superscript ii reverse transcriptase  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    SuperScript IV VILO Master Mix
    Description:
    SuperScript IV VILO SSIV VILO Master Mix is a reaction master mix designed for fast sensitive and reproducible cDNA synthesis in RT qPCR applications Features of SuperScript IV VILO Master Mix include • Super fast RT reactions in just 10 minutes • Super high yields lower Ct values by more than 2 cycles ahead of all other reverse transcription reagents • Super convenient one tube cDNA reaction master mix for two step RT qPCR • Super efficient reaction even with low template amounts and suboptimal purity samples SSIV VILO master mix elevates the trusted VILO technology to the next level with the highly processive and thermostable SuperScript IV Reverse Transcriptase and further optimized buffer These components enable efficient cDNA synthesis at higher temperatures and in less time SSIV VILO master mix provides superior cDNA yield and sensitivity even with suboptimal purity or scarce templates It is your new tool for more efficient and reproducible RT qPCR For even better performance we also offer SuperScript IV VILO Master Mix with ezDNase The ezDNase further accelerates the RT qPCR workflow through an extremely simplified genomic DNA removal step This dramatically reduces the time of the entire reverse transcription protocol and reduces possible variation in gene expression due to RNA loss or damage during conventional DNase treatment SSIV VILO master mix gives you more cDNA in less time with less pipeting less variation less reaction inhibition less gDNA interference and with less sample than all the other cDNA synthesis kits or master mixes for RT qPCR Source Purified from E coli expressing the pol gene of M MLV modified to increase thermostability and half life processivity inhibitor resistance and to reduce RNase H activity Performance and quality testing Assayed for endodeoxyribonuclease exodeoxyribonuclease and ribonuclease as well as yield and length of cDNA product
    Catalog Number:
    11756050
    Price:
    None
    Applications:
    PCR & Real-Time PCR|RT-PCR|Reverse Transcription|Two-Step RT-PCR
    Category:
    Proteins Enzymes Peptides
    Buy from Supplier


    Structured Review

    Thermo Fisher superscript ii reverse transcriptase
    SuperScript IV VILO SSIV VILO Master Mix is a reaction master mix designed for fast sensitive and reproducible cDNA synthesis in RT qPCR applications Features of SuperScript IV VILO Master Mix include • Super fast RT reactions in just 10 minutes • Super high yields lower Ct values by more than 2 cycles ahead of all other reverse transcription reagents • Super convenient one tube cDNA reaction master mix for two step RT qPCR • Super efficient reaction even with low template amounts and suboptimal purity samples SSIV VILO master mix elevates the trusted VILO technology to the next level with the highly processive and thermostable SuperScript IV Reverse Transcriptase and further optimized buffer These components enable efficient cDNA synthesis at higher temperatures and in less time SSIV VILO master mix provides superior cDNA yield and sensitivity even with suboptimal purity or scarce templates It is your new tool for more efficient and reproducible RT qPCR For even better performance we also offer SuperScript IV VILO Master Mix with ezDNase The ezDNase further accelerates the RT qPCR workflow through an extremely simplified genomic DNA removal step This dramatically reduces the time of the entire reverse transcription protocol and reduces possible variation in gene expression due to RNA loss or damage during conventional DNase treatment SSIV VILO master mix gives you more cDNA in less time with less pipeting less variation less reaction inhibition less gDNA interference and with less sample than all the other cDNA synthesis kits or master mixes for RT qPCR Source Purified from E coli expressing the pol gene of M MLV modified to increase thermostability and half life processivity inhibitor resistance and to reduce RNase H activity Performance and quality testing Assayed for endodeoxyribonuclease exodeoxyribonuclease and ribonuclease as well as yield and length of cDNA product
    https://www.bioz.com/result/superscript ii reverse transcriptase/product/Thermo Fisher
    Average 99 stars, based on 4171 article reviews
    Price from $9.99 to $1999.99
    superscript ii reverse transcriptase - by Bioz Stars, 2020-07
    99/100 stars

