streptavidin coated magnetic beads  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Thermo Fisher streptavidin coated magnetic beads
    Binding specificities of anti-VEGF-C scFv. (A) ELISA screening of random clones obtained after 2 or 3 rounds of panning against ΔNΔC-VEGF-C. (B) ELISA analysis of representative anti-VEGF-C scFv clones for the 4 different amino acid sequences obtained. Maxisorp or <t>streptavidin-precoated</t> (SA) plates were coated with his-tagged human ΔNΔC-VEGF-C derived from P. pastoris or biotinylated his-tagged human ΔNΔC-VEGF-C from mammalian cells or P. pastoris , respectively. Control surfaces were left untreated. Antibody fragments and control antibodies were subsequently added and the ELISA was developed as described in Materials and Methods. (C) Cross-reactivity tested by ELISA. Human ΔNΔC-VEGF-C orΔNΔC-VEGF-D (both from mammalian cells) were coated on a maxisorp plate. Anti-VEGF-C scFv clone VC2 or a negative control (PBS only) was added and the ELISA was developed as described in Materials and Methods. (D) BIAcore profiles from the 4 different anti-VEGF-C scFv clones. Different concentrations of protein-A purified scFv were injected on a streptavidin-precoated sensorchip coated with ca. 2000 RU biotinylated mammalian cell-derived ΔNΔC-VEGF-C.
    Streptavidin Coated Magnetic Beads, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 385 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/streptavidin coated magnetic beads/product/Thermo Fisher
    Average 99 stars, based on 385 article reviews
    Price from $9.99 to $1999.99
    streptavidin coated magnetic beads - by Bioz Stars, 2020-02
    99/100 stars

    Images

    1) Product Images from "Phage-Derived Fully Human Monoclonal Antibody Fragments to Human Vascular Endothelial Growth Factor-C Block Its Interaction with VEGF Receptor-2 and 3"

    Article Title: Phage-Derived Fully Human Monoclonal Antibody Fragments to Human Vascular Endothelial Growth Factor-C Block Its Interaction with VEGF Receptor-2 and 3

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0011941

    Binding specificities of anti-VEGF-C scFv. (A) ELISA screening of random clones obtained after 2 or 3 rounds of panning against ΔNΔC-VEGF-C. (B) ELISA analysis of representative anti-VEGF-C scFv clones for the 4 different amino acid sequences obtained. Maxisorp or streptavidin-precoated (SA) plates were coated with his-tagged human ΔNΔC-VEGF-C derived from P. pastoris or biotinylated his-tagged human ΔNΔC-VEGF-C from mammalian cells or P. pastoris , respectively. Control surfaces were left untreated. Antibody fragments and control antibodies were subsequently added and the ELISA was developed as described in Materials and Methods. (C) Cross-reactivity tested by ELISA. Human ΔNΔC-VEGF-C orΔNΔC-VEGF-D (both from mammalian cells) were coated on a maxisorp plate. Anti-VEGF-C scFv clone VC2 or a negative control (PBS only) was added and the ELISA was developed as described in Materials and Methods. (D) BIAcore profiles from the 4 different anti-VEGF-C scFv clones. Different concentrations of protein-A purified scFv were injected on a streptavidin-precoated sensorchip coated with ca. 2000 RU biotinylated mammalian cell-derived ΔNΔC-VEGF-C.
    Figure Legend Snippet: Binding specificities of anti-VEGF-C scFv. (A) ELISA screening of random clones obtained after 2 or 3 rounds of panning against ΔNΔC-VEGF-C. (B) ELISA analysis of representative anti-VEGF-C scFv clones for the 4 different amino acid sequences obtained. Maxisorp or streptavidin-precoated (SA) plates were coated with his-tagged human ΔNΔC-VEGF-C derived from P. pastoris or biotinylated his-tagged human ΔNΔC-VEGF-C from mammalian cells or P. pastoris , respectively. Control surfaces were left untreated. Antibody fragments and control antibodies were subsequently added and the ELISA was developed as described in Materials and Methods. (C) Cross-reactivity tested by ELISA. Human ΔNΔC-VEGF-C orΔNΔC-VEGF-D (both from mammalian cells) were coated on a maxisorp plate. Anti-VEGF-C scFv clone VC2 or a negative control (PBS only) was added and the ELISA was developed as described in Materials and Methods. (D) BIAcore profiles from the 4 different anti-VEGF-C scFv clones. Different concentrations of protein-A purified scFv were injected on a streptavidin-precoated sensorchip coated with ca. 2000 RU biotinylated mammalian cell-derived ΔNΔC-VEGF-C.

    Techniques Used: Binding Assay, Enzyme-linked Immunosorbent Assay, Clone Assay, Derivative Assay, Negative Control, Purification, Injection

    Affinity matured anti-VEGF-C scFvs possess a higher affinity. (A, B) ELISA analysis of bacterial supernatant from randomly picked affinity matured clones after 1 to 3 rounds of selection on biotinylated (A) P. pastoris -derived or (B) mammalian cell-derived ΔNΔC-VEGF-C. (C) BIAcore profiles of monomeric affinity matured anti-VEGF-C scFvs. Monomeric fractions of protein-A purified scFv were prepared by FPLC and injected as 2-fold dilution series on a streptavidin-sensorchip coated with 2000 RU biotinylated ΔNΔC-VEGF-C derived from mammalian cells.
    Figure Legend Snippet: Affinity matured anti-VEGF-C scFvs possess a higher affinity. (A, B) ELISA analysis of bacterial supernatant from randomly picked affinity matured clones after 1 to 3 rounds of selection on biotinylated (A) P. pastoris -derived or (B) mammalian cell-derived ΔNΔC-VEGF-C. (C) BIAcore profiles of monomeric affinity matured anti-VEGF-C scFvs. Monomeric fractions of protein-A purified scFv were prepared by FPLC and injected as 2-fold dilution series on a streptavidin-sensorchip coated with 2000 RU biotinylated ΔNΔC-VEGF-C derived from mammalian cells.

    Techniques Used: Enzyme-linked Immunosorbent Assay, Clone Assay, Selection, Derivative Assay, Purification, Fast Protein Liquid Chromatography, Injection

    2) Product Images from "Design and synthesis of a photocleavable biotinylated nucleotide for DNA analysis by mass spectrometry"

    Article Title: Design and synthesis of a photocleavable biotinylated nucleotide for DNA analysis by mass spectrometry

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkh198

    MALDI-TOF mass spectra of the DNA extension products from four simultaneous primer extension reactions using dUTP-PC-Biotin before and after photocleavage. ( A ) Before UV irradiation. The extension products were purified by solid phase capture and released for MS analysis by using formamide to denature the biotin–streptavidin binding. The double charged ion peaks are indicated by asterisks. ( B ) After 10 min irradiation (340 nm) of the DNA fragments captured on the streptavidin-coated beads, photocleaved DNA products are released without biotin, and detected in the solution.
    Figure Legend Snippet: MALDI-TOF mass spectra of the DNA extension products from four simultaneous primer extension reactions using dUTP-PC-Biotin before and after photocleavage. ( A ) Before UV irradiation. The extension products were purified by solid phase capture and released for MS analysis by using formamide to denature the biotin–streptavidin binding. The double charged ion peaks are indicated by asterisks. ( B ) After 10 min irradiation (340 nm) of the DNA fragments captured on the streptavidin-coated beads, photocleaved DNA products are released without biotin, and detected in the solution.

    Techniques Used: Irradiation, Purification, Mass Spectrometry, Binding Assay

    MALDI-TOF mass spectra of the DNA extension product generated from dUTP-PC-Biotin before and after photocleavage. ( A ) Before UV irradiation. The extension product was purified by solid phase capture and released for MS analysis by using formamide to denature the biotin–streptavidin binding. ( B ) After 10 min irradiation (340 nm) of the DNA fragments captured on the streptavidin-coated beads, the photocleaved DNA fragment 7 is released without biotin, and detected in the solution.
    Figure Legend Snippet: MALDI-TOF mass spectra of the DNA extension product generated from dUTP-PC-Biotin before and after photocleavage. ( A ) Before UV irradiation. The extension product was purified by solid phase capture and released for MS analysis by using formamide to denature the biotin–streptavidin binding. ( B ) After 10 min irradiation (340 nm) of the DNA fragments captured on the streptavidin-coated beads, the photocleaved DNA fragment 7 is released without biotin, and detected in the solution.

    Techniques Used: Generated, Irradiation, Purification, Mass Spectrometry, Binding Assay

    Polymerase extension reaction using dUTP-PC-Biotin as a substrate and photocleavage of DNA fragments containing dU-PC-Biotin on a solid surface. DNA polymerase incorporates dUTP-PC-Biotin and ddGTP to generate the DNA fragment 6 . Photocleavage by near-UV light (340 nm) of the DNA fragment 6 captured on streptavidin-coated beads produces DNA fragment 7 , while the PC-Biotin moiety stays on the solid surface of the beads.
    Figure Legend Snippet: Polymerase extension reaction using dUTP-PC-Biotin as a substrate and photocleavage of DNA fragments containing dU-PC-Biotin on a solid surface. DNA polymerase incorporates dUTP-PC-Biotin and ddGTP to generate the DNA fragment 6 . Photocleavage by near-UV light (340 nm) of the DNA fragment 6 captured on streptavidin-coated beads produces DNA fragment 7 , while the PC-Biotin moiety stays on the solid surface of the beads.

    Techniques Used:

    3) Product Images from "Local palmitoylation cycles define activity-regulated postsynaptic subdomains"

    Article Title: Local palmitoylation cycles define activity-regulated postsynaptic subdomains

    Journal: The Journal of Cell Biology

    doi: 10.1083/jcb.201302071

    DHHC2 directly nucleates PSD-95 assembly at the plasma membrane through local palmitoylation. (A) HEK293T cells were cotransfected with a bi-cistronic RUSH vector containing streptavidin-Ii (Str-ER Hook) and streptavidin-binding peptide (SBP)-GFP-DHHC2 as well as PSD-95-mCherry. Synchronized release of DHHC2 from the ER was induced by the addition of biotin with or without 2-BP. Arrowheads denote signals at the plasma membrane. Bar, 10 µm. (B) Kymograph analysis. The fluorescence intensities of GFP and mCherry were measured along red lines in A. White arrows indicate the timing when DHHC2 arrived at the plasma membrane. Black arrows indicate the position of the plasma membrane (at 90 min). CS, inactive DHHC2. Bar, 2.5 µm.
    Figure Legend Snippet: DHHC2 directly nucleates PSD-95 assembly at the plasma membrane through local palmitoylation. (A) HEK293T cells were cotransfected with a bi-cistronic RUSH vector containing streptavidin-Ii (Str-ER Hook) and streptavidin-binding peptide (SBP)-GFP-DHHC2 as well as PSD-95-mCherry. Synchronized release of DHHC2 from the ER was induced by the addition of biotin with or without 2-BP. Arrowheads denote signals at the plasma membrane. Bar, 10 µm. (B) Kymograph analysis. The fluorescence intensities of GFP and mCherry were measured along red lines in A. White arrows indicate the timing when DHHC2 arrived at the plasma membrane. Black arrows indicate the position of the plasma membrane (at 90 min). CS, inactive DHHC2. Bar, 2.5 µm.

    Techniques Used: Plasmid Preparation, Binding Assay, Fluorescence

    4) Product Images from "Histone modifications influence mediator interactions with chromatin"

    Article Title: Histone modifications influence mediator interactions with chromatin

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkr551

    Assay of Mediator binding to biotinylated synthetic histone tail peptides using streptavidin conjugated magnetic beads. ( A and B ) Wild-type Mediator (~6 nM) was incubated with histone tail peptides (~2 µM) (Input). After incubation of the input with streptavidin beads, the beads were washed, and bound Mediator and peptide eluted from the beads with SDS page loading buffer (Elution). Western blotting using the specified percent of the total input and elution samples and antibodies against subunits from different structural modules of Mediator [α-Med14(Rgr1), α-Med1, α-Med18(Srb5) and α-Med8], were used to analyze the input and elution fractions. ( C ) Wild-type Mediator (~1.5 nM) was incubated with histone tail peptides (~2 µM) (Input). After incubation of the input with streptavidin beads, the beads were washed, and bound Mediator and peptide eluted from the beads with SDS page loading buffer (Elution). Western blotting using the specified percent of the total input and elution samples, and antibodies against subunits from different structural modules of Mediator [α-Med14(Rgr1), α-Med1, and α-Med18(Srb5)], were used to analyze the input and elution fractions. ( D ) Order of affinity of wild-type Mediator for different histone tail peptides.
    Figure Legend Snippet: Assay of Mediator binding to biotinylated synthetic histone tail peptides using streptavidin conjugated magnetic beads. ( A and B ) Wild-type Mediator (~6 nM) was incubated with histone tail peptides (~2 µM) (Input). After incubation of the input with streptavidin beads, the beads were washed, and bound Mediator and peptide eluted from the beads with SDS page loading buffer (Elution). Western blotting using the specified percent of the total input and elution samples and antibodies against subunits from different structural modules of Mediator [α-Med14(Rgr1), α-Med1, α-Med18(Srb5) and α-Med8], were used to analyze the input and elution fractions. ( C ) Wild-type Mediator (~1.5 nM) was incubated with histone tail peptides (~2 µM) (Input). After incubation of the input with streptavidin beads, the beads were washed, and bound Mediator and peptide eluted from the beads with SDS page loading buffer (Elution). Western blotting using the specified percent of the total input and elution samples, and antibodies against subunits from different structural modules of Mediator [α-Med14(Rgr1), α-Med1, and α-Med18(Srb5)], were used to analyze the input and elution fractions. ( D ) Order of affinity of wild-type Mediator for different histone tail peptides.

    Techniques Used: Binding Assay, Magnetic Beads, Incubation, SDS Page, Western Blot

    5) Product Images from "Cell-SELEX Based Identification of an RNA Aptamer for Escherichia coli and Its Use in Various Detection Formats"

    Article Title: Cell-SELEX Based Identification of an RNA Aptamer for Escherichia coli and Its Use in Various Detection Formats

    Journal: Molecules and Cells

    doi: 10.14348/molcells.2016.0167

    Aptamer Ec3(31) mediated E. coli pull-down. Streptavidin coated magnetic beads complexed with Ec3(31)-biotin was used to pull-down E. coli from various concentrations of sample preparations and further cultured on LB plate. Colonies were counted and represented on the Y axis. N40 down primer and SQ2 mutant sequences were used as controls. Results are represented as mean ± SD of 3 independent experiments.
    Figure Legend Snippet: Aptamer Ec3(31) mediated E. coli pull-down. Streptavidin coated magnetic beads complexed with Ec3(31)-biotin was used to pull-down E. coli from various concentrations of sample preparations and further cultured on LB plate. Colonies were counted and represented on the Y axis. N40 down primer and SQ2 mutant sequences were used as controls. Results are represented as mean ± SD of 3 independent experiments.

    Techniques Used: Magnetic Beads, Cell Culture, Mutagenesis

    6) Product Images from "Coactivator-Associated Arginine Methyltransferase 1 Enhances Transcriptional Activity of the Human T-Cell Lymphotropic Virus Type 1 Long Terminal Repeat through Direct Interaction with Tax"

    Article Title: Coactivator-Associated Arginine Methyltransferase 1 Enhances Transcriptional Activity of the Human T-Cell Lymphotropic Virus Type 1 Long Terminal Repeat through Direct Interaction with Tax

    Journal: Journal of Virology

    doi: 10.1128/JVI.00186-06

    CARM1 is recruited to the HTLV-1 PICs in the presence of Tax. HTLV-1 PICs were assembled by incubating biotinylated HTLV-1 templates with HeLa nuclear extracts (ext) in the absence or presence of the His 6 -Tax WT or mutant (del 151-204) and then purified with streptavidin-coated magnetic beads. The protein components of the purified PICs were analyzed by Western blotting with anti-Tax (A), -CARM1 (B), -CREB (C), or -p300 (D) antibodies. DNA-bio, biotinylated DNA.
    Figure Legend Snippet: CARM1 is recruited to the HTLV-1 PICs in the presence of Tax. HTLV-1 PICs were assembled by incubating biotinylated HTLV-1 templates with HeLa nuclear extracts (ext) in the absence or presence of the His 6 -Tax WT or mutant (del 151-204) and then purified with streptavidin-coated magnetic beads. The protein components of the purified PICs were analyzed by Western blotting with anti-Tax (A), -CARM1 (B), -CREB (C), or -p300 (D) antibodies. DNA-bio, biotinylated DNA.

    Techniques Used: Mutagenesis, Purification, Magnetic Beads, Western Blot

    7) Product Images from "High Affinity Binders to EphA2 Isolated from Abdurin Scaffold Libraries; Characterization, Binding and Tumor Targeting"

    Article Title: High Affinity Binders to EphA2 Isolated from Abdurin Scaffold Libraries; Characterization, Binding and Tumor Targeting

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0135278

    Abdurin binding assays. Affinity matured binders to EphA2, selected by CIS display, were tested in end-point titration ELISA assays in 96-well plates coated with hEphA2-Fc (a), mEphA2-Fc (b) or strepavidin (c). The purified matured Abdurin clones D2, G7, B6 and B11 were tested alongside the purified non-matured parental EphA2 binding clones selected by phage display, E10par and H3par, as detected by anti-FLAG M2-HRP conjugated antibody. Binding of Abdurin binders and the truncated wild-type human CH2 (shWTCH2) to CHO cells transfected with human EphA2 (d) or to non-transfected cells (e), was assessed by FACS analysis.
    Figure Legend Snippet: Abdurin binding assays. Affinity matured binders to EphA2, selected by CIS display, were tested in end-point titration ELISA assays in 96-well plates coated with hEphA2-Fc (a), mEphA2-Fc (b) or strepavidin (c). The purified matured Abdurin clones D2, G7, B6 and B11 were tested alongside the purified non-matured parental EphA2 binding clones selected by phage display, E10par and H3par, as detected by anti-FLAG M2-HRP conjugated antibody. Binding of Abdurin binders and the truncated wild-type human CH2 (shWTCH2) to CHO cells transfected with human EphA2 (d) or to non-transfected cells (e), was assessed by FACS analysis.

    Techniques Used: Binding Assay, Titration, Enzyme-linked Immunosorbent Assay, Purification, Clone Assay, Transfection, FACS

    8) Product Images from "DNA sequencing using biotinylated dideoxynucleotides and mass spectrometry"

    Article Title: DNA sequencing using biotinylated dideoxynucleotides and mass spectrometry

    Journal: Nucleic Acids Research

    doi:

    Scheme used to purify DNA-sequencing fragments for analysis by MS. False stops, excess primers and salts are eliminated from the reaction by capturing all correctly terminated DNA-sequencing fragments with streptavidin-coated magnetic beads. The purified fragments are then cleaved from the beads with 98% formamide for analysis by MALDI-TOF MS.
    Figure Legend Snippet: Scheme used to purify DNA-sequencing fragments for analysis by MS. False stops, excess primers and salts are eliminated from the reaction by capturing all correctly terminated DNA-sequencing fragments with streptavidin-coated magnetic beads. The purified fragments are then cleaved from the beads with 98% formamide for analysis by MALDI-TOF MS.

    Techniques Used: DNA Sequencing, Mass Spectrometry, Magnetic Beads, Purification

    9) Product Images from "Galectins control mTOR in response to endomembrane damage"

    Article Title: Galectins control mTOR in response to endomembrane damage

    Journal: Molecular cell

    doi: 10.1016/j.molcel.2018.03.009

    Gal8 is in dynamic complexes with mTOR and its regulators and adaptors (A) Galectin puncta formation in response to GPN. Cells expressing YFP-galectin fusions were treated with 100 μM GPN or without (Ctrl) in full medium for 1 h and galectin puncta quantified by HC. Left, images of galectins 1, 3, 8, and 9. White masks, algorithm-defined cell boundaries (primary objects); green masks, computer-identified galectin puncta (target objects). (B) Co-immunoprecipitation (Co-IP) analysis of galectins and mTOR or RagA. Cells expressing FLAG-tagged galectins were subjected to anti-FLAG immunoprecipitation followed by immunoblotting for endogenous mTOR or RagA. (C) Co-IP analysis of endogenous proteins in macrophage-like cells treated with 100 μM GPN in full medium1 h. IP: anti-Gal8; immunoblotting: endogenous RagA, p14, mTOR and Raptor. (D) APEX2 proximity biotinylation analysis. Cells were transfected with APEX2 fusions with Gal3, 8 and 9, incubated or not with biotin-phenol, pulsed with H 2 O 2 , and biotinylated proteins affinity-isolated on streptavidin-beads analyzed by immunoblotting. (E) Proximity biotinylation as in D in response to GPN. BP, biotin-phenol. (F)(i-ii) GST pulldown assay of in vitro translated and radiolabeled Myc-tagged p18 with GST, or GST-tagged Gal8 and Gal9. Data (% binding). (G)(i-ii) GST pulldown assay of in vitro translated Myc-tagged Gal8 or Gal9 with GST or GST-tagged RagB/D. Data as in F. (H) Cells transfected with GFP-Gal8 and FLAG-tagged metap2 (negative control) or RagB variants (RagB WT , RagB T54L or RagB Q99L ) were subjected to anti-GFP IP, followed by immunoblotting for FLAG-tagged proteins or GFP. (I) Cells transfected with GFP-Gal8 and FLAG-tagged metap2 or RagC variants (RagC WT , RagC S75L or RagC Q120L .
    Figure Legend Snippet: Gal8 is in dynamic complexes with mTOR and its regulators and adaptors (A) Galectin puncta formation in response to GPN. Cells expressing YFP-galectin fusions were treated with 100 μM GPN or without (Ctrl) in full medium for 1 h and galectin puncta quantified by HC. Left, images of galectins 1, 3, 8, and 9. White masks, algorithm-defined cell boundaries (primary objects); green masks, computer-identified galectin puncta (target objects). (B) Co-immunoprecipitation (Co-IP) analysis of galectins and mTOR or RagA. Cells expressing FLAG-tagged galectins were subjected to anti-FLAG immunoprecipitation followed by immunoblotting for endogenous mTOR or RagA. (C) Co-IP analysis of endogenous proteins in macrophage-like cells treated with 100 μM GPN in full medium1 h. IP: anti-Gal8; immunoblotting: endogenous RagA, p14, mTOR and Raptor. (D) APEX2 proximity biotinylation analysis. Cells were transfected with APEX2 fusions with Gal3, 8 and 9, incubated or not with biotin-phenol, pulsed with H 2 O 2 , and biotinylated proteins affinity-isolated on streptavidin-beads analyzed by immunoblotting. (E) Proximity biotinylation as in D in response to GPN. BP, biotin-phenol. (F)(i-ii) GST pulldown assay of in vitro translated and radiolabeled Myc-tagged p18 with GST, or GST-tagged Gal8 and Gal9. Data (% binding). (G)(i-ii) GST pulldown assay of in vitro translated Myc-tagged Gal8 or Gal9 with GST or GST-tagged RagB/D. Data as in F. (H) Cells transfected with GFP-Gal8 and FLAG-tagged metap2 (negative control) or RagB variants (RagB WT , RagB T54L or RagB Q99L ) were subjected to anti-GFP IP, followed by immunoblotting for FLAG-tagged proteins or GFP. (I) Cells transfected with GFP-Gal8 and FLAG-tagged metap2 or RagC variants (RagC WT , RagC S75L or RagC Q120L .

