Assays for mouse MCP-1 –monocyte chemoattractant protein-1 the main ligand of CCL2, which regulates both the migration and infiltration of monocyte/macrophages–, LY6C –marker denoting both macrophages and microglia–, CCR2 –chemokine receptor expressed on monocytes, microglia and T cells–and MIP-2a –chemotactic agent for polymorphonuclear leukocytes secreted by monocytes/macrophages–were then used, containing a pair of unlabelled PCR primers and a TaqMan® probe with a FAM™ dye label on the 5' end, and minor groove binder (MGB) non-fluorescent quencher (NFQ) on the 3' end.

    RNA Sequencing Assay:

    Article Title: Non-typeable Haemophilus influenzae isolates from patients with chronic obstructive pulmonary disease contain new phase-variable modA methyltransferase alleles controlling phasevarions
    Article Snippet: Paragraph title: RNA Seq analysis ... Briefly, RNA was fragmented, and randomly primed first strand cDNA synthesis carried out using SuperScript II Reverse Transcriptase (Invitrogen) according to manufacturer’s protocols.

    Article Title: Responses of unicellular predators to cope with the phototoxicity of photosynthetic prey
    Article Snippet: Paragraph title: RNA-seq analyses ... The cleaved RNA fragments were used for first-strand cDNA synthesis using SuperScript II Reverse Transcriptase (Invitrogen) and random primers.

    Fluorescence:

    Article Title: Transcriptome analysis reveals autophagy as regulator of TGFβ/Smad-induced fibrogenesis in trabecular meshwork cells
    Article Snippet: Quantitative real-time PCR qPCR was performed as described in previous studies . cDNA was synthesized from total RNA (1 µg) using oligo(dT) primer and Superscript II reverse transcriptase (Invitrogen, Carlsbad, CA). .. The following PCR parameters were used: 95 °C for 5 min, followed by 50 cycles of 95 °C for 15 s, 60 °C for 15 s, and 72 °C for 15 s. The fluorescence threshold value (Ct) was calculated using the iCycle iQ system software.

    Article Title: Inhibition of Inflammatory Signaling in Tet2 Mutant Preleukemic Cells Mitigates Stress Induced Abnormalities and Clonal Hematopoiesis
    Article Snippet: LSK cells were purified from Lin- negative BM cells by staining the cells with antibodies against c-Kit and Sca-1 followed by sorting them (Fluorescence-activated cell sorting (FACS) (BD FACSARIA). .. Isolated RNA was quantified by spectrophotometer and RNA concentrations were normalized. cDNA was synthesized by SuperScript II Reverse Transcriptase (ThermoFisher Scientific, Cat # 18064014).

    Isolation:

    Article Title: Systematic Characterization of Stress-Induced RNA Granulation.
    Article Snippet: After reverse transcription using Superscript II reverse transcriptase (Invitrogen), rRNA products were depleted by hybridization to biotinylated sense-strand oligonucleotides, followed by removal of the duplexes through streptavidin bead affinity. .. For the mRNA-seq library, poly(A) RNA was isolated using Dynabeads® mRNA purification kit (Ambion), according to the manufacturer’s protocol.

    Article Title: Interleukin-37 Inhibits Colon Carcinogensis During Chronic Colitis
    Article Snippet: Paragraph title: RNA Isolation and Quantification ... RNA samples (1 μg) were reverse transcribed using SuperScript™ II Reverse Transcriptase (Invitrogen, Carlsbad, CA, USA).

    Article Title: Arl13b Regulates Breast Cancer Cell Migration and Invasion by Controlling Integrin-Mediated Signaling
    Article Snippet: In the case of cell lines, total RNA was isolated using the RNeasy Mini Kit (QIAGEN, Hilden, Germany), according to the manufacturer’s instructions. .. RNA was used as template for cDNA synthesis using SuperScript II Reverse Transcriptase (Invitrogen), according to the manufacturer’s instructions.

