streptavidin horseradish peroxidase conjugate  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Thermo Fisher streptavidin horseradish peroxidase conjugate
    pADPr disrupts Hrp38 binding to 5′UTR of DE-cadherin conferring IRES activity (a) The mRNA expression level of DE-cadherin in the different genotypes at the wandering third-instar larvae stage. (b) The protein expression level of DE-cadherin in the different genotypes at the wandering third-instar larvae stage. (c) The structure of DE-cadherin transcript. The biotin-labeled probes were made from three regions (5′UTR, coding region and 3′UTR). (d) Hrp38 binding to 5′UTR of DE-cadherin in the ovary is shown by UV-crosslinking analysis. The ovarian lysate from the wild-type fly ( y,w) crosslinked to the biotin-labeled RNA probes as indicated was IPed with rabbit anti-Hrp38 antibody or normal rabbit IgG as the control for IP. The supernatant (S/N), which was obtained after each IP, was run in the same blot to show the efficiency of RNase treatment. (e) Decreased amounts of Hrp38 protein binding to 5′UTR of DE-cadherin in the Parg mutant. In (d,e) Hrp38 protein binding to biotin-labeled RNA probe was detected with <t>Streptavidin.</t> The same blot was stripped and probed with anti-Hrp38 antibody to show IP efficiency. (f) Inhibition of Hrp38 binding to its target RNA motif by poly(ADP-ribose). The biotin-labeled G-rich RNA element ( CAGGGCGCGCACUGUACGAG) within 5′UTR of DE-cadherin was incubated with the components as indicated. (g) Diagrams of the different constructs for dual luciferase assay. pNO-IRES (negtative control); pPolio-IRES (positive control); pDEcad 5′UTR: DE-cadherin 5′UTR cloned into the vector in the forward orientation. pDEcad 5′UTR-reverse (spacer control); pDEcad-3′UTR (element control). (h) The ratio of firefly-to-renilla luciferase activity after the transfection of the different constructs as indicated into Drosophila S2 cells. (i–j) The association of Hrp38 with the transcript from pDEcad 5′UTR-luciferase construct shown by regular RT-PCR ( i ) and qRT-PCR ( j ) after RNA-IP. RNA IP was done using anti-Hrp38 antibody or rabbit IgG as a control after the transfection of pDEcad-5′UTR construct into S2 cells. The error bars in (h,j) represents the standard deviation from three independent experiments. ** P ≤ 0.01, analyzed by t -test.
    Streptavidin Horseradish Peroxidase Conjugate, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 122 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/streptavidin horseradish peroxidase conjugate/product/Thermo Fisher
    Average 99 stars, based on 122 article reviews
    Price from $9.99 to $1999.99
    streptavidin horseradish peroxidase conjugate - by Bioz Stars, 2020-03
    99/100 stars

    Images

    1) Product Images from "Poly(ADP-ribose) controls DE-cadherin-dependent stem cell maintenance and oocyte localization"

    Article Title: Poly(ADP-ribose) controls DE-cadherin-dependent stem cell maintenance and oocyte localization

    Journal: Nature Communications

    doi: 10.1038/ncomms1759

    pADPr disrupts Hrp38 binding to 5′UTR of DE-cadherin conferring IRES activity (a) The mRNA expression level of DE-cadherin in the different genotypes at the wandering third-instar larvae stage. (b) The protein expression level of DE-cadherin in the different genotypes at the wandering third-instar larvae stage. (c) The structure of DE-cadherin transcript. The biotin-labeled probes were made from three regions (5′UTR, coding region and 3′UTR). (d) Hrp38 binding to 5′UTR of DE-cadherin in the ovary is shown by UV-crosslinking analysis. The ovarian lysate from the wild-type fly ( y,w) crosslinked to the biotin-labeled RNA probes as indicated was IPed with rabbit anti-Hrp38 antibody or normal rabbit IgG as the control for IP. The supernatant (S/N), which was obtained after each IP, was run in the same blot to show the efficiency of RNase treatment. (e) Decreased amounts of Hrp38 protein binding to 5′UTR of DE-cadherin in the Parg mutant. In (d,e) Hrp38 protein binding to biotin-labeled RNA probe was detected with Streptavidin. The same blot was stripped and probed with anti-Hrp38 antibody to show IP efficiency. (f) Inhibition of Hrp38 binding to its target RNA motif by poly(ADP-ribose). The biotin-labeled G-rich RNA element ( CAGGGCGCGCACUGUACGAG) within 5′UTR of DE-cadherin was incubated with the components as indicated. (g) Diagrams of the different constructs for dual luciferase assay. pNO-IRES (negtative control); pPolio-IRES (positive control); pDEcad 5′UTR: DE-cadherin 5′UTR cloned into the vector in the forward orientation. pDEcad 5′UTR-reverse (spacer control); pDEcad-3′UTR (element control). (h) The ratio of firefly-to-renilla luciferase activity after the transfection of the different constructs as indicated into Drosophila S2 cells. (i–j) The association of Hrp38 with the transcript from pDEcad 5′UTR-luciferase construct shown by regular RT-PCR ( i ) and qRT-PCR ( j ) after RNA-IP. RNA IP was done using anti-Hrp38 antibody or rabbit IgG as a control after the transfection of pDEcad-5′UTR construct into S2 cells. The error bars in (h,j) represents the standard deviation from three independent experiments. ** P ≤ 0.01, analyzed by t -test.
    Figure Legend Snippet: pADPr disrupts Hrp38 binding to 5′UTR of DE-cadherin conferring IRES activity (a) The mRNA expression level of DE-cadherin in the different genotypes at the wandering third-instar larvae stage. (b) The protein expression level of DE-cadherin in the different genotypes at the wandering third-instar larvae stage. (c) The structure of DE-cadherin transcript. The biotin-labeled probes were made from three regions (5′UTR, coding region and 3′UTR). (d) Hrp38 binding to 5′UTR of DE-cadherin in the ovary is shown by UV-crosslinking analysis. The ovarian lysate from the wild-type fly ( y,w) crosslinked to the biotin-labeled RNA probes as indicated was IPed with rabbit anti-Hrp38 antibody or normal rabbit IgG as the control for IP. The supernatant (S/N), which was obtained after each IP, was run in the same blot to show the efficiency of RNase treatment. (e) Decreased amounts of Hrp38 protein binding to 5′UTR of DE-cadherin in the Parg mutant. In (d,e) Hrp38 protein binding to biotin-labeled RNA probe was detected with Streptavidin. The same blot was stripped and probed with anti-Hrp38 antibody to show IP efficiency. (f) Inhibition of Hrp38 binding to its target RNA motif by poly(ADP-ribose). The biotin-labeled G-rich RNA element ( CAGGGCGCGCACUGUACGAG) within 5′UTR of DE-cadherin was incubated with the components as indicated. (g) Diagrams of the different constructs for dual luciferase assay. pNO-IRES (negtative control); pPolio-IRES (positive control); pDEcad 5′UTR: DE-cadherin 5′UTR cloned into the vector in the forward orientation. pDEcad 5′UTR-reverse (spacer control); pDEcad-3′UTR (element control). (h) The ratio of firefly-to-renilla luciferase activity after the transfection of the different constructs as indicated into Drosophila S2 cells. (i–j) The association of Hrp38 with the transcript from pDEcad 5′UTR-luciferase construct shown by regular RT-PCR ( i ) and qRT-PCR ( j ) after RNA-IP. RNA IP was done using anti-Hrp38 antibody or rabbit IgG as a control after the transfection of pDEcad-5′UTR construct into S2 cells. The error bars in (h,j) represents the standard deviation from three independent experiments. ** P ≤ 0.01, analyzed by t -test.

    Techniques Used: Binding Assay, Activity Assay, Expressing, Labeling, Protein Binding, Mutagenesis, Inhibition, Incubation, Construct, Luciferase, Positive Control, Clone Assay, Plasmid Preparation, Transfection, Reverse Transcription Polymerase Chain Reaction, Quantitative RT-PCR, Standard Deviation

    2) Product Images from "Robust, Quantitative Analysis of Proteins using Peptide Immunoreagents, in Vitro Translation, and an Ultrasensitive Acoustic Resonant Sensor"

    Article Title: Robust, Quantitative Analysis of Proteins using Peptide Immunoreagents, in Vitro Translation, and an Ultrasensitive Acoustic Resonant Sensor

    Journal: Analytical Chemistry

    doi: 10.1021/ac500084d

    AMMP and ELISA target-binding assays. (a) Schematic of the AMMP target-binding assay. An HA-tagged ligand binds to target (Bcl-x L ) immobilized on streptavidin magnetic beads. Anti-HA antibody, labeled with fluorescein, binds to the HA tag and to antifluorescein antibody on the sensor surface. (b) AMMP signal in the target-binding assay is a function of dilution factor and ligand affinity. At the same dilution, Pep1 generates higher signal levels than Pep2, whereas ScPep1 and Pep1ΔHA show background levels of signal. (c) AMMP target-binding assay adjusted for peptide concentration as measured using the HA tag competition assay, demonstrating true relative affinities. (d) Schematic of the ELISA target-binding assay. An HA-tagged ligand binds to biotinylated target (Bcl-x L ) and anti-HA antibody on the ELISA plate. Streptavidin-HRP binds to biotin, resulting in an ELISA signal. (e) Target-binding ELISA assay is much less sensitive than the AMMP assay [described in (b)], and the respective samples behave equivalently: Pep1 generates a higher signal level than Pep2 and ScPep1 and Pep1ΔHA generate no signal over the background. (f) ELISA target-binding assay adjusted for peptide concentration as measured using the HA tag competition assay.
    Figure Legend Snippet: AMMP and ELISA target-binding assays. (a) Schematic of the AMMP target-binding assay. An HA-tagged ligand binds to target (Bcl-x L ) immobilized on streptavidin magnetic beads. Anti-HA antibody, labeled with fluorescein, binds to the HA tag and to antifluorescein antibody on the sensor surface. (b) AMMP signal in the target-binding assay is a function of dilution factor and ligand affinity. At the same dilution, Pep1 generates higher signal levels than Pep2, whereas ScPep1 and Pep1ΔHA show background levels of signal. (c) AMMP target-binding assay adjusted for peptide concentration as measured using the HA tag competition assay, demonstrating true relative affinities. (d) Schematic of the ELISA target-binding assay. An HA-tagged ligand binds to biotinylated target (Bcl-x L ) and anti-HA antibody on the ELISA plate. Streptavidin-HRP binds to biotin, resulting in an ELISA signal. (e) Target-binding ELISA assay is much less sensitive than the AMMP assay [described in (b)], and the respective samples behave equivalently: Pep1 generates a higher signal level than Pep2 and ScPep1 and Pep1ΔHA generate no signal over the background. (f) ELISA target-binding assay adjusted for peptide concentration as measured using the HA tag competition assay.

    Techniques Used: Enzyme-linked Immunosorbent Assay, Binding Assay, Magnetic Beads, Labeling, Concentration Assay, Competitive Binding Assay

    3) Product Images from "CD30 on extracellular vesicles from malignant Hodgkin cells supports damaging of CD30 ligand-expressing bystander cells with Brentuximab-Vedotin, in vitro"

    Article Title: CD30 on extracellular vesicles from malignant Hodgkin cells supports damaging of CD30 ligand-expressing bystander cells with Brentuximab-Vedotin, in vitro

    Journal: Oncotarget

    doi: 10.18632/oncotarget.8864

    CD30-positive EVs target SGN-35 to cells of the microenvironment ( A ) CD30L-DsRed2-transfected HMC 1.1 (red) and CD30-eGFP-transfected HD-MyZ (green) were co-cultured in growth factor-reduced matrigel and incubated for 2 h at 37°C, 5% CO2. Two consecutive confocal images (Δ = 1.219 μm) of co-cultivated cells are shown. Arrowheads indicate release and binding of CD30 + vesicles to CD30L + HMC 1.1 cells. The circle indicates internalized CD30. ( B ) Confocal image of a tissue section of a lymph node infiltrated by cHL of mixed cellular subtype was stained with NASDCL (red) and with a CD30 primary antibody (Ber-H2) and an ALEXA488-conjugated secondary antibody (green). Bars indicate 30 μm. Confocal images were taken with laser scanning microscopy (Zeiss Meta 510, Zeiss, Germany) using a 40× oil objective with NA 1.3 and the appropriate filters and analyzed with Imaris 7.0 software. ( C ) L540 cells (5 ml of 2 × 10 6 /mL) were cultivated for 3 h at 37°C in serum-free medium with biotin-labeled SGN-35 (1 μg/mL). Supernatants were harvested, precentrifuged and EVs were finally pelleted at 100000 × g. The pull-down of SGN-35 on pelleted EVs was investigated by Western Blot under reducing conditions. Streptavidin-coupled peroxidase was used to detect the heavy and light chain of the biotinylated SGN-35 (EVs). Biotinylated SGN-35, directly applied to the Western Blot served as loading control. ( D ) Determination of CD30L on HMC1.2 cells by flow cytometry. HMC1.2 cells (5 × 10 5 /mL) were incubated for 1 h on ice with CD30Fc or an anti-CD30L antibody (left) or with the indicated amounts of sCD30, CD30EV or without CD30 (tinted curve) in the presence of 0.1 μg/mL of FITC-labeled SGN-35.
    Figure Legend Snippet: CD30-positive EVs target SGN-35 to cells of the microenvironment ( A ) CD30L-DsRed2-transfected HMC 1.1 (red) and CD30-eGFP-transfected HD-MyZ (green) were co-cultured in growth factor-reduced matrigel and incubated for 2 h at 37°C, 5% CO2. Two consecutive confocal images (Δ = 1.219 μm) of co-cultivated cells are shown. Arrowheads indicate release and binding of CD30 + vesicles to CD30L + HMC 1.1 cells. The circle indicates internalized CD30. ( B ) Confocal image of a tissue section of a lymph node infiltrated by cHL of mixed cellular subtype was stained with NASDCL (red) and with a CD30 primary antibody (Ber-H2) and an ALEXA488-conjugated secondary antibody (green). Bars indicate 30 μm. Confocal images were taken with laser scanning microscopy (Zeiss Meta 510, Zeiss, Germany) using a 40× oil objective with NA 1.3 and the appropriate filters and analyzed with Imaris 7.0 software. ( C ) L540 cells (5 ml of 2 × 10 6 /mL) were cultivated for 3 h at 37°C in serum-free medium with biotin-labeled SGN-35 (1 μg/mL). Supernatants were harvested, precentrifuged and EVs were finally pelleted at 100000 × g. The pull-down of SGN-35 on pelleted EVs was investigated by Western Blot under reducing conditions. Streptavidin-coupled peroxidase was used to detect the heavy and light chain of the biotinylated SGN-35 (EVs). Biotinylated SGN-35, directly applied to the Western Blot served as loading control. ( D ) Determination of CD30L on HMC1.2 cells by flow cytometry. HMC1.2 cells (5 × 10 5 /mL) were incubated for 1 h on ice with CD30Fc or an anti-CD30L antibody (left) or with the indicated amounts of sCD30, CD30EV or without CD30 (tinted curve) in the presence of 0.1 μg/mL of FITC-labeled SGN-35.