    Techniques Used: Expressing, Immunoprecipitation, Co-Immunoprecipitation Assay, Transfection, Incubation, Isolation, GST Pulldown Assay, In Vitro, Binding Assay, Negative Control

    10) Product Images from "Borrelia burgdorferi transcriptome in the central nervous system of non-human primates"

    Article Title: Borrelia burgdorferi transcriptome in the central nervous system of non-human primates

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    doi: 10.1073/pnas.2432412100

    Schematic representation of DECAL. ( A ) Construction of Bb-CAL. A ZAP II B. burgdorferi genomic library was screened with radioactively labeled B. burgdorferi rRNA probes and hybridizing clones discarded. The nonribosomal clones were pooled and restriction digested with EcoR V and Sma I. The 200- to 2,000-bp fragments were gel-purified, ligated to PCR adapters, and PCR-amplified. ( B ) Positive selection and amplification. Total RNA isolated from heart and CNS of B. burgdorferi -infected NHPs was reverse transcribed in the presence of biotin-dATP. The biotinylated cDNA samples were hybridized to Bb-CAL under stringent conditions. The cDNA-Bb-CAL hybrids were bound to streptavidin-coated magnetic beads and then washed to remove unhybridized Bb-CAL. ( C ) The bound genomic Bb-CAL (representing the B. burgdorferi transcripts in the CNS/heart) was eluted by boiling and PCR-amplified. The PCR products were radioactively labeled and hybridized to a replicate genomic array.
    Figure Legend Snippet: Schematic representation of DECAL. ( A ) Construction of Bb-CAL. A ZAP II B. burgdorferi genomic library was screened with radioactively labeled B. burgdorferi rRNA probes and hybridizing clones discarded. The nonribosomal clones were pooled and restriction digested with EcoR V and Sma I. The 200- to 2,000-bp fragments were gel-purified, ligated to PCR adapters, and PCR-amplified. ( B ) Positive selection and amplification. Total RNA isolated from heart and CNS of B. burgdorferi -infected NHPs was reverse transcribed in the presence of biotin-dATP. The biotinylated cDNA samples were hybridized to Bb-CAL under stringent conditions. The cDNA-Bb-CAL hybrids were bound to streptavidin-coated magnetic beads and then washed to remove unhybridized Bb-CAL. ( C ) The bound genomic Bb-CAL (representing the B. burgdorferi transcripts in the CNS/heart) was eluted by boiling and PCR-amplified. The PCR products were radioactively labeled and hybridized to a replicate genomic array.

    Techniques Used: Labeling, Clone Assay, Purification, Polymerase Chain Reaction, Amplification, Selection, Isolation, Infection, Magnetic Beads

    11) Product Images from "A Novel Microtubule-Binding Drug Attenuates and Reverses Protein Aggregation in Animal Models of Alzheimer’s Disease"

    Article Title: A Novel Microtubule-Binding Drug Attenuates and Reverses Protein Aggregation in Animal Models of Alzheimer’s Disease

    Journal: Frontiers in Molecular Neuroscience

    doi: 10.3389/fnmol.2019.00310

    Biotinylated PNR502 localizes to aggregates in AM141 worms and is used to recover drug-adherent proteins. (A) Structure of biotinyl-PNR502. (B,C) AM141 adult worms were either untreated (B) or treated 26 h (C) with 10-μM PNR502 and then fed Alexa594-conjugated streptavidin (Thermo Fisher Scientific, Waltham, MA, USA). Fluorescence images were captured with a Nikon DS-Fi2 camera mounted on a Nikon C2 inverted microscope. Q40::YFP is displayed as green, and Alexa594 as red fluorescence. Yellow fluorescence in (C) indicates the superposition of Q40::YFP with PNR502-Alexa594. (D) Caudal hippocampi, from normal age-matched controls (AMC) or AD patients (pools of three per group), were lysed and incubated 2 h at 4°C with 5-μM PNR502 or biotinyl-PNR502. M , size markers; lanes 1–4, proteins recovered from: 1 , unmodified PNR502; 2 , biotinyl-PNR502; 3 , equivalent portion of flow-through for unmodified PNR502; 4 , flow-through from biotinyl-PNR502.
    Figure Legend Snippet: Biotinylated PNR502 localizes to aggregates in AM141 worms and is used to recover drug-adherent proteins. (A) Structure of biotinyl-PNR502. (B,C) AM141 adult worms were either untreated (B) or treated 26 h (C) with 10-μM PNR502 and then fed Alexa594-conjugated streptavidin (Thermo Fisher Scientific, Waltham, MA, USA). Fluorescence images were captured with a Nikon DS-Fi2 camera mounted on a Nikon C2 inverted microscope. Q40::YFP is displayed as green, and Alexa594 as red fluorescence. Yellow fluorescence in (C) indicates the superposition of Q40::YFP with PNR502-Alexa594. (D) Caudal hippocampi, from normal age-matched controls (AMC) or AD patients (pools of three per group), were lysed and incubated 2 h at 4°C with 5-μM PNR502 or biotinyl-PNR502. M , size markers; lanes 1–4, proteins recovered from: 1 , unmodified PNR502; 2 , biotinyl-PNR502; 3 , equivalent portion of flow-through for unmodified PNR502; 4 , flow-through from biotinyl-PNR502.

    Techniques Used: Fluorescence, Inverted Microscopy, Incubation, Flow Cytometry

    12) Product Images from "Architecture of nucleotide excision repair complexes: DNA is wrapped by UvrB before and after damage recognition"

    Article Title: Architecture of nucleotide excision repair complexes: DNA is wrapped by UvrB before and after damage recognition

    Journal: The EMBO Journal

    doi: 10.1093/emboj/20.3.601

    Fig. 1. ( A ) Schematic representation of the construction of the double-stranded AFM substrate. The different DNA strands of the 5′ biotinylated PCR fragments (indicated by small filled circles) are isolated using streptavidin-coated magnetic beads (indicated by large filled circles). The 297 nt top strand is added to the immobilized 1032 nt bottom strand together with the 50 nt phosphorylated ‘AFM-chol’ oligo containing the cholesterol adduct. After hybridization and ligation, the incomplete top strand is extended by T 7 polymerase to produce a completely double-stranded fragment. Digestion with Sma I yields a 1020 bp DNA fragment containing a single cholesterol adduct at position 324 in the top strand. ( B ) DNA sequence of the 50 bp S1 substrate. The cholesterol adduct (Chol) is introduced at position 27 (X) in the top strand. The incision positions are indicated with arrows.
    Figure Legend Snippet: Fig. 1. ( A ) Schematic representation of the construction of the double-stranded AFM substrate. The different DNA strands of the 5′ biotinylated PCR fragments (indicated by small filled circles) are isolated using streptavidin-coated magnetic beads (indicated by large filled circles). The 297 nt top strand is added to the immobilized 1032 nt bottom strand together with the 50 nt phosphorylated ‘AFM-chol’ oligo containing the cholesterol adduct. After hybridization and ligation, the incomplete top strand is extended by T 7 polymerase to produce a completely double-stranded fragment. Digestion with Sma I yields a 1020 bp DNA fragment containing a single cholesterol adduct at position 324 in the top strand. ( B ) DNA sequence of the 50 bp S1 substrate. The cholesterol adduct (Chol) is introduced at position 27 (X) in the top strand. The incision positions are indicated with arrows.

    Techniques Used: Polymerase Chain Reaction, Isolation, Magnetic Beads, Hybridization, Ligation, Sequencing

    13) Product Images from "A phosphorylation-and-ubiquitylation circuitry driving ATR activation and homologous recombination"

    Article Title: A phosphorylation-and-ubiquitylation circuitry driving ATR activation and homologous recombination

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkx571

    PRP19 assembles with RFWD3 on RPA–ssDNA in response to DNA damage and promotes RPA ubiquitylation. ( A ) PRP19 and RFWD3 depletion perturb DNA damage-induced RPA ubiquitylation. Cells were transfected with siRNAs targeting either PRP19 or RFWD3 and a vector expressing His 6 -tagged ubiquitin, treated or not with CPT and lysed under denaturing conditions. Ni-NTA pulldown was performed to isolate ubiquitylated proteins. ( B ) Cells were transfected with SFB- (S-protein, FLAG, streptavidin-binding peptide) GFP or SFB-RFWD3 vectors and streptavidin pulldown of SFB-tagged proteins in untreated or CPT-treated cells was performed. The indicated proteins were immunoblotted. ( C ) Cells were transfected with SFB-GFP or SFB-PRP19 vectors and streptavidin pulldown of SFB-tagged proteins isolated from untreated or CPT-treated cells was performed. The indicated proteins were immunoblotted. ( D ) Cells were transfected with SFB-GFP or SFB-PRP19 and myc-RFWD3 vectors. Streptavidin pulldown of SFB-tagged proteins isolated from untreated or CPT-treated cells was performed and the indicated proteins were immunoblotted. ( E ) HeLa cells transfected with an SFB-PRP19 vector and pre-sensitized with BrdU were UV laser microirradiated. Immunofluorescence against endogenous γ-H2AX, RFWD3 and FLAG epitope was subsequently performed to monitor RFWD3 and PRP19 accrual at damage sites.
    Figure Legend Snippet: PRP19 assembles with RFWD3 on RPA–ssDNA in response to DNA damage and promotes RPA ubiquitylation. ( A ) PRP19 and RFWD3 depletion perturb DNA damage-induced RPA ubiquitylation. Cells were transfected with siRNAs targeting either PRP19 or RFWD3 and a vector expressing His 6 -tagged ubiquitin, treated or not with CPT and lysed under denaturing conditions. Ni-NTA pulldown was performed to isolate ubiquitylated proteins. ( B ) Cells were transfected with SFB- (S-protein, FLAG, streptavidin-binding peptide) GFP or SFB-RFWD3 vectors and streptavidin pulldown of SFB-tagged proteins in untreated or CPT-treated cells was performed. The indicated proteins were immunoblotted. ( C ) Cells were transfected with SFB-GFP or SFB-PRP19 vectors and streptavidin pulldown of SFB-tagged proteins isolated from untreated or CPT-treated cells was performed. The indicated proteins were immunoblotted. ( D ) Cells were transfected with SFB-GFP or SFB-PRP19 and myc-RFWD3 vectors. Streptavidin pulldown of SFB-tagged proteins isolated from untreated or CPT-treated cells was performed and the indicated proteins were immunoblotted. ( E ) HeLa cells transfected with an SFB-PRP19 vector and pre-sensitized with BrdU were UV laser microirradiated. Immunofluorescence against endogenous γ-H2AX, RFWD3 and FLAG epitope was subsequently performed to monitor RFWD3 and PRP19 accrual at damage sites.

    Techniques Used: Recombinase Polymerase Amplification, Transfection, Plasmid Preparation, Expressing, Cycling Probe Technology, Binding Assay, Isolation, Immunofluorescence, FLAG-tag

    DNA-damage-induced RPA phosphorylation promotes its ubiquitylation. ( A ) HeLa cell lines stably expressing HA-tagged WT or Ala10 RPA32 mutants were transfected with a vector expressing SFB-PRP19. Cells were then treated with CPT 1 μM for 4 h, lysed and SFB-PRP19 and its interactors were isolated using streptavidin-associated beads. ( B ) Stable HeLa cell lines expressing the indicated HA-tagged RPA32 constructs were transfected with an siRNA targeting the 3′ untranslated region for the RPA32 mRNA. 72 h later, cells were treated with 1 μM CPT for 2 h, lysed and the indicated proteins were detected using specific antibodies. ( C ) Alternatively, cells transfected as in (B) were microirradiated and processed for immunofluorescence to examine PRP19 recruitment to laser stripes. ( D ) Histogram representing the recruitment of endogenous PRP19 to RPA32 stripes after laser microirradiation. The error bars correspond to biological triplicate experiments. At least 100 microirradiated cells were examined for each replicate. ( E ) Cells were transfected with vectors expressing His 6 -tagged ubiquitin and myc-tagged WT or Ala10 RPA32 mutants and treated with 1 μM CPT for 3 h. Ubiquitylated proteins were isolated by denaturing Ni-NTA pulldown.
    Figure Legend Snippet: DNA-damage-induced RPA phosphorylation promotes its ubiquitylation. ( A ) HeLa cell lines stably expressing HA-tagged WT or Ala10 RPA32 mutants were transfected with a vector expressing SFB-PRP19. Cells were then treated with CPT 1 μM for 4 h, lysed and SFB-PRP19 and its interactors were isolated using streptavidin-associated beads. ( B ) Stable HeLa cell lines expressing the indicated HA-tagged RPA32 constructs were transfected with an siRNA targeting the 3′ untranslated region for the RPA32 mRNA. 72 h later, cells were treated with 1 μM CPT for 2 h, lysed and the indicated proteins were detected using specific antibodies. ( C ) Alternatively, cells transfected as in (B) were microirradiated and processed for immunofluorescence to examine PRP19 recruitment to laser stripes. ( D ) Histogram representing the recruitment of endogenous PRP19 to RPA32 stripes after laser microirradiation. The error bars correspond to biological triplicate experiments. At least 100 microirradiated cells were examined for each replicate. ( E ) Cells were transfected with vectors expressing His 6 -tagged ubiquitin and myc-tagged WT or Ala10 RPA32 mutants and treated with 1 μM CPT for 3 h. Ubiquitylated proteins were isolated by denaturing Ni-NTA pulldown.

    Techniques Used: Recombinase Polymerase Amplification, Stable Transfection, Expressing, Transfection, Plasmid Preparation, Cycling Probe Technology, Isolation, Construct, Immunofluorescence

    The PRP19 WD40 domain contains an electropositive surface that mediates its damage-induced interaction with the RPA complex. ( A and B ) Electrostatic surface potential of the WD40 repeats domain of human PRP19 identifies two major electropositive surfaces (blue). The mutated positively charged residues in the mPocket1 and mPocket2 PRP19 constructs are shown in magenta. ( C ) Cells were transfected with WT SFB-PRP19 or the indicated mutants and treated with 1 μM CPT 24 h later. SFB-PRP19 constructs and their interactors were isolated using streptavidin-associated beads and immunoblotted with the indicated antibodies.
    Figure Legend Snippet: The PRP19 WD40 domain contains an electropositive surface that mediates its damage-induced interaction with the RPA complex. ( A and B ) Electrostatic surface potential of the WD40 repeats domain of human PRP19 identifies two major electropositive surfaces (blue). The mutated positively charged residues in the mPocket1 and mPocket2 PRP19 constructs are shown in magenta. ( C ) Cells were transfected with WT SFB-PRP19 or the indicated mutants and treated with 1 μM CPT 24 h later. SFB-PRP19 constructs and their interactors were isolated using streptavidin-associated beads and immunoblotted with the indicated antibodies.

    Techniques Used: Recombinase Polymerase Amplification, Construct, Transfection, Cycling Probe Technology, Isolation

    RPA32 ubiquitylation is regulated by PI3K-like kinases. (A) Cells were transfected with a vector expressing Strep-HA-tagged ubiquitin, pre-treated for 1 h with VE-821 (ATRi, 10 μM), KU55933 (ATMi, 10 uM), NU7441 (DNAPKi, 2 μM) or a combination of all three inhibitors, treated with 1 μM CPT for 4 h and lysed under denaturing conditions. Strep-Tactin pulldown was performed to isolate ubiquitylated proteins. ( B ) Cell transfection with an SFB-PRP19 vector were treated as in A and streptavidin pulldown was performed to isolate PRP19 along with its interactors. Controls for the efficiency of the inhibitor treatments are provided in ( S2A ). ( C and D ) U2OS cells were pre-sensitized with 10 μM BrdU, treated with the indicated inhibitors along with DRB for 1 h and damaged by UV-laser microirradiation. Recruitment of PRP19 and RPA32 was monitored 2 h after damage by immunofluorescence.
    Figure Legend Snippet: RPA32 ubiquitylation is regulated by PI3K-like kinases. (A) Cells were transfected with a vector expressing Strep-HA-tagged ubiquitin, pre-treated for 1 h with VE-821 (ATRi, 10 μM), KU55933 (ATMi, 10 uM), NU7441 (DNAPKi, 2 μM) or a combination of all three inhibitors, treated with 1 μM CPT for 4 h and lysed under denaturing conditions. Strep-Tactin pulldown was performed to isolate ubiquitylated proteins. ( B ) Cell transfection with an SFB-PRP19 vector were treated as in A and streptavidin pulldown was performed to isolate PRP19 along with its interactors. Controls for the efficiency of the inhibitor treatments are provided in ( S2A ). ( C and D ) U2OS cells were pre-sensitized with 10 μM BrdU, treated with the indicated inhibitors along with DRB for 1 h and damaged by UV-laser microirradiation. Recruitment of PRP19 and RPA32 was monitored 2 h after damage by immunofluorescence.

    Techniques Used: Transfection, Plasmid Preparation, Expressing, Cycling Probe Technology, Immunofluorescence

    RPA32 is phosphorylated and ubiquitylated in response to DNA damage that targets active replication forks. ( A ) Cells were transfected with a vector expressing His 6 -tagged ubiquitin and lysed under denaturing conditions. Ni-NTA pulldown was performed to isolate ubiquitylated proteins. The indicated proteins were detected with specific antibodies. ( B ) Cells were transfected with a vector expressing Strep-HA ubiquitin and treated with 1 or 5 μM CPT, 10 γ IR, 4 mM HU or 50 J/m 2 UV for 4 h. Ubiquitylated proteins were isolated by Strep-Tactin pulldown under denaturing conditions. ( C ) Cells transfected as in (B) were treated with 1 μM CPT for the indicated times and total RPA32 or ( D ) phosphorylated RPA32 species were detected using specific antibodies after Strep-Tactin pulldown. ( E ) A stable HEK293T cell line expressing SFB-PRP19 was treated with CPT 1 μM for the indicated times. SFB-PRP19 and its interactors were isolated using streptavidin-associated beads.
    Figure Legend Snippet: RPA32 is phosphorylated and ubiquitylated in response to DNA damage that targets active replication forks. ( A ) Cells were transfected with a vector expressing His 6 -tagged ubiquitin and lysed under denaturing conditions. Ni-NTA pulldown was performed to isolate ubiquitylated proteins. The indicated proteins were detected with specific antibodies. ( B ) Cells were transfected with a vector expressing Strep-HA ubiquitin and treated with 1 or 5 μM CPT, 10 γ IR, 4 mM HU or 50 J/m 2 UV for 4 h. Ubiquitylated proteins were isolated by Strep-Tactin pulldown under denaturing conditions. ( C ) Cells transfected as in (B) were treated with 1 μM CPT for the indicated times and total RPA32 or ( D ) phosphorylated RPA32 species were detected using specific antibodies after Strep-Tactin pulldown. ( E ) A stable HEK293T cell line expressing SFB-PRP19 was treated with CPT 1 μM for the indicated times. SFB-PRP19 and its interactors were isolated using streptavidin-associated beads.

    Techniques Used: Transfection, Plasmid Preparation, Expressing, Cycling Probe Technology, Isolation

    14) Product Images from "A Novel Microtubule-Binding Drug Attenuates and Reverses Protein Aggregation in Animal Models of Alzheimer’s Disease"

    Article Title: A Novel Microtubule-Binding Drug Attenuates and Reverses Protein Aggregation in Animal Models of Alzheimer’s Disease

    Journal: Frontiers in Molecular Neuroscience

    doi: 10.3389/fnmol.2019.00310

    Biotinylated PNR502 localizes to aggregates in AM141 worms and is used to recover drug-adherent proteins. (A) Structure of biotinyl-PNR502. (B,C) AM141 adult worms were either untreated (B) or treated 26 h (C) with 10-μM PNR502 and then fed Alexa594-conjugated streptavidin (Thermo Fisher Scientific, Waltham, MA, USA). Fluorescence images were captured with a Nikon DS-Fi2 camera mounted on a Nikon C2 inverted microscope. Q40::YFP is displayed as green, and Alexa594 as red fluorescence. Yellow fluorescence in (C) indicates the superposition of Q40::YFP with PNR502-Alexa594. (D) Caudal hippocampi, from normal age-matched controls (AMC) or AD patients (pools of three per group), were lysed and incubated 2 h at 4°C with 5-μM PNR502 or biotinyl-PNR502. M , size markers; lanes 1–4, proteins recovered from: 1 , unmodified PNR502; 2 , biotinyl-PNR502; 3 , equivalent portion of flow-through for unmodified PNR502; 4 , flow-through from biotinyl-PNR502.
    Figure Legend Snippet: Biotinylated PNR502 localizes to aggregates in AM141 worms and is used to recover drug-adherent proteins. (A) Structure of biotinyl-PNR502. (B,C) AM141 adult worms were either untreated (B) or treated 26 h (C) with 10-μM PNR502 and then fed Alexa594-conjugated streptavidin (Thermo Fisher Scientific, Waltham, MA, USA). Fluorescence images were captured with a Nikon DS-Fi2 camera mounted on a Nikon C2 inverted microscope. Q40::YFP is displayed as green, and Alexa594 as red fluorescence. Yellow fluorescence in (C) indicates the superposition of Q40::YFP with PNR502-Alexa594. (D) Caudal hippocampi, from normal age-matched controls (AMC) or AD patients (pools of three per group), were lysed and incubated 2 h at 4°C with 5-μM PNR502 or biotinyl-PNR502. M , size markers; lanes 1–4, proteins recovered from: 1 , unmodified PNR502; 2 , biotinyl-PNR502; 3 , equivalent portion of flow-through for unmodified PNR502; 4 , flow-through from biotinyl-PNR502.