    Images

    Related Articles

    SYBR Green Assay:

    Article Title: miR-182 and miR-183 Promote Cell Proliferation and Invasion by Targeting FOXO1 in Mesothelioma
    Article Snippet: .. A total of 200 ng of RNA was reverse-transcribed with SuperScript IV VILO Master Mix (Thermo Fisher Scientific) and amplified with PowerUp SYBR Green Master Mix (Thermo Fisher Scientific) on a Mx3000P real-time PCR system (Stratagene, La Jolla, CA, USA). .. Relative expression levels were calculated following the comparative CT (ΔΔCT) method.

    Amplification:

    Article Title: miR-182 and miR-183 Promote Cell Proliferation and Invasion by Targeting FOXO1 in Mesothelioma
    Article Snippet: .. A total of 200 ng of RNA was reverse-transcribed with SuperScript IV VILO Master Mix (Thermo Fisher Scientific) and amplified with PowerUp SYBR Green Master Mix (Thermo Fisher Scientific) on a Mx3000P real-time PCR system (Stratagene, La Jolla, CA, USA). .. Relative expression levels were calculated following the comparative CT (ΔΔCT) method.

    Synthesized:

    Article Title: Analysis of Yellow Striped Mutants of Zea mays Reveals Novel Loci Contributing to Iron Deficiency Chlorosis
    Article Snippet: .. Total RNA was extracted using QIAGENR® Neasy Plant Mini Kit (QIAGEN, Valencia, CA, United States), and on-column DNAse treatment step was included for all samples. cDNA was synthesized from 750 ng of total RNA using SuperScript IV VILO (Life Technologies, Carlsbad, CA, United States). .. For real-time PCR (RT-PCR) analysis, Quantprime primer design webtool ( ) was used to design ZmTOM1 primers.

    Isolation:

    Article Title: Legionella pneumophila translocated translation inhibitors are required for bacterial-induced host cell cycle arrest
    Article Snippet: .. RNA was isolated by using the RNeasy kit, and cDNA synthesis was performed by using SuperScript IV VILO Master Mix (Invitrogen). .. Transcripts were measured by using SYBR green (Applied Biosystems) from cDNA templates using the following primer pairs: Ccnd1 (5′ TGCCGAGAAGTTGTGCATCTA and 3′ ACCTTGACGAAGACCACTTGT), Ccne1 (5′ CTGTGAAAAGCGAGGATAGCA and 3′ AAAGTAGGGGTGGGGATTGT), Il6 (5′ CGATGATGCACTTGCAGAAA and 3′ AAGGAGACCAGAAGACCTCA), Egr1 (5′ ACAACCCTATGAGCACCTGAC and 3′ CCTCTGCTCAATAGGGTCGG), and Gapdh (5′ CAAGGTCATCCCAGAGCTGAA and 3′ ACACAGGCAGCACCTAGAC).

    Quantitative RT-PCR:

    Article Title: Guanylin, Uroguanylin and Guanylate Cyclase-C Are Expressed in the Gastrointestinal Tract of Horses
    Article Snippet: .. qRT-PCR Assays Total RNA (1 μg) of each sample was retrotranscripted using SuperScript® IV Vilo Master Mix (Thermo Fisher Scientific, Rodano, Italy) according to the manufacturer’s specifications. ..

    Real-time Polymerase Chain Reaction:

    Article Title: miR-182 and miR-183 Promote Cell Proliferation and Invasion by Targeting FOXO1 in Mesothelioma
    Article Snippet: .. A total of 200 ng of RNA was reverse-transcribed with SuperScript IV VILO Master Mix (Thermo Fisher Scientific) and amplified with PowerUp SYBR Green Master Mix (Thermo Fisher Scientific) on a Mx3000P real-time PCR system (Stratagene, La Jolla, CA, USA). .. Relative expression levels were calculated following the comparative CT (ΔΔCT) method.