    Article Title: Inhibition of Inflammatory Signaling in Tet2 Mutant Preleukemic Cells Mitigates Stress Induced Abnormalities and Clonal Hematopoiesis
    Article Snippet: .. Isolated RNA was quantified by spectrophotometer and RNA concentrations were normalized. cDNA was synthesized by SuperScript II Reverse Transcriptase (ThermoFisher Scientific, Cat # 18064014). .. Resulting cDNA was analyzed by SYBR Green master mix (Life Technologies, Cat # 4385612) with indicated primers on a ViiA7 Real-Time PCR instrument.

    Transfection:

    Article Title: Reduced DAXX Expression Is Associated with Reduced CD24 Expression in Colorectal Cancer
    Article Snippet: Paragraph title: 2.4. Transient Transfection and PCR ... RNA was then reverse transcribed to cDNA using oligo-dT 18 primers by using Superscript II reverse transcriptase (Invitrogen).

    Purification:

    Article Title: Systematic Characterization of Stress-Induced RNA Granulation.
    Article Snippet: For the ribosome profiling library, lysates were treated with RNase I (100 U/μl) and incubated at room temperature for 45 min. After nuclease digestion, ribosome footprinted RNAs were purified by sedimentation through a 1 M sucrose cushion and excising the urea gel between 26–34 nucleotides. .. After reverse transcription using Superscript II reverse transcriptase (Invitrogen), rRNA products were depleted by hybridization to biotinylated sense-strand oligonucleotides, followed by removal of the duplexes through streptavidin bead affinity.

    Article Title: Interleukin-37 Inhibits Colon Carcinogensis During Chronic Colitis
    Article Snippet: RNA samples (1 μg) were reverse transcribed using SuperScript™ II Reverse Transcriptase (Invitrogen, Carlsbad, CA, USA). .. Gene specific primers were designed using PrimerExpress and ordered from Eurofins MWG (Ebersberg, Germany) with purification grade HPLC. qRT-PCR reactions were performed in triplets in a 96-well format (BioRad iCycler).

    Article Title: Evolution of the HIV-1 Rev Response Element during Natural Infection Reveals Nucleotide Changes That Correlate with Altered Structure and Increased Activity over Time
    Article Snippet: Reverse transcrip tion was performed by first annealing 2 μM RT oligonucleotide to the RNA in a reaction volume of 11 μl by incubation at 65°C for 5 min, followed by cooling on ice. cDNA synthesis was initiated by incubating the annealing mixture with 8 μl of 2.5× RT reaction mixture (2.5×; 125 mM Tris [pH 8.0], 187.5 mM KCl, 15 mM MnCl2 , 25 mM dithiothreitol, 1.25 mM deoxynucleoside triphosphates [dNTPs]) and 1 μl of SuperScript II reverse transcriptase (200 U/μl; Thermo Fisher) for 42°C for 3 h. The RNA template was then hydrolyzed by adding 1 μl 2 N NaOH, followed by neutralization by addition of 1 μl 2 N HCl. .. The cDNA library was purified using G50 spin columns (GE Healthcare).

    Article Title: Chondroitin sulfate proteoglycans as novel drivers of leucocyte infiltration in multiple sclerosis
    Article Snippet: RNA was purified with RNeasy® Mini Kit columns (Cat: 74104, Qiagen) following the manufacturer’s instructions. .. RNA was reverse transcribed to cDNA using SuperScript™ II Reverse Transcriptase (Invitrogen).

    Article Title: Responses of unicellular predators to cope with the phototoxicity of photosynthetic prey
    Article Snippet: The purified mRNA was fragmented into small pieces using divalent cations under elevated temperature. .. The cleaved RNA fragments were used for first-strand cDNA synthesis using SuperScript II Reverse Transcriptase (Invitrogen) and random primers.