    Techniques Used: Fluorescence, Inverted Microscopy, Incubation, Flow Cytometry

    15) Product Images from "A CADASIL-mutated Notch 3 receptor exhibits impaired intracellular trafficking and maturation but normal ligand-induced signaling"

    Article Title: A CADASIL-mutated Notch 3 receptor exhibits impaired intracellular trafficking and maturation but normal ligand-induced signaling

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    doi: 10.1073/pnas.252624099

    Reduced amounts of Notch 3 R142C at the cell surface. Cell surface proteins of HEK 293 stable cell lines expressing either the mNotch 3 or the mNotch 3 R142C receptor were biotinylated. Five percent of the protein extract was removed before the pull down with magnetic beads coupled to streptavidin. The remaining 95% of the extracted proteins was subjected to the streptavidin pull down (B) and followed by SDS/PAGE and Western blot analysis by using the 5E1 antibody along with 5% of total protein extract (T). Note that the ratio between the pulled-down receptor (B) and the total amount of expressed receptor (T) is lower for mNotch 3 R142C compared with wild-type mNotch 3. The 210-kDa immunoreactive band that is present in all pulled-down fractions suggests that both the vast majority of wild-type and mNotch 3 R142C receptors are expressed as S1-cleaved bipartite proteins at the cell surface. The Western blot is from one representative experiment, whereas the 210:280-kDa ratios are mean ± SD from three independent experiments.
    Figure Legend Snippet: Reduced amounts of Notch 3 R142C at the cell surface. Cell surface proteins of HEK 293 stable cell lines expressing either the mNotch 3 or the mNotch 3 R142C receptor were biotinylated. Five percent of the protein extract was removed before the pull down with magnetic beads coupled to streptavidin. The remaining 95% of the extracted proteins was subjected to the streptavidin pull down (B) and followed by SDS/PAGE and Western blot analysis by using the 5E1 antibody along with 5% of total protein extract (T). Note that the ratio between the pulled-down receptor (B) and the total amount of expressed receptor (T) is lower for mNotch 3 R142C compared with wild-type mNotch 3. The 210-kDa immunoreactive band that is present in all pulled-down fractions suggests that both the vast majority of wild-type and mNotch 3 R142C receptors are expressed as S1-cleaved bipartite proteins at the cell surface. The Western blot is from one representative experiment, whereas the 210:280-kDa ratios are mean ± SD from three independent experiments.

    Techniques Used: Stable Transfection, Expressing, Magnetic Beads, SDS Page, Western Blot

    16) Product Images from "RNA-Dependent DNA Binding Activity of the Pur Factor, Potentially Involved in DNA Replication and Gene Transcription"

    Article Title: RNA-Dependent DNA Binding Activity of the Pur Factor, Potentially Involved in DNA Replication and Gene Transcription

    Journal: Gene Expression

    doi:

    Characterization of RNAs associated with the Pur factor. The RNA content of the heparin-agarose fraction of the Pur factor was analyzed by 3′ labeling with [ 32 P]Cp, electrophoresis through an 8% polyacrylamide sequencing gel, and visualized by autoradiography. Lane T: total display of RNA molecules obtained by phenol extraction of the fraction containing the Pur factor (fraction 14 of the heparin-agarose column). Lanes P and S correspond to RNAs extracted from the same fraction incubated with a biotinylated PUR oligonucleotide and reacted with streptavidin-coated magnetic beads. Lane P is the Pur factor fraction pelleted with the beads and lane S is the corresponding supernatant. Lane C is a control similar to P, using beads uncoupled to the PUR oligonucleotide. All samples were separated by electrophoresis through an 8% polyacrylamide sequencing gel and were visualized by autoradiography.
    Figure Legend Snippet: Characterization of RNAs associated with the Pur factor. The RNA content of the heparin-agarose fraction of the Pur factor was analyzed by 3′ labeling with [ 32 P]Cp, electrophoresis through an 8% polyacrylamide sequencing gel, and visualized by autoradiography. Lane T: total display of RNA molecules obtained by phenol extraction of the fraction containing the Pur factor (fraction 14 of the heparin-agarose column). Lanes P and S correspond to RNAs extracted from the same fraction incubated with a biotinylated PUR oligonucleotide and reacted with streptavidin-coated magnetic beads. Lane P is the Pur factor fraction pelleted with the beads and lane S is the corresponding supernatant. Lane C is a control similar to P, using beads uncoupled to the PUR oligonucleotide. All samples were separated by electrophoresis through an 8% polyacrylamide sequencing gel and were visualized by autoradiography.

    Techniques Used: Labeling, Electrophoresis, Sequencing, Autoradiography, Incubation, Magnetic Beads

    17) Product Images from "SDA, a DNA Aptamer Inhibiting E- and P-Selectin Mediated Adhesion of Cancer and Leukemia Cells, the First and Pivotal Step in Transendothelial Migration during Metastasis Formation"

    Article Title: SDA, a DNA Aptamer Inhibiting E- and P-Selectin Mediated Adhesion of Cancer and Leukemia Cells, the First and Pivotal Step in Transendothelial Migration during Metastasis Formation

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0093173

    Affinities of selected DNA aptamers to rh E- and rh P-selectin determined via filter retention assays (FRA). DNA was radiolabeled, incubated with increasing amounts of proteins and filtrated through a nitrocellulose membrane. Fractions of bound DNAs were detected via autoradiography and quantified. (A) Recombinant human E-selectin incubated with DNA pool after one (▴) and 17 (•) SELEX rounds. (B) Aptamer SDA incubated with rh E-selectin (•, K d ≈ 87 nM), rh P-selectin (▪, K d ≈ 84 nM), or streptavidin (▴) as a control. A control DNA did neither bind to human E- (▾) nor P-selectin (♦).
    Figure Legend Snippet: Affinities of selected DNA aptamers to rh E- and rh P-selectin determined via filter retention assays (FRA). DNA was radiolabeled, incubated with increasing amounts of proteins and filtrated through a nitrocellulose membrane. Fractions of bound DNAs were detected via autoradiography and quantified. (A) Recombinant human E-selectin incubated with DNA pool after one (▴) and 17 (•) SELEX rounds. (B) Aptamer SDA incubated with rh E-selectin (•, K d ≈ 87 nM), rh P-selectin (▪, K d ≈ 84 nM), or streptavidin (▴) as a control. A control DNA did neither bind to human E- (▾) nor P-selectin (♦).

    Techniques Used: Incubation, Autoradiography, Recombinant

    18) Product Images from "Rapid Synthesis of a Long Double-Stranded Oligonucleotide from a Single-Stranded Nucleotide Using Magnetic Beads and an Oligo Library"

    Article Title: Rapid Synthesis of a Long Double-Stranded Oligonucleotide from a Single-Stranded Nucleotide Using Magnetic Beads and an Oligo Library

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0149774

    Schematic of the building blocks for DNA construction. Streptavidin-coated magnetic beads were used as solid support for dsDNA synthesis and oligo fragments were ligated to the building block one at a time.
    Figure Legend Snippet: Schematic of the building blocks for DNA construction. Streptavidin-coated magnetic beads were used as solid support for dsDNA synthesis and oligo fragments were ligated to the building block one at a time.

    Techniques Used: Magnetic Beads, Blocking Assay

    Schematic diagram for the proposed dsDNA synthesis. The overall procedure for dsDNA synthesis is composed of three processes: annealing, binding of streptavidin coated magnetic beads to biotinylated oligos, and ligation.
    Figure Legend Snippet: Schematic diagram for the proposed dsDNA synthesis. The overall procedure for dsDNA synthesis is composed of three processes: annealing, binding of streptavidin coated magnetic beads to biotinylated oligos, and ligation.

    Techniques Used: Binding Assay, Magnetic Beads, Ligation

    19) Product Images from "Prodrugs Bioactivated to Quinones Target NF-κB and Multiple Protein Networks: Identification of the Quinonome"

    Article Title: Prodrugs Bioactivated to Quinones Target NF-κB and Multiple Protein Networks: Identification of the Quinonome

    Journal: Chemical research in toxicology

    doi: 10.1021/acs.chemrestox.6b00115

    Visualizing the N 3 QM modified proteins in HT-29 cells: (A) lysates from HT-29 cells treated with DMSO, azido- p NO-ASA (10 µM), azido- p Br-ASA (10 µM), clicked to biotin, and applied on to the streptavidin-coated magnetic beads to separate the QM-modified proteins from the unmodified. All fractions were run on SDS–PAGE gel electrophoresis and stained with Coomassie brilliant blue. (B) Lysates from HT-29 cells treated with DMSO, azido- p NO-ASA (10 µM), and azido- p Br-ASA (10 µM), with or without p NO-ASA (10 µM) or p Br-ASA (10 µM) pretreatments, clicked to biotin, and subjected to Western blotting with the use of antibiotin-HRP for visual characterization of the modified proteins. Representative Western blotting analysis from three independent experiments are shown.
    Figure Legend Snippet: Visualizing the N 3 QM modified proteins in HT-29 cells: (A) lysates from HT-29 cells treated with DMSO, azido- p NO-ASA (10 µM), azido- p Br-ASA (10 µM), clicked to biotin, and applied on to the streptavidin-coated magnetic beads to separate the QM-modified proteins from the unmodified. All fractions were run on SDS–PAGE gel electrophoresis and stained with Coomassie brilliant blue. (B) Lysates from HT-29 cells treated with DMSO, azido- p NO-ASA (10 µM), and azido- p Br-ASA (10 µM), with or without p NO-ASA (10 µM) or p Br-ASA (10 µM) pretreatments, clicked to biotin, and subjected to Western blotting with the use of antibiotin-HRP for visual characterization of the modified proteins. Representative Western blotting analysis from three independent experiments are shown.

    Techniques Used: Modification, Magnetic Beads, SDS Page, Nucleic Acid Electrophoresis, Staining, Western Blot

    20) Product Images from "Efficient preparation of internally modified single-molecule constructs using nicking enzymes"

    Article Title: Efficient preparation of internally modified single-molecule constructs using nicking enzymes

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkq1004

    Schematic representation of the internal labeling method. ( a ) A DNA sequence which incorporates five equally spaced BbvCI recognition sites (black triangles) is nicked only at one of the two strands using either the nicking enzyme Nt.BbvCI or Nb.BbvCI. This results in the formation of short 15–16 bases long fragments. Denaturation and subsequent hybridization, in the presence of a DNA strand (shown in red) that is complementary to the resulting 63 bp gap and that carries the desired internal modifications (e.g. two or six biotins as depicted), lead to an efficient replacement of the original fragments with the labeled fragment. The spacing between the internal modifications of 10–11 bp ensures that they extrude in the same direction from the DNA. ( b ) Model of a streptavidin tetramer bound to an internally biotinylated DNA molecule (Streptavidin PDB id: 1MK5; the bound monomer is illustrated as a yellow ribbon while for the other subunits the surface representation was used. DNA PDB id: 2BNA). The attachment of the streptavidin tetramer to only one of the biotins was arbitrarily chosen.
    Figure Legend Snippet: Schematic representation of the internal labeling method. ( a ) A DNA sequence which incorporates five equally spaced BbvCI recognition sites (black triangles) is nicked only at one of the two strands using either the nicking enzyme Nt.BbvCI or Nb.BbvCI. This results in the formation of short 15–16 bases long fragments. Denaturation and subsequent hybridization, in the presence of a DNA strand (shown in red) that is complementary to the resulting 63 bp gap and that carries the desired internal modifications (e.g. two or six biotins as depicted), lead to an efficient replacement of the original fragments with the labeled fragment. The spacing between the internal modifications of 10–11 bp ensures that they extrude in the same direction from the DNA. ( b ) Model of a streptavidin tetramer bound to an internally biotinylated DNA molecule (Streptavidin PDB id: 1MK5; the bound monomer is illustrated as a yellow ribbon while for the other subunits the surface representation was used. DNA PDB id: 2BNA). The attachment of the streptavidin tetramer to only one of the biotins was arbitrarily chosen.

    Techniques Used: Labeling, Sequencing, Hybridization

    Site-specific attachment of Q-dots to internally biotinylated DNA. ( a ) Band-shift assay of Q-dot binding to DNA. (Lane 0) 1 kb step DNA ladder with the shortest fragment starting at 1 kb. (Lane 1) pNLrep after digestion with BamHI, PspOMI and Nt.BbvCI and internal biotinylation with oligomer biotinx2 ( Figure 2 a). (Lane 2) Sample from Lane 1 with 5-fold molar excess of streptavidin coated Q-dots added. (Lane 3) Sample containing Q-dots only. Symbols on the right side indicate Q-dots (yellow spheres), the short biotinylated fragment (red line) and the long non-biotinylated fragment (blue line). ( b and c ) AFM images of Q-dots bound to DNA. The colour scale corresponds to a height-range of 1 nm, and the scale bar corresponds to 100 nm. ( d ) Histogram of the Q-dot position measured from the nearest DNA end. The expected Q-dot position at 920 bp (310 nm) (blue dashed line) is within the double confidence interval (light grey band) of the experimentally determined mean (290 ± 20 nm, red dashed line).
    Figure Legend Snippet: Site-specific attachment of Q-dots to internally biotinylated DNA. ( a ) Band-shift assay of Q-dot binding to DNA. (Lane 0) 1 kb step DNA ladder with the shortest fragment starting at 1 kb. (Lane 1) pNLrep after digestion with BamHI, PspOMI and Nt.BbvCI and internal biotinylation with oligomer biotinx2 ( Figure 2 a). (Lane 2) Sample from Lane 1 with 5-fold molar excess of streptavidin coated Q-dots added. (Lane 3) Sample containing Q-dots only. Symbols on the right side indicate Q-dots (yellow spheres), the short biotinylated fragment (red line) and the long non-biotinylated fragment (blue line). ( b and c ) AFM images of Q-dots bound to DNA. The colour scale corresponds to a height-range of 1 nm, and the scale bar corresponds to 100 nm. ( d ) Histogram of the Q-dot position measured from the nearest DNA end. The expected Q-dot position at 920 bp (310 nm) (blue dashed line) is within the double confidence interval (light grey band) of the experimentally determined mean (290 ± 20 nm, red dashed line).

    Techniques Used: Electrophoretic Mobility Shift Assay, Binding Assay

    Internal modification and religation efficiencies. ( a ) Polyacrylamide gel electrophoresis of DNA samples in the course of the internal labeling procedure. (Lane 1) pNLrep after digestion with MluI and AatII yielding a 0.8-kb fragment (red line) that carries the region to be replaced as well as a 0.4-kb (light blue line) and a 5-kbp fragment (dark blue line). (Lane 2) pNLrep after simultaneous digestion with MluI, AatII and Nt.BbvCI. The nicking of the 0.8-kb fragment (represented by the fragmented red line) can be seen as a slight mobility decrease. (Lane 3) Sample from lane 2 after column purification, which leads to gap formation within the 0.8-kb fragment causing a large mobility alteration (gapped red line). (Lane 4) Sample from lane 2 after the replacement reaction with oligo biotinx2, during which the 0.8-kb fragment becomes internally biotinylated, and subsequent column purification. The inserted oligo is stably bound and therefore displays the same mobility as the nicked fragment in lane 2. (Lane 5) Sample from lane 4 with > 10-fold molar excess of streptavidin added. (Lane 6) Pulldown assay with sample from lane 4 (see ‘Materials and Methods' section). (Lanes 0, 7) 100 bp step DNA ladder, starting at 400 bp with an additional 517 bp band. ( b ) (Lane 1) pNLrep. (Lane 2) pNLrep after nicking and internal biotinylation with oligo biotinx2. (Lane 3) Sample from lane 2 after ligation. (Lane 4) pNLrep after internal biotinylation with 5′-phosphorylated biotinx2 oligo and religation. (Lane 5) pNLrep after nicking with Nt.BbvCI and religation. Positions of supercoiled, nicked and linearized plasmid species are indicated by corresponding symbols at the right side. (Lane 0) 1 kb step DNA ladder with the shortest fragment starting at 1 kb.
    Figure Legend Snippet: Internal modification and religation efficiencies. ( a ) Polyacrylamide gel electrophoresis of DNA samples in the course of the internal labeling procedure. (Lane 1) pNLrep after digestion with MluI and AatII yielding a 0.8-kb fragment (red line) that carries the region to be replaced as well as a 0.4-kb (light blue line) and a 5-kbp fragment (dark blue line). (Lane 2) pNLrep after simultaneous digestion with MluI, AatII and Nt.BbvCI. The nicking of the 0.8-kb fragment (represented by the fragmented red line) can be seen as a slight mobility decrease. (Lane 3) Sample from lane 2 after column purification, which leads to gap formation within the 0.8-kb fragment causing a large mobility alteration (gapped red line). (Lane 4) Sample from lane 2 after the replacement reaction with oligo biotinx2, during which the 0.8-kb fragment becomes internally biotinylated, and subsequent column purification. The inserted oligo is stably bound and therefore displays the same mobility as the nicked fragment in lane 2. (Lane 5) Sample from lane 4 with > 10-fold molar excess of streptavidin added. (Lane 6) Pulldown assay with sample from lane 4 (see ‘Materials and Methods' section). (Lanes 0, 7) 100 bp step DNA ladder, starting at 400 bp with an additional 517 bp band. ( b ) (Lane 1) pNLrep. (Lane 2) pNLrep after nicking and internal biotinylation with oligo biotinx2. (Lane 3) Sample from lane 2 after ligation. (Lane 4) pNLrep after internal biotinylation with 5′-phosphorylated biotinx2 oligo and religation. (Lane 5) pNLrep after nicking with Nt.BbvCI and religation. Positions of supercoiled, nicked and linearized plasmid species are indicated by corresponding symbols at the right side. (Lane 0) 1 kb step DNA ladder with the shortest fragment starting at 1 kb.

    Techniques Used: Modification, Polyacrylamide Gel Electrophoresis, Labeling, Purification, Stable Transfection, Ligation, Plasmid Preparation

    ssDNA to dsDNA ligation at nicking-enzyme-generated overhangs. ( a ) Schematic representation of overhang generation. A BbvCI recognition site (blue letters) was incorporated near the DNA end in such a way that nicking with Nt.BbvCI generates a 10-bp fragment at the 5′-end. ( b ) Agarose gel of DNA fragments, ligation products and streptavidin-induced band shifts. The biotinylated 40-bp hairpin, the 430-bp dsDNA handle and streptavidin are represented by a blue, red and green symbol, respectively. `Lig.' indicates where a ligation for 1 h at room temperature was carried out. Positions of the reaction products are marked at the right side. (Lanes 1–5) reaction products for the 4 nt overhang generated by BstXI. (Lanes 6–10) reaction products for the 10 nt overhang generated by Nt.BbvCI. The lane in the middle is a 100-bp size marker ladder with the shortest fragment starting at 100-bp and 100-bp size difference between all subsequent fragments (and an additional band at 517 bp). The success of the ssDNA to dsDNA ligation was confirmed by the streptavidin-induced band-shift, in which the desired product specifically shifted only in the case where a 10 nt 3′-overhang had been used. ( c ) Magnetic tweezers experiment with the generated hairpin construct. The molecule was held at the critical force where the closed and the opened states of the hairpin (as illustrated by the sketches) were nearly equally populated. The change in height between the two states was ≈38 nm as expected for a 40-nt hairpin.
    Figure Legend Snippet: ssDNA to dsDNA ligation at nicking-enzyme-generated overhangs. ( a ) Schematic representation of overhang generation. A BbvCI recognition site (blue letters) was incorporated near the DNA end in such a way that nicking with Nt.BbvCI generates a 10-bp fragment at the 5′-end. ( b ) Agarose gel of DNA fragments, ligation products and streptavidin-induced band shifts. The biotinylated 40-bp hairpin, the 430-bp dsDNA handle and streptavidin are represented by a blue, red and green symbol, respectively. `Lig.' indicates where a ligation for 1 h at room temperature was carried out. Positions of the reaction products are marked at the right side. (Lanes 1–5) reaction products for the 4 nt overhang generated by BstXI. (Lanes 6–10) reaction products for the 10 nt overhang generated by Nt.BbvCI. The lane in the middle is a 100-bp size marker ladder with the shortest fragment starting at 100-bp and 100-bp size difference between all subsequent fragments (and an additional band at 517 bp). The success of the ssDNA to dsDNA ligation was confirmed by the streptavidin-induced band-shift, in which the desired product specifically shifted only in the case where a 10 nt 3′-overhang had been used. ( c ) Magnetic tweezers experiment with the generated hairpin construct. The molecule was held at the critical force where the closed and the opened states of the hairpin (as illustrated by the sketches) were nearly equally populated. The change in height between the two states was ≈38 nm as expected for a 40-nt hairpin.

