streptavidin conjugated horseradish peroxidase  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    Thermo Fisher streptavidin conjugated horseradish peroxidase
    Composition of the P protein complex bound to 5′-vRNA. Nuclear extracts from Vac3P or VacT7 infected HeLa cells were incubated with a biotinylated RNA oligonucleotide containing the conserved 5′ terminal sequence of vRNA bound to <t>streptavidin</t> coated paramagnetic beads. Bound proteins were then analysed by western blot using C-terminal peptide antibodies specific for ( A ) PB1, ( B ) PB2 and ( C ) PA. Lane 1, 5′-vRNA coated SA-beads incubated with Vac3P extract. Lane 2, 5′-vRNA coated SA-beads incubated with VacT7 extract. Lanes 3 and 4, uncoated SA-beads incubated with Vac3P or VacT7 extracts, respectively. Lane 5, total Vac3P extract. Lane 6, total VacT7 extract. Lane 7, purified A/PR/8/34 virus marker.
    Streptavidin Conjugated Horseradish Peroxidase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 87 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/streptavidin conjugated horseradish peroxidase/product/Thermo Fisher
    Average 93 stars, based on 87 article reviews
    Price from $9.99 to $1999.99
    streptavidin conjugated horseradish peroxidase - by Bioz Stars, 2020-04
    93/100 stars

    Images

    1) Product Images from "Definition of the minimal viral components required for the initiation of unprimed RNA synthesis by influenza virus RNA polymerase"

    Article Title: Definition of the minimal viral components required for the initiation of unprimed RNA synthesis by influenza virus RNA polymerase

    Journal: Nucleic Acids Research

    doi:

    Composition of the P protein complex bound to 5′-vRNA. Nuclear extracts from Vac3P or VacT7 infected HeLa cells were incubated with a biotinylated RNA oligonucleotide containing the conserved 5′ terminal sequence of vRNA bound to streptavidin coated paramagnetic beads. Bound proteins were then analysed by western blot using C-terminal peptide antibodies specific for ( A ) PB1, ( B ) PB2 and ( C ) PA. Lane 1, 5′-vRNA coated SA-beads incubated with Vac3P extract. Lane 2, 5′-vRNA coated SA-beads incubated with VacT7 extract. Lanes 3 and 4, uncoated SA-beads incubated with Vac3P or VacT7 extracts, respectively. Lane 5, total Vac3P extract. Lane 6, total VacT7 extract. Lane 7, purified A/PR/8/34 virus marker.
    Figure Legend Snippet: Composition of the P protein complex bound to 5′-vRNA. Nuclear extracts from Vac3P or VacT7 infected HeLa cells were incubated with a biotinylated RNA oligonucleotide containing the conserved 5′ terminal sequence of vRNA bound to streptavidin coated paramagnetic beads. Bound proteins were then analysed by western blot using C-terminal peptide antibodies specific for ( A ) PB1, ( B ) PB2 and ( C ) PA. Lane 1, 5′-vRNA coated SA-beads incubated with Vac3P extract. Lane 2, 5′-vRNA coated SA-beads incubated with VacT7 extract. Lanes 3 and 4, uncoated SA-beads incubated with Vac3P or VacT7 extracts, respectively. Lane 5, total Vac3P extract. Lane 6, total VacT7 extract. Lane 7, purified A/PR/8/34 virus marker.

    Techniques Used: Infection, Incubation, Sequencing, Western Blot, Purification, Marker

    2) Product Images from "Primary glia expressing the G93A-SOD1 mutation present a neuroinflammatory phenotype and provide a cellular system for studies of glial inflammation"

    Article Title: Primary glia expressing the G93A-SOD1 mutation present a neuroinflammatory phenotype and provide a cellular system for studies of glial inflammation

    Journal: Journal of Neuroinflammation

    doi: 10.1186/1742-2094-3-2

    Basal and cytokine-stimulated protein carbonylation is increased in G93A-SOD1 astrocyte cultures. Cells were stimulated for 48 hours with 50 U/mL IFNγ plus 40 ng/mL TNFα, lysed in the presence or absence of biotin-LC-hydrazide (+ or - label as indicated), blotted onto a PVDF membrane and probed with streptavidin-conjugated horseradish peroxidase.
    Figure Legend Snippet: Basal and cytokine-stimulated protein carbonylation is increased in G93A-SOD1 astrocyte cultures. Cells were stimulated for 48 hours with 50 U/mL IFNγ plus 40 ng/mL TNFα, lysed in the presence or absence of biotin-LC-hydrazide (+ or - label as indicated), blotted onto a PVDF membrane and probed with streptavidin-conjugated horseradish peroxidase.

    Techniques Used:

    3) Product Images from "Regulation of Calcium/Calmodulin-dependent Kinase IV by O-GlcNAc Modification *"

    Article Title: Regulation of Calcium/Calmodulin-dependent Kinase IV by O-GlcNAc Modification *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M109.007310

    CaMKIV is GlcNAcylated. A–D, lysates from HEK293 cells transfected with empty HA plasmid or HA-CaMKIV were immunoprecipitated for HA. A, subjected to galactosyltransferase labeling in the presence of UDP-[ 3 H]galactose for autoradiography. B, labeled in the presence of UDP-GalNAz and reacted with TAMRA alkyne for detection by in-gel fluorescence. C, treated with β-elimination. IP , immunoprecipitation; IB , immunoblot. D, treated with γ-phosphatase (γ- PPase ) or GlcNAcase prior to immunoblotting for O -GlcNAc and HA. A, prior to autoradiography, the gel was stained for total protein using Coomassie Brilliant Blue G-250 ( CBB G250 ). B, TAMRA fluorescence was detected in-gel prior to staining for total protein using SYPRO Ruby. E, rat cerebellum extract was immunoprecipitated for CaMKIV, subjected to galactosyltransferase labeling in the presence of UDP-GalNAz, reacted with biotin alkyne, and immunoblotted for CaMKIV or biotin (using streptavidin-horseradish peroxidase). F, lysates from Jurkat cells were immunoprecipitated for CaMKIV or using nonspecific ( ns ) mouse antibodies and immunoblotted for O -GlcNAc or CaMKIV.
    Figure Legend Snippet: CaMKIV is GlcNAcylated. A–D, lysates from HEK293 cells transfected with empty HA plasmid or HA-CaMKIV were immunoprecipitated for HA. A, subjected to galactosyltransferase labeling in the presence of UDP-[ 3 H]galactose for autoradiography. B, labeled in the presence of UDP-GalNAz and reacted with TAMRA alkyne for detection by in-gel fluorescence. C, treated with β-elimination. IP , immunoprecipitation; IB , immunoblot. D, treated with γ-phosphatase (γ- PPase ) or GlcNAcase prior to immunoblotting for O -GlcNAc and HA. A, prior to autoradiography, the gel was stained for total protein using Coomassie Brilliant Blue G-250 ( CBB G250 ). B, TAMRA fluorescence was detected in-gel prior to staining for total protein using SYPRO Ruby. E, rat cerebellum extract was immunoprecipitated for CaMKIV, subjected to galactosyltransferase labeling in the presence of UDP-GalNAz, reacted with biotin alkyne, and immunoblotted for CaMKIV or biotin (using streptavidin-horseradish peroxidase). F, lysates from Jurkat cells were immunoprecipitated for CaMKIV or using nonspecific ( ns ) mouse antibodies and immunoblotted for O -GlcNAc or CaMKIV.

    Techniques Used: Transfection, Plasmid Preparation, Immunoprecipitation, Labeling, Autoradiography, Fluorescence, Staining

    4) Product Images from "DIP2A Functions as a FSTL1 Receptor *"

    Article Title: DIP2A Functions as a FSTL1 Receptor *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M109.069468