    Techniques Used: Transfection, Cell Culture, Incubation, Binding Assay, Staining, Laser-Scanning Microscopy, Software, Labeling, Western Blot, Flow Cytometry, Cytometry

    4) Product Images from "Serum MEPE-ASARM-peptides are elevated in X-linked rickets (HYP): implications for phosphaturia and rickets"

    Article Title: Serum MEPE-ASARM-peptides are elevated in X-linked rickets (HYP): implications for phosphaturia and rickets

    Journal: The Journal of Endocrinology

    doi: 10.1677/joe.1.05989

    Competitive ELISA plots of percentage-quenching (y-axis) against non-biotinylated peptide (x-axis). Anti-ASARM-peptide polyclonal was first bound onto protein-G 96-micro-well plates. A constant concentration of biotinylated-ASARM-peptide (0·5 ng/ml) was then separately mixed with different concentrations of non-biotinylated ASARM-peptide and then added to the plates. The relative degree of chemiluminescent quenching was then assayed after addition of streptavidin–horseradish–peroxidase conjugate and measurement of light emission by a Bio-Rad FlourImager max system as described in Material and Methods. Graph A: Illustrates percentage-quenching data directly plotted against ASARM-peptide (ng/ml) (K D of 7·5 ng/ml and a Q max (quench maximum) of 98·7%). Graph B: Illustrates the same data but with a log 10 ASARM-peptide (ng/ml) transform on the X-axis. A linear regression confirms a significant linear-regression fit (r 2 =0·9405, P
    Figure Legend Snippet: Competitive ELISA plots of percentage-quenching (y-axis) against non-biotinylated peptide (x-axis). Anti-ASARM-peptide polyclonal was first bound onto protein-G 96-micro-well plates. A constant concentration of biotinylated-ASARM-peptide (0·5 ng/ml) was then separately mixed with different concentrations of non-biotinylated ASARM-peptide and then added to the plates. The relative degree of chemiluminescent quenching was then assayed after addition of streptavidin–horseradish–peroxidase conjugate and measurement of light emission by a Bio-Rad FlourImager max system as described in Material and Methods. Graph A: Illustrates percentage-quenching data directly plotted against ASARM-peptide (ng/ml) (K D of 7·5 ng/ml and a Q max (quench maximum) of 98·7%). Graph B: Illustrates the same data but with a log 10 ASARM-peptide (ng/ml) transform on the X-axis. A linear regression confirms a significant linear-regression fit (r 2 =0·9405, P

    Techniques Used: Competitive ELISA, Concentration Assay

    5) Product Images from "Characterization of the kinase activity of a WNK4 protein complex"

    Article Title: Characterization of the kinase activity of a WNK4 protein complex

    Journal: American Journal of Physiology - Renal Physiology

    doi: 10.1152/ajprenal.00358.2009

    Expression and in-gel kinase assay of COOH-terminal truncated WNK4 proteins. A : FL and COOH-terminal truncated WNK4 proteins were expressed and recovered from HEK293 cells with the regular TAP protocol and then separated on a 7.5% polyacrylamide gel and visualized by silver staining. B : NH 2 terminal of the WNK4 proteins shown in A was detected by a streptavidin blot. C : COOH terminal of the WNK4 proteins shown in A detected by immunoblotting with anti-myc antibody. D : assay of in-gel phosphorylation of OSR1-D164A by FL and COOH-terminal truncated WNK4 proteins. 32 P-phosphorylated proteins were visualized by 3-h autoradiography.
    Figure Legend Snippet: Expression and in-gel kinase assay of COOH-terminal truncated WNK4 proteins. A : FL and COOH-terminal truncated WNK4 proteins were expressed and recovered from HEK293 cells with the regular TAP protocol and then separated on a 7.5% polyacrylamide gel and visualized by silver staining. B : NH 2 terminal of the WNK4 proteins shown in A was detected by a streptavidin blot. C : COOH terminal of the WNK4 proteins shown in A detected by immunoblotting with anti-myc antibody. D : assay of in-gel phosphorylation of OSR1-D164A by FL and COOH-terminal truncated WNK4 proteins. 32 P-phosphorylated proteins were visualized by 3-h autoradiography.

    Techniques Used: Expressing, Kinase Assay, Silver Staining, Autoradiography

    6) Product Images from "Biochemical and structural features of extracellular vesicle-binding RNA aptamers"

    Article Title: Biochemical and structural features of extracellular vesicle-binding RNA aptamers

    Journal: Biomedical Reports

    doi: 10.3892/br.2017.899

    Analysis by SPR spectroscopy of binding of aptamers to extracellular vesicles. The binding affinity of aptamers was examined by SPR spectroscopy with the Biacore X system. Extracellular vesicles at various concentrations (150, 75, 50, 43 and 38 µg/ml) were passed over aptamers, which had been immobilized on streptavidin-coated sensor chips. The sensorgrams demonstrate the significant binding of the aptamers to extracellular vesicles. RU, resonance units; SPR, surface plasmon resonance.
    Figure Legend Snippet: Analysis by SPR spectroscopy of binding of aptamers to extracellular vesicles. The binding affinity of aptamers was examined by SPR spectroscopy with the Biacore X system. Extracellular vesicles at various concentrations (150, 75, 50, 43 and 38 µg/ml) were passed over aptamers, which had been immobilized on streptavidin-coated sensor chips. The sensorgrams demonstrate the significant binding of the aptamers to extracellular vesicles. RU, resonance units; SPR, surface plasmon resonance.

    Techniques Used: SPR Assay, Spectroscopy, Binding Assay

    7) Product Images from "The Severity of Murray Valley Encephalitis in Mice Is Linked to Neutrophil Infiltration and Inducible Nitric Oxide Synthase Activity in the Central Nervous System"

    Article Title: The Severity of Murray Valley Encephalitis in Mice Is Linked to Neutrophil Infiltration and Inducible Nitric Oxide Synthase Activity in the Central Nervous System

    Journal: Journal of Virology

    doi:

    Localization of MVE BH3479 RNA by ISH and of apoptotic cells by in situ TUNEL assay in the brains of Swiss mice. The ISH probe was DIG-labelled MVE E gene RNA of negative polarity; the hybridized probe was detected with anti-DIG alkaline phosphatase and fast red to produce a red cytoplasmic stain. TUNEL positivity was detected with biotinylated dUTP, streptavidin horseradish peroxidase, and diaminobenzidine to produce a brown nuclear stain. Frozen tissue sections (15 μm) were cut on a cryostat and counterstained with hematoxylin. (A) Coronal section through the anterior olfactory nucleus at 6 days p.i. A double-labelled neuron (long arrow) is seen in the center of the picture. Numerous MVE-infected neurons with TUNEL-negative nuclei are present (short arrows). Bar, 50 μm. (B) Coronal section through the hippocampal formation at 6 days p.i. A double-labelled neuron (long arrow) is seen within a heavily infected region of CA3 (indicated by the no. 3). A TUNEL-positive inflammatory cell is seen adjacent to the double-labelled neuron (short arrow). Bar, 50 μm.
    Figure Legend Snippet: Localization of MVE BH3479 RNA by ISH and of apoptotic cells by in situ TUNEL assay in the brains of Swiss mice. The ISH probe was DIG-labelled MVE E gene RNA of negative polarity; the hybridized probe was detected with anti-DIG alkaline phosphatase and fast red to produce a red cytoplasmic stain. TUNEL positivity was detected with biotinylated dUTP, streptavidin horseradish peroxidase, and diaminobenzidine to produce a brown nuclear stain. Frozen tissue sections (15 μm) were cut on a cryostat and counterstained with hematoxylin. (A) Coronal section through the anterior olfactory nucleus at 6 days p.i. A double-labelled neuron (long arrow) is seen in the center of the picture. Numerous MVE-infected neurons with TUNEL-negative nuclei are present (short arrows). Bar, 50 μm. (B) Coronal section through the hippocampal formation at 6 days p.i. A double-labelled neuron (long arrow) is seen within a heavily infected region of CA3 (indicated by the no. 3). A TUNEL-positive inflammatory cell is seen adjacent to the double-labelled neuron (short arrow). Bar, 50 μm.

    Techniques Used: In Situ Hybridization, In Situ, TUNEL Assay, Mouse Assay, Staining, Infection

    8) Product Images from "Biochemical and structural features of extracellular vesicle-binding RNA aptamers"

    Article Title: Biochemical and structural features of extracellular vesicle-binding RNA aptamers

    Journal: Biomedical Reports

    doi: 10.3892/br.2017.899

    Analysis by SPR spectroscopy of binding of aptamers to extracellular vesicles. The binding affinity of aptamers was examined by SPR spectroscopy with the Biacore X system. Extracellular vesicles at various concentrations (150, 75, 50, 43 and 38 µg/ml) were passed over aptamers, which had been immobilized on streptavidin-coated sensor chips. The sensorgrams demonstrate the significant binding of the aptamers to extracellular vesicles. RU, resonance units; SPR, surface plasmon resonance.
    Figure Legend Snippet: Analysis by SPR spectroscopy of binding of aptamers to extracellular vesicles. The binding affinity of aptamers was examined by SPR spectroscopy with the Biacore X system. Extracellular vesicles at various concentrations (150, 75, 50, 43 and 38 µg/ml) were passed over aptamers, which had been immobilized on streptavidin-coated sensor chips. The sensorgrams demonstrate the significant binding of the aptamers to extracellular vesicles. RU, resonance units; SPR, surface plasmon resonance.

    Techniques Used: SPR Assay, Spectroscopy, Binding Assay

    Related Articles

    Centrifugation:

    Article Title: Intracellular Aβ pathology and early cognitive impairments in a transgenic rat overexpressing human amyloid precursor protein: a multidimensional study
    Article Snippet: Centrifugation at 100.000 g was repeated and supernatants were collected (FA-soluble fraction). .. The monoclonal biotinylated W0-2 (EMI Millipore, USA) recognizing the Aβ N-terminus was used as detection antibody, and the reaction was developed by streptavidin-horseradish peroxidase conjugate and the chromogenic substrate 1-Step Ultra-TMB (Pierce, USA).

    Immunocytochemistry:

    Article Title: Importance of Uterine Cell Death, Renewal, and Their Hormonal Regulation in Hamsters That Show Progesterone-Dependent Implantation
    Article Snippet: Paragraph title: Caspase-3 immunocytochemistry ... Subsequent immunostaining was performed using biotinylated goat antirabbit secondary antibody, streptavidin-horseradish peroxidase conjugate, and a substrate chromogen mixture (AEC single solution) from Zymed.

    Autoradiography:

    Article Title: Characterization of the kinase activity of a WNK4 protein complex
    Article Snippet: .. To detect the NH2 -terminal streptavidin-binding peptide tag, membranes were probed with streptavidin-horseradish peroxidase conjugate at 1:5,000 (Invitrogen), and then incubated with ECL chemiluminescent substrate (GE Healthcare) and detected by autoradiography. ..

    Blocking Assay:

    Article Title: Membrane vesicles of Clostridium perfringens Type A strains induce innate and adaptive immunity
    Article Snippet: After incubation at 4°C overnight, the plates were blocked with sea block blocking buffer (Fisher). .. Wells were developed with streptavidin horseradish peroxidase conjugate (Invitrogen, Carlsbad, CA) at the ratio of 1:6,000, followed by 2,2--azino-bis-(3-ethylbenzthiazoline-6-sulfonic acid) (ABTS) (Sigma).

    Article Title: Characterization of the kinase activity of a WNK4 protein complex
    Article Snippet: Polyacrylamide protein gels were electrophoretically transferred to PVDF membrane and blocked with Odyssey blocking reagent (Li-Cor Biosciences). .. To detect the NH2 -terminal streptavidin-binding peptide tag, membranes were probed with streptavidin-horseradish peroxidase conjugate at 1:5,000 (Invitrogen), and then incubated with ECL chemiluminescent substrate (GE Healthcare) and detected by autoradiography.