    Article Title: Inhibition of Inflammatory Signaling in Tet2 Mutant Preleukemic Cells Mitigates Stress Induced Abnormalities and Clonal Hematopoiesis
    Article Snippet: LSK cells were purified from Lin- negative BM cells by staining the cells with antibodies against c-Kit and Sca-1 followed by sorting them (Fluorescence-activated cell sorting (FACS) (BD FACSARIA). .. Isolated RNA was quantified by spectrophotometer and RNA concentrations were normalized. cDNA was synthesized by SuperScript II Reverse Transcriptase (ThermoFisher Scientific, Cat # 18064014).

    Polymerase Chain Reaction:

    Article Title: C5aR agonist enhances phagocytosis of fibrillar and non-fibrillar Aβ amyloid and preserves memory in a mouse model of familial Alzheimer’s disease
    Article Snippet: The Invitrogen SuperScript™ II Reverse Transcriptase (18064–022) was used to synthesize first-strand cDNA according to the manufacturer’s instructions. .. TaqMan® Gene Expression Assays for mouse MCP-1 –monocyte chemoattractant protein-1 the main ligand of CCL2, which regulates both the migration and infiltration of monocyte/macrophages–, LY6C –marker denoting both macrophages and microglia–, CCR2 –chemokine receptor expressed on monocytes, microglia and T cells–and MIP-2a –chemotactic agent for polymorphonuclear leukocytes secreted by monocytes/macrophages–were then used, containing a pair of unlabelled PCR primers and a TaqMan® probe with a FAM™ dye label on the 5' end, and minor groove binder (MGB) non-fluorescent quencher (NFQ) on the 3' end.

    Article Title: Systematic Characterization of Stress-Induced RNA Granulation.
    Article Snippet: After reverse transcription using Superscript II reverse transcriptase (Invitrogen), rRNA products were depleted by hybridization to biotinylated sense-strand oligonucleotides, followed by removal of the duplexes through streptavidin bead affinity. .. Finally, through PCR and gel extraction, the library was generated using the size range 150–160 bp.

    Article Title: Shenqi Jiangtang Granule Ameliorates Kidney Function by Inhibiting Apoptosis in a Diabetic Rat Model
    Article Snippet: Real-Time PCR Total RNA from the kidney cortex was used to synthesize cDNA using SuperScript II reverse transcriptase (Life Technologies, Carlsbad, CA). .. A SYBR Green Mix Kit (Applied Biosystems, Foster City, CA) and an ABI Prism 7500 Real-Time System (Applied Biosystems, Foster City, CA) were used for PCR.

    Article Title: Transcriptome analysis reveals autophagy as regulator of TGFβ/Smad-induced fibrogenesis in trabecular meshwork cells
    Article Snippet: Quantitative real-time PCR qPCR was performed as described in previous studies . cDNA was synthesized from total RNA (1 µg) using oligo(dT) primer and Superscript II reverse transcriptase (Invitrogen, Carlsbad, CA). .. The following PCR parameters were used: 95 °C for 5 min, followed by 50 cycles of 95 °C for 15 s, 60 °C for 15 s, and 72 °C for 15 s. The fluorescence threshold value (Ct) was calculated using the iCycle iQ system software.

    Article Title: Targeting Glutathione and Cystathionine β-Synthase in Ovarian Cancer Treatment by Selenium–Chrysin Polyurea Dendrimer Nanoformulation
    Article Snippet: The complementary DNA (cDNA) synthesis from 1 µg of RNA was performed using SuperScript II Reverse Transcriptase (18080e44, Invitrogen, Waltham, MA, USA). .. Quantitative real-time PCR was performed using SYBR Green PCR Master Mix (4309155, Applied Biosystems, Waltham, MA, USA), according to the manufacturer’s protocol.

    Article Title: Reduced DAXX Expression Is Associated with Reduced CD24 Expression in Colorectal Cancer
    Article Snippet: Paragraph title: 2.4. Transient Transfection and PCR ... RNA was then reverse transcribed to cDNA using oligo-dT 18 primers by using Superscript II reverse transcriptase (Invitrogen).