    Involvement of DIP2A in FSTL1 binding to endothelial cells. A , detection of DIP2A on the cell surface of HUVECs. HUVECs were incubated with anti-DIP2A antibody ( red ; mouse IgG, 5 μg/ml) or control mouse IgG ( black ) for 60 min. Cells were stained with Alexa Fluor® 488-conjugated secondary antibody and analyzed using a FACScan. B , immunocytochemical analysis of HUVECs with anti-DIP2A antibody. HUVECs were incubated with anti-DIP2A antibody, followed by staining with Alexa Fluor® 594-conjugated secondary antibody ( red ). Nuclei were stained with 4′,6-diamidino-2-phenylindole ( blue ). Representative pictures are shown. C , reduction of DIP2A mRNA expression in HUVECs following transfection with siRNA against DIP2A. At 48 h after transfection of HUVECs with siRNA against DIP2A or control siRNA, DIP2A mRNA levels were determined by quantitative real-time PCR analysis and expressed relative to 36B4 levels ( n = 3). D , effect of knockdown of DIP2A on the binding of FSTL1 to HUVECs. HUVECs were transfected with siRNA targeting DIP2A (○) or unrelated siRNA (●), incubated with increasing concentrations of biotinylated recombinant FSTL1 for 60 min, and treated with streptavidin-conjugated horseradish peroxidase, followed by incubation with QuantaBlu fluorogenic peroxidase substrate. The binding was assessed with a fluorescent microplate reader ( n = 6–7). The data were analyzed with Microsoft Excel to generate a logarithmic trend line.
    Figure Legend Snippet: Involvement of DIP2A in FSTL1 binding to endothelial cells. A , detection of DIP2A on the cell surface of HUVECs. HUVECs were incubated with anti-DIP2A antibody ( red ; mouse IgG, 5 μg/ml) or control mouse IgG ( black ) for 60 min. Cells were stained with Alexa Fluor® 488-conjugated secondary antibody and analyzed using a FACScan. B , immunocytochemical analysis of HUVECs with anti-DIP2A antibody. HUVECs were incubated with anti-DIP2A antibody, followed by staining with Alexa Fluor® 594-conjugated secondary antibody ( red ). Nuclei were stained with 4′,6-diamidino-2-phenylindole ( blue ). Representative pictures are shown. C , reduction of DIP2A mRNA expression in HUVECs following transfection with siRNA against DIP2A. At 48 h after transfection of HUVECs with siRNA against DIP2A or control siRNA, DIP2A mRNA levels were determined by quantitative real-time PCR analysis and expressed relative to 36B4 levels ( n = 3). D , effect of knockdown of DIP2A on the binding of FSTL1 to HUVECs. HUVECs were transfected with siRNA targeting DIP2A (○) or unrelated siRNA (●), incubated with increasing concentrations of biotinylated recombinant FSTL1 for 60 min, and treated with streptavidin-conjugated horseradish peroxidase, followed by incubation with QuantaBlu fluorogenic peroxidase substrate. The binding was assessed with a fluorescent microplate reader ( n = 6–7). The data were analyzed with Microsoft Excel to generate a logarithmic trend line.

    Techniques Used: Binding Assay, Incubation, Staining, Expressing, Transfection, Real-time Polymerase Chain Reaction, Recombinant

    5) Product Images from "Cell Surface Galectin-9 Expressing Th Cells Regulate Th17 and Foxp3+ Treg Development by Galectin-9 Secretion"

    Article Title: Cell Surface Galectin-9 Expressing Th Cells Regulate Th17 and Foxp3+ Treg Development by Galectin-9 Secretion

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0048574

    Phenotype of Gal-9 + Th cells. To clearly demonstrate the co-expression of cell-surface Gal-9 with either Foxp3 or Tim-3, highly sensitive Gal-9 staining with biotinylated-anti-Gal-9 antibody plus streptavidin-APC was employed. ( A ) Naïve CD4 T cells cultured under neutral conditions (left) or Treg-skewing conditions (right) for 4 days were examined for Foxp3 (Treg marker) and cell-surface Gal-9 expressions using flow cytometry. ( B ) Co-expression analysis of cell-surface Gal-9 and Tim-3 in naïve CD4 T cells cultured under neutral conditions for 4 days. ( C ) Intracellular IL-10 in naïve CD4 T cells purified from wild-type (WT) or Gal-9 knockout (Gal-9 KO) mice. ( D ) Naïve CD4 T cells from WT and Gal-9 KO mice were cultured under neutral or Th17-skewing conditions, and IL-10 mRNA expression was measured. Results are shown as the mean ± SEM of triplicate or quadruplicate. Symbol (*) represents significant ( p
    Figure Legend Snippet: Phenotype of Gal-9 + Th cells. To clearly demonstrate the co-expression of cell-surface Gal-9 with either Foxp3 or Tim-3, highly sensitive Gal-9 staining with biotinylated-anti-Gal-9 antibody plus streptavidin-APC was employed. ( A ) Naïve CD4 T cells cultured under neutral conditions (left) or Treg-skewing conditions (right) for 4 days were examined for Foxp3 (Treg marker) and cell-surface Gal-9 expressions using flow cytometry. ( B ) Co-expression analysis of cell-surface Gal-9 and Tim-3 in naïve CD4 T cells cultured under neutral conditions for 4 days. ( C ) Intracellular IL-10 in naïve CD4 T cells purified from wild-type (WT) or Gal-9 knockout (Gal-9 KO) mice. ( D ) Naïve CD4 T cells from WT and Gal-9 KO mice were cultured under neutral or Th17-skewing conditions, and IL-10 mRNA expression was measured. Results are shown as the mean ± SEM of triplicate or quadruplicate. Symbol (*) represents significant ( p

    Techniques Used: Expressing, Staining, Cell Culture, Marker, Flow Cytometry, Cytometry, Purification, Knock-Out, Mouse Assay

    6) Product Images from "Development of peptidomimetic inhibitors of the ERG gene fusion product in prostate cancer"

    Article Title: Development of peptidomimetic inhibitors of the ERG gene fusion product in prostate cancer

    Journal: Cancer cell

    doi: 10.1016/j.ccell.2017.02.017

    Binding properties of synthetic peptides ( A ) The synthetic peptide sequences and corresponding binding affinity (Kd) as determined by OctetRED biolayer interferometry. Point mutations with alanine substitution and scrambled peptide were used as negative controls where Kd could not be determined (N.D.). ( B ) Real-time binding was measured by immobilization of biotinylated ERG protein to the streptavidin biosensors and subsequent interactions with varying concentrations of synthetic peptides as indicated. ( C ) The plots show the response versus peptide concentration curves derived from the raw binding data. Dissociation constants (Kd) represent the peptide concentration yielding half-maximal binding to ERG. For all experiments, mean ± SEM is shown. ( D ) Halo-tagged ERG protein was expressed by in vitro transcription/translation. Pull-downs followed by immunoblot analysis were performed on mixtures of either Halo-ERG and GST-AR or Halo-ERG and DNA-PKcs in the presence of varying concentrations of peptide, as indicated. ( E ) Biotin-EIP1/2 or biotin-muEIP was incubated with VCaP cell lysates. Eluates from the pull-downs were subjected to immunoblot analysis using an anti-ERG antibody. ( F ) Pull-down experiment was performed as in ( E ) followed by silver staining (left panel) and parallel immunoblot analysis (right panel). ( G ) Candidate ERG bands identified in ( F) .
    Figure Legend Snippet: Binding properties of synthetic peptides ( A ) The synthetic peptide sequences and corresponding binding affinity (Kd) as determined by OctetRED biolayer interferometry. Point mutations with alanine substitution and scrambled peptide were used as negative controls where Kd could not be determined (N.D.). ( B ) Real-time binding was measured by immobilization of biotinylated ERG protein to the streptavidin biosensors and subsequent interactions with varying concentrations of synthetic peptides as indicated. ( C ) The plots show the response versus peptide concentration curves derived from the raw binding data. Dissociation constants (Kd) represent the peptide concentration yielding half-maximal binding to ERG. For all experiments, mean ± SEM is shown. ( D ) Halo-tagged ERG protein was expressed by in vitro transcription/translation. Pull-downs followed by immunoblot analysis were performed on mixtures of either Halo-ERG and GST-AR or Halo-ERG and DNA-PKcs in the presence of varying concentrations of peptide, as indicated. ( E ) Biotin-EIP1/2 or biotin-muEIP was incubated with VCaP cell lysates. Eluates from the pull-downs were subjected to immunoblot analysis using an anti-ERG antibody. ( F ) Pull-down experiment was performed as in ( E ) followed by silver staining (left panel) and parallel immunoblot analysis (right panel). ( G ) Candidate ERG bands identified in ( F) .

    Techniques Used: Binding Assay, Concentration Assay, Derivative Assay, In Vitro, Incubation, Silver Staining

    7) Product Images from "A Versatile New Tool to Quantify Abasic Sites in DNA and Inhibit Base Excision Repair"

    Article Title: A Versatile New Tool to Quantify Abasic Sites in DNA and Inhibit Base Excision Repair