    Article Title: Importance of Uterine Cell Death, Renewal, and Their Hormonal Regulation in Hamsters That Show Progesterone-Dependent Implantation
    Article Snippet: Freshly prepared cryosections were rapidly fixed (10 min) in acetone at room temperature for 10 min. After rinsing in PBS, the blocking solution of 10% (vol/vol) goat serum was added to the section for 10 min at room temperature followed by the primary antibody (antirabbit active caspase-3 obtained from Promega) (1:40 dilution) in PBS at 4 C overnight. .. Subsequent immunostaining was performed using biotinylated goat antirabbit secondary antibody, streptavidin-horseradish peroxidase conjugate, and a substrate chromogen mixture (AEC single solution) from Zymed.

    Article Title: Neutrophil derived human S100A12 (EN-RAGE) is strongly expressed during chronic active inflammatory bowel disease
    Article Snippet: Plates were washed once with wash buffer, and 50 μl of samples in at least three dilutions using block buffer were added for two hours at room temperature. .. Plates were washed and incubated with streptavidin-horseradish peroxidase conjugate (1:5000 dilution; Pierce, Rockford, Illinois, USA) for 30 minutes at 37°C.

    Enzyme-linked Immunosorbent Assay:

    Article Title: Membrane vesicles of Clostridium perfringens Type A strains induce innate and adaptive immunity
    Article Snippet: Paragraph title: Enzyme-linked immunosorbent assay (ELISA) ... Wells were developed with streptavidin horseradish peroxidase conjugate (Invitrogen, Carlsbad, CA) at the ratio of 1:6,000, followed by 2,2--azino-bis-(3-ethylbenzthiazoline-6-sulfonic acid) (ABTS) (Sigma).

    Article Title: Serum MEPE-ASARM-peptides are elevated in X-linked rickets (HYP): implications for phosphaturia and rickets
    Article Snippet: Paragraph title: ELISA assay ... The important components of this assay included 96 well Reacti-Bind Protein-G Coated Plates (Pierce & Co), anti-ASARM-peptide polyclonal antibody (see above), non-phosphorylated ASARM-peptide (also described above), a biotinylated ASARM-peptide (bio-ASARM-peptide), streptavidin horseradish-peroxidase conjugate (Zymed Laboratories, Inc., South San Francisco, CA), and an ECL Advance chemiluminescent detection kit (Amersham BioSciences, Piscataway, NJ).

    Article Title: CD30 on extracellular vesicles from malignant Hodgkin cells supports damaging of CD30 ligand-expressing bystander cells with Brentuximab-Vedotin, in vitro
    Article Snippet: Paragraph title: Determination of CD30endo by ELISA ... After washing, the plates were incubated for 40 min with 50 μL of streptavidin-horseradish peroxidase conjugate, washed and peroxidase activity was developed with TMB solution (Thermo Fisher).

    Article Title: Intracellular Aβ pathology and early cognitive impairments in a transgenic rat overexpressing human amyloid precursor protein: a multidimensional study
    Article Snippet: Paragraph title: Human Aβ40 and Aβ42 ELISA ... The monoclonal biotinylated W0-2 (EMI Millipore, USA) recognizing the Aβ N-terminus was used as detection antibody, and the reaction was developed by streptavidin-horseradish peroxidase conjugate and the chromogenic substrate 1-Step Ultra-TMB (Pierce, USA).

    Article Title: Neutrophil derived human S100A12 (EN-RAGE) is strongly expressed during chronic active inflammatory bowel disease
    Article Snippet: ELISA was calibrated with purified S100A12 in concentrations ranging from 0.016 to 125 ng/ml. .. Plates were washed and incubated with streptavidin-horseradish peroxidase conjugate (1:5000 dilution; Pierce, Rockford, Illinois, USA) for 30 minutes at 37°C.

    Article Title: Robust, Quantitative Analysis of Proteins using Peptide Immunoreagents, in Vitro Translation, and an Ultrasensitive Acoustic Resonant Sensor
    Article Snippet: Paragraph title: ELISA Target-Binding Assay ... Plates were washed with wash buffer [1× PBS + 0.1% (v/v) Tween-20] and blocked with 1× PBS + 5% (w/v) BSA for 2 h. In each well, 100 μL of sample and 100 μL of 33 nM biotinylated Bcl-xL were added and incubated for 4 h. Plates were washed, incubated with streptavidin horseradish peroxidase conjugate (Strep-HRP, Thermo Scientific) for 1 h, washed, and incubated with TMB substrate (Thermo Scientific).

    Sandwich ELISA:

    Article Title: A Lipoprotein Receptor Cluster IV Mutant Preferentially Binds Amyloid-? and Regulates Its Clearance from the Mouse Brain *
    Article Snippet: Sandwich ELISA for murine plasma apoE was carried out as described ( ). .. Briefly, 96-well plates (Costar, Corning) were coated overnight with 0.5 μg/well of the capturing antibody (catalog no. sc-6384, clone M-20, goat anti-mouse apoE, Santa Cruz Biotechnology, Inc., Santa Cruz, CA), blocked with 7% milk in PBS, and incubated with the secondary antibody, biotinylated goat anti-apoE (1:10,000 dilution, catalog no. K74180B, Biodesign Meridian LifeScience), followed by streptavidin-horseradish peroxidase conjugate (catalog no. SNN 2004, Invitrogen).

    Article Title: Intracellular Aβ pathology and early cognitive impairments in a transgenic rat overexpressing human amyloid precursor protein: a multidimensional study
    Article Snippet: Levels of Aβ40 or Aβ42 in TBS-soluble and FA-soluble fractions were determined by sandwich ELISA. .. The monoclonal biotinylated W0-2 (EMI Millipore, USA) recognizing the Aβ N-terminus was used as detection antibody, and the reaction was developed by streptavidin-horseradish peroxidase conjugate and the chromogenic substrate 1-Step Ultra-TMB (Pierce, USA).

    Article Title: Neutrophil derived human S100A12 (EN-RAGE) is strongly expressed during chronic active inflammatory bowel disease
    Article Snippet: Paragraph title: Determination of S100A12 concentrations by sandwich ELISA ... Plates were washed and incubated with streptavidin-horseradish peroxidase conjugate (1:5000 dilution; Pierce, Rockford, Illinois, USA) for 30 minutes at 37°C.

    Incubation:

    Article Title: A Lipoprotein Receptor Cluster IV Mutant Preferentially Binds Amyloid-? and Regulates Its Clearance from the Mouse Brain *
    Article Snippet: .. Briefly, 96-well plates (Costar, Corning) were coated overnight with 0.5 μg/well of the capturing antibody (catalog no. sc-6384, clone M-20, goat anti-mouse apoE, Santa Cruz Biotechnology, Inc., Santa Cruz, CA), blocked with 7% milk in PBS, and incubated with the secondary antibody, biotinylated goat anti-apoE (1:10,000 dilution, catalog no. K74180B, Biodesign Meridian LifeScience), followed by streptavidin-horseradish peroxidase conjugate (catalog no. SNN 2004, Invitrogen). ..

    Article Title: Membrane vesicles of Clostridium perfringens Type A strains induce innate and adaptive immunity
    Article Snippet: After three times PBS-0.05% Tween-20 washing, the plates were incubated with biotinylated goat anti-mouse IgG, IgG1, IgG2a, or IgA (Southern Biotechnology Inc., Birmingham, AL) antibodies diluted 1:10,000 for 1 h at 37°C. .. Wells were developed with streptavidin horseradish peroxidase conjugate (Invitrogen, Carlsbad, CA) at the ratio of 1:6,000, followed by 2,2--azino-bis-(3-ethylbenzthiazoline-6-sulfonic acid) (ABTS) (Sigma).

    Article Title: Biochemical and structural features of extracellular vesicle-binding RNA aptamers
    Article Snippet: .. Following washing, the filter was incubated with streptavidin-horseradish peroxidase conjugate (Thermo Fisher Scientific, Inc.; cat. no. N100; dilution, 1:1,000) for 60 min at room temperature and washed. .. Then, the Amersham ECL Prime Western Blotting Detection reagent (GE Healthcare Life Sciences, Chalfont, UK) was used to visualize the chemiluminescence of the 5′-biotinylated aptamer on the filter.

    Article Title: Characterization of the kinase activity of a WNK4 protein complex
    Article Snippet: .. To detect the NH2 -terminal streptavidin-binding peptide tag, membranes were probed with streptavidin-horseradish peroxidase conjugate at 1:5,000 (Invitrogen), and then incubated with ECL chemiluminescent substrate (GE Healthcare) and detected by autoradiography. ..

    Article Title: The Severity of Murray Valley Encephalitis in Mice Is Linked to Neutrophil Infiltration and Inducible Nitric Oxide Synthase Activity in the Central Nervous System
    Article Snippet: .. After labelling, the sections were blocked with 2% normal sheep serum and 0.2% Triton X-100 in PBS, followed by a 30-min incubation with streptavidin horseradish peroxidase conjugate (Pierce) diluted 1:100 in PBS. .. The ISH signal was detected by using the alkaline phosphatase substrate fast red TR/Naphthol (Sigma) to give a red cytoplasmic signal for viral RNA.

    Article Title: Sialic Acid Expression in the Mosquito Aedes aegypti and Its Possible Role in Dengue Virus-Vector Interactions
    Article Snippet: .. The membranes were incubated with biotinylated SNA or Canavalia ensiformis agglutinin (ConA; EY Laboratories Inc., USA) at a dilution of 1 : 10 for 3 h at RT, followed by streptavidin-horseradish peroxidase conjugate (43-4323; Zymed Laboratories Inc., USA) at a dilution of 1 : 3000 for 1 h at RT. .. The membranes were then washed with PBS and visualized with luminol (Western Blotting Reagent sc-2048; Santa Cruz Biotechnology, USA).

    Article Title: Poly(ADP-ribose) controls DE-cadherin-dependent stem cell maintenance and oocyte localization
    Article Snippet: For immunoprecipitation, the reaction with 150 ul polysome lysis buffer was incubated with the rabbit anti-Hrp38 antibody ( ) or rabbit IgG (Sigma) (the negative control) at 1:20 dilution overnight and then with 30 μl protein A agarose (Invitrogen) for 2h at 4°C. .. The protein covalently linked to a stub of the biotin-labeled RNA probe was detected with stabilized streptavidin-horseradish peroxidase conjugate with chemiluminescent substrate (Pierce).

    Article Title: CD30 on extracellular vesicles from malignant Hodgkin cells supports damaging of CD30 ligand-expressing bystander cells with Brentuximab-Vedotin, in vitro
    Article Snippet: .. After washing, the plates were incubated for 40 min with 50 μL of streptavidin-horseradish peroxidase conjugate, washed and peroxidase activity was developed with TMB solution (Thermo Fisher). ..

    Article Title: Biochemical and structural features of extracellular vesicle-binding RNA aptamers
    Article Snippet: The membrane was then incubated with 100 µM 5′-biotinylated aptamer in binding buffer supplemented with 0.1% Tween-20, 1% BSA and 100 µg/ml tRNA for 60 min at room temperature and washed three times with binding buffer supplemented with 0.1% Tween-20. .. The membrane was exposed to UV irradiation (254 nm) and then to streptavidin-horseradish peroxidase conjugate (Thermo Fisher Scientific, Inc.; cat. no. N100; dilution, 1:4,000) for 60 min at room temperature.

    Article Title: Neutrophil derived human S100A12 (EN-RAGE) is strongly expressed during chronic active inflammatory bowel disease
    Article Snippet: .. Plates were washed and incubated with streptavidin-horseradish peroxidase conjugate (1:5000 dilution; Pierce, Rockford, Illinois, USA) for 30 minutes at 37°C. .. After washing three times, plates were incubated with ABTS (2,2′-azinobis (3-ethylbenzthiazoline sulphonic acid); Roche Diagnostics, Mannheim, Germany) and H2 O2 in 0.05 M citrate buffer, pH 4.0, for 20 minutes at room temperature.

    Article Title: Robust, Quantitative Analysis of Proteins using Peptide Immunoreagents, in Vitro Translation, and an Ultrasensitive Acoustic Resonant Sensor
    Article Snippet: .. Plates were washed with wash buffer [1× PBS + 0.1% (v/v) Tween-20] and blocked with 1× PBS + 5% (w/v) BSA for 2 h. In each well, 100 μL of sample and 100 μL of 33 nM biotinylated Bcl-xL were added and incubated for 4 h. Plates were washed, incubated with streptavidin horseradish peroxidase conjugate (Strep-HRP, Thermo Scientific) for 1 h, washed, and incubated with TMB substrate (Thermo Scientific). .. Reactions were stopped after approximately 10 min with 2 M sulfuric acid, and the absorbance at 450 nm was measured via a plate reader (Molecular Devices).

    Activity Assay:

    Article Title: The Severity of Murray Valley Encephalitis in Mice Is Linked to Neutrophil Infiltration and Inducible Nitric Oxide Synthase Activity in the Central Nervous System
    Article Snippet: Prior to commencing the TUNEL assay, endogenous peroxidase activity was blocked by immersion of the sections in 1% hydrogen peroxide-methanol for 10 min. .. After labelling, the sections were blocked with 2% normal sheep serum and 0.2% Triton X-100 in PBS, followed by a 30-min incubation with streptavidin horseradish peroxidase conjugate (Pierce) diluted 1:100 in PBS.

    Article Title: CD30 on extracellular vesicles from malignant Hodgkin cells supports damaging of CD30 ligand-expressing bystander cells with Brentuximab-Vedotin, in vitro
    Article Snippet: .. After washing, the plates were incubated for 40 min with 50 μL of streptavidin-horseradish peroxidase conjugate, washed and peroxidase activity was developed with TMB solution (Thermo Fisher). ..