    Article Title: Chondroitin sulfate proteoglycans as novel drivers of leucocyte infiltration in multiple sclerosis
    Article Snippet: RNA was reverse transcribed to cDNA using SuperScript™ II Reverse Transcriptase (Invitrogen). .. Transcripts were quantified by real-time quantitative PCR on the iCycler (BioRad) using RT2 Real Time SYBR Green/Fluorescein PCR Master Mix (SA Biosciences).

    Article Title: The molecular landscape of glioma in patients with Neurofibromatosis 1
    Article Snippet: Total RNA was prepared using the AllPrep DNA/RNA/Protein Mini Kit (Qiagen) according to the manufacturer’s instructions, and cDNA was synthesized using SuperScript II Reverse Transcriptase (Invitrogen). .. RT-qPCR was performed with a 7500 Real Time PCR thermal cycler system (Applied Biosystems), using SYBR Green PCR Master Mix (Applied Biosystems).

    De-Phosphorylation Assay:

    Article Title: Systematic Characterization of Stress-Induced RNA Granulation.
    Article Snippet: After reverse transcription using Superscript II reverse transcriptase (Invitrogen), rRNA products were depleted by hybridization to biotinylated sense-strand oligonucleotides, followed by removal of the duplexes through streptavidin bead affinity. .. After RNA fragmentation with 1 N NaOH at 37°C for 3 min, the final library ranging from 150 to 200 bp was generated, followed by the same process for producing the ribosome profiling library from the step of 3’ dephosphorylation, excluding rRNA depletion.

    FACS:

    Article Title: Inhibition of Inflammatory Signaling in Tet2 Mutant Preleukemic Cells Mitigates Stress Induced Abnormalities and Clonal Hematopoiesis
    Article Snippet: LSK cells were purified from Lin- negative BM cells by staining the cells with antibodies against c-Kit and Sca-1 followed by sorting them (Fluorescence-activated cell sorting (FACS) (BD FACSARIA). .. Isolated RNA was quantified by spectrophotometer and RNA concentrations were normalized. cDNA was synthesized by SuperScript II Reverse Transcriptase (ThermoFisher Scientific, Cat # 18064014).

    cDNA Library Assay:

    Article Title: Evolution of the HIV-1 Rev Response Element during Natural Infection Reveals Nucleotide Changes That Correlate with Altered Structure and Increased Activity over Time
    Article Snippet: RNA from the 1M7 (+), 1M7 (−), and denatured control reaction mixtures was reverse transcribed using the corresponding oligonucleotides to generate a cDNA library (Table S1). .. Reverse transcrip tion was performed by first annealing 2 μM RT oligonucleotide to the RNA in a reaction volume of 11 μl by incubation at 65°C for 5 min, followed by cooling on ice. cDNA synthesis was initiated by incubating the annealing mixture with 8 μl of 2.5× RT reaction mixture (2.5×; 125 mM Tris [pH 8.0], 187.5 mM KCl, 15 mM MnCl2 , 25 mM dithiothreitol, 1.25 mM deoxynucleoside triphosphates [dNTPs]) and 1 μl of SuperScript II reverse transcriptase (200 U/μl; Thermo Fisher) for 42°C for 3 h. The RNA template was then hydrolyzed by adding 1 μl 2 N NaOH, followed by neutralization by addition of 1 μl 2 N HCl.

    Chromatin Immunoprecipitation:

    Article Title: Non-typeable Haemophilus influenzae isolates from patients with chronic obstructive pulmonary disease contain new phase-variable modA methyltransferase alleles controlling phasevarions
    Article Snippet: Briefly, RNA was fragmented, and randomly primed first strand cDNA synthesis carried out using SuperScript II Reverse Transcriptase (Invitrogen) according to manufacturer’s protocols. .. Library quality was assessed using an Agilent Bioanalyser DNA 1000 chip. qPCR quantification was used to assess individual libraries before normalizing (2 nM) and pooling using the Illumina cBot system with TruSeq PE Cluster Kit v3 reagents.