    Journal: DNA repair

    doi: 10.1016/j.dnarep.2014.12.006

    Quantification of aldehydic lesions and AP sites using ARP and AA3. (A) HeLa DNA was labeled with ARP and vacuum-spotted onto a nylon membrane. Aldehydic lesions in this DNA were quantified using streptavidin-conjugated horseradish peroxidase (HRP) and detected using a chemiluminescent substrate (open bar). In parallel, aldehydic lesions in HeLa DNA were also labeled with AA3 followed by reaction with Cy5 azide and quantification of fluorescence on a nylon membrane (black bar). AA3-labeled aldehydic lesions reacted with Cy5 azide were also quantified in solution using a microplate reader (gray bars). Mean and standard deviation of triplicate samples is shown. (B) HeLa DNA was pre-treated with NaBH 4 to reduce endogenous aldehydic lesions and AP sites were generated by heat and acid treatment for different lengths of time. The AP sites were labeled using ARP or AA3 for labeling and the DNA was spotted onto a nylon membrane and the membranes scanned to quantify AP sites ( Left ). AP sites in the same DNAs were also quantified by reacting them successively with AA3 and Cy5 azide, and measuring fluorescence intensity directly using a microplate reader ( right) . Mean and standard deviation of triplicate samples is shown for each time point.
    Figure Legend Snippet: Quantification of aldehydic lesions and AP sites using ARP and AA3. (A) HeLa DNA was labeled with ARP and vacuum-spotted onto a nylon membrane. Aldehydic lesions in this DNA were quantified using streptavidin-conjugated horseradish peroxidase (HRP) and detected using a chemiluminescent substrate (open bar). In parallel, aldehydic lesions in HeLa DNA were also labeled with AA3 followed by reaction with Cy5 azide and quantification of fluorescence on a nylon membrane (black bar). AA3-labeled aldehydic lesions reacted with Cy5 azide were also quantified in solution using a microplate reader (gray bars). Mean and standard deviation of triplicate samples is shown. (B) HeLa DNA was pre-treated with NaBH 4 to reduce endogenous aldehydic lesions and AP sites were generated by heat and acid treatment for different lengths of time. The AP sites were labeled using ARP or AA3 for labeling and the DNA was spotted onto a nylon membrane and the membranes scanned to quantify AP sites ( Left ). AP sites in the same DNAs were also quantified by reacting them successively with AA3 and Cy5 azide, and measuring fluorescence intensity directly using a microplate reader ( right) . Mean and standard deviation of triplicate samples is shown for each time point.

    Techniques Used: Labeling, Fluorescence, Standard Deviation, Generated

    Sensitivity of detection of AP sites using ARP and AA3. (A) Image of the nylon membranes where different amounts of DNA containing a synthetic oligomer with one AP site were labeled using either ARP-HRP (top) or AA3-Cy5 (bottom). (B) Synthetic duplex containing one AP site was labeled with either ARP or AA3. Different dilutions of ARP-labeled DNA was spotted on a membrane and bound with Cy5-streptavidin. AA3-labeled DNA was reacted with Cy5 azide and different dilutions were spotted on a membrane. Cy5 fluorescence was quantified in each case and is plotted against the number of AP sites in each spot. (Inset) Image of the membrane in each case.
    Figure Legend Snippet: Sensitivity of detection of AP sites using ARP and AA3. (A) Image of the nylon membranes where different amounts of DNA containing a synthetic oligomer with one AP site were labeled using either ARP-HRP (top) or AA3-Cy5 (bottom). (B) Synthetic duplex containing one AP site was labeled with either ARP or AA3. Different dilutions of ARP-labeled DNA was spotted on a membrane and bound with Cy5-streptavidin. AA3-labeled DNA was reacted with Cy5 azide and different dilutions were spotted on a membrane. Cy5 fluorescence was quantified in each case and is plotted against the number of AP sites in each spot. (Inset) Image of the membrane in each case.

    Techniques Used: Labeling, Fluorescence

    8) Product Images from "An RNA Aptamer That Specifically Binds to the Glycosylated Hemagglutinin of Avian Influenza Virus and Suppresses Viral Infection in Cells"

    Article Title: An RNA Aptamer That Specifically Binds to the Glycosylated Hemagglutinin of Avian Influenza Virus and Suppresses Viral Infection in Cells

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0097574

    Affinity measurements of selected RNA aptamers to gHA1. (A) Each 32 P end-labeled RNA aptamer was incubated with gHA1, and the reaction sample was then filtered through a pre-wetted nitrocellulose membrane and applied to the double-filter dot-blot apparatus. The amounts of 32 P end-labeled RNA aptamers retained on the membrane in the presence of gHA1 were radioactively measured and quantified. Percentage binding to the gHA1 protein relative to the highest value is shown in the graph. (B) The immobilized gHA1 protein (0.5 µg) was incubated with each 3′-biotinylated RNA sample (30 ng) as indicated. After addition of streptavidin-conjugated HRP, the amount of the gHA1-aptamer complex was measured by absorbance reading at 450 nm.
    Figure Legend Snippet: Affinity measurements of selected RNA aptamers to gHA1. (A) Each 32 P end-labeled RNA aptamer was incubated with gHA1, and the reaction sample was then filtered through a pre-wetted nitrocellulose membrane and applied to the double-filter dot-blot apparatus. The amounts of 32 P end-labeled RNA aptamers retained on the membrane in the presence of gHA1 were radioactively measured and quantified. Percentage binding to the gHA1 protein relative to the highest value is shown in the graph. (B) The immobilized gHA1 protein (0.5 µg) was incubated with each 3′-biotinylated RNA sample (30 ng) as indicated. After addition of streptavidin-conjugated HRP, the amount of the gHA1-aptamer complex was measured by absorbance reading at 450 nm.

    Techniques Used: Labeling, Incubation, Dot Blot, Binding Assay

    9) Product Images from "A Versatile New Tool to Quantify Abasic Sites in DNA and Inhibit Base Excision Repair"

    Article Title: A Versatile New Tool to Quantify Abasic Sites in DNA and Inhibit Base Excision Repair

    Journal: DNA repair

    doi: 10.1016/j.dnarep.2014.12.006

    Quantification of aldehydic lesions and AP sites using ARP and AA3. (A) HeLa DNA was labeled with ARP and vacuum-spotted onto a nylon membrane. Aldehydic lesions in this DNA were quantified using streptavidin-conjugated horseradish peroxidase (HRP) and detected using a chemiluminescent substrate (open bar). In parallel, aldehydic lesions in HeLa DNA were also labeled with AA3 followed by reaction with Cy5 azide and quantification of fluorescence on a nylon membrane (black bar). AA3-labeled aldehydic lesions reacted with Cy5 azide were also quantified in solution using a microplate reader (gray bars). Mean and standard deviation of triplicate samples is shown. (B) HeLa DNA was pre-treated with NaBH 4 to reduce endogenous aldehydic lesions and AP sites were generated by heat and acid treatment for different lengths of time. The AP sites were labeled using ARP or AA3 for labeling and the DNA was spotted onto a nylon membrane and the membranes scanned to quantify AP sites ( Left ). AP sites in the same DNAs were also quantified by reacting them successively with AA3 and Cy5 azide, and measuring fluorescence intensity directly using a microplate reader ( right) . Mean and standard deviation of triplicate samples is shown for each time point.
    Figure Legend Snippet: Quantification of aldehydic lesions and AP sites using ARP and AA3. (A) HeLa DNA was labeled with ARP and vacuum-spotted onto a nylon membrane. Aldehydic lesions in this DNA were quantified using streptavidin-conjugated horseradish peroxidase (HRP) and detected using a chemiluminescent substrate (open bar). In parallel, aldehydic lesions in HeLa DNA were also labeled with AA3 followed by reaction with Cy5 azide and quantification of fluorescence on a nylon membrane (black bar). AA3-labeled aldehydic lesions reacted with Cy5 azide were also quantified in solution using a microplate reader (gray bars). Mean and standard deviation of triplicate samples is shown. (B) HeLa DNA was pre-treated with NaBH 4 to reduce endogenous aldehydic lesions and AP sites were generated by heat and acid treatment for different lengths of time. The AP sites were labeled using ARP or AA3 for labeling and the DNA was spotted onto a nylon membrane and the membranes scanned to quantify AP sites ( Left ). AP sites in the same DNAs were also quantified by reacting them successively with AA3 and Cy5 azide, and measuring fluorescence intensity directly using a microplate reader ( right) . Mean and standard deviation of triplicate samples is shown for each time point.

    Techniques Used: Labeling, Fluorescence, Standard Deviation, Generated

    Sensitivity of detection of AP sites using ARP and AA3. (A) Image of the nylon membranes where different amounts of DNA containing a synthetic oligomer with one AP site were labeled using either ARP-HRP (top) or AA3-Cy5 (bottom). (B) Synthetic duplex containing one AP site was labeled with either ARP or AA3. Different dilutions of ARP-labeled DNA was spotted on a membrane and bound with Cy5-streptavidin. AA3-labeled DNA was reacted with Cy5 azide and different dilutions were spotted on a membrane. Cy5 fluorescence was quantified in each case and is plotted against the number of AP sites in each spot. (Inset) Image of the membrane in each case.
    Figure Legend Snippet: Sensitivity of detection of AP sites using ARP and AA3. (A) Image of the nylon membranes where different amounts of DNA containing a synthetic oligomer with one AP site were labeled using either ARP-HRP (top) or AA3-Cy5 (bottom). (B) Synthetic duplex containing one AP site was labeled with either ARP or AA3. Different dilutions of ARP-labeled DNA was spotted on a membrane and bound with Cy5-streptavidin. AA3-labeled DNA was reacted with Cy5 azide and different dilutions were spotted on a membrane. Cy5 fluorescence was quantified in each case and is plotted against the number of AP sites in each spot. (Inset) Image of the membrane in each case.