    Techniques Used: Ligation, Generated, Agarose Gel Electrophoresis, Marker, Electrophoretic Mobility Shift Assay, Construct

    21) Product Images from "miRNA Enriched in Human Neuroblast Nuclei Bind the MAZ Transcription Factor and Their Precursors Contain the MAZ Consensus Motif"

    Article Title: miRNA Enriched in Human Neuroblast Nuclei Bind the MAZ Transcription Factor and Their Precursors Contain the MAZ Consensus Motif

    Journal: Frontiers in Molecular Neuroscience

    doi: 10.3389/fnmol.2017.00259

    MAZ binds to pre-miR-1207 and -647 in the nucleus. (A) Schematic illustration of the workflow of the RNA pull-down assay. Biotinylated pre-miRNA were conjugated to streptavidin-coated beads and used as bait to retrieve binding proteins from pre-cleared nuclear lysate. (B) Design of pre-miR oligos for electrophoretic mobility shift assay (EMSA). “MAZ” labels indicate putative MAZ binding sites. Red labels indicate where native sequences were edited to achieve the 80 nt length limit. (C) Predicted hairpin structures of native and edited EMSA pre-miRs. Bulge loop features from the original predictions were retained in the new sequences. Oligo design and structure prediction was done using Geneious software. (D) Western blot detection of RNA pulldown assay. MAZ was detected at 55 kDa. (E) EMSA demonstrating shift of pre-miRs by addition of nuclear lysate. Me1a1 oligo was used as a competitive inhibitor to binding, which reversed the observed shift. (F) Western-EMSA (WEMSA) shows the presence of MAZ in the shifted band.
    Figure Legend Snippet: MAZ binds to pre-miR-1207 and -647 in the nucleus. (A) Schematic illustration of the workflow of the RNA pull-down assay. Biotinylated pre-miRNA were conjugated to streptavidin-coated beads and used as bait to retrieve binding proteins from pre-cleared nuclear lysate. (B) Design of pre-miR oligos for electrophoretic mobility shift assay (EMSA). “MAZ” labels indicate putative MAZ binding sites. Red labels indicate where native sequences were edited to achieve the 80 nt length limit. (C) Predicted hairpin structures of native and edited EMSA pre-miRs. Bulge loop features from the original predictions were retained in the new sequences. Oligo design and structure prediction was done using Geneious software. (D) Western blot detection of RNA pulldown assay. MAZ was detected at 55 kDa. (E) EMSA demonstrating shift of pre-miRs by addition of nuclear lysate. Me1a1 oligo was used as a competitive inhibitor to binding, which reversed the observed shift. (F) Western-EMSA (WEMSA) shows the presence of MAZ in the shifted band.

    Techniques Used: Pull Down Assay, Binding Assay, Electrophoretic Mobility Shift Assay, Software, Western Blot

    22) Product Images from "MC159 of Molluscum Contagiosum Virus Suppresses Autophagy by Recruiting Cellular SH3BP4 via an SH3 Domain-Mediated Interaction"

    Article Title: MC159 of Molluscum Contagiosum Virus Suppresses Autophagy by Recruiting Cellular SH3BP4 via an SH3 Domain-Mediated Interaction

    Journal: Journal of Virology

    doi: 10.1128/JVI.01613-18

    Association of MC159 with SH3BP4 in human cells. Biotin acceptor domain-tagged MC159 or the indicated PXXP motif mutants were transfected into 293T cells together with Myc-tagged SH3BP4 (A) or SH3BP4 alone (B). Lysates of these cells were examined by Western blotting either directly (cell lysates) or after precipitation with streptavidin-coated beads (MC159 pulldown) by probing the membranes using labeled streptavidin (MC159) or anti-Myc (A) or anti-SH3BP4 (B) antibodies.
    Figure Legend Snippet: Association of MC159 with SH3BP4 in human cells. Biotin acceptor domain-tagged MC159 or the indicated PXXP motif mutants were transfected into 293T cells together with Myc-tagged SH3BP4 (A) or SH3BP4 alone (B). Lysates of these cells were examined by Western blotting either directly (cell lysates) or after precipitation with streptavidin-coated beads (MC159 pulldown) by probing the membranes using labeled streptavidin (MC159) or anti-Myc (A) or anti-SH3BP4 (B) antibodies.

    Techniques Used: Transfection, Western Blot, Labeling

    23) Product Images from "Small molecule inhibitor of the RPA70 N-terminal protein interaction domain discovered using in silico and in vitro methods"

    Article Title: Small molecule inhibitor of the RPA70 N-terminal protein interaction domain discovered using in silico and in vitro methods

    Journal: Bioorganic & medicinal chemistry

    doi: 10.1016/j.bmc.2011.03.012

    HTS for RPA–Rad9 interactions. RPA bound to biotinylated-ssDNA in a streptavidin coated 384-well plate was mixed with the indicated compounds, A, B, C, and D (D represents NSC15520), and percent inhibition was normalized to reactions that did
    Figure Legend Snippet: HTS for RPA–Rad9 interactions. RPA bound to biotinylated-ssDNA in a streptavidin coated 384-well plate was mixed with the indicated compounds, A, B, C, and D (D represents NSC15520), and percent inhibition was normalized to reactions that did

    Techniques Used: Recombinase Polymerase Amplification, Inhibition

    Purification and interaction of recombinant RPA and GST–Rad9. (A) Proteins were separated by SDS–PAGE and stained with Coomassie blue. (B) Pulldown of Rad9 with ssDNA bound RPA using streptavidin-linked magnetic beads. Lane 1 does not
    Figure Legend Snippet: Purification and interaction of recombinant RPA and GST–Rad9. (A) Proteins were separated by SDS–PAGE and stained with Coomassie blue. (B) Pulldown of Rad9 with ssDNA bound RPA using streptavidin-linked magnetic beads. Lane 1 does not

    Techniques Used: Purification, Recombinant, Recombinase Polymerase Amplification, SDS Page, Staining, Magnetic Beads

    24) Product Images from "A medium hyperglycosylated podocalyxin enables noninvasive and quantitative detection of tumorigenic human pluripotent stem cells"

    Article Title: A medium hyperglycosylated podocalyxin enables noninvasive and quantitative detection of tumorigenic human pluripotent stem cells

    Journal: Scientific Reports

    doi: 10.1038/srep04069

    The GlycoStem test discriminates undifferentiated cells from differentiated cells. Biotinylated rBC2LCN (0.1 μg/well) was immobilized on streptavidin-coated 96-well microtiter plates at 37°C for 1 h. Cell culture supernatants of MEF and 253G1 hiPSCs with or without retinoic acid (RA) treatments for 15 days were incubated at 37°C for 1 h. After washing, HRP-labeled rABA (0.1 μg/mL, 50 μL) was overlayed at 37°C for 1 h. After washing, absorbance at 450 nm was then detected. Absorbance at 450 nm of the control cell culture media was subtracted from the values obtained from the cell culture supernatants. Data are shown as mean ± SD of triplicate samples.
    Figure Legend Snippet: The GlycoStem test discriminates undifferentiated cells from differentiated cells. Biotinylated rBC2LCN (0.1 μg/well) was immobilized on streptavidin-coated 96-well microtiter plates at 37°C for 1 h. Cell culture supernatants of MEF and 253G1 hiPSCs with or without retinoic acid (RA) treatments for 15 days were incubated at 37°C for 1 h. After washing, HRP-labeled rABA (0.1 μg/mL, 50 μL) was overlayed at 37°C for 1 h. After washing, absorbance at 450 nm was then detected. Absorbance at 450 nm of the control cell culture media was subtracted from the values obtained from the cell culture supernatants. Data are shown as mean ± SD of triplicate samples.

    Techniques Used: Cell Culture, Incubation, Labeling

    25) Product Images from "Monitoring the T-Cell Receptor Repertoire at Single-Clone Resolution"

    Article Title: Monitoring the T-Cell Receptor Repertoire at Single-Clone Resolution

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0000055

    The T-array protocol. (A) During development, VDJ recombination causes enormous variability in TCRβ chain by randomly selecting different combinations of 23 V, 2 D, and 13 J gene segments, by nucleotide insertion ( ), and by nucleotide deletion from V ( ), D, and J ( ) genes. This results in a diversity of an estimated 10 6 different β chains per individual. (B) N-deletion causes shortening of the Vβ and Jβ segments. The number of nucleotides deleted from Vβ and Jβ germline DNA is limited. N-deletion of 192 published TCRβ mRNAs was determined. The figure shows the cumulative percentage of CDR3βs for the number of nucleotides deleted. TCRβ's with n nucleotides deleted represent approximately 10% of the repertoire if n = 0 to 6, and 5%, if n = 7 to 9. (C) The T-array protocol: (C1) cDNA from T-cells is generated. (C2) CDR3β regions are PCR amplified using biotinylated Vβ-specific ( ) or Vβ-generic primers (not shown here). (C3) Biotinylated strands are removed after alkaline denaturation using streptavidin-coated beads. (c4) Single-strands of polyclonal TCRs are aliquoted and hybridized to fluorescently labeled annealers ( ) complementary to the NDN-adjacent end of a Jβ gene. A specific number of Jβ-gene nucleotides (n) is deleted for each annealer, accounting for N-deletion during the VDJ recombination process. Insert (C4): Each annealer will hybridize to TCRβ rearrangements where n nucleotides are deleted from the Jβ-germline gene segment ( C4A ) or where less than n nucleotides are deleted ( C4B ). (C5) The annealer-hybridized fractions are loaded on universal hexamer arrays for (C6) T-cell-clone-specific ligation and, (C7) subsequently washed, scanned and analyzed.
    Figure Legend Snippet: The T-array protocol. (A) During development, VDJ recombination causes enormous variability in TCRβ chain by randomly selecting different combinations of 23 V, 2 D, and 13 J gene segments, by nucleotide insertion ( ), and by nucleotide deletion from V ( ), D, and J ( ) genes. This results in a diversity of an estimated 10 6 different β chains per individual. (B) N-deletion causes shortening of the Vβ and Jβ segments. The number of nucleotides deleted from Vβ and Jβ germline DNA is limited. N-deletion of 192 published TCRβ mRNAs was determined. The figure shows the cumulative percentage of CDR3βs for the number of nucleotides deleted. TCRβ's with n nucleotides deleted represent approximately 10% of the repertoire if n = 0 to 6, and 5%, if n = 7 to 9. (C) The T-array protocol: (C1) cDNA from T-cells is generated. (C2) CDR3β regions are PCR amplified using biotinylated Vβ-specific ( ) or Vβ-generic primers (not shown here). (C3) Biotinylated strands are removed after alkaline denaturation using streptavidin-coated beads. (c4) Single-strands of polyclonal TCRs are aliquoted and hybridized to fluorescently labeled annealers ( ) complementary to the NDN-adjacent end of a Jβ gene. A specific number of Jβ-gene nucleotides (n) is deleted for each annealer, accounting for N-deletion during the VDJ recombination process. Insert (C4): Each annealer will hybridize to TCRβ rearrangements where n nucleotides are deleted from the Jβ-germline gene segment ( C4A ) or where less than n nucleotides are deleted ( C4B ). (C5) The annealer-hybridized fractions are loaded on universal hexamer arrays for (C6) T-cell-clone-specific ligation and, (C7) subsequently washed, scanned and analyzed.

    Techniques Used: Generated, Polymerase Chain Reaction, Amplification, Labeling, Ligation

    26) Product Images from "circFGFR4 Promotes Differentiation of Myoblasts via Binding miR-107 to Relieve Its Inhibition of Wnt3a"

    Article Title: circFGFR4 Promotes Differentiation of Myoblasts via Binding miR-107 to Relieve Its Inhibition of Wnt3a

    Journal: Molecular Therapy. Nucleic Acids

    doi: 10.1016/j.omtn.2018.02.012

    circFGFR4 Binding miR-107 to Promote Cell Differentiation (A) circFGFR4 expression in different tissues from embryonic Qinchuan cattle detected by real-time qPCR. (B) The expression efficiency of pcDNA-circFGFR4 is shown. (C) Bovine primary myoblasts were co-transfected with miR-107 mimic and pCK-circFGFR4-W or pCK-circFGFR4-Mut. Renilla luciferase activity was normalized to the Firefly luciferase activity. (D) qPCR analysis of circFGFR4 level in the streptavidin captured fractions from the bovine primary myoblasts lysates after transfection with 3′ end biotinylated miR-107 or control RNA (NC). (E) Biotin-labeled circRNA was purified and subjected to RNA pull-down assays by incubation with bovine primary myoblasts lysates, followed by qPCR analysis of miR-107 level. (F) The mRNA expression of Wnt3a in primary bovine myoblasts transfected with miR-107 mimic and (or) circFGFR4 for 24 hr was detected by qPCR. (G and H) The expression of MyoG in primary bovine myoblasts was detected by qPCR (G) and western blotting (H). (I) Bovine primary myocytes were transfected with pcDNA-circFGFR4 and (or) miR-107 mimic, and cell differentiation was detected by immunofluorescence (MyHC) and observed under a fluorescence microscope. Values are means ± SEM for three individuals. *p
    Figure Legend Snippet: circFGFR4 Binding miR-107 to Promote Cell Differentiation (A) circFGFR4 expression in different tissues from embryonic Qinchuan cattle detected by real-time qPCR. (B) The expression efficiency of pcDNA-circFGFR4 is shown. (C) Bovine primary myoblasts were co-transfected with miR-107 mimic and pCK-circFGFR4-W or pCK-circFGFR4-Mut. Renilla luciferase activity was normalized to the Firefly luciferase activity. (D) qPCR analysis of circFGFR4 level in the streptavidin captured fractions from the bovine primary myoblasts lysates after transfection with 3′ end biotinylated miR-107 or control RNA (NC). (E) Biotin-labeled circRNA was purified and subjected to RNA pull-down assays by incubation with bovine primary myoblasts lysates, followed by qPCR analysis of miR-107 level. (F) The mRNA expression of Wnt3a in primary bovine myoblasts transfected with miR-107 mimic and (or) circFGFR4 for 24 hr was detected by qPCR. (G and H) The expression of MyoG in primary bovine myoblasts was detected by qPCR (G) and western blotting (H). (I) Bovine primary myocytes were transfected with pcDNA-circFGFR4 and (or) miR-107 mimic, and cell differentiation was detected by immunofluorescence (MyHC) and observed under a fluorescence microscope. Values are means ± SEM for three individuals. *p

    Techniques Used: Binding Assay, Cell Differentiation, Expressing, Real-time Polymerase Chain Reaction, Transfection, Luciferase, Activity Assay, Labeling, Purification, Incubation, Western Blot, Immunofluorescence, Fluorescence, Microscopy

    27) Product Images from "Circular RNA profiling reveals an abundant circHIPK3 that regulates cell growth by sponging multiple miRNAs"

    Article Title: Circular RNA profiling reveals an abundant circHIPK3 that regulates cell growth by sponging multiple miRNAs

    Journal: Nature Communications

    doi: 10.1038/ncomms11215

    circHIPK3 sponges with miR-124 and inhibits its activity. ( a ) Proliferation assessed using a CCK-8 kit in HEK-293 T cells transfected with nine miRNA mimics or control RNA (20 nM). ( b ) qRT–PCR analysis of circHIPK3 level in the streptavidin captured fractions from the HEK-293 T cell lysates after transfection with 3′-end biotinylated miR-124 or control RNA (NC). ( c ) Co-localization between miR-124 and circHIPK3 was observed (arrowheads) by RNA in situ hybridization in HeLa cells after co-transfection with circHIPK3 and miR-124 expressing vectors. Nuclei were stained with DAPI. Scale bar, 5μm. ( d ) qRT–PCR analysis of IL6R and DLX2 expression in HEK-293 T cells after transfected with si-cHIPK3, miR-124 mimics or miR-124 with circHIPK3 expressing vector (p-cHIPK3). ( e ) Proliferation assessed using a CCK-8 kit in cells transfected with circHIPK3 or miR-124 (10 nM) as indicated. Data in a , b , d are the means±s.e.m. of three experiments. ( f ) qRT–PCR for the abundance of circHIPK3 relative to ACTB and miR-124 relative RNU6B in six human normal tissues. The correlation between circHIPK3 and miR-124 is also shown. * P
    Figure Legend Snippet: circHIPK3 sponges with miR-124 and inhibits its activity. ( a ) Proliferation assessed using a CCK-8 kit in HEK-293 T cells transfected with nine miRNA mimics or control RNA (20 nM). ( b ) qRT–PCR analysis of circHIPK3 level in the streptavidin captured fractions from the HEK-293 T cell lysates after transfection with 3′-end biotinylated miR-124 or control RNA (NC). ( c ) Co-localization between miR-124 and circHIPK3 was observed (arrowheads) by RNA in situ hybridization in HeLa cells after co-transfection with circHIPK3 and miR-124 expressing vectors. Nuclei were stained with DAPI. Scale bar, 5μm. ( d ) qRT–PCR analysis of IL6R and DLX2 expression in HEK-293 T cells after transfected with si-cHIPK3, miR-124 mimics or miR-124 with circHIPK3 expressing vector (p-cHIPK3). ( e ) Proliferation assessed using a CCK-8 kit in cells transfected with circHIPK3 or miR-124 (10 nM) as indicated. Data in a , b , d are the means±s.e.m. of three experiments. ( f ) qRT–PCR for the abundance of circHIPK3 relative to ACTB and miR-124 relative RNU6B in six human normal tissues. The correlation between circHIPK3 and miR-124 is also shown. * P

    Techniques Used: Activity Assay, CCK-8 Assay, Transfection, Quantitative RT-PCR, RNA In Situ Hybridization, Cotransfection, Expressing, Staining, Plasmid Preparation

    28) Product Images from "PCR-Free Detection of Genetically Modified Organisms Using Magnetic Capture Technology and Fluorescence Cross-Correlation Spectroscopy"

    Article Title: PCR-Free Detection of Genetically Modified Organisms Using Magnetic Capture Technology and Fluorescence Cross-Correlation Spectroscopy

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0008074

    Proposed methodology for PCR-free identification of GMOs by magnetic capture-FCCS. Genomic DNA is isolated from GMOs and then fragmented. Biotin-labeled DNA is hybridized with the 35S promoter region and streptavidin coated-magnetic beads are used to capture the targets from the sample and then washed. The single strand targets are released and hybridized with two fluorophore labeled probes for FCCS detection.
    Figure Legend Snippet: Proposed methodology for PCR-free identification of GMOs by magnetic capture-FCCS. Genomic DNA is isolated from GMOs and then fragmented. Biotin-labeled DNA is hybridized with the 35S promoter region and streptavidin coated-magnetic beads are used to capture the targets from the sample and then washed. The single strand targets are released and hybridized with two fluorophore labeled probes for FCCS detection.

    Techniques Used: Polymerase Chain Reaction, Isolation, Labeling, Magnetic Beads

    29) Product Images from "A novel method to identify and characterise peptide mimotopes of heat shock protein 70-associated antigens"

    Article Title: A novel method to identify and characterise peptide mimotopes of heat shock protein 70-associated antigens

    Journal: Journal of Immune Based Therapies and Vaccines

    doi: 10.1186/1476-8518-4-2

    Purification of Hsp70 and Hsp70-PCs from MDA-MB-231 cells by affinity chromatography . Hsp70-peptide complexes (Hsp70-PCs) were isolated from whole cell extracts of MDA-MB-231 cells using ADP-Agarose. A . Coomassie-Blue stained SDS-polyacrylamide gel and B : Western blot using anti-Hsp70 antibody. Lane 1: MDA-MB-231 total cell extract (10 μg), Lane 2: Flow-through from an ADP-agarose column (2 μg), Lane 3: Proteins eluted from ADP-agarose column with 3 mM ADP (2 μg). Lane 4: Molecular weight markers. C : ELISA to detect the interaction between biotinylated TMG and DSP peptides and the corresponding phages. Streptavidin-coated paramagnetic beads bound to biotinylated TMG peptide (TMG) or DSP peptide (DSP) were incubated with the M13 phage clones displaying DSP or TMG respectively. As a control, streptavidin-coated beads without the peptides were incubated with M13 phage clone displaying the TMG (TMG negative) or the DSP (DSP negative) peptides alone. All beads were then incubated with anti-M13-HRP antibody. Interactions were detected by absorbance at 405 nm using DAB as a substrate.
    Figure Legend Snippet: Purification of Hsp70 and Hsp70-PCs from MDA-MB-231 cells by affinity chromatography . Hsp70-peptide complexes (Hsp70-PCs) were isolated from whole cell extracts of MDA-MB-231 cells using ADP-Agarose. A . Coomassie-Blue stained SDS-polyacrylamide gel and B : Western blot using anti-Hsp70 antibody. Lane 1: MDA-MB-231 total cell extract (10 μg), Lane 2: Flow-through from an ADP-agarose column (2 μg), Lane 3: Proteins eluted from ADP-agarose column with 3 mM ADP (2 μg). Lane 4: Molecular weight markers. C : ELISA to detect the interaction between biotinylated TMG and DSP peptides and the corresponding phages. Streptavidin-coated paramagnetic beads bound to biotinylated TMG peptide (TMG) or DSP peptide (DSP) were incubated with the M13 phage clones displaying DSP or TMG respectively. As a control, streptavidin-coated beads without the peptides were incubated with M13 phage clone displaying the TMG (TMG negative) or the DSP (DSP negative) peptides alone. All beads were then incubated with anti-M13-HRP antibody. Interactions were detected by absorbance at 405 nm using DAB as a substrate.