    Concentration Assay:

    Article Title: A transient DMSO treatment increases the differentiation potential of human pluripotent stem cells through the Rb family
    Article Snippet: .. After determining the concentration and purity of RNA by the NanoDrop spectrophotometer, reverse transcription was conducted using SuperScript IV VILO Master Mix with ezDNase (Thermo Fisher) to synthesize cDNA. .. Quantitative RT-PCR was performed using the SYBR green system.

    Spectrophotometry:

    Article Title: A transient DMSO treatment increases the differentiation potential of human pluripotent stem cells through the Rb family
    Article Snippet: .. After determining the concentration and purity of RNA by the NanoDrop spectrophotometer, reverse transcription was conducted using SuperScript IV VILO Master Mix with ezDNase (Thermo Fisher) to synthesize cDNA. .. Quantitative RT-PCR was performed using the SYBR green system.

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Evidence for excessive osteoclast activation in SIRT6 null mice
    Article Snippet: .. Total mRNA was extracted with TRIzol reagent (Cat15596018, Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol. mRNA was treated with DNase and then used for first-strand cDNA synthesis via oligo (dT) primer and SuperScript II reverse transcriptase (Cat#11756050, Invitrogen, Carlsbad, CA, USA). .. Quantitative real-time PCR was performed in quadruplicate by using SYBR Green Supermix on the Real-Time Detection System (Bio-Rad Laboratories, Hercules, CA, USA).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher dnase i
    Influence of Eap on DNA stability. (A) DNase activities of different Eap (3 μg/ml) preparations. Eap samples were purified from strain Newman (New), its nuc1 nuc2 derivative (M0746N1), or as a recombinant protein from E. coli (rMu50). DNase activity was quantified by ELISA (given in optical density (OD) readings at 450 nm). PCR grade water and <t>DNase</t> I (12.5 mKuU) served as negative and positive controls, respectively. OD 450 nm readings were normalized in relation to the values obtained for the negative controls, which were set to 100%. Data represent the mean ± SD of four to six independent experiments. ** P
    Dnase I, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 44 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dnase i/product/Thermo Fisher
    Average 99 stars, based on 44 article reviews
    Price from $9.99 to $1999.99
    dnase i - by Bioz Stars, 2020-07
    99/100 stars
      Buy from Supplier

    95
    Thermo Fisher superscript ii reverse transcriptase
    Influence of Eap on DNA stability. (A) DNase activities of different Eap (3 μg/ml) preparations. Eap samples were purified from strain Newman (New), its nuc1 nuc2 derivative (M0746N1), or as a recombinant protein from E. coli (rMu50). DNase activity was quantified by ELISA (given in optical density (OD) readings at 450 nm). PCR grade water and <t>DNase</t> I (12.5 mKuU) served as negative and positive controls, respectively. OD 450 nm readings were normalized in relation to the values obtained for the negative controls, which were set to 100%. Data represent the mean ± SD of four to six independent experiments. ** P
    Superscript Ii Reverse Transcriptase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 95/100, based on 4171 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript ii reverse transcriptase/product/Thermo Fisher
    Average 95 stars, based on 4171 article reviews
    Price from $9.99 to $1999.99
    superscript ii reverse transcriptase - by Bioz Stars, 2020-07
    95/100 stars
      Buy from Supplier

    Image Search Results


    Influence of Eap on DNA stability. (A) DNase activities of different Eap (3 μg/ml) preparations. Eap samples were purified from strain Newman (New), its nuc1 nuc2 derivative (M0746N1), or as a recombinant protein from E. coli (rMu50). DNase activity was quantified by ELISA (given in optical density (OD) readings at 450 nm). PCR grade water and DNase I (12.5 mKuU) served as negative and positive controls, respectively. OD 450 nm readings were normalized in relation to the values obtained for the negative controls, which were set to 100%. Data represent the mean ± SD of four to six independent experiments. ** P