    Techniques Used: Labeling, Fluorescence

    10) Product Images from "A 12-Amino-Acid Segment, Present in Type s2 but Not Type s1 Helicobacter pylori VacA Proteins, Abolishes Cytotoxin Activity and Alters Membrane Channel Formation"

    Article Title: A 12-Amino-Acid Segment, Present in Type s2 but Not Type s1 Helicobacter pylori VacA Proteins, Abolishes Cytotoxin Activity and Alters Membrane Channel Formation

    Journal: Journal of Bacteriology

    doi: 10.1128/JB.183.22.6499-6508.2001

    Interactions of VacA-(Δ6–27), s1/m1 VacA, and chimeric s2/m1 VacA with c-myc-tagged s1/m1 VacA. Three species of purified VacA were biotinylated as described in Materials and Methods. Samples used for immunoprecipitations included acid-activated biotinylated VacA (lane a), acid-activated mixtures of biotinylated VacA and c-myc-tagged VacA (lane b), and untreated mixtures of biotinylated VacA and c-myc-tagged VacA (lane c). Immunoprecipitations using anti-c-myc antibody 9E10 were performed as described in Materials and Methods. Immunoprecipitated proteins were separated by SDS-PAGE and transferred to nitrocellulose, and biotinylated VacA was detected with streptavidin-conjugated horseradish peroxidase and enhanced chemiluminescence. Biotinylated VacA species were successfully immunoprecipitated only if mixtures of biotinylated VacA and c-myc VacA were acid activated prior to the immunoprecipitation (lane b).
    Figure Legend Snippet: Interactions of VacA-(Δ6–27), s1/m1 VacA, and chimeric s2/m1 VacA with c-myc-tagged s1/m1 VacA. Three species of purified VacA were biotinylated as described in Materials and Methods. Samples used for immunoprecipitations included acid-activated biotinylated VacA (lane a), acid-activated mixtures of biotinylated VacA and c-myc-tagged VacA (lane b), and untreated mixtures of biotinylated VacA and c-myc-tagged VacA (lane c). Immunoprecipitations using anti-c-myc antibody 9E10 were performed as described in Materials and Methods. Immunoprecipitated proteins were separated by SDS-PAGE and transferred to nitrocellulose, and biotinylated VacA was detected with streptavidin-conjugated horseradish peroxidase and enhanced chemiluminescence. Biotinylated VacA species were successfully immunoprecipitated only if mixtures of biotinylated VacA and c-myc VacA were acid activated prior to the immunoprecipitation (lane b).

    Techniques Used: Purification, Immunoprecipitation, SDS Page

    Related Articles

    Filtration:

    Article Title: A 12-Amino-Acid Segment, Present in Type s2 but Not Type s1 Helicobacter pylori VacA Proteins, Abolishes Cytotoxin Activity and Alters Membrane Channel Formation
    Article Snippet: The biotinylated toxin was then separated from unincorporated biotin by gel filtration chromatography using a Micro Bio-Spin chromatography column (Bio-Rad) containing Bio-Gel P-6 equilibrated in 25 mM HEPES containing 150 mM sodium chloride and bovine serum albumin (100 μg per ml). .. Biotinylated VacA was detected in immunoblotting studies by use of streptavidin-conjugated horseradish peroxidase (Life Technologies) and enhanced chemiluminescence (Amersham Pharmacia Biotech).

    Construct:

    Article Title: Cell Surface Galectin-9 Expressing Th Cells Regulate Th17 and Foxp3+ Treg Development by Galectin-9 Secretion
    Article Snippet: Gal-9 was detected using polyclonal anti-mouse Gal-9 antibody conjugated with biotin (GalPharma) and streptavidin-conjugated horseradish peroxidase (Thermo Fisher Scientific, Waltham, MA, USA). .. After color development with tetramethyl benzidine (KPL, Gaithersburg, MD, USA), Gal-9 was quantified using a standard curve constructed with a recombinant mouse Gal-9.

    Enzyme-linked Immunosorbent Assay:

    Article Title: An RNA Aptamer That Specifically Binds to the Glycosylated Hemagglutinin of Avian Influenza Virus and Suppresses Viral Infection in Cells
    Article Snippet: Paragraph title: Enzyme-linked immunosorbent assay (ELISA) ... After washing, 30 ng of 3′-biotinylated RNAs was added to wells (100 µl in PBS per well) and incubated at room temperature for 2 h. The wells were then washed with PBS-T three times, and the protein-bound biotinylated RNAs were detected by incubation with 100 µl of streptavidin-conjugated horseradish peroxidase (diluted 1∶8000 in PBS-T, Pierce) at room temperature for 1 h. After washing, the color development was initiated by adding 100 µl of 3,3′,5,5′-tetrametylbenzidine (TMB) substrate solution (Pierce, Rockford, IL) to each well, and stopped by adding 2 M H2 SO4 .

    Article Title: DIP2A Functions as a FSTL1 Receptor *
    Article Snippet: FSTL1 binding to the cell surface was determined by enzyme-linked immunosorbent assay. .. HUVECs were incubated with the indicated concentrations of biotinylated recombinant FSTL1 (NHS-Biotin, Pierce) for 60 min and treated with streptavidin-conjugated horseradish peroxidase, followed by incubation with QuantaBlu fluorogenic peroxidase substrate (Pierce).

    Article Title: Cell Surface Galectin-9 Expressing Th Cells Regulate Th17 and Foxp3+ Treg Development by Galectin-9 Secretion
    Article Snippet: Paragraph title: ELISA ... Gal-9 was detected using polyclonal anti-mouse Gal-9 antibody conjugated with biotin (GalPharma) and streptavidin-conjugated horseradish peroxidase (Thermo Fisher Scientific, Waltham, MA, USA).

    Article Title: Robust Stimulation of Humoral and Cellular Immune Responses following Vaccination with Antigen-Loaded ?-Glucan Particles
    Article Snippet: Paragraph title: OVA-specific antibody ELISA. ... Round-bottom 96-well plates with high binding (Corning, Corning, NY) were coated with 50 µl of 10 µg/ml OVA in 0.1 M NaHCO3 overnight at 4°C, washed three times with PBS with 0.05% Tween 20, blocked with 100 µl 10% FBS in PBS for 1 h at room temperature, washed three times with PBS with 0.05% Tween 20, and incubated with 50 µl diluted mouse sera at room temperature for 2 h. Wells were then washed five times with PBS with 0.05% Tween 20, and incubated with biotin-conjugated rat anti-mouse IgG1 (1:500 dilution in 10% FBS in PBS) (BD Biosciences, San Jose, CA) or biotin-conjugated rat anti-mouse IgG2c (1:1,000 dilution in 10% FBS in PBS) (Jackson ImmunoResearch, West Grove, PA) at room temperature for 1 h. Then, the plates were washed five times with PBS-0.05% Tween 20, incubated with streptavidin-conjugated horseradish peroxidase (1:250 dilution in 10% FBS in PBS) (eBioscience) at room temperature for 1 h, washed five times with PBS-0.05% Tween 20, and then developed with tetramethylbenzidine solution (eBioscience).

    Incubation:

    Article Title: An RNA Aptamer That Specifically Binds to the Glycosylated Hemagglutinin of Avian Influenza Virus and Suppresses Viral Infection in Cells
    Article Snippet: .. After washing, 30 ng of 3′-biotinylated RNAs was added to wells (100 µl in PBS per well) and incubated at room temperature for 2 h. The wells were then washed with PBS-T three times, and the protein-bound biotinylated RNAs were detected by incubation with 100 µl of streptavidin-conjugated horseradish peroxidase (diluted 1∶8000 in PBS-T, Pierce) at room temperature for 1 h. After washing, the color development was initiated by adding 100 µl of 3,3′,5,5′-tetrametylbenzidine (TMB) substrate solution (Pierce, Rockford, IL) to each well, and stopped by adding 2 M H2 SO4 . .. The absorbance of each well was measured at 450 nm using a VICTOR X3 Multilabel Plate Reader (PerkinElmer, Waltham, MA).

    Article Title: A 12-Amino-Acid Segment, Present in Type s2 but Not Type s1 Helicobacter pylori VacA Proteins, Abolishes Cytotoxin Activity and Alters Membrane Channel Formation
    Article Snippet: N -Hydroxysuccinimidobiotin (NHS-biotin; Pierce) dissolved in dimethyl sulfoxide was added at molar ratios of NHS-biotin to VacA ranging from 1:1 to 5:1, and the reaction mixtures were incubated at 25°C for 1 h. The reactions were stopped by addition of a 1/10 volume of hydroxylamine (10 mg per ml). .. Biotinylated VacA was detected in immunoblotting studies by use of streptavidin-conjugated horseradish peroxidase (Life Technologies) and enhanced chemiluminescence (Amersham Pharmacia Biotech).