    Techniques Used: Purification, Multiple Displacement Amplification, Affinity Chromatography, Isolation, Staining, Western Blot, Flow Cytometry, Molecular Weight, Enzyme-linked Immunosorbent Assay, Incubation, Clone Assay

    30) Product Images from "Droplet Digital Enzyme-Linked Oligonucleotide Hybridization Assay for Absolute RNA Quantification"

    Article Title: Droplet Digital Enzyme-Linked Oligonucleotide Hybridization Assay for Absolute RNA Quantification

    Journal: Scientific Reports

    doi: 10.1038/srep13795

    Continuous flow droplet digital ELOHA for absolute RNA quantification based on two dependent Poisson process. ( a ) Schematic of droplet digital ELOHA on a microfluidic chip. Initially, a sandwiched complex (inset i, first Poisson process) is formed by hybridization of oligos on magnetic beads. The enzyme labels (SβG) are then attached to the sandwiched complex through biotin-streptavidin interaction. This magnetic bead suspension and the fluorogenic substrate (RGP), each of a volume of 50 μL, are loaded into separate capillary tubes. Droplets are continuously generated by shearing the bead/substrate mixture with oil/surfactant on the device (inset ii, second dependent Poisson process). After continuous incubation of the droplets at room temperature in-line, the fluorescence intensity of each droplet is recorded one by one through a custom designed optical system (inset iii). ( b ) Schematic of custom designed optical system. The system includes a trans-illumination source for imaging the droplets on the chip, and two laser sources for fluorescence excitation. Abbreviation: DM, dichroic mirror; BP: band pass; APD: avalanche photodiode; CCD: CCD Camera.
    Figure Legend Snippet: Continuous flow droplet digital ELOHA for absolute RNA quantification based on two dependent Poisson process. ( a ) Schematic of droplet digital ELOHA on a microfluidic chip. Initially, a sandwiched complex (inset i, first Poisson process) is formed by hybridization of oligos on magnetic beads. The enzyme labels (SβG) are then attached to the sandwiched complex through biotin-streptavidin interaction. This magnetic bead suspension and the fluorogenic substrate (RGP), each of a volume of 50 μL, are loaded into separate capillary tubes. Droplets are continuously generated by shearing the bead/substrate mixture with oil/surfactant on the device (inset ii, second dependent Poisson process). After continuous incubation of the droplets at room temperature in-line, the fluorescence intensity of each droplet is recorded one by one through a custom designed optical system (inset iii). ( b ) Schematic of custom designed optical system. The system includes a trans-illumination source for imaging the droplets on the chip, and two laser sources for fluorescence excitation. Abbreviation: DM, dichroic mirror; BP: band pass; APD: avalanche photodiode; CCD: CCD Camera.

    Techniques Used: Flow Cytometry, Chromatin Immunoprecipitation, Hybridization, Magnetic Beads, Generated, Incubation, Fluorescence, Imaging

    31) Product Images from "RstA Is a Major Regulator of Clostridioides difficile Toxin Production and Motility"

    Article Title: RstA Is a Major Regulator of Clostridioides difficile Toxin Production and Motility

    Journal: mBio

    doi: 10.1128/mBio.01991-18

    RstA binds to the rstA , tcdR , flgB , tcdA , and tcdB promoters. Western blot analysis using FLAG M2 antibody to detect recombinant RstA-3XFLAG or RstAΔHTH-3XFLAG in cell lysates or following biotin-labeled DNA pulldown assays. As a control, cell lysate expressing the RstA-3XFLAG construct (MC1004) or the RstAΔHTH-3XFLAG construct (MC1028) is included in the first lane or two of each Western blot shown. Additional negative controls in each panel include unbiotinylated full-length rstA promoter (−) and beads-only controls to ensure that RstA does not interact with the beads nonspecifically. The biotin-labeled fragments used as bait are of the 115-bp wild-type, T-19A, A-21C, or T-19A/A-21C rstA promoters or of the 380-bp intergenic region upstream of the rstA promoter (IR; see Fig. 2 ; present in all panels) (A), the full-length tcdR (446-bp) or the 630Δ erm or R20291 flgB (229-bp) promoters (B), the full-length tcdR (446-bp), σ A -dependent (92-bp), σ D -dependent (116-bp), σ TcdRP2 -dependent (188-bp), or σ TcdRP1 -dependent (112-bp) promoters (C), or the full-length tcdR (446-bp), tcdA (511-bp), or tcdB (501-bp) promoters (D). All promoter fragments were bound to streptavidin-coated magnetic beads and incubated with C. difficile cell lysates grown in TY medium (pH 7.4) supplemented with 2 µg/ml thiamphenicol and 1 µg/ml nisin to mid-log phase (OD 600 of 0.5 to 0.7), expressing either the RstA-3XFLAG construct (MC1004) or the RstAΔHTH-3XFLAG construct (MC1028).
    Figure Legend Snippet: RstA binds to the rstA , tcdR , flgB , tcdA , and tcdB promoters. Western blot analysis using FLAG M2 antibody to detect recombinant RstA-3XFLAG or RstAΔHTH-3XFLAG in cell lysates or following biotin-labeled DNA pulldown assays. As a control, cell lysate expressing the RstA-3XFLAG construct (MC1004) or the RstAΔHTH-3XFLAG construct (MC1028) is included in the first lane or two of each Western blot shown. Additional negative controls in each panel include unbiotinylated full-length rstA promoter (−) and beads-only controls to ensure that RstA does not interact with the beads nonspecifically. The biotin-labeled fragments used as bait are of the 115-bp wild-type, T-19A, A-21C, or T-19A/A-21C rstA promoters or of the 380-bp intergenic region upstream of the rstA promoter (IR; see Fig. 2 ; present in all panels) (A), the full-length tcdR (446-bp) or the 630Δ erm or R20291 flgB (229-bp) promoters (B), the full-length tcdR (446-bp), σ A -dependent (92-bp), σ D -dependent (116-bp), σ TcdRP2 -dependent (188-bp), or σ TcdRP1 -dependent (112-bp) promoters (C), or the full-length tcdR (446-bp), tcdA (511-bp), or tcdB (501-bp) promoters (D). All promoter fragments were bound to streptavidin-coated magnetic beads and incubated with C. difficile cell lysates grown in TY medium (pH 7.4) supplemented with 2 µg/ml thiamphenicol and 1 µg/ml nisin to mid-log phase (OD 600 of 0.5 to 0.7), expressing either the RstA-3XFLAG construct (MC1004) or the RstAΔHTH-3XFLAG construct (MC1028).

    Techniques Used: Western Blot, Recombinant, Labeling, Expressing, Construct, Magnetic Beads, Incubation

    32) Product Images from "In Vitro and In Vivo Evidence that Thrombospondin-1 (TSP-1) Contributes to Stirring- and Shear-Dependent Activation of Platelet-Derived TGF-?1"

    Article Title: In Vitro and In Vivo Evidence that Thrombospondin-1 (TSP-1) Contributes to Stirring- and Shear-Dependent Activation of Platelet-Derived TGF-?1

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0006608

    Shear depletes TSP-1 via a thiol-dependent mechanism. (A) The proteins in human platelet releasates were labeled with MPB (100 µM) for 30 min either before (−) or after (+) shear for 2 hours. The labeled proteins were either analyzed directly (left two lanes) or after affinity-purification using Streptavidin-coupled beads (right two lanes). Shearing led to a dramatic decrease in intensity of the HRP reaction in select regions. (B) One of the MPB-labeled proteins (boxed) that was most affected by shearing was identified as TSP-1 by LC-MS/MS analysis. (C) Platelet releasates were passed through either a control-Sepharose column (Con) or a thiol-Sepharose column (Thiol) and then labeled with MPB. Depletion of thiol-reactive proteins by the column was analyzed by reaction of the separated proteins with Streptavidin (left panel) and depletion of TSP-1 protein was measured by immunoblotting with an anti-TSP-1 antibody (right panel). Nearly all of the proteins that labeled with MPB from the control column were not labeled after passage through the thiol-Sepharose column. (D) Effect of increasing time of exposure to shear on depletion of TSP-1 from platelet releasates. MPB labeling of TSP-1 was concordantly reduced with the loss to TSP-1 protein during shear as judged by reaction with Streptavidin-HRP (left panel) and immunoblotting with an anti-TSP-1 antibody (middle panel). TGF-β1 depletion was much less pronounced as judged by immunoblotting with an anti-TGF-β1 antibody (right panel). (E) Addition of MPB (100 µM) before shear partially prevented the loss of TSP-1 protein as shown by immunoblotting with an anti-TSP-1 antibody. Addition of the other thiol-reactive reagents, BMCC (F) or NEM (G), similarly protected against loss of TSP-1. Vertical lines in (F) indicate deletion of intermediate lanes from the same gel.
    Figure Legend Snippet: Shear depletes TSP-1 via a thiol-dependent mechanism. (A) The proteins in human platelet releasates were labeled with MPB (100 µM) for 30 min either before (−) or after (+) shear for 2 hours. The labeled proteins were either analyzed directly (left two lanes) or after affinity-purification using Streptavidin-coupled beads (right two lanes). Shearing led to a dramatic decrease in intensity of the HRP reaction in select regions. (B) One of the MPB-labeled proteins (boxed) that was most affected by shearing was identified as TSP-1 by LC-MS/MS analysis. (C) Platelet releasates were passed through either a control-Sepharose column (Con) or a thiol-Sepharose column (Thiol) and then labeled with MPB. Depletion of thiol-reactive proteins by the column was analyzed by reaction of the separated proteins with Streptavidin (left panel) and depletion of TSP-1 protein was measured by immunoblotting with an anti-TSP-1 antibody (right panel). Nearly all of the proteins that labeled with MPB from the control column were not labeled after passage through the thiol-Sepharose column. (D) Effect of increasing time of exposure to shear on depletion of TSP-1 from platelet releasates. MPB labeling of TSP-1 was concordantly reduced with the loss to TSP-1 protein during shear as judged by reaction with Streptavidin-HRP (left panel) and immunoblotting with an anti-TSP-1 antibody (middle panel). TGF-β1 depletion was much less pronounced as judged by immunoblotting with an anti-TGF-β1 antibody (right panel). (E) Addition of MPB (100 µM) before shear partially prevented the loss of TSP-1 protein as shown by immunoblotting with an anti-TSP-1 antibody. Addition of the other thiol-reactive reagents, BMCC (F) or NEM (G), similarly protected against loss of TSP-1. Vertical lines in (F) indicate deletion of intermediate lanes from the same gel.

    Techniques Used: Labeling, Affinity Purification, Liquid Chromatography with Mass Spectroscopy, Mass Spectrometry

    33) Product Images from "Integration of sample preparation and analysis on an optofluidic chip for multi-target disease detection"

    Article Title: Integration of sample preparation and analysis on an optofluidic chip for multi-target disease detection

    Journal: Lab on a chip

    doi: 10.1039/c8lc00966j

    Target differentiation through dual protein-nucleic acid assay: Bar plots indicate relative number of peaks observed in the protein (green) and nucleic acid (red) channel in each of the 4 separate tests. Each bar plot is normalized with respect to the number of peaks observed with Zika nucleic acid and protein targets. Very few peaks are seen when the wrong nucleic acid (Ebola) target and wrong protein (Monovalent Streptavidin) targets are introduced. However, a significant signal is observed with dengue protein targets due to cross reactivity with Zika NS1 antibodies, but the low signal in the nucleic acid channel confirms the absence of the Zika target.
    Figure Legend Snippet: Target differentiation through dual protein-nucleic acid assay: Bar plots indicate relative number of peaks observed in the protein (green) and nucleic acid (red) channel in each of the 4 separate tests. Each bar plot is normalized with respect to the number of peaks observed with Zika nucleic acid and protein targets. Very few peaks are seen when the wrong nucleic acid (Ebola) target and wrong protein (Monovalent Streptavidin) targets are introduced. However, a significant signal is observed with dengue protein targets due to cross reactivity with Zika NS1 antibodies, but the low signal in the nucleic acid channel confirms the absence of the Zika target.

    Techniques Used: Acid Assay

    34) Product Images from "Synthetic genome readers target clustered binding sites across diverse chromatin states"

    Article Title: Synthetic genome readers target clustered binding sites across diverse chromatin states

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    doi: 10.1073/pnas.1604847113

    Bioactive polyamides and COSMIC scheme. ( A ) COSMIC-seq. Cells are treated with trifunctional derivatives of polyamide (PA). After cross-linking with 365 nm of UV irradiation, cells are lysed and genomic DNA is sheared. Streptavidin-coated magnetic beads are added to capture polyamide–DNA adducts. The DNA is released and analyzed by qPCR or by NGS. ( B ) Hairpin polyamides 1 and 2 target the DNA sequence 5′-WACGTW-3′, where W = A or T. Linear polyamides 3 and 4 target 5′-AAGAAGAAG-3′. Two derivatives of psoralen, 5 and 6 , were also examined. Rings of N -methylimidazole are bolded for clarity. N -methylpyrrole (○), N -methylimidazole (●), 3-chlorothiophene (□), and β-alanine (◇) are shown. Psoralen (P) and biotin (B) are denoted.
    Figure Legend Snippet: Bioactive polyamides and COSMIC scheme. ( A ) COSMIC-seq. Cells are treated with trifunctional derivatives of polyamide (PA). After cross-linking with 365 nm of UV irradiation, cells are lysed and genomic DNA is sheared. Streptavidin-coated magnetic beads are added to capture polyamide–DNA adducts. The DNA is released and analyzed by qPCR or by NGS. ( B ) Hairpin polyamides 1 and 2 target the DNA sequence 5′-WACGTW-3′, where W = A or T. Linear polyamides 3 and 4 target 5′-AAGAAGAAG-3′. Two derivatives of psoralen, 5 and 6 , were also examined. Rings of N -methylimidazole are bolded for clarity. N -methylpyrrole (○), N -methylimidazole (●), 3-chlorothiophene (□), and β-alanine (◇) are shown. Psoralen (P) and biotin (B) are denoted.

    Techniques Used: Irradiation, Magnetic Beads, Real-time Polymerase Chain Reaction, Next-Generation Sequencing, Sequencing

    35) Product Images from "Single molecule measurements of DNA helicase activity with magnetic tweezers and t-test based step-finding analysis"

    Article Title: Single molecule measurements of DNA helicase activity with magnetic tweezers and t-test based step-finding analysis

    Journal: Methods (San Diego, Calif.)

    doi: 10.1016/j.ymeth.2016.04.030

    Hairpin and gapped DNA substrate geometries. (a) Cartoon of hairpin and gapped DNA substrates bound to the surface via anti-digoxigenin and digoxigenin (red dot) and to the streptavidin coated magnetic beads via biotin linkage (green dot). RecQ unwinding
    Figure Legend Snippet: Hairpin and gapped DNA substrate geometries. (a) Cartoon of hairpin and gapped DNA substrates bound to the surface via anti-digoxigenin and digoxigenin (red dot) and to the streptavidin coated magnetic beads via biotin linkage (green dot). RecQ unwinding

    Techniques Used: Magnetic Beads

    36) Product Images from "The RNA-mediated, asymmetric ring regulatory mechanism of the transcription termination Rho helicase decrypted by time-resolved Nucleotide Analog Interference Probing (trNAIP)"

    Article Title: The RNA-mediated, asymmetric ring regulatory mechanism of the transcription termination Rho helicase decrypted by time-resolved Nucleotide Analog Interference Probing (trNAIP)

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gku595

    Principle of the trNAIP approach implemented to study Rho translocation/unwinding mechanisms. The starting library of biotinylated RNA:DNA substrates is prepared as in standard NAIM so that each individual substrate bears a phosphorothioate-containing nucleotide analog within the RNA strand (Step 1). The library of substrates is affixed to streptavidin-coated magnetic beads and incubated with Rho to form Rho:substrate complexes (Step 2). After elimination of unbound species from the bead slurry, single-run unwinding reactions are initiated by addition of Mg-ATP and poly[rC] trap. Bead slurry aliquots are then withdrawn at various reaction times and mixed with quench buffer (Step 3). Supernatants containing RNA species released upon Rho action are separated with a magnet from beads bearing unreacted RNA:DNA substrates (Step 4). Total RNA species present in each bead and supernatant fraction are subjected to iodine treatment (to cleave phosphorothioate linkage tags) and analyzed by sequencing PAGE (Step 5). Then, reaction progress curves are calculated for each band position of the sequencing profile from the variations in band intensities observed as a function of time for the bead and supernatant fractions. In this way, a ‘kinetic trace’ can be assigned to each species of the initial library of substrates, reflecting the kinetic effect induced by the specific nucleotide modification contained (at a given position) in the individual species (Step 6).
    Figure Legend Snippet: Principle of the trNAIP approach implemented to study Rho translocation/unwinding mechanisms. The starting library of biotinylated RNA:DNA substrates is prepared as in standard NAIM so that each individual substrate bears a phosphorothioate-containing nucleotide analog within the RNA strand (Step 1). The library of substrates is affixed to streptavidin-coated magnetic beads and incubated with Rho to form Rho:substrate complexes (Step 2). After elimination of unbound species from the bead slurry, single-run unwinding reactions are initiated by addition of Mg-ATP and poly[rC] trap. Bead slurry aliquots are then withdrawn at various reaction times and mixed with quench buffer (Step 3). Supernatants containing RNA species released upon Rho action are separated with a magnet from beads bearing unreacted RNA:DNA substrates (Step 4). Total RNA species present in each bead and supernatant fraction are subjected to iodine treatment (to cleave phosphorothioate linkage tags) and analyzed by sequencing PAGE (Step 5). Then, reaction progress curves are calculated for each band position of the sequencing profile from the variations in band intensities observed as a function of time for the bead and supernatant fractions. In this way, a ‘kinetic trace’ can be assigned to each species of the initial library of substrates, reflecting the kinetic effect induced by the specific nucleotide modification contained (at a given position) in the individual species (Step 6).

    Techniques Used: Translocation Assay, Magnetic Beads, Incubation, Sequencing, Polyacrylamide Gel Electrophoresis, Modification

    37) Product Images from "circFGFR4 Promotes Differentiation of Myoblasts via Binding miR-107 to Relieve Its Inhibition of Wnt3a"

    Article Title: circFGFR4 Promotes Differentiation of Myoblasts via Binding miR-107 to Relieve Its Inhibition of Wnt3a

    Journal: Molecular Therapy. Nucleic Acids

    doi: 10.1016/j.omtn.2018.02.012

    circFGFR4 Binding miR-107 to Promote Cell Differentiation (A) circFGFR4 expression in different tissues from embryonic Qinchuan cattle detected by real-time qPCR. (B) The expression efficiency of pcDNA-circFGFR4 is shown. (C) Bovine primary myoblasts were co-transfected with miR-107 mimic and pCK-circFGFR4-W or pCK-circFGFR4-Mut. Renilla luciferase activity was normalized to the Firefly luciferase activity. (D) qPCR analysis of circFGFR4 level in the streptavidin captured fractions from the bovine primary myoblasts lysates after transfection with 3′ end biotinylated miR-107 or control RNA (NC). (E) Biotin-labeled circRNA was purified and subjected to RNA pull-down assays by incubation with bovine primary myoblasts lysates, followed by qPCR analysis of miR-107 level. (F) The mRNA expression of Wnt3a in primary bovine myoblasts transfected with miR-107 mimic and (or) circFGFR4 for 24 hr was detected by qPCR. (G and H) The expression of MyoG in primary bovine myoblasts was detected by qPCR (G) and western blotting (H). (I) Bovine primary myocytes were transfected with pcDNA-circFGFR4 and (or) miR-107 mimic, and cell differentiation was detected by immunofluorescence (MyHC) and observed under a fluorescence microscope. Values are means ± SEM for three individuals. *p
    Figure Legend Snippet: circFGFR4 Binding miR-107 to Promote Cell Differentiation (A) circFGFR4 expression in different tissues from embryonic Qinchuan cattle detected by real-time qPCR. (B) The expression efficiency of pcDNA-circFGFR4 is shown. (C) Bovine primary myoblasts were co-transfected with miR-107 mimic and pCK-circFGFR4-W or pCK-circFGFR4-Mut. Renilla luciferase activity was normalized to the Firefly luciferase activity. (D) qPCR analysis of circFGFR4 level in the streptavidin captured fractions from the bovine primary myoblasts lysates after transfection with 3′ end biotinylated miR-107 or control RNA (NC). (E) Biotin-labeled circRNA was purified and subjected to RNA pull-down assays by incubation with bovine primary myoblasts lysates, followed by qPCR analysis of miR-107 level. (F) The mRNA expression of Wnt3a in primary bovine myoblasts transfected with miR-107 mimic and (or) circFGFR4 for 24 hr was detected by qPCR. (G and H) The expression of MyoG in primary bovine myoblasts was detected by qPCR (G) and western blotting (H). (I) Bovine primary myocytes were transfected with pcDNA-circFGFR4 and (or) miR-107 mimic, and cell differentiation was detected by immunofluorescence (MyHC) and observed under a fluorescence microscope. Values are means ± SEM for three individuals. *p

    Techniques Used: Binding Assay, Cell Differentiation, Expressing, Real-time Polymerase Chain Reaction, Transfection, Luciferase, Activity Assay, Labeling, Purification, Incubation, Western Blot, Immunofluorescence, Fluorescence, Microscopy

    38) Product Images from "Evidence for antigen presentation to sensitized T cells by thyroid peroxidase (TPO)-specific B cells in mice injected with fibroblasts co-expressing TPO and MHC class II"

    Article Title: Evidence for antigen presentation to sensitized T cells by thyroid peroxidase (TPO)-specific B cells in mice injected with fibroblasts co-expressing TPO and MHC class II

    Journal: Clinical and Experimental Immunology

    doi: 10.1046/j.1365-2249.2000.01087.x

    Removal of B220 + cells from spleen cells depletes B cells and enriches for T cells and macrophages. Spleen cells were analysed by flow cytometry before and after removal of cells labelled with biotinylated anti-B220 using streptavidin-coated beads. B cells, T cells and macrophages were labelled with biotinylated antibodies (anti-B220, anti-CD3ε and anti-Mac-1α, respectively) and detected with streptavidin–FITC (Materials and Methods).
    Figure Legend Snippet: Removal of B220 + cells from spleen cells depletes B cells and enriches for T cells and macrophages. Spleen cells were analysed by flow cytometry before and after removal of cells labelled with biotinylated anti-B220 using streptavidin-coated beads. B cells, T cells and macrophages were labelled with biotinylated antibodies (anti-B220, anti-CD3ε and anti-Mac-1α, respectively) and detected with streptavidin–FITC (Materials and Methods).