    Journal: Frontiers in Cellular and Infection Microbiology

    Article Title: The Staphylococcus aureus Extracellular Adherence Protein Eap Is a DNA Binding Protein Capable of Blocking Neutrophil Extracellular Trap Formation

    doi: 10.3389/fcimb.2018.00235

    Figure Lengend Snippet: Influence of Eap on DNA stability. (A) DNase activities of different Eap (3 μg/ml) preparations. Eap samples were purified from strain Newman (New), its nuc1 nuc2 derivative (M0746N1), or as a recombinant protein from E. coli (rMu50). DNase activity was quantified by ELISA (given in optical density (OD) readings at 450 nm). PCR grade water and DNase I (12.5 mKuU) served as negative and positive controls, respectively. OD 450 nm readings were normalized in relation to the values obtained for the negative controls, which were set to 100%. Data represent the mean ± SD of four to six independent experiments. ** P

    Article Snippet: Subsequently, cells were challenged with increasing concentrations of Eap (0, 1, 2.5, and 10 μg/ml) or DNase I (10 U/ml; Thermo Fisher), and incubated for 3 h at 37°C in presence of 5% CO2 .

    Techniques: Purification, Recombinant, Activity Assay, Enzyme-linked Immunosorbent Assay, Polymerase Chain Reaction

    TLR9 signalling pathway, miR‐7 and Smad2 expressions in NET‐treated LFs. LFs were divided into control group, PMA group and PMA+DNase I group. A, Western blot assay showed that TLR9 protein level and phosphorylation levels of its downstream molecules p38, AKT and p65 were up‐regulated in PMA group, whereas PMA+DNase I decreased these expressions. B, miR‐7 expression level was down‐regulated in PMA group, whereas PMA+DNase I increased miR‐7 expression. C, Smad2 protein level was up‐regulated in PMA group, whereas PMA+DNase I inhibited Smad2 expression. ** P

    Journal: Journal of Cellular and Molecular Medicine

    Article Title: Neutrophil extracellular traps activate lung fibroblast to induce polymyositis‐related interstitial lung diseases via TLR9‐miR‐7‐Smad2 pathway, et al. Neutrophil extracellular traps activate lung fibroblast to induce polymyositis‐related interstitial lung diseases via TLR9‐miR‐7‐Smad2 pathway

    doi: 10.1111/jcmm.14858

    Figure Lengend Snippet: TLR9 signalling pathway, miR‐7 and Smad2 expressions in NET‐treated LFs. LFs were divided into control group, PMA group and PMA+DNase I group. A, Western blot assay showed that TLR9 protein level and phosphorylation levels of its downstream molecules p38, AKT and p65 were up‐regulated in PMA group, whereas PMA+DNase I decreased these expressions. B, miR‐7 expression level was down‐regulated in PMA group, whereas PMA+DNase I increased miR‐7 expression. C, Smad2 protein level was up‐regulated in PMA group, whereas PMA+DNase I inhibited Smad2 expression. ** P

    Article Snippet: In PMA+DNase I group, the LFs were cultivated by PMA‐stimulated NETs pre‐treated with DNase I (10 U/mL, Thermo Scientific) in 37°C for 30 minutes.

    Techniques: Western Blot, Expressing

    NETs accelerated the proliferation of LF and their differentiation into MF. LFs were divided into control group, PMA group and PMA+DNase I group. A, SYTOX Green nucleic acid stain showed that the nuclear membrane was fractured and DNA was released in PMA‐treated NET. B, qRT‐PCR assay detected mRNA levels of ACTA2 (α‐SMA gene), CCN2 (connective tissue growth factor) and ADAM12 (ADAM metallopeptidase domain 12) in control, PMA and PMA+DNase I groups. C, Western blot assay detected protein levels of α‐SMA and CCN2 in control, PMA and PMA+DNase I groups. D, PMA‐stimulated NET promoted the formation of collagen in LF, whereas the formation of collagen was reduced by DNase I. E‐F, The proliferation of LF was detected by MTT assay. G, The proliferation of LF was also detected by EdU experiment. H, The apoptosis of LF was detected by flow cytometry analysis. ** P