    Article Title: Development of peptidomimetic inhibitors of the ERG gene fusion product in prostate cancer
    Article Snippet: For each binding reaction, VCaP cell extract was incubated with 1μg poly d (I–C), 2 μl of EMSA binding buffer (1.5% glycerol, 75 mM KCl, 0.375 mM DTT, 12.5 mM NaCl, 0.375 mM phenylmethylsulfonyl fluoride [PMSF]) and 5μM biotin-labeled EBS in the presence or absence of the peptides as indicated for 30 min at room temperature. .. Biotinylated oligonucleotides were detected by probing with streptavidin-conjugated horseradish peroxidase and visualized by enhanced chemiluminescence (Pierce).

    Article Title: DIP2A Functions as a FSTL1 Receptor *
    Article Snippet: .. HUVECs were incubated with the indicated concentrations of biotinylated recombinant FSTL1 (NHS-Biotin, Pierce) for 60 min and treated with streptavidin-conjugated horseradish peroxidase, followed by incubation with QuantaBlu fluorogenic peroxidase substrate (Pierce). .. Fluorescence intensity was measured with a fluorescence microplate reader (SpectraMax).

    Article Title: Cell Surface Galectin-9 Expressing Th Cells Regulate Th17 and Foxp3+ Treg Development by Galectin-9 Secretion
    Article Snippet: Briefly, 96-well plates were coated with an anti-mouse Gal-9 antibody (Clone 108A2), blocked with 3% fetal bovine serum in phosphate-buffered saline, and then incubated with culture supernatant. .. Gal-9 was detected using polyclonal anti-mouse Gal-9 antibody conjugated with biotin (GalPharma) and streptavidin-conjugated horseradish peroxidase (Thermo Fisher Scientific, Waltham, MA, USA).

    Article Title: A Versatile New Tool to Quantify Abasic Sites in DNA and Inhibit Base Excision Repair
    Article Snippet: .. The membrane was then incubated with Starting Block Blocking Buffer (Fisher) at room temperature for 1Hr, followed by the incubation of streptavidin-conjugated horseradish peroxidase (HRP, Thermo Scientific) in blocking buffer at room temperature for 30 minutes. .. Alternatively, ARP-DNA on the membrane was incubated with 5×10−4 mg/ml of Cy5-streptavidin at room temperature for 1hr.

    Article Title: Characterization and Optimization of the Glucan Particle-Based Vaccine Platform
    Article Snippet: .. Plates were then incubated with streptavidin-conjugated horseradish peroxidase (eBioscience) and developed with 3,3′,5,5′-tetramethylbenzidine solution (eBioscience), and the optical density at 450 nm (OD450 ) was measured. ..

    Article Title: Robust Stimulation of Humoral and Cellular Immune Responses following Vaccination with Antigen-Loaded ?-Glucan Particles
    Article Snippet: .. Round-bottom 96-well plates with high binding (Corning, Corning, NY) were coated with 50 µl of 10 µg/ml OVA in 0.1 M NaHCO3 overnight at 4°C, washed three times with PBS with 0.05% Tween 20, blocked with 100 µl 10% FBS in PBS for 1 h at room temperature, washed three times with PBS with 0.05% Tween 20, and incubated with 50 µl diluted mouse sera at room temperature for 2 h. Wells were then washed five times with PBS with 0.05% Tween 20, and incubated with biotin-conjugated rat anti-mouse IgG1 (1:500 dilution in 10% FBS in PBS) (BD Biosciences, San Jose, CA) or biotin-conjugated rat anti-mouse IgG2c (1:1,000 dilution in 10% FBS in PBS) (Jackson ImmunoResearch, West Grove, PA) at room temperature for 1 h. Then, the plates were washed five times with PBS-0.05% Tween 20, incubated with streptavidin-conjugated horseradish peroxidase (1:250 dilution in 10% FBS in PBS) (eBioscience) at room temperature for 1 h, washed five times with PBS-0.05% Tween 20, and then developed with tetramethylbenzidine solution (eBioscience). .. The optical density at 450 nm (OD450 ) was measured on a plate reader (Molecular Devices, Sunnyvale, CA).

    Article Title: Regulation of Calcium/Calmodulin-dependent Kinase IV by O-GlcNAc Modification *
    Article Snippet: The blocked membranes were then incubated overnight at 4 °C with primary antibodies against O- GlcNAc (CTD110.6), O- GlcNAcase, HA (HA.11; Covance), CaMKIV (Cell Signaling), or pT200 CaMKIV (Santa Cruz Biotechnology). .. Streptavidin-conjugated horseradish peroxidase (Pierce) was used to probe for biotin labeling.

    Activity Assay:

    Article Title: A 12-Amino-Acid Segment, Present in Type s2 but Not Type s1 Helicobacter pylori VacA Proteins, Abolishes Cytotoxin Activity and Alters Membrane Channel Formation
    Article Snippet: Under these conditions, biotinylation of VacA from H. pylori strain 60190 resulted in minimal loss of vacuolating activity. .. Biotinylated VacA was detected in immunoblotting studies by use of streptavidin-conjugated horseradish peroxidase (Life Technologies) and enhanced chemiluminescence (Amersham Pharmacia Biotech).

    Article Title: Development of peptidomimetic inhibitors of the ERG gene fusion product in prostate cancer
    Article Snippet: To determine the inhibitory activity of the peptide against the ERG:DNA interaction, we performed electrophoretic mobility shift assays (EMSAs). .. Biotinylated oligonucleotides were detected by probing with streptavidin-conjugated horseradish peroxidase and visualized by enhanced chemiluminescence (Pierce).

    BIA-KA:

    Article Title: A 12-Amino-Acid Segment, Present in Type s2 but Not Type s1 Helicobacter pylori VacA Proteins, Abolishes Cytotoxin Activity and Alters Membrane Channel Formation
    Article Snippet: The protein concentration was determined using the Micro BCA protein assay (Pierce). .. Biotinylated VacA was detected in immunoblotting studies by use of streptavidin-conjugated horseradish peroxidase (Life Technologies) and enhanced chemiluminescence (Amersham Pharmacia Biotech).

    Western Blot:

    Article Title: Definition of the minimal viral components required for the initiation of unprimed RNA synthesis by influenza virus RNA polymerase
    Article Snippet: Paragraph title: SDS–PAGE and western blot analysis ... Bound antibodies were detected using biotin conjugated goat, anti-rabbit or anti-mouse IgG secondary antibody as appropriate (Sigma-Aldrich Co.) followed by either streptavidin conjugated alkaline phosphatase/BCIP/NBT development (Sigma-Aldrich Co.) for Figure only; or streptavidin conjugated horseradish peroxidase (Pierce) chemiluminescent development according to the manufacturer’s protocol (BM Chemiluminescence Blotting substrate, Roche Diagnostics Ltd).

    Article Title: Regulation of Calcium/Calmodulin-dependent Kinase IV by O-GlcNAc Modification *
    Article Snippet: CTD110.6 O- GlcNAc immunoblots were performed using bovine serum albumin as the blocking agent. .. Streptavidin-conjugated horseradish peroxidase (Pierce) was used to probe for biotin labeling.

    Blocking Assay:

    Article Title: A Versatile New Tool to Quantify Abasic Sites in DNA and Inhibit Base Excision Repair
    Article Snippet: .. The membrane was then incubated with Starting Block Blocking Buffer (Fisher) at room temperature for 1Hr, followed by the incubation of streptavidin-conjugated horseradish peroxidase (HRP, Thermo Scientific) in blocking buffer at room temperature for 30 minutes. .. Alternatively, ARP-DNA on the membrane was incubated with 5×10−4 mg/ml of Cy5-streptavidin at room temperature for 1hr.

    Article Title: Regulation of Calcium/Calmodulin-dependent Kinase IV by O-GlcNAc Modification *
    Article Snippet: CTD110.6 O- GlcNAc immunoblots were performed using bovine serum albumin as the blocking agent. .. Streptavidin-conjugated horseradish peroxidase (Pierce) was used to probe for biotin labeling.

    Chromatography:

    Article Title: A 12-Amino-Acid Segment, Present in Type s2 but Not Type s1 Helicobacter pylori VacA Proteins, Abolishes Cytotoxin Activity and Alters Membrane Channel Formation
    Article Snippet: The biotinylated toxin was then separated from unincorporated biotin by gel filtration chromatography using a Micro Bio-Spin chromatography column (Bio-Rad) containing Bio-Gel P-6 equilibrated in 25 mM HEPES containing 150 mM sodium chloride and bovine serum albumin (100 μg per ml). .. Biotinylated VacA was detected in immunoblotting studies by use of streptavidin-conjugated horseradish peroxidase (Life Technologies) and enhanced chemiluminescence (Amersham Pharmacia Biotech).