    Techniques Used: Flow Cytometry, Cytometry

    39) Product Images from "MC159 of Molluscum Contagiosum Virus Suppresses Autophagy by Recruiting Cellular SH3BP4 via an SH3 Domain-Mediated Interaction"

    Article Title: MC159 of Molluscum Contagiosum Virus Suppresses Autophagy by Recruiting Cellular SH3BP4 via an SH3 Domain-Mediated Interaction

    Journal: Journal of Virology

    doi: 10.1128/JVI.01613-18

    Association of MC159 with SH3BP4 in human cells. Biotin acceptor domain-tagged MC159 or the indicated PXXP motif mutants were transfected into 293T cells together with Myc-tagged SH3BP4 (A) or SH3BP4 alone (B). Lysates of these cells were examined by Western blotting either directly (cell lysates) or after precipitation with streptavidin-coated beads (MC159 pulldown) by probing the membranes using labeled streptavidin (MC159) or anti-Myc (A) or anti-SH3BP4 (B) antibodies.
    Figure Legend Snippet: Association of MC159 with SH3BP4 in human cells. Biotin acceptor domain-tagged MC159 or the indicated PXXP motif mutants were transfected into 293T cells together with Myc-tagged SH3BP4 (A) or SH3BP4 alone (B). Lysates of these cells were examined by Western blotting either directly (cell lysates) or after precipitation with streptavidin-coated beads (MC159 pulldown) by probing the membranes using labeled streptavidin (MC159) or anti-Myc (A) or anti-SH3BP4 (B) antibodies.

    Techniques Used: Transfection, Western Blot, Labeling

    40) Product Images from "Integration of sample preparation and analysis on an optofluidic chip for multi-target disease detection"

    Article Title: Integration of sample preparation and analysis on an optofluidic chip for multi-target disease detection

    Journal: Lab on a chip

    doi: 10.1039/c8lc00966j

    Target differentiation through dual protein-nucleic acid assay: Bar plots indicate relative number of peaks observed in the protein (green) and nucleic acid (red) channel in each of the 4 separate tests. Each bar plot is normalized with respect to the number of peaks observed with Zika nucleic acid and protein targets. Very few peaks are seen when the wrong nucleic acid (Ebola) target and wrong protein (Monovalent Streptavidin) targets are introduced. However, a significant signal is observed with dengue protein targets due to cross reactivity with Zika NS1 antibodies, but the low signal in the nucleic acid channel confirms the absence of the Zika target.
    Figure Legend Snippet: Target differentiation through dual protein-nucleic acid assay: Bar plots indicate relative number of peaks observed in the protein (green) and nucleic acid (red) channel in each of the 4 separate tests. Each bar plot is normalized with respect to the number of peaks observed with Zika nucleic acid and protein targets. Very few peaks are seen when the wrong nucleic acid (Ebola) target and wrong protein (Monovalent Streptavidin) targets are introduced. However, a significant signal is observed with dengue protein targets due to cross reactivity with Zika NS1 antibodies, but the low signal in the nucleic acid channel confirms the absence of the Zika target.

    Techniques Used: Acid Assay

    41) Product Images from "Ancient and Recent Adaptive Evolution of Primate Non-Homologous End Joining Genes"

    Article Title: Ancient and Recent Adaptive Evolution of Primate Non-Homologous End Joining Genes

    Journal: PLoS Genetics

    doi: 10.1371/journal.pgen.1001169

    Interactions with other repair proteins have been conserved in Nbs1 despite its positive selection. A) Positively selected residues 9 and 185 (red balls) are mapped onto the partial Nbs1 structure (PDB 3HUE) [48] . B) SNP frequencies of Q185E are reported for the ten human populations included in the HapMap project ( http://hapmap.ncbi.nlm.nih.gov/ ). Three-letter labels are standard codes (ASW - African ancestry in Southwest USA; CEU - Utah residents with Northern and Western European ancestry; CHB- Han Chinese in Beijing, China; CHD - Chinese in Metropolitan Denver, Colorado; GIH - Gujarati Indians in Houston, Texas; JPT - Japanese in Tokyo, Japan; LWK - Luhya in Webuye, Kenya; MEX - Mexican ancestry in Los Angeles, California; MKK - Maasai in Kinyawa, Kenya; TSI - Toscans in Italy). C) Binding assays were performed between recombinant biotinylated MRN complexes containing Nbs1 E185 or Q185, and an N-terminal Flag-tagged fragment of Mdc1 containing amino acids 1 to 740, as indicated. The biotinylated MRN complexes (20nM) were incubated with 45 nM Mdc1 and then isolated with streptavidin-coated magnetic beads. Bound protein was visualized by western blotting with anti-Flag (Mdc1) and anti-Nbs1 antibodies. D) MRN complexes containing Nbs1 E185 or Q185 were tested in ATM kinase assays with linear DNA as indicated. Phosphorylation of the substrate, GST-p53 (aa 1–100), was assessed by western blotting using a phospho-specific antibody directed against p53-phospho-ser15 as previously described [57] .
    Figure Legend Snippet: Interactions with other repair proteins have been conserved in Nbs1 despite its positive selection. A) Positively selected residues 9 and 185 (red balls) are mapped onto the partial Nbs1 structure (PDB 3HUE) [48] . B) SNP frequencies of Q185E are reported for the ten human populations included in the HapMap project ( http://hapmap.ncbi.nlm.nih.gov/ ). Three-letter labels are standard codes (ASW - African ancestry in Southwest USA; CEU - Utah residents with Northern and Western European ancestry; CHB- Han Chinese in Beijing, China; CHD - Chinese in Metropolitan Denver, Colorado; GIH - Gujarati Indians in Houston, Texas; JPT - Japanese in Tokyo, Japan; LWK - Luhya in Webuye, Kenya; MEX - Mexican ancestry in Los Angeles, California; MKK - Maasai in Kinyawa, Kenya; TSI - Toscans in Italy). C) Binding assays were performed between recombinant biotinylated MRN complexes containing Nbs1 E185 or Q185, and an N-terminal Flag-tagged fragment of Mdc1 containing amino acids 1 to 740, as indicated. The biotinylated MRN complexes (20nM) were incubated with 45 nM Mdc1 and then isolated with streptavidin-coated magnetic beads. Bound protein was visualized by western blotting with anti-Flag (Mdc1) and anti-Nbs1 antibodies. D) MRN complexes containing Nbs1 E185 or Q185 were tested in ATM kinase assays with linear DNA as indicated. Phosphorylation of the substrate, GST-p53 (aa 1–100), was assessed by western blotting using a phospho-specific antibody directed against p53-phospho-ser15 as previously described [57] .

    Techniques Used: Selection, Northern Blot, Western Blot, Binding Assay, Recombinant, Incubation, Isolation, Magnetic Beads

    42) Product Images from "Capture of MicroRNA-Bound mRNAs Identifies the Tumor Suppressor miR-34a as a Regulator of Growth Factor Signaling"

    Article Title: Capture of MicroRNA-Bound mRNAs Identifies the Tumor Suppressor miR-34a as a Regulator of Growth Factor Signaling

    Journal: PLoS Genetics

    doi: 10.1371/journal.pgen.1002363

    The Biotin-miRNA pulldown method. (A) Schematic of the Bi-miRNA pull-down (PD) assay. (B) Activity of 3′-biotinylated miR-34a (Bi-miR-34a) is similar to unbiotinylated miR-34a mimics by dual luciferase assay performed in HeLa cells cotransfected with psiCHECK-2 vector (black) or psi-CHECK-2 bearing a perfectly complementary sequence to miR-34a (psiCHECK-2-AS-miR-34a, white). Transfection with cel-miR-67 is the control (CTL). Luciferase expression was assayed after 24 hr; results are normalized to cells transfected with the luciferase vector and the CTL miRNA. (C) Bi-miR-34a efficiently silences known miR-34a targets CDK4 , CDK6 and MYB . K562 cells were transfected with CTL miRNA, miR-34a, Bi-CTL or Bi-miR-34a mimics for 48 hr. Expression was measured by qRT-PCR normalized to GAPDH . The housekeeping genes SDHA and UBC are negative controls. (D) Cytoplasmic lysates from K562 cells were prepared 48 hr after cotransfection with Bi-CTL (black) miRNA or Bi-miR-34a (white) and a plasmid encoding HA-Ago1, HA-Ago2, or empty vector. Enrichment of miR-34a by HA immunoprecipitation was measured by qRT-PCR normalized to U6 . Enrichment of Bi-miR-34a in the HA-immunoprecipitates suggests that Bi-miR-34a is incorporated into RISC. (E) Bi-miR-34a pull-downs optimally enrich targets 24 or 48 hr after transfection. K562 cells were transfected in duplicate with Bi-CTL (black) or Bi-miR-34a (white) mimics for the indicated times. Enrichment of known miR-34a targets ( CDK4 and CDK6 ) or control genes ( GAPDH and UBC ) was assessed by qRT-PCR relative to GAPDH . (F) The streptavidin pull-down enriches for miR-34a target genes in K562 cells transfected with Bi-CTL (black) or Bi-miR-34a (white) mimics. (G) Known miR-24 target mRNAs ( H2AX , E2F2 and MYC ) are also pulled down with Bi-miR-24 in HepG2 cells reverse transfected 48 hr earlier with Bi-CTL (black) or Bi-miR-24 (white). Enrichment of target mRNAs in (F) and (G) was analyzed by qRT-PCR relative to SDHA . In all panels, data represent mean ± SD of 3 independent experiments. *, p
    Figure Legend Snippet: The Biotin-miRNA pulldown method. (A) Schematic of the Bi-miRNA pull-down (PD) assay. (B) Activity of 3′-biotinylated miR-34a (Bi-miR-34a) is similar to unbiotinylated miR-34a mimics by dual luciferase assay performed in HeLa cells cotransfected with psiCHECK-2 vector (black) or psi-CHECK-2 bearing a perfectly complementary sequence to miR-34a (psiCHECK-2-AS-miR-34a, white). Transfection with cel-miR-67 is the control (CTL). Luciferase expression was assayed after 24 hr; results are normalized to cells transfected with the luciferase vector and the CTL miRNA. (C) Bi-miR-34a efficiently silences known miR-34a targets CDK4 , CDK6 and MYB . K562 cells were transfected with CTL miRNA, miR-34a, Bi-CTL or Bi-miR-34a mimics for 48 hr. Expression was measured by qRT-PCR normalized to GAPDH . The housekeeping genes SDHA and UBC are negative controls. (D) Cytoplasmic lysates from K562 cells were prepared 48 hr after cotransfection with Bi-CTL (black) miRNA or Bi-miR-34a (white) and a plasmid encoding HA-Ago1, HA-Ago2, or empty vector. Enrichment of miR-34a by HA immunoprecipitation was measured by qRT-PCR normalized to U6 . Enrichment of Bi-miR-34a in the HA-immunoprecipitates suggests that Bi-miR-34a is incorporated into RISC. (E) Bi-miR-34a pull-downs optimally enrich targets 24 or 48 hr after transfection. K562 cells were transfected in duplicate with Bi-CTL (black) or Bi-miR-34a (white) mimics for the indicated times. Enrichment of known miR-34a targets ( CDK4 and CDK6 ) or control genes ( GAPDH and UBC ) was assessed by qRT-PCR relative to GAPDH . (F) The streptavidin pull-down enriches for miR-34a target genes in K562 cells transfected with Bi-CTL (black) or Bi-miR-34a (white) mimics. (G) Known miR-24 target mRNAs ( H2AX , E2F2 and MYC ) are also pulled down with Bi-miR-24 in HepG2 cells reverse transfected 48 hr earlier with Bi-CTL (black) or Bi-miR-24 (white). Enrichment of target mRNAs in (F) and (G) was analyzed by qRT-PCR relative to SDHA . In all panels, data represent mean ± SD of 3 independent experiments. *, p

    Techniques Used: Activity Assay, Luciferase, Plasmid Preparation, Sequencing, Transfection, CTL Assay, Expressing, Quantitative RT-PCR, Cotransfection, Immunoprecipitation

    43) Product Images from "DNA-binding and strand-annealing activities of human Mre11: implications for its roles in DNA double-strand break repair pathways"

    Article Title: DNA-binding and strand-annealing activities of human Mre11: implications for its roles in DNA double-strand break repair pathways

    Journal: Nucleic Acids Research

    doi:

    hMre11 binds to ssDNA and dsDNA molecules. ( A ) Radiolabeled 50 nt ssDNA or blunt-ended dsDNA (MJ19 and MJ19/20, respectively) were incubated at 1.25 nM with the indicated amounts of hMre11 under standard conditions in the absence of divalent cations. Samples were analyzed by native PAGE, followed by autoradiography. nb, non-bound probe; b, bound probe; DNA–protein complex. ( B ) Biotinylated 50 nt ssDNA or blunt-ended dsDNA (MJ29 and MJ29/20, respectively) were coupled to streptavidin-coated magnetic beads and incubated at 20 nM with 24 nM hMre11 preparation under standard conditions supplemented with 0.1% NP-40. Bound fractions were analyzed by SDS–PAGE and immunoblotting with affinity-purified α-hMre11 antibodies. Lane 1, size marker (m, molecular mass indicated in kDa); lane 2, incubation with control beads lacking DNA; lane 3, incubation with beads coupled to ssDNA; lane 4, incubation with beads coupled to dsDNA.
    Figure Legend Snippet: hMre11 binds to ssDNA and dsDNA molecules. ( A ) Radiolabeled 50 nt ssDNA or blunt-ended dsDNA (MJ19 and MJ19/20, respectively) were incubated at 1.25 nM with the indicated amounts of hMre11 under standard conditions in the absence of divalent cations. Samples were analyzed by native PAGE, followed by autoradiography. nb, non-bound probe; b, bound probe; DNA–protein complex. ( B ) Biotinylated 50 nt ssDNA or blunt-ended dsDNA (MJ29 and MJ29/20, respectively) were coupled to streptavidin-coated magnetic beads and incubated at 20 nM with 24 nM hMre11 preparation under standard conditions supplemented with 0.1% NP-40. Bound fractions were analyzed by SDS–PAGE and immunoblotting with affinity-purified α-hMre11 antibodies. Lane 1, size marker (m, molecular mass indicated in kDa); lane 2, incubation with control beads lacking DNA; lane 3, incubation with beads coupled to ssDNA; lane 4, incubation with beads coupled to dsDNA.

    Techniques Used: Incubation, Clear Native PAGE, Autoradiography, Magnetic Beads, SDS Page, Affinity Purification, Marker

    44) Product Images from "Mre11-Rad50-Xrs2 and Sae2 promote 5' strand resection of DNA double-strand breaks"

    Article Title: Mre11-Rad50-Xrs2 and Sae2 promote 5' strand resection of DNA double-strand breaks

    Journal: Nature structural & molecular biology

    doi: 10.1038/nsmb.1957

    MRX and Sae2 promote Exo1 DNA binding (a) Gel mobility shift assays were performed with wild-type MRX (2.5 nM), Sae2 (2.5 nM), and Exo1 D173A (4 nM) proteins as indicated and a 32 [P]-labeled, double-stranded oligonucleotide substrate containing 4 nt 3’ overhangs on both ends. Reactions were incubated for 15 min on ice before separation on a native acrylamide gel. (b) MRX and Exo1 D173A proteins were incubated with biotinylated, blunt 100 bp duplex DNA as indicated, crosslinked with formaldehyde, and proteins bound to the DNA were isolated using streptavidin-coated magnetic beads. Bound protein were visualized by SDS-PAGE and western blotting with anti-Flag antibody for Exo1 and Rad50. (c) Protein-DNA binding assays were performed with a 90 bp blunt DNA substrate, containing 5 azide groups (N 3 ) on the 5' ends of the 5' strands or the 3' ends of the 3' strands as shown in the diagram. Both DNA substrates were labeled with 32 [P] (
    Figure Legend Snippet: MRX and Sae2 promote Exo1 DNA binding (a) Gel mobility shift assays were performed with wild-type MRX (2.5 nM), Sae2 (2.5 nM), and Exo1 D173A (4 nM) proteins as indicated and a 32 [P]-labeled, double-stranded oligonucleotide substrate containing 4 nt 3’ overhangs on both ends. Reactions were incubated for 15 min on ice before separation on a native acrylamide gel. (b) MRX and Exo1 D173A proteins were incubated with biotinylated, blunt 100 bp duplex DNA as indicated, crosslinked with formaldehyde, and proteins bound to the DNA were isolated using streptavidin-coated magnetic beads. Bound protein were visualized by SDS-PAGE and western blotting with anti-Flag antibody for Exo1 and Rad50. (c) Protein-DNA binding assays were performed with a 90 bp blunt DNA substrate, containing 5 azide groups (N 3 ) on the 5' ends of the 5' strands or the 3' ends of the 3' strands as shown in the diagram. Both DNA substrates were labeled with 32 [P] ("*"). Proteins were incubated with the DNA substrates on ice, UV irradiated, separated by SDS-PAGE and transferred to a PVDF membrane to remove all uncrosslinked DNA before phosphorimager analysis. Migration of molecular weight markers in the gels are shown in the lane marked “M”.

    Techniques Used: Binding Assay, Mobility Shift, Labeling, Incubation, Acrylamide Gel Assay, Isolation, Magnetic Beads, SDS Page, Western Blot, Irradiation, Migration, Molecular Weight

    45) Product Images from "Human Rab small GTPase– and class V myosin–mediated membrane tethering in a chemically defined reconstitution system"

    Article Title: Human Rab small GTPase– and class V myosin–mediated membrane tethering in a chemically defined reconstitution system

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M117.811356

    Rab11a- and Myo5-GTD–dependent membrane tethering requires the membrane attachment of Rab11a on both of two opposing membranes destined to tether. A , schematic representation of the streptavidin bead–based liposome-tethering assay described
    Figure Legend Snippet: Rab11a- and Myo5-GTD–dependent membrane tethering requires the membrane attachment of Rab11a on both of two opposing membranes destined to tether. A , schematic representation of the streptavidin bead–based liposome-tethering assay described

    Techniques Used:

    46) Product Images from "Telomeres are partly shielded from ultraviolet-induced damage and proficient for nucleotide excision repair of photoproducts"

    Article Title: Telomeres are partly shielded from ultraviolet-induced damage and proficient for nucleotide excision repair of photoproducts

    Journal: Nature Communications

    doi: 10.1038/ncomms9214

    Telomere isolation assay. ( a ) Schematic of telomere capture assay. Telomeres (blue lines) are released by digesting the genome (scissors) and are captured by annealing a biotinylated oligonucleotide (red) that binds to the telomeric single-strand overhang and to streptavidin beads (green). Triangles denote photoproducts. ( b ) Undigested (lane 2) and digested (lane 3) genomic DNA, and isolated telomeres (lane 4) from BJ-hTERT cells were electrophoresed on a 0.6% agarose gel that was subsequently hybridized with a radiolabelled telomeric probe (lane 2–4). The ladder was visualized by SYBR Green staining (lane 1). ( c ) Specificity of telomere capture. Telomeres were isolated using three different conditions: mock (no oligonucleotide), scrambled (non-telomeric oligonucleotide) and telomere oligonucleotide ( Table 1 ). Various amounts of digested genomic DNA (input), 50% of the unbound (s'nat) and 50% of the combined washes were loaded on the membrane. 50% of the eluent for the telomere oligo (exactly 5 ng) and total eluent for the mock (0 ng) and scrambled oligo (2.6 ng) was loaded. The membrane was hybridized with a radiolabelled telomeric probe and exposed to a phosphoimager screen for one hour or 10 min as indicated. ( d ) Telomere purity. Various amounts of digested genomic DNA (input) and exactly 10 ng of the telomere eluent were loaded on a membrane that was hybridized with a radiolabelled Alu repeat DNA probe. ( e ) Alu signal intensities from the genomic DNA were plotted against the DNA amounts loaded. Values and error bars represent the mean and s.d. from two independent experiments. The Alu signal intensity for 10 ng of telomere eluent corresponded to about 1.2 ng.
    Figure Legend Snippet: Telomere isolation assay. ( a ) Schematic of telomere capture assay. Telomeres (blue lines) are released by digesting the genome (scissors) and are captured by annealing a biotinylated oligonucleotide (red) that binds to the telomeric single-strand overhang and to streptavidin beads (green). Triangles denote photoproducts. ( b ) Undigested (lane 2) and digested (lane 3) genomic DNA, and isolated telomeres (lane 4) from BJ-hTERT cells were electrophoresed on a 0.6% agarose gel that was subsequently hybridized with a radiolabelled telomeric probe (lane 2–4). The ladder was visualized by SYBR Green staining (lane 1). ( c ) Specificity of telomere capture. Telomeres were isolated using three different conditions: mock (no oligonucleotide), scrambled (non-telomeric oligonucleotide) and telomere oligonucleotide ( Table 1 ). Various amounts of digested genomic DNA (input), 50% of the unbound (s'nat) and 50% of the combined washes were loaded on the membrane. 50% of the eluent for the telomere oligo (exactly 5 ng) and total eluent for the mock (0 ng) and scrambled oligo (2.6 ng) was loaded. The membrane was hybridized with a radiolabelled telomeric probe and exposed to a phosphoimager screen for one hour or 10 min as indicated. ( d ) Telomere purity. Various amounts of digested genomic DNA (input) and exactly 10 ng of the telomere eluent were loaded on a membrane that was hybridized with a radiolabelled Alu repeat DNA probe. ( e ) Alu signal intensities from the genomic DNA were plotted against the DNA amounts loaded. Values and error bars represent the mean and s.d. from two independent experiments. The Alu signal intensity for 10 ng of telomere eluent corresponded to about 1.2 ng.