    Western Blot:

    Article Title: Biochemical and structural features of extracellular vesicle-binding RNA aptamers
    Article Snippet: Following washing, the filter was incubated with streptavidin-horseradish peroxidase conjugate (Thermo Fisher Scientific, Inc.; cat. no. N100; dilution, 1:1,000) for 60 min at room temperature and washed. .. Then, the Amersham ECL Prime Western Blotting Detection reagent (GE Healthcare Life Sciences, Chalfont, UK) was used to visualize the chemiluminescence of the 5′-biotinylated aptamer on the filter.

    Article Title: Characterization of the kinase activity of a WNK4 protein complex
    Article Snippet: Paragraph title: Streptavidin and Western blots. ... To detect the NH2 -terminal streptavidin-binding peptide tag, membranes were probed with streptavidin-horseradish peroxidase conjugate at 1:5,000 (Invitrogen), and then incubated with ECL chemiluminescent substrate (GE Healthcare) and detected by autoradiography.

    Article Title: Sialic Acid Expression in the Mosquito Aedes aegypti and Its Possible Role in Dengue Virus-Vector Interactions
    Article Snippet: The membranes were incubated with biotinylated SNA or Canavalia ensiformis agglutinin (ConA; EY Laboratories Inc., USA) at a dilution of 1 : 10 for 3 h at RT, followed by streptavidin-horseradish peroxidase conjugate (43-4323; Zymed Laboratories Inc., USA) at a dilution of 1 : 3000 for 1 h at RT. .. The membranes were then washed with PBS and visualized with luminol (Western Blotting Reagent sc-2048; Santa Cruz Biotechnology, USA).

    Article Title: Biochemical and structural features of extracellular vesicle-binding RNA aptamers
    Article Snippet: The membrane was exposed to UV irradiation (254 nm) and then to streptavidin-horseradish peroxidase conjugate (Thermo Fisher Scientific, Inc.; cat. no. N100; dilution, 1:4,000) for 60 min at room temperature. .. It was washed three times and, finally, the Amersham ECL Prime Western Blotting Detection reagent (GE Healthcare Life Sciences; cat. no. RPN2232) was used to visualize the chemiluminescence of the aptamer on the membrane.

    RNA Binding Assay:

    Article Title: Poly(ADP-ribosyl)ation of heterogeneous nuclear ribonucleoproteins modulates splicing
    Article Snippet: RNA-binding reaction was done by incubating 100 ng GST (BioVision) or 100 ng GST-hnRNPA1 (Abnovo) with 25 fmol biotin-labeled human hnRNP A1 ‘winner’ sequence (UAUGAUAGGGACUUAGGGUG) ( ) (Invitrogen) in a 25 µl volume, including 1× binding buffer (10 mM Tris–HCl, 50 mM KCl, 1 mM DTT, pH 7.5), 2.5% glycerol, 2 unit/µl RNAasin (Promega), 0.25 µg/µl purified BSA and 0.25 µg/µl yeast tRNA (Invitrogen) for 30 min at 30°C. .. The free RNA and RNA–protein complex were detected with stabilized streptavidin-horseradish peroxidase conjugate with chemiluminescent substrate (Pierce).

    TUNEL Assay:

    Article Title: The Severity of Murray Valley Encephalitis in Mice Is Linked to Neutrophil Infiltration and Inducible Nitric Oxide Synthase Activity in the Central Nervous System
    Article Snippet: Paragraph title: TUNEL assay. ... After labelling, the sections were blocked with 2% normal sheep serum and 0.2% Triton X-100 in PBS, followed by a 30-min incubation with streptavidin horseradish peroxidase conjugate (Pierce) diluted 1:100 in PBS.

    Intra Assay:

    Article Title: Neutrophil derived human S100A12 (EN-RAGE) is strongly expressed during chronic active inflammatory bowel disease
    Article Snippet: Plates were washed and incubated with streptavidin-horseradish peroxidase conjugate (1:5000 dilution; Pierce, Rockford, Illinois, USA) for 30 minutes at 37°C. .. The inter- and intra-assay coefficients of variation were < 9% (n=10) and 8% (n=10), respectively.

    Protease Inhibitor:

    Article Title: A Lipoprotein Receptor Cluster IV Mutant Preferentially Binds Amyloid-? and Regulates Its Clearance from the Mouse Brain *
    Article Snippet: Plasma samples were diluted directly with BSAT-DPBS buffer (Dulbecco's phosphate-buffered saline (Cellgro, Mediatech, Inc.) with 5% BSA and 0.03% Tween 20, supplemented with complete protease inhibitor mixture (Roche Applied Science)). .. Briefly, 96-well plates (Costar, Corning) were coated overnight with 0.5 μg/well of the capturing antibody (catalog no. sc-6384, clone M-20, goat anti-mouse apoE, Santa Cruz Biotechnology, Inc., Santa Cruz, CA), blocked with 7% milk in PBS, and incubated with the secondary antibody, biotinylated goat anti-apoE (1:10,000 dilution, catalog no. K74180B, Biodesign Meridian LifeScience), followed by streptavidin-horseradish peroxidase conjugate (catalog no. SNN 2004, Invitrogen).

    Inhibition:

    Article Title: Poly(ADP-ribosyl)ation of heterogeneous nuclear ribonucleoproteins modulates splicing
    Article Snippet: For pADPr inhibition assay, 100 ng human GST-hnRNPA1 was preincubated with 70 ng or 140 ng pADPr (Biomol) in 1× binding buffer for 20 min at 25°C. .. The free RNA and RNA–protein complex were detected with stabilized streptavidin-horseradish peroxidase conjugate with chemiluminescent substrate (Pierce).

    Imaging:

    Article Title: Characterization of the kinase activity of a WNK4 protein complex
    Article Snippet: To detect the COOH-terminal epitope tag, the membranes were immunoblotted with mouse anti-c- myc as the primary antibody at 1:500 dilution (Invitrogen), and Alexa Fluor 680 goat anti-mouse IgG secondary antibody at 1:5,000 (Invitrogen), and then detected with an Odyssey infrared imaging system (Li-Cor Biosciences). .. To detect the NH2 -terminal streptavidin-binding peptide tag, membranes were probed with streptavidin-horseradish peroxidase conjugate at 1:5,000 (Invitrogen), and then incubated with ECL chemiluminescent substrate (GE Healthcare) and detected by autoradiography.

    Sequencing:

    Article Title: Poly(ADP-ribosyl)ation of heterogeneous nuclear ribonucleoproteins modulates splicing
    Article Snippet: RNA-binding reaction was done by incubating 100 ng GST (BioVision) or 100 ng GST-hnRNPA1 (Abnovo) with 25 fmol biotin-labeled human hnRNP A1 ‘winner’ sequence (UAUGAUAGGGACUUAGGGUG) ( ) (Invitrogen) in a 25 µl volume, including 1× binding buffer (10 mM Tris–HCl, 50 mM KCl, 1 mM DTT, pH 7.5), 2.5% glycerol, 2 unit/µl RNAasin (Promega), 0.25 µg/µl purified BSA and 0.25 µg/µl yeast tRNA (Invitrogen) for 30 min at 30°C. .. The free RNA and RNA–protein complex were detected with stabilized streptavidin-horseradish peroxidase conjugate with chemiluminescent substrate (Pierce).

    Sonication:

    Article Title: Intracellular Aβ pathology and early cognitive impairments in a transgenic rat overexpressing human amyloid precursor protein: a multidimensional study
    Article Snippet: The remaining pellets were dissolved in 70% formic acid (FA) with 50% of homogenization volume and sonicated for 30 s at 30% power. .. The monoclonal biotinylated W0-2 (EMI Millipore, USA) recognizing the Aβ N-terminus was used as detection antibody, and the reaction was developed by streptavidin-horseradish peroxidase conjugate and the chromogenic substrate 1-Step Ultra-TMB (Pierce, USA).

    Binding Assay:

    Article Title: Biochemical and structural features of extracellular vesicle-binding RNA aptamers
    Article Snippet: The filter was exposed to UV irradiation (254 nm) and was blocked in binding buffer that contained 3% BSA and 0.1% Tween-20 (Wako Pure Chemical Industries, Ltd.) for 60 min. .. Following washing, the filter was incubated with streptavidin-horseradish peroxidase conjugate (Thermo Fisher Scientific, Inc.; cat. no. N100; dilution, 1:1,000) for 60 min at room temperature and washed.

    Article Title: Poly(ADP-ribose) controls DE-cadherin-dependent stem cell maintenance and oocyte localization
    Article Snippet: The binding reaction was irradiated with 254 nm UV light for 10 minutes on ice using Spectrolinker UV Crosslinker (Krackeler Scientific, Inc., Albany, NY). .. The protein covalently linked to a stub of the biotin-labeled RNA probe was detected with stabilized streptavidin-horseradish peroxidase conjugate with chemiluminescent substrate (Pierce).

    Article Title: Poly(ADP-ribosyl)ation of heterogeneous nuclear ribonucleoproteins modulates splicing
    Article Snippet: For pADPr inhibition assay, 100 ng human GST-hnRNPA1 was preincubated with 70 ng or 140 ng pADPr (Biomol) in 1× binding buffer for 20 min at 25°C. .. The free RNA and RNA–protein complex were detected with stabilized streptavidin-horseradish peroxidase conjugate with chemiluminescent substrate (Pierce).

    Article Title: Biochemical and structural features of extracellular vesicle-binding RNA aptamers
    Article Snippet: The membrane was then incubated with 100 µM 5′-biotinylated aptamer in binding buffer supplemented with 0.1% Tween-20, 1% BSA and 100 µg/ml tRNA for 60 min at room temperature and washed three times with binding buffer supplemented with 0.1% Tween-20. .. The membrane was exposed to UV irradiation (254 nm) and then to streptavidin-horseradish peroxidase conjugate (Thermo Fisher Scientific, Inc.; cat. no. N100; dilution, 1:4,000) for 60 min at room temperature.

    DC Protein Assay:

    Article Title: Biochemical and structural features of extracellular vesicle-binding RNA aptamers
    Article Snippet: Protein concentrations were determined with a DC protein assay kit (Bio-Rad Laboratories, Inc.) according to the manufacturer's instructions. .. The membrane was exposed to UV irradiation (254 nm) and then to streptavidin-horseradish peroxidase conjugate (Thermo Fisher Scientific, Inc.; cat. no. N100; dilution, 1:4,000) for 60 min at room temperature.

    Nucleic Acid Electrophoresis:

    Article Title: Sialic Acid Expression in the Mosquito Aedes aegypti and Its Possible Role in Dengue Virus-Vector Interactions
    Article Snippet: SG Glycoprotein Detection by Blot Assay Glycoproteins in the SG protein extracts were identified by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) with a polyacrylamide gradient of 4–20%, which was then stained to detect all carbohydrates using a Pro-Q Emerald 300 Glycoprotein Gel Stain kit (Molecular Probes, Invitrogen P21855), according to the supplier's protocol. .. The membranes were incubated with biotinylated SNA or Canavalia ensiformis agglutinin (ConA; EY Laboratories Inc., USA) at a dilution of 1 : 10 for 3 h at RT, followed by streptavidin-horseradish peroxidase conjugate (43-4323; Zymed Laboratories Inc., USA) at a dilution of 1 : 3000 for 1 h at RT.

    Electrophoretic Mobility Shift Assay:

    Article Title: Poly(ADP-ribosyl)ation of heterogeneous nuclear ribonucleoproteins modulates splicing
    Article Snippet: Paragraph title: RNA electrophoretic mobility shift assay (EMSA) ... The free RNA and RNA–protein complex were detected with stabilized streptavidin-horseradish peroxidase conjugate with chemiluminescent substrate (Pierce).

    Mouse Assay:

    Article Title: A Lipoprotein Receptor Cluster IV Mutant Preferentially Binds Amyloid-? and Regulates Its Clearance from the Mouse Brain *
    Article Snippet: Pooled plasma from C57BL6 mice containing 68 μg/ml apoE was used as a standard as reported previously ( , ). .. Briefly, 96-well plates (Costar, Corning) were coated overnight with 0.5 μg/well of the capturing antibody (catalog no. sc-6384, clone M-20, goat anti-mouse apoE, Santa Cruz Biotechnology, Inc., Santa Cruz, CA), blocked with 7% milk in PBS, and incubated with the secondary antibody, biotinylated goat anti-apoE (1:10,000 dilution, catalog no. K74180B, Biodesign Meridian LifeScience), followed by streptavidin-horseradish peroxidase conjugate (catalog no. SNN 2004, Invitrogen).

    Article Title: Serum MEPE-ASARM-peptides are elevated in X-linked rickets (HYP): implications for phosphaturia and rickets
    Article Snippet: A new enzyme-linked-immunosorbent-assay (ELISA) was designed to specifically quantitate ASARM-peptide(s) in sera from humans and mice. .. The important components of this assay included 96 well Reacti-Bind Protein-G Coated Plates (Pierce & Co), anti-ASARM-peptide polyclonal antibody (see above), non-phosphorylated ASARM-peptide (also described above), a biotinylated ASARM-peptide (bio-ASARM-peptide), streptavidin horseradish-peroxidase conjugate (Zymed Laboratories, Inc., South San Francisco, CA), and an ECL Advance chemiluminescent detection kit (Amersham BioSciences, Piscataway, NJ).