    Ligation:

    Article Title: An RNA Aptamer That Specifically Binds to the Glycosylated Hemagglutinin of Avian Influenza Virus and Suppresses Viral Infection in Cells
    Article Snippet: After the reaction mixture was incubated at 16°C overnight to increase ligation efficiency, 3′-biotinylated RNAs were then extracted by phenol-chloroform and ethanol precipitation. .. After washing, 30 ng of 3′-biotinylated RNAs was added to wells (100 µl in PBS per well) and incubated at room temperature for 2 h. The wells were then washed with PBS-T three times, and the protein-bound biotinylated RNAs were detected by incubation with 100 µl of streptavidin-conjugated horseradish peroxidase (diluted 1∶8000 in PBS-T, Pierce) at room temperature for 1 h. After washing, the color development was initiated by adding 100 µl of 3,3′,5,5′-tetrametylbenzidine (TMB) substrate solution (Pierce, Rockford, IL) to each well, and stopped by adding 2 M H2 SO4 .

    other:

    Article Title: A Versatile New Tool to Quantify Abasic Sites in DNA and Inhibit Base Excision Repair
    Article Snippet: When ARP was used, the DNA adducts were quantified using streptavidin-conjugated horseradish peroxidase , and when AA3 was used the adducts were tagged with Cy5 for quantification.

    Imaging:

    Article Title: A Versatile New Tool to Quantify Abasic Sites in DNA and Inhibit Base Excision Repair
    Article Snippet: The membrane was then incubated with Starting Block Blocking Buffer (Fisher) at room temperature for 1Hr, followed by the incubation of streptavidin-conjugated horseradish peroxidase (HRP, Thermo Scientific) in blocking buffer at room temperature for 30 minutes. .. The emitted light was captured by FluorChem Imaging System (Alpha Innotech).

    DNA Labeling:

    Article Title: Development of peptidomimetic inhibitors of the ERG gene fusion product in prostate cancer
    Article Snippet: Double stranded ERG ETS binding sequence (5′ GATCTTCGAAACGGAAGTTCGAG 3′) was end-labeled using Biotin 3′ End DNA Labeling Kit (Pierce). .. Biotinylated oligonucleotides were detected by probing with streptavidin-conjugated horseradish peroxidase and visualized by enhanced chemiluminescence (Pierce).

    Sequencing:

    Article Title: Development of peptidomimetic inhibitors of the ERG gene fusion product in prostate cancer
    Article Snippet: Double stranded ERG ETS binding sequence (5′ GATCTTCGAAACGGAAGTTCGAG 3′) was end-labeled using Biotin 3′ End DNA Labeling Kit (Pierce). .. Biotinylated oligonucleotides were detected by probing with streptavidin-conjugated horseradish peroxidase and visualized by enhanced chemiluminescence (Pierce).

    Recombinant:

    Article Title: DIP2A Functions as a FSTL1 Receptor *
    Article Snippet: .. HUVECs were incubated with the indicated concentrations of biotinylated recombinant FSTL1 (NHS-Biotin, Pierce) for 60 min and treated with streptavidin-conjugated horseradish peroxidase, followed by incubation with QuantaBlu fluorogenic peroxidase substrate (Pierce). .. Fluorescence intensity was measured with a fluorescence microplate reader (SpectraMax).

    Article Title: Cell Surface Galectin-9 Expressing Th Cells Regulate Th17 and Foxp3+ Treg Development by Galectin-9 Secretion
    Article Snippet: Gal-9 was detected using polyclonal anti-mouse Gal-9 antibody conjugated with biotin (GalPharma) and streptavidin-conjugated horseradish peroxidase (Thermo Fisher Scientific, Waltham, MA, USA). .. After color development with tetramethyl benzidine (KPL, Gaithersburg, MD, USA), Gal-9 was quantified using a standard curve constructed with a recombinant mouse Gal-9.

    Fluorescence:

    Article Title: DIP2A Functions as a FSTL1 Receptor *
    Article Snippet: HUVECs were incubated with the indicated concentrations of biotinylated recombinant FSTL1 (NHS-Biotin, Pierce) for 60 min and treated with streptavidin-conjugated horseradish peroxidase, followed by incubation with QuantaBlu fluorogenic peroxidase substrate (Pierce). .. Fluorescence intensity was measured with a fluorescence microplate reader (SpectraMax).

    Protein Concentration:

    Article Title: A 12-Amino-Acid Segment, Present in Type s2 but Not Type s1 Helicobacter pylori VacA Proteins, Abolishes Cytotoxin Activity and Alters Membrane Channel Formation
    Article Snippet: The protein concentration was determined using the Micro BCA protein assay (Pierce). .. Biotinylated VacA was detected in immunoblotting studies by use of streptavidin-conjugated horseradish peroxidase (Life Technologies) and enhanced chemiluminescence (Amersham Pharmacia Biotech).

    Electrophoretic Mobility Shift Assay:

    Article Title: Development of peptidomimetic inhibitors of the ERG gene fusion product in prostate cancer
    Article Snippet: Paragraph title: Electrophoretic mobility shift assay (EMSA) ... Biotinylated oligonucleotides were detected by probing with streptavidin-conjugated horseradish peroxidase and visualized by enhanced chemiluminescence (Pierce).

    Purification:

    Article Title: An RNA Aptamer That Specifically Binds to the Glycosylated Hemagglutinin of Avian Influenza Virus and Suppresses Viral Infection in Cells
    Article Snippet: For enzyme-linked immunosorbent assay (ELISA), the wells of a nickel-coated plate (Pierce, Rockford, IL) were incubated overnight with the purified gHA1 (0.5 µg) at 4°C. .. After washing, 30 ng of 3′-biotinylated RNAs was added to wells (100 µl in PBS per well) and incubated at room temperature for 2 h. The wells were then washed with PBS-T three times, and the protein-bound biotinylated RNAs were detected by incubation with 100 µl of streptavidin-conjugated horseradish peroxidase (diluted 1∶8000 in PBS-T, Pierce) at room temperature for 1 h. After washing, the color development was initiated by adding 100 µl of 3,3′,5,5′-tetrametylbenzidine (TMB) substrate solution (Pierce, Rockford, IL) to each well, and stopped by adding 2 M H2 SO4 .

    Article Title: A Versatile New Tool to Quantify Abasic Sites in DNA and Inhibit Base Excision Repair
    Article Snippet: All DNAs were purified by phenol/chloroform extraction and ethanol precipitation, followed by MicroSpin G-25 column (GE Healthcare). .. The membrane was then incubated with Starting Block Blocking Buffer (Fisher) at room temperature for 1Hr, followed by the incubation of streptavidin-conjugated horseradish peroxidase (HRP, Thermo Scientific) in blocking buffer at room temperature for 30 minutes.

    Article Title: Characterization and Optimization of the Glucan Particle-Based Vaccine Platform
    Article Snippet: Similarly, for the enzyme-linked immunosorbent spot assay (ELISpot), purified CD4+ T cells, mitomycin C-treated BMDCs, and stimuli were incubated in filtered plates coated with capture antibodies (Abs) specific for each cytokine. .. Plates were then incubated with streptavidin-conjugated horseradish peroxidase (eBioscience) and developed with 3,3′,5,5′-tetramethylbenzidine solution (eBioscience), and the optical density at 450 nm (OD450 ) was measured.

    Article Title: Definition of the minimal viral components required for the initiation of unprimed RNA synthesis by influenza virus RNA polymerase
    Article Snippet: Samples from total nuclear extracts or SA-bead purified polymerase were resuspended in SDS–PAGE loading buffer containing 10% 2-mercaptoethanol, boiled for 5 min and then analysed by discontinuous PAGE (4.5% stacking gel and 7.5% resolving gel). .. Bound antibodies were detected using biotin conjugated goat, anti-rabbit or anti-mouse IgG secondary antibody as appropriate (Sigma-Aldrich Co.) followed by either streptavidin conjugated alkaline phosphatase/BCIP/NBT development (Sigma-Aldrich Co.) for Figure only; or streptavidin conjugated horseradish peroxidase (Pierce) chemiluminescent development according to the manufacturer’s protocol (BM Chemiluminescence Blotting substrate, Roche Diagnostics Ltd).

    Labeling:

    Article Title: Characterization and Optimization of the Glucan Particle-Based Vaccine Platform
    Article Snippet: Secreted cytokines were then captured in situ and incubated with labeled cytokine detection Abs, and spots were developed following the enzymatic reaction of the substrate. .. Plates were then incubated with streptavidin-conjugated horseradish peroxidase (eBioscience) and developed with 3,3′,5,5′-tetramethylbenzidine solution (eBioscience), and the optical density at 450 nm (OD450 ) was measured.

    Article Title: Primary glia expressing the G93A-SOD1 mutation present a neuroinflammatory phenotype and provide a cellular system for studies of glial inflammation
    Article Snippet: Blots were blocked overnight in 4% BSA, probed with 50 ng/mL streptavidin-conjugated horseradish peroxidase (Pierce) and visualized by chemiluminescence. .. Control experiments omitted the biotin-LC-hydrazide reagent or substituted biotin for biotin-hydrazide; in neither case was any labeling observed.