    Techniques Used: Isolation, Agarose Gel Electrophoresis, SYBR Green Assay, Staining

    47) Product Images from "Rapid Internalization of the Oncogenic K+ Channel KV10.1"

    Article Title: Rapid Internalization of the Oncogenic K+ Channel KV10.1

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0026329

    Endocytosis of K V 10.1 is constitutive and shows saturation after 45 minutes. A) left) Internalized K V 10.1-BBS molecules were detected in western blots (row 1, lane 3 4) and correspond up to ∼20% of initially labeled surface-channels (lane 1). Intracellular K V 10.1-BBS molecules were discriminated from surface molecules by removing surface-labels using acid wash before harvest and pull-down. Endogenous biotinylated carboxylases were detected with streptavidin-peroxidase in western blots to correct for slight variations in pull-down and blotting efficiency. ( From top to bottom: a: pyruvate-carboxylase, b: propionyl-CoA carboxylase, c: methycrotonyl-CoA carboxylase [46] , [47] ). Right: Acid washing at pH3 removes surface-labels while washing at pH5 does not. B) The endocytosis rate of K V 10.1 was measured by determining the cellular uptake of BTX-biotin via K V 10.1-BBS surface-molecules. The relative amount of internalized BTX-biotin was plotted over time (error bars: SD; top) and starts to saturate after 45 minutes. To generate this data, internalized BTX-biotin was blotted on membranes and detected with streptavidin-peroxidase (bottom, representative blot of duplicates). Ratios were determined as ‘intracellular signal/(whole-cell signal – intracellular signal)’ and corrected for unspecific uptake of BTX-biotin in cells expressing K V 10.1. Whole-cell signals (lane 4) were determined after omitting acid washing.
    Figure Legend Snippet: Endocytosis of K V 10.1 is constitutive and shows saturation after 45 minutes. A) left) Internalized K V 10.1-BBS molecules were detected in western blots (row 1, lane 3 4) and correspond up to ∼20% of initially labeled surface-channels (lane 1). Intracellular K V 10.1-BBS molecules were discriminated from surface molecules by removing surface-labels using acid wash before harvest and pull-down. Endogenous biotinylated carboxylases were detected with streptavidin-peroxidase in western blots to correct for slight variations in pull-down and blotting efficiency. ( From top to bottom: a: pyruvate-carboxylase, b: propionyl-CoA carboxylase, c: methycrotonyl-CoA carboxylase [46] , [47] ). Right: Acid washing at pH3 removes surface-labels while washing at pH5 does not. B) The endocytosis rate of K V 10.1 was measured by determining the cellular uptake of BTX-biotin via K V 10.1-BBS surface-molecules. The relative amount of internalized BTX-biotin was plotted over time (error bars: SD; top) and starts to saturate after 45 minutes. To generate this data, internalized BTX-biotin was blotted on membranes and detected with streptavidin-peroxidase (bottom, representative blot of duplicates). Ratios were determined as ‘intracellular signal/(whole-cell signal – intracellular signal)’ and corrected for unspecific uptake of BTX-biotin in cells expressing K V 10.1. Whole-cell signals (lane 4) were determined after omitting acid washing.

    Techniques Used: Western Blot, Labeling, Expressing

    The K V 10.1 life cycle includes recycling of internalized channels to the plasma membrane. A) Internalized K V 10.1-BBS channels complexed to BTX-biotin recycle back to the plasma membrane and were detected with streptavidin-Alexa594. Before, BTX-biotin surface-labels had been removed by acid wash. Thereafter incubation at permissive temperatures (30°C) lead to more pronounced membrane signals than at non-permissive temperatures (4°C) (right column versus center, respectively) GFP is expressed from pTracer- K V 10.1-BBS plasmids as a marker of transfection (second row). Identical exposure times and look up tables were used. Membrane-label intensity was quantified and normalized to membrane-signals before acid wash B) A reduction of intracellular BTX-biotin due to recycling and degradation was detected in western blots (scheme). Intracellular BTX-biotin levels decreased by ∼60% during 30 minutes of incubation at 30°C (lanes 3 4) compared to 4°C (lanes 1 and 2). A second acid wash lead to another decrease of BTX-biotin levels by ∼30% presumably by removing recycled BTX-biotin molecules from the cell surface.
    Figure Legend Snippet: The K V 10.1 life cycle includes recycling of internalized channels to the plasma membrane. A) Internalized K V 10.1-BBS channels complexed to BTX-biotin recycle back to the plasma membrane and were detected with streptavidin-Alexa594. Before, BTX-biotin surface-labels had been removed by acid wash. Thereafter incubation at permissive temperatures (30°C) lead to more pronounced membrane signals than at non-permissive temperatures (4°C) (right column versus center, respectively) GFP is expressed from pTracer- K V 10.1-BBS plasmids as a marker of transfection (second row). Identical exposure times and look up tables were used. Membrane-label intensity was quantified and normalized to membrane-signals before acid wash B) A reduction of intracellular BTX-biotin due to recycling and degradation was detected in western blots (scheme). Intracellular BTX-biotin levels decreased by ∼60% during 30 minutes of incubation at 30°C (lanes 3 4) compared to 4°C (lanes 1 and 2). A second acid wash lead to another decrease of BTX-biotin levels by ∼30% presumably by removing recycled BTX-biotin molecules from the cell surface.

    Techniques Used: Incubation, Marker, Transfection, Western Blot

    48) Product Images from "Synthetic genome readers target clustered binding sites across diverse chromatin states"

    Article Title: Synthetic genome readers target clustered binding sites across diverse chromatin states

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    doi: 10.1073/pnas.1604847113

    Bioactive polyamides and COSMIC scheme. ( A ) COSMIC-seq. Cells are treated with trifunctional derivatives of polyamide (PA). After cross-linking with 365 nm of UV irradiation, cells are lysed and genomic DNA is sheared. Streptavidin-coated magnetic beads are added to capture polyamide–DNA adducts. The DNA is released and analyzed by qPCR or by NGS. ( B ) Hairpin polyamides 1 and 2 target the DNA sequence 5′-WACGTW-3′, where W = A or T. Linear polyamides 3 and 4 target 5′-AAGAAGAAG-3′. Two derivatives of psoralen, 5 and 6 , were also examined. Rings of N -methylimidazole are bolded for clarity. N -methylpyrrole (○), N -methylimidazole (●), 3-chlorothiophene (□), and β-alanine (◇) are shown. Psoralen (P) and biotin (B) are denoted.
    Figure Legend Snippet: Bioactive polyamides and COSMIC scheme. ( A ) COSMIC-seq. Cells are treated with trifunctional derivatives of polyamide (PA). After cross-linking with 365 nm of UV irradiation, cells are lysed and genomic DNA is sheared. Streptavidin-coated magnetic beads are added to capture polyamide–DNA adducts. The DNA is released and analyzed by qPCR or by NGS. ( B ) Hairpin polyamides 1 and 2 target the DNA sequence 5′-WACGTW-3′, where W = A or T. Linear polyamides 3 and 4 target 5′-AAGAAGAAG-3′. Two derivatives of psoralen, 5 and 6 , were also examined. Rings of N -methylimidazole are bolded for clarity. N -methylpyrrole (○), N -methylimidazole (●), 3-chlorothiophene (□), and β-alanine (◇) are shown. Psoralen (P) and biotin (B) are denoted.

    Techniques Used: Irradiation, Magnetic Beads, Real-time Polymerase Chain Reaction, Next-Generation Sequencing, Sequencing

    49) Product Images from "Cell-type-specific nuclei purification from whole animals for genome-wide expression and chromatin profiling"

    Article Title: Cell-type-specific nuclei purification from whole animals for genome-wide expression and chromatin profiling

    Journal: Genome Research

    doi: 10.1101/gr.131748.111

    Nuclear tagging in D. melanogaster . ( A ) Schematic representation of the D. melanogaster nuclear targeting fusion (NTF) transgene, consisting of the mesoderm-specific twi promoter, the RanGap gene tagged with 3xFLAG , biotin ligase recognition peptide ( BLRP ), and mCherry . A second twi promoter drives transcription of E. coli biotin ligase gene ( birA ). ( B , C ) Confocal imaging of mCherry localization in a living stage 13 embryo. Anterior is to the left . ( B ) Mesodermal expression pattern is evident in somites. Some autofluorescence was also observed in particles in the yolk sac at this stage. ( C ) mCherry is present in the nuclear envelope and in the surrounding cytoplasm. ( D–G ) Detection of biotin and Flag epitopes in a fixed stage 7 embryo. ( D ) DAPI. ( E ) Anti-Flag. ( F ) Streptavidin, detecting prominent mesodermal signal from NTF and weak peripheral signal from endogenous biotinylated proteins. ( G ) Merge of D (blue), E (yellow), and F (green). ( H–J ) Localization of NTF to larval salivary gland nuclei in Actin5C-GAL4; UAS-NTF flies. ( H ) Actin 5C/+ cells, not expressing NTF. ( I ) Actin 5C/+ ; UAS-NTF/+ cells. ( J ) Actin 5C/+ ; UAS-NTF/+ nucleus, broken free of cytoplasm. mCherry fluorescence is shown in red, DAPI staining in blue. ( K–N ) Affinity-purified nuclei (arrowheads) bound to an anti-Flag-coated bead. ( K ) DAPI. ( L ) mCherry. ( M ) Streptavidin. ( N ) Merge of K (blue), L (red), and M (green). Note that anti-Flag-coated beads are 25× larger than streptavidin-coated beads.
    Figure Legend Snippet: Nuclear tagging in D. melanogaster . ( A ) Schematic representation of the D. melanogaster nuclear targeting fusion (NTF) transgene, consisting of the mesoderm-specific twi promoter, the RanGap gene tagged with 3xFLAG , biotin ligase recognition peptide ( BLRP ), and mCherry . A second twi promoter drives transcription of E. coli biotin ligase gene ( birA ). ( B , C ) Confocal imaging of mCherry localization in a living stage 13 embryo. Anterior is to the left . ( B ) Mesodermal expression pattern is evident in somites. Some autofluorescence was also observed in particles in the yolk sac at this stage. ( C ) mCherry is present in the nuclear envelope and in the surrounding cytoplasm. ( D–G ) Detection of biotin and Flag epitopes in a fixed stage 7 embryo. ( D ) DAPI. ( E ) Anti-Flag. ( F ) Streptavidin, detecting prominent mesodermal signal from NTF and weak peripheral signal from endogenous biotinylated proteins. ( G ) Merge of D (blue), E (yellow), and F (green). ( H–J ) Localization of NTF to larval salivary gland nuclei in Actin5C-GAL4; UAS-NTF flies. ( H ) Actin 5C/+ cells, not expressing NTF. ( I ) Actin 5C/+ ; UAS-NTF/+ cells. ( J ) Actin 5C/+ ; UAS-NTF/+ nucleus, broken free of cytoplasm. mCherry fluorescence is shown in red, DAPI staining in blue. ( K–N ) Affinity-purified nuclei (arrowheads) bound to an anti-Flag-coated bead. ( K ) DAPI. ( L ) mCherry. ( M ) Streptavidin. ( N ) Merge of K (blue), L (red), and M (green). Note that anti-Flag-coated beads are 25× larger than streptavidin-coated beads.

    Techniques Used: Imaging, Expressing, Fluorescence, Staining, Affinity Purification

    Affinity purification of muscle nuclei from adult C. elegans . ( A , B ) Total nuclei after isolation, stained with DAPI ( A ) or showing mCherry fluorescence ( B ). ( C–F ) Affinity purification of nuclei from strains containing both NTF and birA transgenes ( C , D ) or only the NTF transgene ( E , F ). DAPI-stained nuclei ( C , E ) and autofluorescing beads ( D , F ) are shown. ( G , H ) Example of an affinity-purified nucleus from a strain containing both NTF and birA transgenes. mCherry fluorescence ( G ), anti-Flag staining ( H ), DAPI staining ( I ), and autofluorescing beads ( J ) are shown. ( K ) Western blots detecting the NTF in total and affinity-purified nuclei, probed with an anti-Flag antibody ( top ) and streptavidin ( middle ). Streptavidin also detects an endogenous biotinylated protein of ∼125 kDa that is present in all samples and serves as a loading control (asterisk). Western blot detecting histone H3 in affinity-purified nuclei ( bottom ).
    Figure Legend Snippet: Affinity purification of muscle nuclei from adult C. elegans . ( A , B ) Total nuclei after isolation, stained with DAPI ( A ) or showing mCherry fluorescence ( B ). ( C–F ) Affinity purification of nuclei from strains containing both NTF and birA transgenes ( C , D ) or only the NTF transgene ( E , F ). DAPI-stained nuclei ( C , E ) and autofluorescing beads ( D , F ) are shown. ( G , H ) Example of an affinity-purified nucleus from a strain containing both NTF and birA transgenes. mCherry fluorescence ( G ), anti-Flag staining ( H ), DAPI staining ( I ), and autofluorescing beads ( J ) are shown. ( K ) Western blots detecting the NTF in total and affinity-purified nuclei, probed with an anti-Flag antibody ( top ) and streptavidin ( middle ). Streptavidin also detects an endogenous biotinylated protein of ∼125 kDa that is present in all samples and serves as a loading control (asterisk). Western blot detecting histone H3 in affinity-purified nuclei ( bottom ).

    Techniques Used: Affinity Purification, Isolation, Staining, Fluorescence, Western Blot

    50) Product Images from "Winding single-molecule double-stranded DNA on a nanometer-sized reel"

    Article Title: Winding single-molecule double-stranded DNA on a nanometer-sized reel

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gks651

    Experimental setup. ( a ) The molecular reel was constructed of F 1 , a magnetic bead, and the Fab fragment on Ni–NTA glass. A biotinylated anti-DIG Fab fragment (orange) specifically linked the γ subunit (red) of F 1 –ATPase and the streptavidin-coated magnetic bead. A dsDNA molecule (8.7 kb) was bridged between the anti-DIG Fab fragment and a streptavidin-coated polystyrene bead trapped using optical tweezers. The dsDNA was wound by rotating the magnetic bead using the magnetic tweezers. The stretching force was nearly parallel to the glass surface; the angle of the DNA strand against the coverglass was
    Figure Legend Snippet: Experimental setup. ( a ) The molecular reel was constructed of F 1 , a magnetic bead, and the Fab fragment on Ni–NTA glass. A biotinylated anti-DIG Fab fragment (orange) specifically linked the γ subunit (red) of F 1 –ATPase and the streptavidin-coated magnetic bead. A dsDNA molecule (8.7 kb) was bridged between the anti-DIG Fab fragment and a streptavidin-coated polystyrene bead trapped using optical tweezers. The dsDNA was wound by rotating the magnetic bead using the magnetic tweezers. The stretching force was nearly parallel to the glass surface; the angle of the DNA strand against the coverglass was

    Techniques Used: Construct

    51) Product Images from "Antibody Binding and Neutralization of Primary and T-Cell Line-Adapted Isolates of Human Immunodeficiency Virus Type 1"

    Article Title: Antibody Binding and Neutralization of Primary and T-Cell Line-Adapted Isolates of Human Immunodeficiency Virus Type 1

    Journal: Journal of Virology

    doi: 10.1128/JVI.75.6.2741-2752.2001

    MAb capture of infectious PI and TCLA virions. Virions were captured from 168P and 168C virus stocks (dark and light symbols, respectively) using streptavidin-coated M-280 Dynabeads to which biotinylated MAb 50.1 had been bound. Infectivity retained by the MAb was assessed by culturing U87-CD4-CXCR4 cells with the extensively washed magnetic beads, and the numbers of infected cell foci were determined as described in Materials and Methods. Incubations of virions with MAb-coated beads were at 4 or 37°C (circle and square symbols), and retained infectivity is compared to that in the initial virus stock used for capture (triangle symbols). Streptavidin-coated beads that were incubated with nonbiotinylated MAb 50.1 (mock) served as specificity controls (data not plotted; all, ≤5 foci/well).
    Figure Legend Snippet: MAb capture of infectious PI and TCLA virions. Virions were captured from 168P and 168C virus stocks (dark and light symbols, respectively) using streptavidin-coated M-280 Dynabeads to which biotinylated MAb 50.1 had been bound. Infectivity retained by the MAb was assessed by culturing U87-CD4-CXCR4 cells with the extensively washed magnetic beads, and the numbers of infected cell foci were determined as described in Materials and Methods. Incubations of virions with MAb-coated beads were at 4 or 37°C (circle and square symbols), and retained infectivity is compared to that in the initial virus stock used for capture (triangle symbols). Streptavidin-coated beads that were incubated with nonbiotinylated MAb 50.1 (mock) served as specificity controls (data not plotted; all, ≤5 foci/well).

    Techniques Used: Infection, Magnetic Beads, Incubation

    52) Product Images from "Probing the SELEX Process with Next-Generation Sequencing"

    Article Title: Probing the SELEX Process with Next-Generation Sequencing

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0029604

    SPR sensorgram of streptavidin-aptamer binding. Streptavidin was covalently immobilized on a CM5-chip. Aptamer clone R10#17 with highest affinity determined by FLAA was injected at a concentrations ranging between 0.1 and 2 µM in binding buffer.
    Figure Legend Snippet: SPR sensorgram of streptavidin-aptamer binding. Streptavidin was covalently immobilized on a CM5-chip. Aptamer clone R10#17 with highest affinity determined by FLAA was injected at a concentrations ranging between 0.1 and 2 µM in binding buffer.

    Techniques Used: SPR Assay, Binding Assay, Chromatin Immunoprecipitation, Injection

    Microtiter plate binding assay (FLAA) of selection pools to immobilized streptavidin. Depicted are rounds 1 to 10 with the original library pool indicated as round 0.
    Figure Legend Snippet: Microtiter plate binding assay (FLAA) of selection pools to immobilized streptavidin. Depicted are rounds 1 to 10 with the original library pool indicated as round 0.

    Techniques Used: Binding Assay, Selection

    Microtiter plate binding assay (FLAA) of single clones applied as synthetic oligonucleotides to immobilized streptavidin.
    Figure Legend Snippet: Microtiter plate binding assay (FLAA) of single clones applied as synthetic oligonucleotides to immobilized streptavidin.

    Techniques Used: Binding Assay, Clone Assay

    53) Product Images from "A genome-wide miRNA screen revealed miR-603 as a MGMT-regulating miRNA in glioblastomas"

    Article Title: A genome-wide miRNA screen revealed miR-603 as a MGMT-regulating miRNA in glioblastomas

    Journal: Oncotarget

    doi:

    miR-603 and miR-181d act cooperatively to silence MGMT (A) Schematic representation of the predicted miR-181d and miR-603 binding sites on MGMT 3'UTR. MRE prediction was performed by Targetscan 4.2. The miR-181d MREs were previously published [ 17 ]. The first three miR-603 MREs are as shown in Figure 3D . (B) miR-603 and miR-181d cooperate to suppress MGMT expression. A1207 cells were seeded at 5x105 cells per well. 24 hours after seeding, cells were transfected with miR-603 (25nM or 30 nM), miR-181d (5nM, 30nM) or a combination of miR-603(25nM) and miR-181d (5nM). Non-targeting miRNA (30nM) was transfected as a control. MGMT expression was assessed by Western blotting 72 hours after transfection. Quantitative assessment of MGMT expression is shown on the right panel. (C) Cooperative binding of miR-603 and miR-181d to MGMT mRNA. Biotinylated miR-603 (15nM or 20nM) or biotinylated miR-181d (5nM, 20nM) were transfected in A1207 cells. Biotinylated non-targeting miRNA (20nM) were transfected as a control. 48 hours after transfection, cells were lysed and treated with streptavidin coated magnetic beads. An increase in MGMT mRNA precipitation is seen with a combination of biotinylated miR-603 and biotinylated miR-181d. This effect is not observed with increasing concentrations of either miRNA by itself. (D) An index of miR-181d and miR-603 more closely mirrors MGMT expression in glioblastoma specimens than each individual miRNA. To avoid arbitrary cut offs, we examined MGMT expression in the specimens dichotomized by the median expression of miR-181d, miR-603, or a combined index of miR-181d and miR-603. Student's t-test was performed to assess whether MGMT expression differed significantly between the miR-high and miR-low groups. P-values of the comparison are as shown.
    Figure Legend Snippet: miR-603 and miR-181d act cooperatively to silence MGMT (A) Schematic representation of the predicted miR-181d and miR-603 binding sites on MGMT 3'UTR. MRE prediction was performed by Targetscan 4.2. The miR-181d MREs were previously published [ 17 ]. The first three miR-603 MREs are as shown in Figure 3D . (B) miR-603 and miR-181d cooperate to suppress MGMT expression. A1207 cells were seeded at 5x105 cells per well. 24 hours after seeding, cells were transfected with miR-603 (25nM or 30 nM), miR-181d (5nM, 30nM) or a combination of miR-603(25nM) and miR-181d (5nM). Non-targeting miRNA (30nM) was transfected as a control. MGMT expression was assessed by Western blotting 72 hours after transfection. Quantitative assessment of MGMT expression is shown on the right panel. (C) Cooperative binding of miR-603 and miR-181d to MGMT mRNA. Biotinylated miR-603 (15nM or 20nM) or biotinylated miR-181d (5nM, 20nM) were transfected in A1207 cells. Biotinylated non-targeting miRNA (20nM) were transfected as a control. 48 hours after transfection, cells were lysed and treated with streptavidin coated magnetic beads. An increase in MGMT mRNA precipitation is seen with a combination of biotinylated miR-603 and biotinylated miR-181d. This effect is not observed with increasing concentrations of either miRNA by itself. (D) An index of miR-181d and miR-603 more closely mirrors MGMT expression in glioblastoma specimens than each individual miRNA. To avoid arbitrary cut offs, we examined MGMT expression in the specimens dichotomized by the median expression of miR-181d, miR-603, or a combined index of miR-181d and miR-603. Student's t-test was performed to assess whether MGMT expression differed significantly between the miR-high and miR-low groups. P-values of the comparison are as shown.