    Filter-binding Assay:

    Article Title: Biochemical and structural features of extracellular vesicle-binding RNA aptamers
    Article Snippet: Paragraph title: Filter-binding assay ... Following washing, the filter was incubated with streptavidin-horseradish peroxidase conjugate (Thermo Fisher Scientific, Inc.; cat. no. N100; dilution, 1:1,000) for 60 min at room temperature and washed.

    Immunostaining:

    Article Title: Importance of Uterine Cell Death, Renewal, and Their Hormonal Regulation in Hamsters That Show Progesterone-Dependent Implantation
    Article Snippet: .. Subsequent immunostaining was performed using biotinylated goat antirabbit secondary antibody, streptavidin-horseradish peroxidase conjugate, and a substrate chromogen mixture (AEC single solution) from Zymed. ..

    Polyacrylamide Gel Electrophoresis:

    Article Title: Poly(ADP-ribose) controls DE-cadherin-dependent stem cell maintenance and oocyte localization
    Article Snippet: The IP complex was washed using the lysis buffer three times and resolved in 4–12% PAGE gel (Invitrogen). .. The protein covalently linked to a stub of the biotin-labeled RNA probe was detected with stabilized streptavidin-horseradish peroxidase conjugate with chemiluminescent substrate (Pierce).

    Lysis:

    Article Title: Poly(ADP-ribose) controls DE-cadherin-dependent stem cell maintenance and oocyte localization
    Article Snippet: The IP complex was washed using the lysis buffer three times and resolved in 4–12% PAGE gel (Invitrogen). .. The protein covalently linked to a stub of the biotin-labeled RNA probe was detected with stabilized streptavidin-horseradish peroxidase conjugate with chemiluminescent substrate (Pierce).

    Purification:

    Article Title: Membrane vesicles of Clostridium perfringens Type A strains induce innate and adaptive immunity
    Article Snippet: To measure IgG, IgG1 and IgG2a responses against CP4 in mouse sera and IgA in vaginal washes, purified CP4 membrane proteins resuspended in sodium carbonate-bicarbonate buffer (pH 9.6) were used to coat polystyrene 96-well flat-bottom microtiter plates (Dynatech Laboratories Inc., Chantilly, VA) with 100 ng/well. .. Wells were developed with streptavidin horseradish peroxidase conjugate (Invitrogen, Carlsbad, CA) at the ratio of 1:6,000, followed by 2,2--azino-bis-(3-ethylbenzthiazoline-6-sulfonic acid) (ABTS) (Sigma).

    Article Title: Poly(ADP-ribosyl)ation of heterogeneous nuclear ribonucleoproteins modulates splicing
    Article Snippet: RNA-binding reaction was done by incubating 100 ng GST (BioVision) or 100 ng GST-hnRNPA1 (Abnovo) with 25 fmol biotin-labeled human hnRNP A1 ‘winner’ sequence (UAUGAUAGGGACUUAGGGUG) ( ) (Invitrogen) in a 25 µl volume, including 1× binding buffer (10 mM Tris–HCl, 50 mM KCl, 1 mM DTT, pH 7.5), 2.5% glycerol, 2 unit/µl RNAasin (Promega), 0.25 µg/µl purified BSA and 0.25 µg/µl yeast tRNA (Invitrogen) for 30 min at 30°C. .. The free RNA and RNA–protein complex were detected with stabilized streptavidin-horseradish peroxidase conjugate with chemiluminescent substrate (Pierce).

    Article Title: Neutrophil derived human S100A12 (EN-RAGE) is strongly expressed during chronic active inflammatory bowel disease
    Article Snippet: ELISA was calibrated with purified S100A12 in concentrations ranging from 0.016 to 125 ng/ml. .. Plates were washed and incubated with streptavidin-horseradish peroxidase conjugate (1:5000 dilution; Pierce, Rockford, Illinois, USA) for 30 minutes at 37°C.

    SDS Page:

    Article Title: Sialic Acid Expression in the Mosquito Aedes aegypti and Its Possible Role in Dengue Virus-Vector Interactions
    Article Snippet: SG Glycoprotein Detection by Blot Assay Glycoproteins in the SG protein extracts were identified by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) with a polyacrylamide gradient of 4–20%, which was then stained to detect all carbohydrates using a Pro-Q Emerald 300 Glycoprotein Gel Stain kit (Molecular Probes, Invitrogen P21855), according to the supplier's protocol. .. The membranes were incubated with biotinylated SNA or Canavalia ensiformis agglutinin (ConA; EY Laboratories Inc., USA) at a dilution of 1 : 10 for 3 h at RT, followed by streptavidin-horseradish peroxidase conjugate (43-4323; Zymed Laboratories Inc., USA) at a dilution of 1 : 3000 for 1 h at RT.

    Software:

    Article Title: Poly(ADP-ribosyl)ation of heterogeneous nuclear ribonucleoproteins modulates splicing
    Article Snippet: The free RNA and RNA–protein complex were detected with stabilized streptavidin-horseradish peroxidase conjugate with chemiluminescent substrate (Pierce). .. EMSA was repeated three times, and the signals were measured using the Image J software (NIH).

    Irradiation:

    Article Title: Biochemical and structural features of extracellular vesicle-binding RNA aptamers
    Article Snippet: The filter was exposed to UV irradiation (254 nm) and was blocked in binding buffer that contained 3% BSA and 0.1% Tween-20 (Wako Pure Chemical Industries, Ltd.) for 60 min. .. Following washing, the filter was incubated with streptavidin-horseradish peroxidase conjugate (Thermo Fisher Scientific, Inc.; cat. no. N100; dilution, 1:1,000) for 60 min at room temperature and washed.

    Article Title: Poly(ADP-ribose) controls DE-cadherin-dependent stem cell maintenance and oocyte localization
    Article Snippet: The binding reaction was irradiated with 254 nm UV light for 10 minutes on ice using Spectrolinker UV Crosslinker (Krackeler Scientific, Inc., Albany, NY). .. The protein covalently linked to a stub of the biotin-labeled RNA probe was detected with stabilized streptavidin-horseradish peroxidase conjugate with chemiluminescent substrate (Pierce).

    Article Title: Biochemical and structural features of extracellular vesicle-binding RNA aptamers
    Article Snippet: .. The membrane was exposed to UV irradiation (254 nm) and then to streptavidin-horseradish peroxidase conjugate (Thermo Fisher Scientific, Inc.; cat. no. N100; dilution, 1:4,000) for 60 min at room temperature. .. It was washed three times and, finally, the Amersham ECL Prime Western Blotting Detection reagent (GE Healthcare Life Sciences; cat. no. RPN2232) was used to visualize the chemiluminescence of the aptamer on the membrane.

    Negative Control:

    Article Title: Importance of Uterine Cell Death, Renewal, and Their Hormonal Regulation in Hamsters That Show Progesterone-Dependent Implantation
    Article Snippet: Subsequent immunostaining was performed using biotinylated goat antirabbit secondary antibody, streptavidin-horseradish peroxidase conjugate, and a substrate chromogen mixture (AEC single solution) from Zymed. .. Negative control studies were performed in which PBS was used instead of primary antibody.

    Article Title: Poly(ADP-ribose) controls DE-cadherin-dependent stem cell maintenance and oocyte localization
    Article Snippet: For immunoprecipitation, the reaction with 150 ul polysome lysis buffer was incubated with the rabbit anti-Hrp38 antibody ( ) or rabbit IgG (Sigma) (the negative control) at 1:20 dilution overnight and then with 30 μl protein A agarose (Invitrogen) for 2h at 4°C. .. The protein covalently linked to a stub of the biotin-labeled RNA probe was detected with stabilized streptavidin-horseradish peroxidase conjugate with chemiluminescent substrate (Pierce).

    In Vitro:

    Article Title: Neutrophil derived human S100A12 (EN-RAGE) is strongly expressed during chronic active inflammatory bowel disease
    Article Snippet: Concentrations of S100A12 in the serum of patients and supernatant of in vitro experiments were determined by a double sandwich enzyme linked immunosorbent assay (ELISA) system established in our laboratory. .. Plates were washed and incubated with streptavidin-horseradish peroxidase conjugate (1:5000 dilution; Pierce, Rockford, Illinois, USA) for 30 minutes at 37°C.

    Homogenization:

    Article Title: Intracellular Aβ pathology and early cognitive impairments in a transgenic rat overexpressing human amyloid precursor protein: a multidimensional study
    Article Snippet: The remaining pellets were dissolved in 70% formic acid (FA) with 50% of homogenization volume and sonicated for 30 s at 30% power. .. The monoclonal biotinylated W0-2 (EMI Millipore, USA) recognizing the Aβ N-terminus was used as detection antibody, and the reaction was developed by streptavidin-horseradish peroxidase conjugate and the chromogenic substrate 1-Step Ultra-TMB (Pierce, USA).

    Immunoprecipitation:

    Article Title: Poly(ADP-ribose) controls DE-cadherin-dependent stem cell maintenance and oocyte localization
    Article Snippet: For immunoprecipitation, the reaction with 150 ul polysome lysis buffer was incubated with the rabbit anti-Hrp38 antibody ( ) or rabbit IgG (Sigma) (the negative control) at 1:20 dilution overnight and then with 30 μl protein A agarose (Invitrogen) for 2h at 4°C. .. The protein covalently linked to a stub of the biotin-labeled RNA probe was detected with stabilized streptavidin-horseradish peroxidase conjugate with chemiluminescent substrate (Pierce).

    Fractionation:

    Article Title: Biochemical and structural features of extracellular vesicle-binding RNA aptamers
    Article Snippet: Paragraph title: Fractionation of extracellular vesicles and dot-blotting assay ... The membrane was exposed to UV irradiation (254 nm) and then to streptavidin-horseradish peroxidase conjugate (Thermo Fisher Scientific, Inc.; cat. no. N100; dilution, 1:4,000) for 60 min at room temperature.

    Staining:

    Article Title: Sialic Acid Expression in the Mosquito Aedes aegypti and Its Possible Role in Dengue Virus-Vector Interactions
    Article Snippet: SG Glycoprotein Detection by Blot Assay Glycoproteins in the SG protein extracts were identified by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) with a polyacrylamide gradient of 4–20%, which was then stained to detect all carbohydrates using a Pro-Q Emerald 300 Glycoprotein Gel Stain kit (Molecular Probes, Invitrogen P21855), according to the supplier's protocol. .. The membranes were incubated with biotinylated SNA or Canavalia ensiformis agglutinin (ConA; EY Laboratories Inc., USA) at a dilution of 1 : 10 for 3 h at RT, followed by streptavidin-horseradish peroxidase conjugate (43-4323; Zymed Laboratories Inc., USA) at a dilution of 1 : 3000 for 1 h at RT.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher horseradish peroxidase conjugated streptavidin
    Depletion of glypican-1 stimulates the endocytosis of PrP C . SH-SY5Y cells expressing wild type PrP C were treated with either control or glypican-1 siRNA and then incubated for 60 h. Cells were surface biotinylated and incubated in OptiMEM for 1 h at 37°C. Where indicated, cells were treated with trypsin to remove remaining cell surface PrP C . Cells were then lysed and total PrP C immunoprecipitated from the sample using antibody 3F4. ( A ) Samples were subjected to western blot analysis and the biotin-labelled PrP C fraction was detected with peroxidase-conjugated <t>streptavidin.</t> ( B ) Densitometric analysis (mean ± s.e.m.) of multiple blots from three separate experiments in (A) is shown. ( C ) Expression of glypican-1 (in lysate samples treated with heparinase I and heparinase III) and PrP C in the cell lysates from (A). β-actin was used as a loading control. ( D ) SH-SY5Y cells expressing PrP C were treated with either control siRNA or glypican-1 siRNA and then allowed to reach confluence for 48 h. Cells were subsequently surface biotinylated and incubated in OptiMEM for 1 h at 37°C. Cells were homogenised in the presence of 1% (v/v) Triton X-100 and subjected to buoyant sucrose density gradient centrifugation. ( E ) Densitometric analysis of the proportion of total PrP C present in the detergent soluble fractions of the plasma membrane after siRNA treatment from three independent experiments. ( F ) SH-SY5Y cells expressing PrP C were seeded onto glass coverslips and grown to 50% confluency. Cells were fixed, and then incubated with anti-PrP antibody 3F4 and a glypican-1 polyclonal antibody. Finally, cells were incubated with Alexa488-conjugated rabbit anti-mouse and Alexa594-conjugated goat anti-rabbit antibodies and viewed using a DeltaVision Optical Restoration Microscopy System. Images are representative of three individual experiments. Scale bars equal 10 µm. * P
    Horseradish Peroxidase Conjugated Streptavidin, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 90 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/horseradish peroxidase conjugated streptavidin/product/Thermo Fisher
    Average 99 stars, based on 90 article reviews
    Price from $9.99 to $1999.99
    horseradish peroxidase conjugated streptavidin - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    Image Search Results