    Article Title: Regulation of Calcium/Calmodulin-dependent Kinase IV by O-GlcNAc Modification *
    Article Snippet: .. Streptavidin-conjugated horseradish peroxidase (Pierce) was used to probe for biotin labeling. .. The blots were then washed, incubated with the appropriate secondary antibody, developed using ECL (GE Healthcare), and exposed to Hyperfilm ECL (GE Healthcare).

    Polyacrylamide Gel Electrophoresis:

    Article Title: Definition of the minimal viral components required for the initiation of unprimed RNA synthesis by influenza virus RNA polymerase
    Article Snippet: Samples from total nuclear extracts or SA-bead purified polymerase were resuspended in SDS–PAGE loading buffer containing 10% 2-mercaptoethanol, boiled for 5 min and then analysed by discontinuous PAGE (4.5% stacking gel and 7.5% resolving gel). .. Bound antibodies were detected using biotin conjugated goat, anti-rabbit or anti-mouse IgG secondary antibody as appropriate (Sigma-Aldrich Co.) followed by either streptavidin conjugated alkaline phosphatase/BCIP/NBT development (Sigma-Aldrich Co.) for Figure only; or streptavidin conjugated horseradish peroxidase (Pierce) chemiluminescent development according to the manufacturer’s protocol (BM Chemiluminescence Blotting substrate, Roche Diagnostics Ltd).

    SDS Page:

    Article Title: Definition of the minimal viral components required for the initiation of unprimed RNA synthesis by influenza virus RNA polymerase
    Article Snippet: Paragraph title: SDS–PAGE and western blot analysis ... Bound antibodies were detected using biotin conjugated goat, anti-rabbit or anti-mouse IgG secondary antibody as appropriate (Sigma-Aldrich Co.) followed by either streptavidin conjugated alkaline phosphatase/BCIP/NBT development (Sigma-Aldrich Co.) for Figure only; or streptavidin conjugated horseradish peroxidase (Pierce) chemiluminescent development according to the manufacturer’s protocol (BM Chemiluminescence Blotting substrate, Roche Diagnostics Ltd).

    Software:

    Article Title: Regulation of Calcium/Calmodulin-dependent Kinase IV by O-GlcNAc Modification *
    Article Snippet: Streptavidin-conjugated horseradish peroxidase (Pierce) was used to probe for biotin labeling. .. NIH Image or ImageJ software were used for densitometric analysis of immunoblots, and all measurements were normalized against HA loading controls.

    Binding Assay:

    Article Title: An RNA Aptamer That Specifically Binds to the Glycosylated Hemagglutinin of Avian Influenza Virus and Suppresses Viral Infection in Cells
    Article Snippet: The wells were washed with phosphate-buffered saline with Tween (PBS-T; 0.1% Tween 20 in PBS, pH 7.4) 3 times and blocked with 1% bovine serum albumin (BSA) in PBS at room temperature for 1 h to avoid non-specific binding. .. After washing, 30 ng of 3′-biotinylated RNAs was added to wells (100 µl in PBS per well) and incubated at room temperature for 2 h. The wells were then washed with PBS-T three times, and the protein-bound biotinylated RNAs were detected by incubation with 100 µl of streptavidin-conjugated horseradish peroxidase (diluted 1∶8000 in PBS-T, Pierce) at room temperature for 1 h. After washing, the color development was initiated by adding 100 µl of 3,3′,5,5′-tetrametylbenzidine (TMB) substrate solution (Pierce, Rockford, IL) to each well, and stopped by adding 2 M H2 SO4 .

    Article Title: Development of peptidomimetic inhibitors of the ERG gene fusion product in prostate cancer
    Article Snippet: For each binding reaction, VCaP cell extract was incubated with 1μg poly d (I–C), 2 μl of EMSA binding buffer (1.5% glycerol, 75 mM KCl, 0.375 mM DTT, 12.5 mM NaCl, 0.375 mM phenylmethylsulfonyl fluoride [PMSF]) and 5μM biotin-labeled EBS in the presence or absence of the peptides as indicated for 30 min at room temperature. .. Biotinylated oligonucleotides were detected by probing with streptavidin-conjugated horseradish peroxidase and visualized by enhanced chemiluminescence (Pierce).

    Article Title: DIP2A Functions as a FSTL1 Receptor *
    Article Snippet: Paragraph title: Binding of FSTL1 to Endothelial Cells ... HUVECs were incubated with the indicated concentrations of biotinylated recombinant FSTL1 (NHS-Biotin, Pierce) for 60 min and treated with streptavidin-conjugated horseradish peroxidase, followed by incubation with QuantaBlu fluorogenic peroxidase substrate (Pierce).

    Article Title: Robust Stimulation of Humoral and Cellular Immune Responses following Vaccination with Antigen-Loaded ?-Glucan Particles
    Article Snippet: .. Round-bottom 96-well plates with high binding (Corning, Corning, NY) were coated with 50 µl of 10 µg/ml OVA in 0.1 M NaHCO3 overnight at 4°C, washed three times with PBS with 0.05% Tween 20, blocked with 100 µl 10% FBS in PBS for 1 h at room temperature, washed three times with PBS with 0.05% Tween 20, and incubated with 50 µl diluted mouse sera at room temperature for 2 h. Wells were then washed five times with PBS with 0.05% Tween 20, and incubated with biotin-conjugated rat anti-mouse IgG1 (1:500 dilution in 10% FBS in PBS) (BD Biosciences, San Jose, CA) or biotin-conjugated rat anti-mouse IgG2c (1:1,000 dilution in 10% FBS in PBS) (Jackson ImmunoResearch, West Grove, PA) at room temperature for 1 h. Then, the plates were washed five times with PBS-0.05% Tween 20, incubated with streptavidin-conjugated horseradish peroxidase (1:250 dilution in 10% FBS in PBS) (eBioscience) at room temperature for 1 h, washed five times with PBS-0.05% Tween 20, and then developed with tetramethylbenzidine solution (eBioscience). .. The optical density at 450 nm (OD450 ) was measured on a plate reader (Molecular Devices, Sunnyvale, CA).

    In Situ:

    Article Title: Characterization and Optimization of the Glucan Particle-Based Vaccine Platform
    Article Snippet: Secreted cytokines were then captured in situ and incubated with labeled cytokine detection Abs, and spots were developed following the enzymatic reaction of the substrate. .. Plates were then incubated with streptavidin-conjugated horseradish peroxidase (eBioscience) and developed with 3,3′,5,5′-tetramethylbenzidine solution (eBioscience), and the optical density at 450 nm (OD450 ) was measured.

    Ethanol Precipitation:

    Article Title: An RNA Aptamer That Specifically Binds to the Glycosylated Hemagglutinin of Avian Influenza Virus and Suppresses Viral Infection in Cells
    Article Snippet: After the reaction mixture was incubated at 16°C overnight to increase ligation efficiency, 3′-biotinylated RNAs were then extracted by phenol-chloroform and ethanol precipitation. .. After washing, 30 ng of 3′-biotinylated RNAs was added to wells (100 µl in PBS per well) and incubated at room temperature for 2 h. The wells were then washed with PBS-T three times, and the protein-bound biotinylated RNAs were detected by incubation with 100 µl of streptavidin-conjugated horseradish peroxidase (diluted 1∶8000 in PBS-T, Pierce) at room temperature for 1 h. After washing, the color development was initiated by adding 100 µl of 3,3′,5,5′-tetrametylbenzidine (TMB) substrate solution (Pierce, Rockford, IL) to each well, and stopped by adding 2 M H2 SO4 .

    Article Title: A Versatile New Tool to Quantify Abasic Sites in DNA and Inhibit Base Excision Repair
    Article Snippet: All DNAs were purified by phenol/chloroform extraction and ethanol precipitation, followed by MicroSpin G-25 column (GE Healthcare). .. The membrane was then incubated with Starting Block Blocking Buffer (Fisher) at room temperature for 1Hr, followed by the incubation of streptavidin-conjugated horseradish peroxidase (HRP, Thermo Scientific) in blocking buffer at room temperature for 30 minutes.

    Enzyme-linked Immunospot:

    Article Title: Characterization and Optimization of the Glucan Particle-Based Vaccine Platform
    Article Snippet: Paragraph title: T-cell proliferation, ELISpot, and OVA-specific Ab ELISAs. ... Plates were then incubated with streptavidin-conjugated horseradish peroxidase (eBioscience) and developed with 3,3′,5,5′-tetramethylbenzidine solution (eBioscience), and the optical density at 450 nm (OD450 ) was measured.