    Plasmid Preparation:

    Article Title: T-bet optimizes CD4 T-cell responses against influenza through CXCR3-dependent lung trafficking but not functional programming
    Article Snippet: 2.5 μg of RNA was reverse transcribed into cDNA using random hexamer primers and Superscript II Reverse Transcriptase (Invitrogen). .. The copy number of the PA gene per 50 ng of cDNA was calculated using a PA-containing plasmid of known concentration as a standard.

    Software:

    Article Title: Transcriptome analysis reveals autophagy as regulator of TGFβ/Smad-induced fibrogenesis in trabecular meshwork cells
    Article Snippet: Quantitative real-time PCR qPCR was performed as described in previous studies . cDNA was synthesized from total RNA (1 µg) using oligo(dT) primer and Superscript II reverse transcriptase (Invitrogen, Carlsbad, CA). .. The following PCR parameters were used: 95 °C for 5 min, followed by 50 cycles of 95 °C for 15 s, 60 °C for 15 s, and 72 °C for 15 s. The fluorescence threshold value (Ct) was calculated using the iCycle iQ system software.

    SYBR Green Assay:

    Article Title: Shenqi Jiangtang Granule Ameliorates Kidney Function by Inhibiting Apoptosis in a Diabetic Rat Model
    Article Snippet: Real-Time PCR Total RNA from the kidney cortex was used to synthesize cDNA using SuperScript II reverse transcriptase (Life Technologies, Carlsbad, CA). .. A SYBR Green Mix Kit (Applied Biosystems, Foster City, CA) and an ABI Prism 7500 Real-Time System (Applied Biosystems, Foster City, CA) were used for PCR.

    Article Title: Transcriptome analysis reveals autophagy as regulator of TGFβ/Smad-induced fibrogenesis in trabecular meshwork cells
    Article Snippet: Quantitative real-time PCR qPCR was performed as described in previous studies . cDNA was synthesized from total RNA (1 µg) using oligo(dT) primer and Superscript II reverse transcriptase (Invitrogen, Carlsbad, CA). .. Real-time PCRs were performed in a 20 µL mix reaction [1 µL of cDNA (1:5 dilution), 10 µL iQ SYBR Green Supermix (Bio-Rad, Hercules, CA), 500 nm of each primer], in the BIO-RAD iCycler iQ system (Bio-Rad, Hercules, CA).

    Article Title: Interleukin-37 Inhibits Colon Carcinogensis During Chronic Colitis
    Article Snippet: RNA samples (1 μg) were reverse transcribed using SuperScript™ II Reverse Transcriptase (Invitrogen, Carlsbad, CA, USA). .. Gene expression levels were measured by quantitative PCR (SYBR Green Supermix, Biorad).

    Article Title: The molecular landscape of glioma in patients with Neurofibromatosis 1
    Article Snippet: Total RNA was prepared using the AllPrep DNA/RNA/Protein Mini Kit (Qiagen) according to the manufacturer’s instructions, and cDNA was synthesized using SuperScript II Reverse Transcriptase (Invitrogen). .. RT-qPCR was performed with a 7500 Real Time PCR thermal cycler system (Applied Biosystems), using SYBR Green PCR Master Mix (Applied Biosystems).

    Article Title: Inhibition of Inflammatory Signaling in Tet2 Mutant Preleukemic Cells Mitigates Stress Induced Abnormalities and Clonal Hematopoiesis
    Article Snippet: Isolated RNA was quantified by spectrophotometer and RNA concentrations were normalized. cDNA was synthesized by SuperScript II Reverse Transcriptase (ThermoFisher Scientific, Cat # 18064014). .. Resulting cDNA was analyzed by SYBR Green master mix (Life Technologies, Cat # 4385612) with indicated primers on a ViiA7 Real-Time PCR instrument.