    Depletion of glypican-1 stimulates the endocytosis of PrP C . SH-SY5Y cells expressing wild type PrP C were treated with either control or glypican-1 siRNA and then incubated for 60 h. Cells were surface biotinylated and incubated in OptiMEM for 1 h at 37°C. Where indicated, cells were treated with trypsin to remove remaining cell surface PrP C . Cells were then lysed and total PrP C immunoprecipitated from the sample using antibody 3F4. ( A ) Samples were subjected to western blot analysis and the biotin-labelled PrP C fraction was detected with peroxidase-conjugated streptavidin. ( B ) Densitometric analysis (mean ± s.e.m.) of multiple blots from three separate experiments in (A) is shown. ( C ) Expression of glypican-1 (in lysate samples treated with heparinase I and heparinase III) and PrP C in the cell lysates from (A). β-actin was used as a loading control. ( D ) SH-SY5Y cells expressing PrP C were treated with either control siRNA or glypican-1 siRNA and then allowed to reach confluence for 48 h. Cells were subsequently surface biotinylated and incubated in OptiMEM for 1 h at 37°C. Cells were homogenised in the presence of 1% (v/v) Triton X-100 and subjected to buoyant sucrose density gradient centrifugation. ( E ) Densitometric analysis of the proportion of total PrP C present in the detergent soluble fractions of the plasma membrane after siRNA treatment from three independent experiments. ( F ) SH-SY5Y cells expressing PrP C were seeded onto glass coverslips and grown to 50% confluency. Cells were fixed, and then incubated with anti-PrP antibody 3F4 and a glypican-1 polyclonal antibody. Finally, cells were incubated with Alexa488-conjugated rabbit anti-mouse and Alexa594-conjugated goat anti-rabbit antibodies and viewed using a DeltaVision Optical Restoration Microscopy System. Images are representative of three individual experiments. Scale bars equal 10 µm. * P

    Journal: PLoS Pathogens

    Article Title: Glypican-1 Mediates Both Prion Protein Lipid Raft Association and Disease Isoform Formation

    doi: 10.1371/journal.ppat.1000666

    Figure Lengend Snippet: Depletion of glypican-1 stimulates the endocytosis of PrP C . SH-SY5Y cells expressing wild type PrP C were treated with either control or glypican-1 siRNA and then incubated for 60 h. Cells were surface biotinylated and incubated in OptiMEM for 1 h at 37°C. Where indicated, cells were treated with trypsin to remove remaining cell surface PrP C . Cells were then lysed and total PrP C immunoprecipitated from the sample using antibody 3F4. ( A ) Samples were subjected to western blot analysis and the biotin-labelled PrP C fraction was detected with peroxidase-conjugated streptavidin. ( B ) Densitometric analysis (mean ± s.e.m.) of multiple blots from three separate experiments in (A) is shown. ( C ) Expression of glypican-1 (in lysate samples treated with heparinase I and heparinase III) and PrP C in the cell lysates from (A). β-actin was used as a loading control. ( D ) SH-SY5Y cells expressing PrP C were treated with either control siRNA or glypican-1 siRNA and then allowed to reach confluence for 48 h. Cells were subsequently surface biotinylated and incubated in OptiMEM for 1 h at 37°C. Cells were homogenised in the presence of 1% (v/v) Triton X-100 and subjected to buoyant sucrose density gradient centrifugation. ( E ) Densitometric analysis of the proportion of total PrP C present in the detergent soluble fractions of the plasma membrane after siRNA treatment from three independent experiments. ( F ) SH-SY5Y cells expressing PrP C were seeded onto glass coverslips and grown to 50% confluency. Cells were fixed, and then incubated with anti-PrP antibody 3F4 and a glypican-1 polyclonal antibody. Finally, cells were incubated with Alexa488-conjugated rabbit anti-mouse and Alexa594-conjugated goat anti-rabbit antibodies and viewed using a DeltaVision Optical Restoration Microscopy System. Images are representative of three individual experiments. Scale bars equal 10 µm. * P

    Article Snippet: Where indicated, biotin-labelled PrP was detected by subsequent immunoprecipitation of epitope-tagged PrP from the individual fractions using antibody 3F4 (Eurogentec Ltd., Southampton, U.K.) and subsequent immunoblotting using horseradish peroxidase-conjugated streptavidin (Thermo Fisher Scientific, Cramlington, U.K.).

    Techniques: Expressing, Incubation, Immunoprecipitation, Western Blot, Gradient Centrifugation, Microscopy

    Depletion of glypican-1 does not affect cell division or surface levels of PrP C . ( A ) ScN2a cells were seeded into 96 well plates and treated with transfection reagent only or incubated with either control siRNA or one of the four siRNAs targeted to glypican-1. Those experiments exceeding 48 h were dosed with a second treatment of the indicated siRNAs. Cells were then rinsed with PBS and fixed with 70% (v/v) ethanol. Plates were allowed to dry, stained with Hoescht 33342 and the fluorescence measured. ( B ) ScN2a cells were treated with control or glypican-1 siRNA. After 96 h, cell monolayers were labelled with a membrane impermeable biotin reagent. Biotin-labelled cell surface PrP was detected by immunoprecipitation using 6D11 and subsequent immunoblotting using HRP-conjugated streptavidin. Total PrP and PK-resistant PrP (PrP Sc ) were detected by immunoblotting using antibody 6D11. ( C ) Densitometric analysis of the proportion of the relative amount of biotinylated cell surface PrP in the absence or presence of glypican-1 siRNA from three independent experiments.

    Journal: PLoS Pathogens

    Article Title: Glypican-1 Mediates Both Prion Protein Lipid Raft Association and Disease Isoform Formation

    doi: 10.1371/journal.ppat.1000666

    Figure Lengend Snippet: Depletion of glypican-1 does not affect cell division or surface levels of PrP C . ( A ) ScN2a cells were seeded into 96 well plates and treated with transfection reagent only or incubated with either control siRNA or one of the four siRNAs targeted to glypican-1. Those experiments exceeding 48 h were dosed with a second treatment of the indicated siRNAs. Cells were then rinsed with PBS and fixed with 70% (v/v) ethanol. Plates were allowed to dry, stained with Hoescht 33342 and the fluorescence measured. ( B ) ScN2a cells were treated with control or glypican-1 siRNA. After 96 h, cell monolayers were labelled with a membrane impermeable biotin reagent. Biotin-labelled cell surface PrP was detected by immunoprecipitation using 6D11 and subsequent immunoblotting using HRP-conjugated streptavidin. Total PrP and PK-resistant PrP (PrP Sc ) were detected by immunoblotting using antibody 6D11. ( C ) Densitometric analysis of the proportion of the relative amount of biotinylated cell surface PrP in the absence or presence of glypican-1 siRNA from three independent experiments.

    Article Snippet: Where indicated, biotin-labelled PrP was detected by subsequent immunoprecipitation of epitope-tagged PrP from the individual fractions using antibody 3F4 (Eurogentec Ltd., Southampton, U.K.) and subsequent immunoblotting using horseradish peroxidase-conjugated streptavidin (Thermo Fisher Scientific, Cramlington, U.K.).

    Techniques: Transfection, Incubation, Staining, Fluorescence, Immunoprecipitation

    Heparin stimulates the endocytosis of PrP C in a dose-dependent manner and displaces it from detergent-resistant lipid rafts. ( A ) SH-SY5Y cells expressing PrP C were surface biotinylated and then incubated for 1 h at 37°C in the absence or presence of various concentrations of heparin diluted in OptiMEM. Prior to lysis cells were, where indicated, incubated with trypsin to digest cell surface PrP C . Cells were then lysed and PrP C immunoprecipitated from the sample using antibody 3F4. Samples were subjected to SDS PAGE and western blot analysis and the biotin-labelled PrP C detected with peroxidase-conjugated streptavidin. ( B ) Densitometric analysis of multiple blots from four separate experiments as described in (A) is shown. ( C ) SH-SY5Y cells expressing PrP C were surface biotinylated and then incubated in the absence or presence of 50 µM heparin prepared in OptiMEM for 1 h at 37°C. Cells were homogenised in the presence of 1% (v/v) Triton X-100 and subjected to buoyant sucrose density gradient centrifugation. PrP C was immunoprecipitated from equal volumes of each gradient fraction using 3F4 and subjected to SDS-PAGE and western blotting. The gradient fractions from both the untreated and heparin treated cells were analysed on the same SDS gel and immunoblotted under identical conditions. The biotin-labelled PrP C was detected with peroxidase-conjugated streptavidin. Flotillin-1 and transferrin receptor (TfR) were detected by immunoblotting as markers for DRM and detergent-soluble fractions, respectively. ( D ) Densitometric analysis of the proportion of total PrP C in the detergent soluble fractions of the plasma membrane. ( E ) Untransfected SH-SY5Y cells and SH-SY5Y cells expressing either PrP C or PrP-TM were grown to confluence and then incubated for 1 h in the presence or absence of 50 µM heparin prepared in OptiMEM. Media samples were collected and concentrated and cells harvested and lysed. Cell lysate samples were immunoblotted for PrP C using antibody 3F4, with β-actin used as a loading control. ( F ) Quantification of PrP C and PrP-TM levels after treatment of cells with heparin as in (E). Experiments were performed in triplicate and repeated on three occasions. * P

    Journal: PLoS Pathogens

    Article Title: Glypican-1 Mediates Both Prion Protein Lipid Raft Association and Disease Isoform Formation

    doi: 10.1371/journal.ppat.1000666

    Figure Lengend Snippet: Heparin stimulates the endocytosis of PrP C in a dose-dependent manner and displaces it from detergent-resistant lipid rafts. ( A ) SH-SY5Y cells expressing PrP C were surface biotinylated and then incubated for 1 h at 37°C in the absence or presence of various concentrations of heparin diluted in OptiMEM. Prior to lysis cells were, where indicated, incubated with trypsin to digest cell surface PrP C . Cells were then lysed and PrP C immunoprecipitated from the sample using antibody 3F4. Samples were subjected to SDS PAGE and western blot analysis and the biotin-labelled PrP C detected with peroxidase-conjugated streptavidin. ( B ) Densitometric analysis of multiple blots from four separate experiments as described in (A) is shown. ( C ) SH-SY5Y cells expressing PrP C were surface biotinylated and then incubated in the absence or presence of 50 µM heparin prepared in OptiMEM for 1 h at 37°C. Cells were homogenised in the presence of 1% (v/v) Triton X-100 and subjected to buoyant sucrose density gradient centrifugation. PrP C was immunoprecipitated from equal volumes of each gradient fraction using 3F4 and subjected to SDS-PAGE and western blotting. The gradient fractions from both the untreated and heparin treated cells were analysed on the same SDS gel and immunoblotted under identical conditions. The biotin-labelled PrP C was detected with peroxidase-conjugated streptavidin. Flotillin-1 and transferrin receptor (TfR) were detected by immunoblotting as markers for DRM and detergent-soluble fractions, respectively. ( D ) Densitometric analysis of the proportion of total PrP C in the detergent soluble fractions of the plasma membrane. ( E ) Untransfected SH-SY5Y cells and SH-SY5Y cells expressing either PrP C or PrP-TM were grown to confluence and then incubated for 1 h in the presence or absence of 50 µM heparin prepared in OptiMEM. Media samples were collected and concentrated and cells harvested and lysed. Cell lysate samples were immunoblotted for PrP C using antibody 3F4, with β-actin used as a loading control. ( F ) Quantification of PrP C and PrP-TM levels after treatment of cells with heparin as in (E). Experiments were performed in triplicate and repeated on three occasions. * P

    Article Snippet: Where indicated, biotin-labelled PrP was detected by subsequent immunoprecipitation of epitope-tagged PrP from the individual fractions using antibody 3F4 (Eurogentec Ltd., Southampton, U.K.) and subsequent immunoblotting using horseradish peroxidase-conjugated streptavidin (Thermo Fisher Scientific, Cramlington, U.K.).

    Techniques: Expressing, Incubation, Lysis, Immunoprecipitation, SDS Page, Western Blot, Gradient Centrifugation, SDS-Gel

    Depletion of glypican-1 inhibits the association of PrP-TM with DRMs. SH-SY5Y cells expressing PrP-TM were treated with either control siRNA or siRNA targeted to glypican-1 and then allowed to reach confluence for 48 h. Cells were subsequently surface biotinylated and incubated in OptiMEM for 1 h at 37°C in the presence of Tyrphostin A23 to block endocytosis. The media was removed and the cells washed in phosphate-buffered saline prior to homogenisation in the presence of 1% (v/v) Triton X-100 and subjected to buoyant sucrose density gradient centrifugation. ( A ) Quantification of glypican-1 and PrP-TM expression in cell lysates. To detect glypican-1, cell lysate samples were treated with heparinase I and heparinase III prior to electrophoresis as described in the materials and methods section. ( B ) PrP-TM was immunoprecipitated from equal volumes of each gradient fraction using 3F4 and then subjected to western blotting with peroxidase-conjugated streptavidin. Flotillin-1 and transferrin receptor (TfR) were detected by immunoblotting as markers for DRM and detergent-soluble fractions, respectively. ( C ) Densitometric analysis of the proportion of total PrP-TM present in the detergent soluble fractions of the plasma membrane after siRNA treatment from multiple blots from three independent experiments. * P

    Journal: PLoS Pathogens

    Article Title: Glypican-1 Mediates Both Prion Protein Lipid Raft Association and Disease Isoform Formation

    doi: 10.1371/journal.ppat.1000666

    Figure Lengend Snippet: Depletion of glypican-1 inhibits the association of PrP-TM with DRMs. SH-SY5Y cells expressing PrP-TM were treated with either control siRNA or siRNA targeted to glypican-1 and then allowed to reach confluence for 48 h. Cells were subsequently surface biotinylated and incubated in OptiMEM for 1 h at 37°C in the presence of Tyrphostin A23 to block endocytosis. The media was removed and the cells washed in phosphate-buffered saline prior to homogenisation in the presence of 1% (v/v) Triton X-100 and subjected to buoyant sucrose density gradient centrifugation. ( A ) Quantification of glypican-1 and PrP-TM expression in cell lysates. To detect glypican-1, cell lysate samples were treated with heparinase I and heparinase III prior to electrophoresis as described in the materials and methods section. ( B ) PrP-TM was immunoprecipitated from equal volumes of each gradient fraction using 3F4 and then subjected to western blotting with peroxidase-conjugated streptavidin. Flotillin-1 and transferrin receptor (TfR) were detected by immunoblotting as markers for DRM and detergent-soluble fractions, respectively. ( C ) Densitometric analysis of the proportion of total PrP-TM present in the detergent soluble fractions of the plasma membrane after siRNA treatment from multiple blots from three independent experiments. * P

    Article Snippet: Where indicated, biotin-labelled PrP was detected by subsequent immunoprecipitation of epitope-tagged PrP from the individual fractions using antibody 3F4 (Eurogentec Ltd., Southampton, U.K.) and subsequent immunoblotting using horseradish peroxidase-conjugated streptavidin (Thermo Fisher Scientific, Cramlington, U.K.).