    ELISpot Assay:

    Article Title: Characterization and Optimization of the Glucan Particle-Based Vaccine Platform
    Article Snippet: Similarly, for the enzyme-linked immunosorbent spot assay (ELISpot), purified CD4+ T cells, mitomycin C-treated BMDCs, and stimuli were incubated in filtered plates coated with capture antibodies (Abs) specific for each cytokine. .. Plates were then incubated with streptavidin-conjugated horseradish peroxidase (eBioscience) and developed with 3,3′,5,5′-tetramethylbenzidine solution (eBioscience), and the optical density at 450 nm (OD450 ) was measured.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    Thermo Fisher streptavidin conjugated horseradish peroxidase
    Phenotype of Gal-9 + Th cells. To clearly demonstrate the co-expression of cell-surface Gal-9 with either Foxp3 or Tim-3, highly sensitive Gal-9 staining with biotinylated-anti-Gal-9 antibody plus <t>streptavidin-APC</t> was employed. ( A ) Naïve CD4 T cells cultured under neutral conditions (left) or Treg-skewing conditions (right) for 4 days were examined for Foxp3 (Treg marker) and cell-surface Gal-9 expressions using flow cytometry. ( B ) Co-expression analysis of cell-surface Gal-9 and Tim-3 in naïve CD4 T cells cultured under neutral conditions for 4 days. ( C ) Intracellular IL-10 in naïve CD4 T cells purified from wild-type (WT) or Gal-9 knockout (Gal-9 KO) mice. ( D ) Naïve CD4 T cells from WT and Gal-9 KO mice were cultured under neutral or Th17-skewing conditions, and IL-10 mRNA expression was measured. Results are shown as the mean ± SEM of triplicate or quadruplicate. Symbol (*) represents significant ( p
    Streptavidin Conjugated Horseradish Peroxidase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 87 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/streptavidin conjugated horseradish peroxidase/product/Thermo Fisher
    Average 93 stars, based on 87 article reviews
    Price from $9.99 to $1999.99
    streptavidin conjugated horseradish peroxidase - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    Image Search Results


    Phenotype of Gal-9 + Th cells. To clearly demonstrate the co-expression of cell-surface Gal-9 with either Foxp3 or Tim-3, highly sensitive Gal-9 staining with biotinylated-anti-Gal-9 antibody plus streptavidin-APC was employed. ( A ) Naïve CD4 T cells cultured under neutral conditions (left) or Treg-skewing conditions (right) for 4 days were examined for Foxp3 (Treg marker) and cell-surface Gal-9 expressions using flow cytometry. ( B ) Co-expression analysis of cell-surface Gal-9 and Tim-3 in naïve CD4 T cells cultured under neutral conditions for 4 days. ( C ) Intracellular IL-10 in naïve CD4 T cells purified from wild-type (WT) or Gal-9 knockout (Gal-9 KO) mice. ( D ) Naïve CD4 T cells from WT and Gal-9 KO mice were cultured under neutral or Th17-skewing conditions, and IL-10 mRNA expression was measured. Results are shown as the mean ± SEM of triplicate or quadruplicate. Symbol (*) represents significant ( p

    Journal: PLoS ONE

    Article Title: Cell Surface Galectin-9 Expressing Th Cells Regulate Th17 and Foxp3+ Treg Development by Galectin-9 Secretion

    doi: 10.1371/journal.pone.0048574

    Figure Lengend Snippet: Phenotype of Gal-9 + Th cells. To clearly demonstrate the co-expression of cell-surface Gal-9 with either Foxp3 or Tim-3, highly sensitive Gal-9 staining with biotinylated-anti-Gal-9 antibody plus streptavidin-APC was employed. ( A ) Naïve CD4 T cells cultured under neutral conditions (left) or Treg-skewing conditions (right) for 4 days were examined for Foxp3 (Treg marker) and cell-surface Gal-9 expressions using flow cytometry. ( B ) Co-expression analysis of cell-surface Gal-9 and Tim-3 in naïve CD4 T cells cultured under neutral conditions for 4 days. ( C ) Intracellular IL-10 in naïve CD4 T cells purified from wild-type (WT) or Gal-9 knockout (Gal-9 KO) mice. ( D ) Naïve CD4 T cells from WT and Gal-9 KO mice were cultured under neutral or Th17-skewing conditions, and IL-10 mRNA expression was measured. Results are shown as the mean ± SEM of triplicate or quadruplicate. Symbol (*) represents significant ( p

    Article Snippet: Gal-9 was detected using polyclonal anti-mouse Gal-9 antibody conjugated with biotin (GalPharma) and streptavidin-conjugated horseradish peroxidase (Thermo Fisher Scientific, Waltham, MA, USA).

    Techniques: Expressing, Staining, Cell Culture, Marker, Flow Cytometry, Cytometry, Purification, Knock-Out, Mouse Assay

    Quantification of aldehydic lesions and AP sites using ARP and AA3. (A) HeLa DNA was labeled with ARP and vacuum-spotted onto a nylon membrane. Aldehydic lesions in this DNA were quantified using streptavidin-conjugated horseradish peroxidase (HRP) and detected using a chemiluminescent substrate (open bar). In parallel, aldehydic lesions in HeLa DNA were also labeled with AA3 followed by reaction with Cy5 azide and quantification of fluorescence on a nylon membrane (black bar). AA3-labeled aldehydic lesions reacted with Cy5 azide were also quantified in solution using a microplate reader (gray bars). Mean and standard deviation of triplicate samples is shown. (B) HeLa DNA was pre-treated with NaBH 4 to reduce endogenous aldehydic lesions and AP sites were generated by heat and acid treatment for different lengths of time. The AP sites were labeled using ARP or AA3 for labeling and the DNA was spotted onto a nylon membrane and the membranes scanned to quantify AP sites ( Left ). AP sites in the same DNAs were also quantified by reacting them successively with AA3 and Cy5 azide, and measuring fluorescence intensity directly using a microplate reader ( right) . Mean and standard deviation of triplicate samples is shown for each time point.

    Journal: DNA repair

    Article Title: A Versatile New Tool to Quantify Abasic Sites in DNA and Inhibit Base Excision Repair

    doi: 10.1016/j.dnarep.2014.12.006

    Figure Lengend Snippet: Quantification of aldehydic lesions and AP sites using ARP and AA3. (A) HeLa DNA was labeled with ARP and vacuum-spotted onto a nylon membrane. Aldehydic lesions in this DNA were quantified using streptavidin-conjugated horseradish peroxidase (HRP) and detected using a chemiluminescent substrate (open bar). In parallel, aldehydic lesions in HeLa DNA were also labeled with AA3 followed by reaction with Cy5 azide and quantification of fluorescence on a nylon membrane (black bar). AA3-labeled aldehydic lesions reacted with Cy5 azide were also quantified in solution using a microplate reader (gray bars). Mean and standard deviation of triplicate samples is shown. (B) HeLa DNA was pre-treated with NaBH 4 to reduce endogenous aldehydic lesions and AP sites were generated by heat and acid treatment for different lengths of time. The AP sites were labeled using ARP or AA3 for labeling and the DNA was spotted onto a nylon membrane and the membranes scanned to quantify AP sites ( Left ). AP sites in the same DNAs were also quantified by reacting them successively with AA3 and Cy5 azide, and measuring fluorescence intensity directly using a microplate reader ( right) . Mean and standard deviation of triplicate samples is shown for each time point.

    Article Snippet: When ARP was used, the DNA adducts were quantified using streptavidin-conjugated horseradish peroxidase , and when AA3 was used the adducts were tagged with Cy5 for quantification.

    Techniques: Labeling, Fluorescence, Standard Deviation, Generated

    Sensitivity of detection of AP sites using ARP and AA3. (A) Image of the nylon membranes where different amounts of DNA containing a synthetic oligomer with one AP site were labeled using either ARP-HRP (top) or AA3-Cy5 (bottom). (B) Synthetic duplex containing one AP site was labeled with either ARP or AA3. Different dilutions of ARP-labeled DNA was spotted on a membrane and bound with Cy5-streptavidin. AA3-labeled DNA was reacted with Cy5 azide and different dilutions were spotted on a membrane. Cy5 fluorescence was quantified in each case and is plotted against the number of AP sites in each spot. (Inset) Image of the membrane in each case.

    Journal: DNA repair

    Article Title: A Versatile New Tool to Quantify Abasic Sites in DNA and Inhibit Base Excision Repair

    doi: 10.1016/j.dnarep.2014.12.006

    Figure Lengend Snippet: Sensitivity of detection of AP sites using ARP and AA3. (A) Image of the nylon membranes where different amounts of DNA containing a synthetic oligomer with one AP site were labeled using either ARP-HRP (top) or AA3-Cy5 (bottom). (B) Synthetic duplex containing one AP site was labeled with either ARP or AA3. Different dilutions of ARP-labeled DNA was spotted on a membrane and bound with Cy5-streptavidin. AA3-labeled DNA was reacted with Cy5 azide and different dilutions were spotted on a membrane. Cy5 fluorescence was quantified in each case and is plotted against the number of AP sites in each spot. (Inset) Image of the membrane in each case.

    Article Snippet: When ARP was used, the DNA adducts were quantified using streptavidin-conjugated horseradish peroxidase , and when AA3 was used the adducts were tagged with Cy5 for quantification.

    Techniques: Labeling, Fluorescence