    Journal: Journal of Cellular and Molecular Medicine

    Article Title: Neutrophil extracellular traps activate lung fibroblast to induce polymyositis‐related interstitial lung diseases via TLR9‐miR‐7‐Smad2 pathway, et al. Neutrophil extracellular traps activate lung fibroblast to induce polymyositis‐related interstitial lung diseases via TLR9‐miR‐7‐Smad2 pathway

    doi: 10.1111/jcmm.14858

    Figure Lengend Snippet: NETs accelerated the proliferation of LF and their differentiation into MF. LFs were divided into control group, PMA group and PMA+DNase I group. A, SYTOX Green nucleic acid stain showed that the nuclear membrane was fractured and DNA was released in PMA‐treated NET. B, qRT‐PCR assay detected mRNA levels of ACTA2 (α‐SMA gene), CCN2 (connective tissue growth factor) and ADAM12 (ADAM metallopeptidase domain 12) in control, PMA and PMA+DNase I groups. C, Western blot assay detected protein levels of α‐SMA and CCN2 in control, PMA and PMA+DNase I groups. D, PMA‐stimulated NET promoted the formation of collagen in LF, whereas the formation of collagen was reduced by DNase I. E‐F, The proliferation of LF was detected by MTT assay. G, The proliferation of LF was also detected by EdU experiment. H, The apoptosis of LF was detected by flow cytometry analysis. ** P

    Article Snippet: In PMA+DNase I group, the LFs were cultivated by PMA‐stimulated NETs pre‐treated with DNase I (10 U/mL, Thermo Scientific) in 37°C for 30 minutes.

    Techniques: Staining, Quantitative RT-PCR, Western Blot, MTT Assay, Flow Cytometry

    Influence of Eap on DNA stability. (A) DNase activities of different Eap (3 μg/ml) preparations. Eap samples were purified from strain Newman (New), its nuc1 nuc2 derivative (M0746N1), or as a recombinant protein from E. coli (rMu50). DNase activity was quantified by ELISA (given in optical density (OD) readings at 450 nm). PCR grade water and DNase I (12.5 mKuU) served as negative and positive controls, respectively. OD 450 nm readings were normalized in relation to the values obtained for the negative controls, which were set to 100%. Data represent the mean ± SD of four to six independent experiments. ** P

    Journal: Frontiers in Cellular and Infection Microbiology

    Article Title: The Staphylococcus aureus Extracellular Adherence Protein Eap Is a DNA Binding Protein Capable of Blocking Neutrophil Extracellular Trap Formation

    doi: 10.3389/fcimb.2018.00235

    Figure Lengend Snippet: Influence of Eap on DNA stability. (A) DNase activities of different Eap (3 μg/ml) preparations. Eap samples were purified from strain Newman (New), its nuc1 nuc2 derivative (M0746N1), or as a recombinant protein from E. coli (rMu50). DNase activity was quantified by ELISA (given in optical density (OD) readings at 450 nm). PCR grade water and DNase I (12.5 mKuU) served as negative and positive controls, respectively. OD 450 nm readings were normalized in relation to the values obtained for the negative controls, which were set to 100%. Data represent the mean ± SD of four to six independent experiments. ** P

    Article Snippet: Subsequently, cells were challenged with increasing concentrations of Eap (0, 1, 2.5, and 10 μg/ml) or DNase I (10 U/ml; Thermo Fisher), and incubated for 3 h at 37°C in presence of 5% CO2 .

    Techniques: Purification, Recombinant, Activity Assay, Enzyme-linked Immunosorbent Assay, Polymerase Chain Reaction