    Techniques: Expressing, Incubation, Blocking Assay, Homogenization, Gradient Centrifugation, Electrophoresis, Immunoprecipitation, Western Blot

    The association of PrP-TM with DRMs is disrupted by treatment of cells with either heparin or bacterial PI-PLC. SH-SY5Y cells expressing PrP-TM were surface biotinylated and then ( A ) incubated in the absence or presence of 50 µM heparin prepared in OptiMEM for 1 h at 37°C or ( B ) incubated in the absence or presence of 1 U/ml bacterial PI-PLC for 1 h at 4°C. Cells were homogenised in the presence of 1% (v/v) Triton X-100 and subjected to buoyant sucrose density gradient centrifugation. PrP-TM was immunoprecipitated from equal volumes of each gradient fraction using 3F4 and subjected to western blotting. The biotin-labelled PrP-TM fraction was detected with peroxidase-conjugated streptavidin. Flotillin-1 and transferrin receptor (TfR) were detected by immunoblotting as markers for DRM and detergent-soluble fractions respectively. ( C ) Densitometric analysis of the proportion of total PrP-TM present in the detergent soluble fractions of the plasma membrane after heparin and PI-PLC treatment. Experiments were performed in triplicate and repeated on three occasions. * P

    Journal: PLoS Pathogens

    Article Title: Glypican-1 Mediates Both Prion Protein Lipid Raft Association and Disease Isoform Formation

    doi: 10.1371/journal.ppat.1000666

    Figure Lengend Snippet: The association of PrP-TM with DRMs is disrupted by treatment of cells with either heparin or bacterial PI-PLC. SH-SY5Y cells expressing PrP-TM were surface biotinylated and then ( A ) incubated in the absence or presence of 50 µM heparin prepared in OptiMEM for 1 h at 37°C or ( B ) incubated in the absence or presence of 1 U/ml bacterial PI-PLC for 1 h at 4°C. Cells were homogenised in the presence of 1% (v/v) Triton X-100 and subjected to buoyant sucrose density gradient centrifugation. PrP-TM was immunoprecipitated from equal volumes of each gradient fraction using 3F4 and subjected to western blotting. The biotin-labelled PrP-TM fraction was detected with peroxidase-conjugated streptavidin. Flotillin-1 and transferrin receptor (TfR) were detected by immunoblotting as markers for DRM and detergent-soluble fractions respectively. ( C ) Densitometric analysis of the proportion of total PrP-TM present in the detergent soluble fractions of the plasma membrane after heparin and PI-PLC treatment. Experiments were performed in triplicate and repeated on three occasions. * P

    Article Snippet: Where indicated, biotin-labelled PrP was detected by subsequent immunoprecipitation of epitope-tagged PrP from the individual fractions using antibody 3F4 (Eurogentec Ltd., Southampton, U.K.) and subsequent immunoblotting using horseradish peroxidase-conjugated streptavidin (Thermo Fisher Scientific, Cramlington, U.K.).

    Techniques: Planar Chromatography, Expressing, Incubation, Gradient Centrifugation, Immunoprecipitation, Western Blot

    Oxidative modification of identified proteins in planta upon H 2 O 2 treatment. Transgenic plants expressing the protein of interest fused with the FLAG tag were vacuum infiltrated with either water (mock) or 5 mM H 2 O 2 . For analysis of AtCIAPIN1, eEF1α, and AtPTP1, free thiols in the total protein were labeled with BIAM during protein extraction. For analysis of AtNAP1;1 and AtPDIL1-1, free thiols in the samples were first alkylated by IAM. Samples were then treated with DTT and newly generated free thiols were labeled by BIAM. After that, FLAG-tagged protein from each sample was affinity purified, separated by SDS-PAGE, and detected by HRP-Conjugated Streptavidin (to determine the amount of BIAM attached to the FLAG-tagged protein) or by the anti-FLAG M2 antibody (to determine the amount of the total recombinant protein).

    Journal: Journal of Proteome Research

    Article Title: Proteomic Analysis of Early-Responsive Redox-Sensitive Proteins in Arabidopsis

    doi: 10.1021/pr200918f

    Figure Lengend Snippet: Oxidative modification of identified proteins in planta upon H 2 O 2 treatment. Transgenic plants expressing the protein of interest fused with the FLAG tag were vacuum infiltrated with either water (mock) or 5 mM H 2 O 2 . For analysis of AtCIAPIN1, eEF1α, and AtPTP1, free thiols in the total protein were labeled with BIAM during protein extraction. For analysis of AtNAP1;1 and AtPDIL1-1, free thiols in the samples were first alkylated by IAM. Samples were then treated with DTT and newly generated free thiols were labeled by BIAM. After that, FLAG-tagged protein from each sample was affinity purified, separated by SDS-PAGE, and detected by HRP-Conjugated Streptavidin (to determine the amount of BIAM attached to the FLAG-tagged protein) or by the anti-FLAG M2 antibody (to determine the amount of the total recombinant protein).

    Article Snippet: Immunoprecipitated protein was separated by SDS-PAGE and immunoblotted with either anti-FLAG M2-Peroxidase (HRP) antibody (Sigma) or Horseradish Peroxidase-Conjugated Streptavidin (Thermo Scientific).

    Techniques: Modification, Transgenic Assay, Expressing, FLAG-tag, Labeling, Protein Extraction, Generated, Affinity Purification, SDS Page, Recombinant

    Comparison of histone extraction protocols, and specificity testing of streptavidin and anti-biotin Panel A: Nuclear histones were extracted from Jurkat cells (lanes 1, 5, and 9) or HeLa cells (lanes 3, 7, and 11) by using HCl; for comparison histones were extracted from Jurkat cells (lanes 2, 6, and 10) or HeLa cells (lanes 4, 8, and 12) by using H 2 SO 4 +TCA+acetone/HCl+acetone. Histones were probed with coomassie blue (lanes 1–4) and antibodies to the C-termini in histone H3 (lanes 5–8) and H4 (lanes 9–12). Panel B: HCl extracts of Jurkat cell histones (lanes 1, 4, 7, 10, and 13), recombinant human histone H4 (lanes 2, 5, 8, 11, and 14), and chemically biotinylated histone H4 (lanes 3, 6, 9, 12, and 15) were probed with streptavidin without biotin competitor (lanes 1–3) and with 5 mM free biotin (lanes 4–6), and with anti-biotin without biotin competitor (lanes 7–9) and with 5 mM free biotin (lanes 10–12), and with coomassie blue (lanes 13–15).

    Journal: Molecular genetics and metabolism

    Article Title: Biotinylation is a natural, albeit rare, modification of human histones

    doi: 10.1016/j.ymgme.2011.08.030

    Figure Lengend Snippet: Comparison of histone extraction protocols, and specificity testing of streptavidin and anti-biotin Panel A: Nuclear histones were extracted from Jurkat cells (lanes 1, 5, and 9) or HeLa cells (lanes 3, 7, and 11) by using HCl; for comparison histones were extracted from Jurkat cells (lanes 2, 6, and 10) or HeLa cells (lanes 4, 8, and 12) by using H 2 SO 4 +TCA+acetone/HCl+acetone. Histones were probed with coomassie blue (lanes 1–4) and antibodies to the C-termini in histone H3 (lanes 5–8) and H4 (lanes 9–12). Panel B: HCl extracts of Jurkat cell histones (lanes 1, 4, 7, 10, and 13), recombinant human histone H4 (lanes 2, 5, 8, 11, and 14), and chemically biotinylated histone H4 (lanes 3, 6, 9, 12, and 15) were probed with streptavidin without biotin competitor (lanes 1–3) and with 5 mM free biotin (lanes 4–6), and with anti-biotin without biotin competitor (lanes 7–9) and with 5 mM free biotin (lanes 10–12), and with coomassie blue (lanes 13–15).

    Article Snippet: Controls included pre-immune serum, horseradish peroxidase-conjugated streptavidin (Thermo Scientific), and IRDye 800CW Streptavidin (LI-COR).

    Techniques: Recombinant

    Biotinylation marks can be detected in bulk extracts from human cells, using streptavidin and anti-biotin as probes Bulk extracts of histone extracts from various cell lineages were probed with streptavidin (panel A), anti-biotin (panel B), and the loading and transfer controls coomassie blue (panel C), anti-H3 (panel D), and anti-H4 (panel E). Panel F: Histones from HeLa cells were extracted with H 2 SO 4 +TCA+acetone/HCl+acetone. Ten or five microgram of histones were loaded per well. Blots were blocked with PBS containing 5% BSA. After probing with horseradish peroxidase-conjugated anti-biotin or Nutravidin, the blots were washed for 6 hrs, and exposed to autoradiography film for 1 min.

    Journal: Molecular genetics and metabolism

    Article Title: Biotinylation is a natural, albeit rare, modification of human histones

    doi: 10.1016/j.ymgme.2011.08.030

    Figure Lengend Snippet: Biotinylation marks can be detected in bulk extracts from human cells, using streptavidin and anti-biotin as probes Bulk extracts of histone extracts from various cell lineages were probed with streptavidin (panel A), anti-biotin (panel B), and the loading and transfer controls coomassie blue (panel C), anti-H3 (panel D), and anti-H4 (panel E). Panel F: Histones from HeLa cells were extracted with H 2 SO 4 +TCA+acetone/HCl+acetone. Ten or five microgram of histones were loaded per well. Blots were blocked with PBS containing 5% BSA. After probing with horseradish peroxidase-conjugated anti-biotin or Nutravidin, the blots were washed for 6 hrs, and exposed to autoradiography film for 1 min.

    Article Snippet: Controls included pre-immune serum, horseradish peroxidase-conjugated streptavidin (Thermo Scientific), and IRDye 800CW Streptavidin (LI-COR).

    Techniques: Autoradiography

    Specificity of antibodies to H3K4bio, H3K9bio and H3K18bio Panel A: Confirmation of equal loading of peptides H3K4bio, H3K9bio, and H3K18bio with streptavidin. Panel B: Transblots of peptides N 1–25 (non-biotinylated negative control), H3K4bio, H3K9bio, and H3K18bio were probed with anti-H3K4bio (left), anti-H3K9bio (middle), and anti-H3K18bio (right). Panel C: HCl extracts of histones from Jurkat cells were probed using streptavidin, anti-H3K9bio, and anti-H3K18bio; samples of biotin-free histones (“-”) were generated by using avidin agarose. Panel D: Bulk HCl extracts of histones from Jurkat cells were probed with anti-H3K9bio (top) and anti-H3K18bio (bottom) after pre-incubation of antibodies with increasing amounts of competing peptides H3K4bio, H3K9bio, and H3K18bio; controls (“C”) were prepared without peptide competitors. Note the difference in the order of peptide competitors in the two gels. For some gels, bands from the same analytical runs were electronically re-arranged to facilitate comparisons. Panel E: Peptides H3K9bio, H3K9ac, and H3K9me2 were probed with streptavidin (lanes 1, 2, 9 and 10), anti-H3K9bio (lanes 3, 4, 11 and 12), anti-H3K9ac (lanes 5 and 6), and anti-H3K9me2 (lanes 13 and 14); Ponceau S was used as loading control (lanes 7, 8, 15 and 16). Panel F: Peptides H3K18bio and H3K18ac were probed with streptavidin (lanes 1 and 2), anti-H3K18bio (lanes 3 and 4) and anti-H3K18ac (lanes 5 and 6); Ponceau S was used as loading control (lanes 7 and 8).

    Journal: Molecular genetics and metabolism

    Article Title: Biotinylation is a natural, albeit rare, modification of human histones

    doi: 10.1016/j.ymgme.2011.08.030

    Figure Lengend Snippet: Specificity of antibodies to H3K4bio, H3K9bio and H3K18bio Panel A: Confirmation of equal loading of peptides H3K4bio, H3K9bio, and H3K18bio with streptavidin. Panel B: Transblots of peptides N 1–25 (non-biotinylated negative control), H3K4bio, H3K9bio, and H3K18bio were probed with anti-H3K4bio (left), anti-H3K9bio (middle), and anti-H3K18bio (right). Panel C: HCl extracts of histones from Jurkat cells were probed using streptavidin, anti-H3K9bio, and anti-H3K18bio; samples of biotin-free histones (“-”) were generated by using avidin agarose. Panel D: Bulk HCl extracts of histones from Jurkat cells were probed with anti-H3K9bio (top) and anti-H3K18bio (bottom) after pre-incubation of antibodies with increasing amounts of competing peptides H3K4bio, H3K9bio, and H3K18bio; controls (“C”) were prepared without peptide competitors. Note the difference in the order of peptide competitors in the two gels. For some gels, bands from the same analytical runs were electronically re-arranged to facilitate comparisons. Panel E: Peptides H3K9bio, H3K9ac, and H3K9me2 were probed with streptavidin (lanes 1, 2, 9 and 10), anti-H3K9bio (lanes 3, 4, 11 and 12), anti-H3K9ac (lanes 5 and 6), and anti-H3K9me2 (lanes 13 and 14); Ponceau S was used as loading control (lanes 7, 8, 15 and 16). Panel F: Peptides H3K18bio and H3K18ac were probed with streptavidin (lanes 1 and 2), anti-H3K18bio (lanes 3 and 4) and anti-H3K18ac (lanes 5 and 6); Ponceau S was used as loading control (lanes 7 and 8).