    RNA Extraction:

    Article Title: Targeting Glutathione and Cystathionine β-Synthase in Ovarian Cancer Treatment by Selenium–Chrysin Polyurea Dendrimer Nanoformulation
    Article Snippet: Prior to the addition of the experimental conditions, cells were synchronized under starvation (culture medium without FBS) for 8 h. The cells were collected after 16 h of experimental conditions, and RNA extraction was executed using RNeasy Mini Extraction kit (74,104, Qiagen, Hilden, Germany). .. The complementary DNA (cDNA) synthesis from 1 µg of RNA was performed using SuperScript II Reverse Transcriptase (18080e44, Invitrogen, Waltham, MA, USA).

    Article Title: Arl13b Regulates Breast Cancer Cell Migration and Invasion by Controlling Integrin-Mediated Signaling
    Article Snippet: Paragraph title: 4.3. RNA Extraction, cDNA Synthesis and Real-Time Quantitative PCR ... RNA was used as template for cDNA synthesis using SuperScript II Reverse Transcriptase (Invitrogen), according to the manufacturer’s instructions.

    Electrophoresis:

    Article Title: Transcriptome analysis reveals autophagy as regulator of TGFβ/Smad-induced fibrogenesis in trabecular meshwork cells
    Article Snippet: Quantitative real-time PCR qPCR was performed as described in previous studies . cDNA was synthesized from total RNA (1 µg) using oligo(dT) primer and Superscript II reverse transcriptase (Invitrogen, Carlsbad, CA). .. The absence of nonspecific products was confirmed by analysis of the melt curves and electrophoresis in agarose gels.

    Quantitation Assay:

    Article Title: T-bet optimizes CD4 T-cell responses against influenza through CXCR3-dependent lung trafficking but not functional programming
    Article Snippet: Viral titers were determined by quantitation of viral RNA prepared from whole lung homogenates using TRIzol (Sigma-Aldrich). .. 2.5 μg of RNA was reverse transcribed into cDNA using random hexamer primers and Superscript II Reverse Transcriptase (Invitrogen).

    Spectrophotometry:

    Article Title: Chondroitin sulfate proteoglycans as novel drivers of leucocyte infiltration in multiple sclerosis
    Article Snippet: A spectrophotometer assessed RNA for concentration and quality by measuring optical density at wavelengths 260 and 280 nm. .. RNA was reverse transcribed to cDNA using SuperScript™ II Reverse Transcriptase (Invitrogen).

    Article Title: Inhibition of Inflammatory Signaling in Tet2 Mutant Preleukemic Cells Mitigates Stress Induced Abnormalities and Clonal Hematopoiesis
    Article Snippet: .. Isolated RNA was quantified by spectrophotometer and RNA concentrations were normalized. cDNA was synthesized by SuperScript II Reverse Transcriptase (ThermoFisher Scientific, Cat # 18064014). .. Resulting cDNA was analyzed by SYBR Green master mix (Life Technologies, Cat # 4385612) with indicated primers on a ViiA7 Real-Time PCR instrument.

    Concentration Assay:

    Article Title: C5aR agonist enhances phagocytosis of fibrillar and non-fibrillar Aβ amyloid and preserves memory in a mouse model of familial Alzheimer’s disease
    Article Snippet: RNA concentration was assessed by Nanodrop2000 and maximum 100ng/μl was used for cDNA synthesis. .. The Invitrogen SuperScript™ II Reverse Transcriptase (18064–022) was used to synthesize first-strand cDNA according to the manufacturer’s instructions.

    Article Title: T-bet optimizes CD4 T-cell responses against influenza through CXCR3-dependent lung trafficking but not functional programming
    Article Snippet: 2.5 μg of RNA was reverse transcribed into cDNA using random hexamer primers and Superscript II Reverse Transcriptase (Invitrogen). .. The copy number of the PA gene per 50 ng of cDNA was calculated using a PA-containing plasmid of known concentration as a standard.

    Article Title: Chondroitin sulfate proteoglycans as novel drivers of leucocyte infiltration in multiple sclerosis
    Article Snippet: A spectrophotometer assessed RNA for concentration and quality by measuring optical density at wavelengths 260 and 280 nm. .. RNA was reverse transcribed to cDNA using SuperScript™ II Reverse Transcriptase (Invitrogen).