    Article Snippet: Controls included pre-immune serum, horseradish peroxidase-conjugated streptavidin (Thermo Scientific), and IRDye 800CW Streptavidin (LI-COR).

    Techniques: Negative Control, Generated, Avidin-Biotin Assay, Incubation

    Specificity of antibodies to H4K8bio and H4K12bio Panel A: Transblots of peptides N 1–19 (non-biotinylated negative control), H4K8bio, and H4K12bio were probed with anti-H4K8bio; pre-immune serum was used as negative control. Panel B: HCl extracts of histones from Jurkat cells were probed using streptavidin and anti-H4K8bio; samples of biotin-free histones (“-”) were generated by using avidin agarose. Panel C: HCl extracts of histones from Jurkat cells were probed with anti-H4K8bio after pre-incubation of antibodies with increasing amounts of competing peptides H4K8bio and H4K12bio; controls (“C”) were prepared without peptide competitors. For some gels, bands from the same analytical runs were electronically rearranged to facilitate comparisons. Panel D: Peptides H4K8bio and H4K8ac were probed with streptavidin (lanes 1 and 2), anti-H4K8bio (lanes 3 and 4) and anti-H4K8ac (lanes 5 and 6); Ponceau S was used as loading control (lanes 7 and 8). Panel E: Peptides H4K12bio and H4K12ac were probed with streptavidin (lanes 1 and 2), anti-H4K12bio (lanes 3 and 4) and anti-H4K12ac (lanes 5 and 6); Ponceau S was used as loading control (lanes 7 and 8).

    Journal: Molecular genetics and metabolism

    Article Title: Biotinylation is a natural, albeit rare, modification of human histones

    doi: 10.1016/j.ymgme.2011.08.030

    Figure Lengend Snippet: Specificity of antibodies to H4K8bio and H4K12bio Panel A: Transblots of peptides N 1–19 (non-biotinylated negative control), H4K8bio, and H4K12bio were probed with anti-H4K8bio; pre-immune serum was used as negative control. Panel B: HCl extracts of histones from Jurkat cells were probed using streptavidin and anti-H4K8bio; samples of biotin-free histones (“-”) were generated by using avidin agarose. Panel C: HCl extracts of histones from Jurkat cells were probed with anti-H4K8bio after pre-incubation of antibodies with increasing amounts of competing peptides H4K8bio and H4K12bio; controls (“C”) were prepared without peptide competitors. For some gels, bands from the same analytical runs were electronically rearranged to facilitate comparisons. Panel D: Peptides H4K8bio and H4K8ac were probed with streptavidin (lanes 1 and 2), anti-H4K8bio (lanes 3 and 4) and anti-H4K8ac (lanes 5 and 6); Ponceau S was used as loading control (lanes 7 and 8). Panel E: Peptides H4K12bio and H4K12ac were probed with streptavidin (lanes 1 and 2), anti-H4K12bio (lanes 3 and 4) and anti-H4K12ac (lanes 5 and 6); Ponceau S was used as loading control (lanes 7 and 8).

    Article Snippet: Controls included pre-immune serum, horseradish peroxidase-conjugated streptavidin (Thermo Scientific), and IRDye 800CW Streptavidin (LI-COR).

    Techniques: Negative Control, Generated, Avidin-Biotin Assay, Incubation

    Validation of the biotin depletion and repletion protocol Panel A: Jurkat cells after a 2-wk depletion in biotin-deficient medium (0.025 nM, lane 1) compared with cells cultured in medium containing a physiological concentration of biotin (0.25 nM) (lane 2), and cells after a 1-wk repletion in medium containing a pharmacological concentration of biotin (10 nM) (lane 3). Biotinylated carboxylases were probed using streptavidin (SA). Equal expression, loading, and transfer of carboxylases was confirmed using anti-PC and anti-PCC. Panel B: As described for panel A, but HeLa cells (lanes 4–6) were substituted for Jurkat cells.

    Journal: Molecular genetics and metabolism

    Article Title: Biotinylation is a natural, albeit rare, modification of human histones

    doi: 10.1016/j.ymgme.2011.08.030

    Figure Lengend Snippet: Validation of the biotin depletion and repletion protocol Panel A: Jurkat cells after a 2-wk depletion in biotin-deficient medium (0.025 nM, lane 1) compared with cells cultured in medium containing a physiological concentration of biotin (0.25 nM) (lane 2), and cells after a 1-wk repletion in medium containing a pharmacological concentration of biotin (10 nM) (lane 3). Biotinylated carboxylases were probed using streptavidin (SA). Equal expression, loading, and transfer of carboxylases was confirmed using anti-PC and anti-PCC. Panel B: As described for panel A, but HeLa cells (lanes 4–6) were substituted for Jurkat cells.

    Article Snippet: Controls included pre-immune serum, horseradish peroxidase-conjugated streptavidin (Thermo Scientific), and IRDye 800CW Streptavidin (LI-COR).

    Techniques: Cell Culture, Concentration Assay, Expressing, Periodic Counter-current Chromatography

    Nuclear CD44 associates with STAT3 and functions to modulate transcription. (A) Confocal microscopy of H1299 cells cultured in serum-free medium for 24 h and treated with control IgG or H-3 for 1 h. (B) Nuclear (N) and cytosolic (C) fractions were prepared from AZ521/mock and AZ521/CD44 cells and immunoprecipitated followed by Western blotting. (C) Nuclear (Nuc) and cytosolic (Cyto) fractions were immunoprecipitated followed by Western blotting. (D) Nuclear extracts were prepared from the parental H1299 and HT29 cells or cell clones stably harboring lentivirus-encoded control (Cont) shRNA or shRNA targeting CD44 and immunoprecipitated followed by Western blotting. (E) Confocal microscopy of AZ521/CD44 cells with anti-STAT3 (in red) after incubation with control IgG or H-3 for 1 and 2.5 h. (F) AZ521/CD44 cells were incubated with biotin-conjugated H-3 at 4°C. After removal to 37°C for 1 h, cytosolic and nuclear fractions and immunoprecipitates from streptavidin beads were analyzed by Western blotting. (G) Nuclear extracts were prepared from AZ521/CD44 (top) and AZ521/CD44(NLS) mutant (bottom) cells after cross-linking with 1% formaldehyde. ChIP was performed using anti-CD44 and anti-STAT3. PCR amplification of designated regions within cyclin D1 promoter was performed. (H) Nuclear extracts were prepared from AZ521/mock and AZ521/CD44 s cells cultured in serum-free medium for 24 h. EMSA was performed with biotin-labeled double-stranded oligonucleotide probes corresponding to various regions of cyclin D1 promoter in the presence and absence of anti-CD44, anti-STAT3, or anti-p300 antibodies. Shifted and supershifted complexes are indicated by arrowheads. A nonspecific band is indicated by an asterisk. Ab, antibody. (I) Reporter assays were performed in AZ521 cells and AZ521 cell clones stably harboring lentivirus-encoded control shRNA or shRNA targeting STAT3 or p300 using the pFR-Luc reporter plasmid containing five copies of GAL4 DNA–binding sites. Data are presented as the means ± SD and were derived from at least three independent experiments. *, P

    Journal: The Journal of Cell Biology

    Article Title: Acetylation and activation of STAT3 mediated by nuclear translocation of CD44

    doi: 10.1083/jcb.200812060

    Figure Lengend Snippet: Nuclear CD44 associates with STAT3 and functions to modulate transcription. (A) Confocal microscopy of H1299 cells cultured in serum-free medium for 24 h and treated with control IgG or H-3 for 1 h. (B) Nuclear (N) and cytosolic (C) fractions were prepared from AZ521/mock and AZ521/CD44 cells and immunoprecipitated followed by Western blotting. (C) Nuclear (Nuc) and cytosolic (Cyto) fractions were immunoprecipitated followed by Western blotting. (D) Nuclear extracts were prepared from the parental H1299 and HT29 cells or cell clones stably harboring lentivirus-encoded control (Cont) shRNA or shRNA targeting CD44 and immunoprecipitated followed by Western blotting. (E) Confocal microscopy of AZ521/CD44 cells with anti-STAT3 (in red) after incubation with control IgG or H-3 for 1 and 2.5 h. (F) AZ521/CD44 cells were incubated with biotin-conjugated H-3 at 4°C. After removal to 37°C for 1 h, cytosolic and nuclear fractions and immunoprecipitates from streptavidin beads were analyzed by Western blotting. (G) Nuclear extracts were prepared from AZ521/CD44 (top) and AZ521/CD44(NLS) mutant (bottom) cells after cross-linking with 1% formaldehyde. ChIP was performed using anti-CD44 and anti-STAT3. PCR amplification of designated regions within cyclin D1 promoter was performed. (H) Nuclear extracts were prepared from AZ521/mock and AZ521/CD44 s cells cultured in serum-free medium for 24 h. EMSA was performed with biotin-labeled double-stranded oligonucleotide probes corresponding to various regions of cyclin D1 promoter in the presence and absence of anti-CD44, anti-STAT3, or anti-p300 antibodies. Shifted and supershifted complexes are indicated by arrowheads. A nonspecific band is indicated by an asterisk. Ab, antibody. (I) Reporter assays were performed in AZ521 cells and AZ521 cell clones stably harboring lentivirus-encoded control shRNA or shRNA targeting STAT3 or p300 using the pFR-Luc reporter plasmid containing five copies of GAL4 DNA–binding sites. Data are presented as the means ± SD and were derived from at least three independent experiments. *, P

    Article Snippet: DNA–protein complexes were fractionated by PAGE and visualized by horseradish peroxidase–conjugated streptavidin using the LightShift Chemiluminescent EMSA kit (Thermo Fisher Scientific).

    Techniques: Confocal Microscopy, Cell Culture, Immunoprecipitation, Western Blot, Clone Assay, Stable Transfection, shRNA, Incubation, Mutagenesis, Chromatin Immunoprecipitation, Polymerase Chain Reaction, Amplification, Labeling, Plasmid Preparation, Binding Assay, Derivative Assay

    Nuclear localization of full-length CD44. (A) Immunohistochemistry of nuclear CD44 in human gastric mucosal (a) and cancerous (b–d) tissues using anti-CD44 v 6 antibody, with nuclei counterstained in hematoxylin. (B) Western blot analyses of nuclear (Nuc) and cytosolic (Cyto) fractions of human gastric (GC), colon (CRC), and lung (NSCLC) cancer cell lines. NUGC, Nagoya University gastric cancer. (C and D) HT29 (C) and H1299 (D) cells were surface labeled with biotin at 4°C followed by incubation at 37°C in the presence of OPN (C) and H-3 (D). The nuclear fraction was incubated with streptavidin beads and subjected to Western blotting. (B–D) Molecular mass is shown in kilodaltons. (E) H1299 and AZ521/CD44 cells were suspended in medium for 30 min, replated on dishes for 1 h, and immunostained using H-3 (top) and anti-myc (bottom) antibodies. Representative images taken by confocal laser microscopy are shown. (F) H1299 cells were incubated with biotin-conjugated control IgG or H-3 at 4°C followed by further incubation at 37°C for 60 min. After removing surface-retained biotin, cells were fixed and stained by avidin. Bars: (A) 100 µm; (E) 10 µm; (F) 25 µm.

    Journal: The Journal of Cell Biology

    Article Title: Acetylation and activation of STAT3 mediated by nuclear translocation of CD44

    doi: 10.1083/jcb.200812060

    Figure Lengend Snippet: Nuclear localization of full-length CD44. (A) Immunohistochemistry of nuclear CD44 in human gastric mucosal (a) and cancerous (b–d) tissues using anti-CD44 v 6 antibody, with nuclei counterstained in hematoxylin. (B) Western blot analyses of nuclear (Nuc) and cytosolic (Cyto) fractions of human gastric (GC), colon (CRC), and lung (NSCLC) cancer cell lines. NUGC, Nagoya University gastric cancer. (C and D) HT29 (C) and H1299 (D) cells were surface labeled with biotin at 4°C followed by incubation at 37°C in the presence of OPN (C) and H-3 (D). The nuclear fraction was incubated with streptavidin beads and subjected to Western blotting. (B–D) Molecular mass is shown in kilodaltons. (E) H1299 and AZ521/CD44 cells were suspended in medium for 30 min, replated on dishes for 1 h, and immunostained using H-3 (top) and anti-myc (bottom) antibodies. Representative images taken by confocal laser microscopy are shown. (F) H1299 cells were incubated with biotin-conjugated control IgG or H-3 at 4°C followed by further incubation at 37°C for 60 min. After removing surface-retained biotin, cells were fixed and stained by avidin. Bars: (A) 100 µm; (E) 10 µm; (F) 25 µm.

    Article Snippet: DNA–protein complexes were fractionated by PAGE and visualized by horseradish peroxidase–conjugated streptavidin using the LightShift Chemiluminescent EMSA kit (Thermo Fisher Scientific).

    Techniques: Immunohistochemistry, Western Blot, Labeling, Incubation, Microscopy, Staining, Avidin-Biotin Assay