    Migration:

    Article Title: C5aR agonist enhances phagocytosis of fibrillar and non-fibrillar Aβ amyloid and preserves memory in a mouse model of familial Alzheimer’s disease
    Article Snippet: The Invitrogen SuperScript™ II Reverse Transcriptase (18064–022) was used to synthesize first-strand cDNA according to the manufacturer’s instructions. .. TaqMan® Gene Expression Assays for mouse MCP-1 –monocyte chemoattractant protein-1 the main ligand of CCL2, which regulates both the migration and infiltration of monocyte/macrophages–, LY6C –marker denoting both macrophages and microglia–, CCR2 –chemokine receptor expressed on monocytes, microglia and T cells–and MIP-2a –chemotactic agent for polymorphonuclear leukocytes secreted by monocytes/macrophages–were then used, containing a pair of unlabelled PCR primers and a TaqMan® probe with a FAM™ dye label on the 5' end, and minor groove binder (MGB) non-fluorescent quencher (NFQ) on the 3' end.

    Lysis:

    Article Title: Systematic Characterization of Stress-Induced RNA Granulation.
    Article Snippet: 7 × 105 cells were seeded in a 10-cm dish, followed by DMSO or thapsigargin (1 μM for 1.5 hr) treatment after 48 h. Cultured cells were washed twice with ice-cold 1x PBS and lysed in lysis buffer (20 mM Tris-Cl (pH7.4), 150 mM NaCl, 5 mM MgCl2 , 1 mM DTT, 100 μg/ml cycloheximide, 1% (v/v) Triton X-100, 25 U/ml Turbo DNase I) by triturating the cells ten times through a 26-gauge needle. .. After reverse transcription using Superscript II reverse transcriptase (Invitrogen), rRNA products were depleted by hybridization to biotinylated sense-strand oligonucleotides, followed by removal of the duplexes through streptavidin bead affinity.

    High Throughput Screening Assay:

    Article Title: Evolution of the HIV-1 Rev Response Element during Natural Infection Reveals Nucleotide Changes That Correlate with Altered Structure and Increased Activity over Time
    Article Snippet: Reverse transcrip tion was performed by first annealing 2 μM RT oligonucleotide to the RNA in a reaction volume of 11 μl by incubation at 65°C for 5 min, followed by cooling on ice. cDNA synthesis was initiated by incubating the annealing mixture with 8 μl of 2.5× RT reaction mixture (2.5×; 125 mM Tris [pH 8.0], 187.5 mM KCl, 15 mM MnCl2 , 25 mM dithiothreitol, 1.25 mM deoxynucleoside triphosphates [dNTPs]) and 1 μl of SuperScript II reverse transcriptase (200 U/μl; Thermo Fisher) for 42°C for 3 h. The RNA template was then hydrolyzed by adding 1 μl 2 N NaOH, followed by neutralization by addition of 1 μl 2 N HCl. .. For mutational profiling, cDNA was converted to dsDNA with Illumina adapters for high-throughput sequencing on an Illumina platform.

    Staining:

    Article Title: Inhibition of Inflammatory Signaling in Tet2 Mutant Preleukemic Cells Mitigates Stress Induced Abnormalities and Clonal Hematopoiesis
    Article Snippet: LSK cells were purified from Lin- negative BM cells by staining the cells with antibodies against c-Kit and Sca-1 followed by sorting them (Fluorescence-activated cell sorting (FACS) (BD FACSARIA). .. Isolated RNA was quantified by spectrophotometer and RNA concentrations were normalized. cDNA was synthesized by SuperScript II Reverse Transcriptase (ThermoFisher Scientific, Cat # 18064014).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Thermo Fisher superscript ii reverse transcriptase
    Superscript Ii Reverse Transcriptase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 805 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript ii reverse transcriptase/product/Thermo Fisher
    Average 90 stars, based on 805 article reviews
    Price from $9.99 to $1999.99
    superscript ii reverse transcriptase - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    Image Search Results