    Techniques Used: Activated Clotting Time Assay, Binding Assay, Expressing, Transfection, Western Blot, Magnetic Beads

    miR-603 directly interacts with the 3'UTR of MGMT (A) MGMT mRNA co-precipitated with biotinylated miR-603. 48 hours after biotinylated miR-603 or biotinylated non-targeting miRNA (30nM) was transfected into A1207 cells, cells were lysed and treated with streptavidin coated magnetic beads. qRT-PCR was performed to determine the relative abundance of MGMT mRNA and GAPDH mRNA (control). There was a significant enrichment of MGMT mRNA in the biotinylated miR-603 pull-down relative to the non-targeting miRNA pull-down. (B) Predicted miR-603 binding sites (MREs) in 3'UTR of MGMT. MRE prediction was performed using Targetscan 4.2. (C) Co-transfection of a luciferase reporter vector with the full length MGMT 3'UTR and miR-603 mimics resulted in a significant loss of luciferase activity. A1207 cells were seeded at a 5x10 5 cells per well. 24 hours after seeding, cells were transfected with both miR-603 and the MGMT 3'UTR or non-targeting miRNA and the MGMT 3'UTR. The NOTCH 3'UTR was co-transfected with miR-34a as a positive control. Luciferase activity was assessed 48 hours after co-transfection. (D) Mutation of miR-603 MRE in the MGMT 3'UTR abolished the suppressive effect of miR-603. Truncated versions of the MGMT 3'UTR were constructed and tested as above described. Mutations of the first three MREs disrupted the luciferase suppressive effect of miR-603.
    Figure Legend Snippet: miR-603 directly interacts with the 3'UTR of MGMT (A) MGMT mRNA co-precipitated with biotinylated miR-603. 48 hours after biotinylated miR-603 or biotinylated non-targeting miRNA (30nM) was transfected into A1207 cells, cells were lysed and treated with streptavidin coated magnetic beads. qRT-PCR was performed to determine the relative abundance of MGMT mRNA and GAPDH mRNA (control). There was a significant enrichment of MGMT mRNA in the biotinylated miR-603 pull-down relative to the non-targeting miRNA pull-down. (B) Predicted miR-603 binding sites (MREs) in 3'UTR of MGMT. MRE prediction was performed using Targetscan 4.2. (C) Co-transfection of a luciferase reporter vector with the full length MGMT 3'UTR and miR-603 mimics resulted in a significant loss of luciferase activity. A1207 cells were seeded at a 5x10 5 cells per well. 24 hours after seeding, cells were transfected with both miR-603 and the MGMT 3'UTR or non-targeting miRNA and the MGMT 3'UTR. The NOTCH 3'UTR was co-transfected with miR-34a as a positive control. Luciferase activity was assessed 48 hours after co-transfection. (D) Mutation of miR-603 MRE in the MGMT 3'UTR abolished the suppressive effect of miR-603. Truncated versions of the MGMT 3'UTR were constructed and tested as above described. Mutations of the first three MREs disrupted the luciferase suppressive effect of miR-603.

    Techniques Used: Transfection, Magnetic Beads, Quantitative RT-PCR, Binding Assay, Cotransfection, Luciferase, Plasmid Preparation, Activity Assay, Positive Control, Mutagenesis, Construct

    54) Product Images from "Phosphorylation of the RNA Polymerase II Carboxyl-Terminal Domain by CDK9 Is Directly Responsible for Human Immunodeficiency Virus Type 1 Tat-Activated Transcriptional Elongation"

    Article Title: Phosphorylation of the RNA Polymerase II Carboxyl-Terminal Domain by CDK9 Is Directly Responsible for Human Immunodeficiency Virus Type 1 Tat-Activated Transcriptional Elongation

    Journal: Molecular and Cellular Biology

    doi: 10.1128/MCB.22.13.4622-4637.2002

    Strategy used for analyzing transcription elongation complexes. (A) Structure of HIV-LTR template. DNA templates containing the lac operator (lacO) binding site for the lac repressor protein (LacR) and a terminator (τ) sequence were biotinylated and bound to streptavidin beads. (B) Elongation complexes were trapped by the lac repressor (LacR) after incubation of the immobilized templates with HeLa nuclear extract (NE) in the presence of nucleotide triphosphates and LacR and in the absence or presence of Tat. The CTD of the RNA polymerase was phosphorylated during the elongation reaction due to the activity of CDK7 and CDK9. (C) Elongation complexes arrested by LacR were treated with PP1 to remove phosphate groups from the CTD. (D) The phosphatase-treated complexes can resume transcription elongation after the addition of nucleotides and IPTG. During the chase reaction the CTD became phosphorylated by CDK9. The addition of DRB blocked the rephosphorylation of the CTD and induced pausing of the transcription complex at the terminator sequences.
    Figure Legend Snippet: Strategy used for analyzing transcription elongation complexes. (A) Structure of HIV-LTR template. DNA templates containing the lac operator (lacO) binding site for the lac repressor protein (LacR) and a terminator (τ) sequence were biotinylated and bound to streptavidin beads. (B) Elongation complexes were trapped by the lac repressor (LacR) after incubation of the immobilized templates with HeLa nuclear extract (NE) in the presence of nucleotide triphosphates and LacR and in the absence or presence of Tat. The CTD of the RNA polymerase was phosphorylated during the elongation reaction due to the activity of CDK7 and CDK9. (C) Elongation complexes arrested by LacR were treated with PP1 to remove phosphate groups from the CTD. (D) The phosphatase-treated complexes can resume transcription elongation after the addition of nucleotides and IPTG. During the chase reaction the CTD became phosphorylated by CDK9. The addition of DRB blocked the rephosphorylation of the CTD and induced pausing of the transcription complex at the terminator sequences.

    Techniques Used: Binding Assay, Sequencing, Incubation, Activity Assay

    55) Product Images from "RanBP2/Nup358 Potentiates the Translation of a Subset of mRNAs Encoding Secretory Proteins"

    Article Title: RanBP2/Nup358 Potentiates the Translation of a Subset of mRNAs Encoding Secretory Proteins

    Journal: PLoS Biology

    doi: 10.1371/journal.pbio.1001545

    Identification of ALREX-element associating proteins from HeLa nuclear extract. (A–B) Various [ 32 P]-labeled RNA fragments, either 82 ( Ins SSCR, 7A-Ins SSCR, and the 5′ end of the βG ORF) or 86 ( MHC SSCR) nucleotides long, were incubated with or without HeLa nuclear extract (“NE”) and separated on a non-denaturing polyacrylamide gel and visualized by autoradiography. (C) [ 32 P]-labeled Ins SSCR RNA was mixed with increasing amounts of various unlabeled RNA fragments, then incubated with NE. The reactions were separated on a non-denaturing polyacrylamide gel and visualized by autoradiography. (D–F) Streptavidin-coated magnetic beads, bound with either various biotinylated RNAs (each 76 nucleotides long) or without any RNA (“No RNA”), were used to isolate proteins from HeLa nuclear extract. Proteins were eluted by first treating the beads with RNase A (D, lanes 1–4), followed by denaturation in SDS at 90°C for 5 min (D, lanes 5–8). (D) Silver stained gel of the eluted proteins. Bands identified by mass spectrometry are indicated on the right. (E–F) Eluted proteins and NE were analyzed by immunoblots using an antibody that recognizes, RanBP2, RanGAP1, Ran, or FG-repeat Nucleoporin proteins (mAb414).
    Figure Legend Snippet: Identification of ALREX-element associating proteins from HeLa nuclear extract. (A–B) Various [ 32 P]-labeled RNA fragments, either 82 ( Ins SSCR, 7A-Ins SSCR, and the 5′ end of the βG ORF) or 86 ( MHC SSCR) nucleotides long, were incubated with or without HeLa nuclear extract (“NE”) and separated on a non-denaturing polyacrylamide gel and visualized by autoradiography. (C) [ 32 P]-labeled Ins SSCR RNA was mixed with increasing amounts of various unlabeled RNA fragments, then incubated with NE. The reactions were separated on a non-denaturing polyacrylamide gel and visualized by autoradiography. (D–F) Streptavidin-coated magnetic beads, bound with either various biotinylated RNAs (each 76 nucleotides long) or without any RNA (“No RNA”), were used to isolate proteins from HeLa nuclear extract. Proteins were eluted by first treating the beads with RNase A (D, lanes 1–4), followed by denaturation in SDS at 90°C for 5 min (D, lanes 5–8). (D) Silver stained gel of the eluted proteins. Bands identified by mass spectrometry are indicated on the right. (E–F) Eluted proteins and NE were analyzed by immunoblots using an antibody that recognizes, RanBP2, RanGAP1, Ran, or FG-repeat Nucleoporin proteins (mAb414).

    Techniques Used: Labeling, Incubation, Autoradiography, Magnetic Beads, Staining, Mass Spectrometry, Western Blot

    56) Product Images from "Normal human chromosomes have long G-rich telomeric overhangs at one end"

    Article Title: Normal human chromosomes have long G-rich telomeric overhangs at one end

    Journal: Genes & Development

    doi:

    Purification of telomeres. ( A ) Sequence specificity of the purification of telomeres. Hin fI-digested human placental DNA was annealed to various biotinylated oligonucleotides, and telomere/oligonucleotide complexes were captured with streptavidin-coated magnetic beads. The DNA remaining in the supernatant vs. that bound to the beads was then analyzed on agarose gels and probed with a 32 P-labeled (TTAGGG) 4 oligonucleotide. CTR 4 and CTR 6 contain four and six copies of the C-rich terminal repeat (CCCTAA), GTR 6 contains six copies of the G-rich terminal repeat (TTAGGG), and ClaHin is a nontelomeric biotinylated oligonucleotide. Only the C-rich oligonucleotides complementary to the G-rich telomeric overhang were able to retrieve the double-stranded placental telomeres. ( B ) Purification requires single-stranded overhangs. Treatment of the DNA with the single-stranded exonuclease Exo 1 (1 U/μg) largely abolished the ability to retrieve telomeres. Noncanonical G structures (Henderson 1995; Kipling 1995) may make a small fraction of the overhangs resistant to complete digestion. ( C ) Purification requires ⩾12 bases of overhang. A 5-kbp artificial telomere containing single-stranded G-rich overhangs of variable lengths was annealed to a biotinylated C-rich oligonucleotide and purified using streptavidin-coated magnetic beads. The material bound to the magnetic beads or remaining in the supernatant is large and does not enter a denaturing polyacrylamide gel (uncut lanes). The radioactive telomeric repeats were released by digestion with an enzyme that cuts the plasmid just before the start of the telomeric repeats ( Cla I). Sequences containing as few as 12 nucleotides of G-rich overhangs can be recovered even if they are part of a 5-kbp-long artificial telomere.
    Figure Legend Snippet: Purification of telomeres. ( A ) Sequence specificity of the purification of telomeres. Hin fI-digested human placental DNA was annealed to various biotinylated oligonucleotides, and telomere/oligonucleotide complexes were captured with streptavidin-coated magnetic beads. The DNA remaining in the supernatant vs. that bound to the beads was then analyzed on agarose gels and probed with a 32 P-labeled (TTAGGG) 4 oligonucleotide. CTR 4 and CTR 6 contain four and six copies of the C-rich terminal repeat (CCCTAA), GTR 6 contains six copies of the G-rich terminal repeat (TTAGGG), and ClaHin is a nontelomeric biotinylated oligonucleotide. Only the C-rich oligonucleotides complementary to the G-rich telomeric overhang were able to retrieve the double-stranded placental telomeres. ( B ) Purification requires single-stranded overhangs. Treatment of the DNA with the single-stranded exonuclease Exo 1 (1 U/μg) largely abolished the ability to retrieve telomeres. Noncanonical G structures (Henderson 1995; Kipling 1995) may make a small fraction of the overhangs resistant to complete digestion. ( C ) Purification requires ⩾12 bases of overhang. A 5-kbp artificial telomere containing single-stranded G-rich overhangs of variable lengths was annealed to a biotinylated C-rich oligonucleotide and purified using streptavidin-coated magnetic beads. The material bound to the magnetic beads or remaining in the supernatant is large and does not enter a denaturing polyacrylamide gel (uncut lanes). The radioactive telomeric repeats were released by digestion with an enzyme that cuts the plasmid just before the start of the telomeric repeats ( Cla I). Sequences containing as few as 12 nucleotides of G-rich overhangs can be recovered even if they are part of a 5-kbp-long artificial telomere.

    Techniques Used: Purification, Sequencing, Magnetic Beads, Labeling, Plasmid Preparation

    57) Product Images from "An ATP/ADP-Dependent Molecular Switch Regulates the Stability of p53-DNA Complexes"

    Article Title: An ATP/ADP-Dependent Molecular Switch Regulates the Stability of p53-DNA Complexes

    Journal: Molecular and Cellular Biology

    doi:

    Scheme of the DNA binding and release assay. (A) Streptavidin-coated magnetic beads were used to bind biotinylated oligonucleotide targets. After washing, the DNA-bound beads were incubated with p53. Bound p53-DNA complexes on the beads were washed (to remove nonbound p53) and incubated in fresh buffer, with or without nucleotides, for 10 min at 37°C (or longer for time course experiments). Subsequently the released p53 (in solution) and DNA-bound p53 were analyzed by scintillation counting (for radiolabelled p53) and PAGE (15% polyacrylamide) followed by immunoblotting or autoradiography. (B) Binding of 35 S-labelled p53 to magnetic beads coated with different oligonucleotides (detailed in Materials and Methods). An aliquot of beads without DNA was included as negative control (beads lane). Other lanes: CON-DNA, beads prebound with a consensus sequence-specific p53 DNA binding site; L-DNA, dsDNA containing triple insertion-deletion lesion; NL-DNA, dsDNA with blunt ends (the bottom strand of NL-DNA alone was used as ssDNA target) (see Materials and Methods). RNA was obtained by in vitro transcription from p53 cDNA under the T7 promoter by using biotinylated UTP. The faster-migrating band (below p53) represents a truncated p53 product that is routinely observed for in vitro-translated p53. wt, wild type.
    Figure Legend Snippet: Scheme of the DNA binding and release assay. (A) Streptavidin-coated magnetic beads were used to bind biotinylated oligonucleotide targets. After washing, the DNA-bound beads were incubated with p53. Bound p53-DNA complexes on the beads were washed (to remove nonbound p53) and incubated in fresh buffer, with or without nucleotides, for 10 min at 37°C (or longer for time course experiments). Subsequently the released p53 (in solution) and DNA-bound p53 were analyzed by scintillation counting (for radiolabelled p53) and PAGE (15% polyacrylamide) followed by immunoblotting or autoradiography. (B) Binding of 35 S-labelled p53 to magnetic beads coated with different oligonucleotides (detailed in Materials and Methods). An aliquot of beads without DNA was included as negative control (beads lane). Other lanes: CON-DNA, beads prebound with a consensus sequence-specific p53 DNA binding site; L-DNA, dsDNA containing triple insertion-deletion lesion; NL-DNA, dsDNA with blunt ends (the bottom strand of NL-DNA alone was used as ssDNA target) (see Materials and Methods). RNA was obtained by in vitro transcription from p53 cDNA under the T7 promoter by using biotinylated UTP. The faster-migrating band (below p53) represents a truncated p53 product that is routinely observed for in vitro-translated p53. wt, wild type.

    Techniques Used: Binding Assay, Release Assay, Magnetic Beads, Incubation, Polyacrylamide Gel Electrophoresis, Autoradiography, Negative Control, Sequencing, In Vitro

    58) Product Images from "Phage Display of the Serpin Alpha-1 Proteinase Inhibitor Randomized at Consecutive Residues in the Reactive Centre Loop and Biopanned with or without Thrombin"

    Article Title: Phage Display of the Serpin Alpha-1 Proteinase Inhibitor Randomized at Consecutive Residues in the Reactive Centre Loop and Biopanned with or without Thrombin

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0084491

    Reactivity of T7 10B-API M358R fusion proteins displayed on intact phage with thrombin and time course of enrichment of API M358R-expressing phage by exposure to thrombin. Panel A: 1×10 10 pfu of purified T7Select10-3b API M358R (API M358R phages) and T7Select10-3b S-tag phages (Control phage) were separately reacted with (+) or without (−) 20 nM thrombin. Reactions were solubilized with SDS, electrophoresed on SDS-polyacrylamide gels under reducing conditions, immunoblotted, and probed with an affinity-purified sheep anti-thrombin antibody. Molecular weight marker positions, in kDa, are indicated to the left of the figure. The left panel represents four contiguous lanes of a single immunoblot. The right panel shows the reaction of 20 nM thrombin with 8.5 nM purified, soluble API M358R or saline controls; both lanes were derived from the same immunoblot but were not contiguous on the original image. Panel B: T7Select10-3b API M358R phages and T7Select10-3b S-tag phages were combined 1:100 and reacted with 0.5 nM thrombin for times shown on the x axis, prior to biopanning with biotinylated anti-thrombin IgG and streptavidin-linked magnetic beads. Washed beads were used to infect E. coli and aliquots of the resulting lysates used to form plaques on agarose/agar plates. Nitrocellulose plaque lifts were probed with anti-API antibodies to determine the percentage of immunoreactive plaques as a fraction of the total, shown on the y axis. “No IIa” (open bar) refers to a sample from the original mixture of phages subjected to plaque assay directly, without biopanning.
    Figure Legend Snippet: Reactivity of T7 10B-API M358R fusion proteins displayed on intact phage with thrombin and time course of enrichment of API M358R-expressing phage by exposure to thrombin. Panel A: 1×10 10 pfu of purified T7Select10-3b API M358R (API M358R phages) and T7Select10-3b S-tag phages (Control phage) were separately reacted with (+) or without (−) 20 nM thrombin. Reactions were solubilized with SDS, electrophoresed on SDS-polyacrylamide gels under reducing conditions, immunoblotted, and probed with an affinity-purified sheep anti-thrombin antibody. Molecular weight marker positions, in kDa, are indicated to the left of the figure. The left panel represents four contiguous lanes of a single immunoblot. The right panel shows the reaction of 20 nM thrombin with 8.5 nM purified, soluble API M358R or saline controls; both lanes were derived from the same immunoblot but were not contiguous on the original image. Panel B: T7Select10-3b API M358R phages and T7Select10-3b S-tag phages were combined 1:100 and reacted with 0.5 nM thrombin for times shown on the x axis, prior to biopanning with biotinylated anti-thrombin IgG and streptavidin-linked magnetic beads. Washed beads were used to infect E. coli and aliquots of the resulting lysates used to form plaques on agarose/agar plates. Nitrocellulose plaque lifts were probed with anti-API antibodies to determine the percentage of immunoreactive plaques as a fraction of the total, shown on the y axis. “No IIa” (open bar) refers to a sample from the original mixture of phages subjected to plaque assay directly, without biopanning.

    Techniques Used: Expressing, Purification, Affinity Purification, Molecular Weight, Marker, Derivative Assay, Magnetic Beads, Plaque Assay

    Schematic diagrams of construction of phage display library and biopanning strategy. Panel A shows the cloning strategy employed to create T7Select10-3b phage constructs displaying API M358R or libraries displaying API with randomized RCL codons. 1) The API M358R cDNA was mobilized from pBAD-H 6 API M358R [29] by PCR that appropriately positioned EcoRI (green) and HindIII cohesive ends, and ensured that it was in-frame for subsequent insertion into the T7 Select 10-3b vector, in plasmid pUC19-API M358R. 2) Degeneracy was introduced at either P2–P1 or P7–P3 codons using a sense primer overlapping the unique PmlI site or a degenerate antisense (NNN primer) overlapping the unique SauI site. PCR products were inserted into phosphatase-treated PmlI- and SauI-restricted pUC19-API M358R and the resulting plasmid library biologically amplified in E. coli TOP10. 3) EcoRI-and HindIII-restricted total digestion products of the P2–P1 or P7–P3 plasmid libraries, respectively, were then ligated to T7Select10-3b vector arms. 4) The recombinant T7Select10-3b library, containing either the API P2–P1 randomized or the API M358R P7–P3 randomized inserts, was then packaged into phages to create the respective phage display libraries. Pink, light blue, yellow, and purple API-encoding inserts (between steps 2 and 3) indicate the encoding of different variants, and the correspondingly coloured phages (step 4) represent their displayed products. Panel B shows the biopanning procedure. 1) A phage lysate produced by infection of E. coli BLT5615 with a T7Select10-3b API library was reacted with thrombin in solution (green squares), which bound to some displayed sequences (e.g. blue but not yellow or pink). 2) A biotinylated antibody specific to thrombin (Y-shaped symbols) was added to the thrombin-phages mixture, reacting with thrombin bound to phages via API-thrombin serpin-enzyme complexes. 3) Streptavidin-coated magnetic beads (yellow S shown on red circular symbols) were added to the mixture, reacting preferentially with antibody-thrombin-phage complexes. 4) Magnetic bead-streptavidin-thrombin-phage complexes were concentrated using a magnet. 5) After washing, bead assemblies were used to directly infect a fresh culture of E. coli BLT5615 to start the next round of biopanning.
    Figure Legend Snippet: Schematic diagrams of construction of phage display library and biopanning strategy. Panel A shows the cloning strategy employed to create T7Select10-3b phage constructs displaying API M358R or libraries displaying API with randomized RCL codons. 1) The API M358R cDNA was mobilized from pBAD-H 6 API M358R [29] by PCR that appropriately positioned EcoRI (green) and HindIII cohesive ends, and ensured that it was in-frame for subsequent insertion into the T7 Select 10-3b vector, in plasmid pUC19-API M358R. 2) Degeneracy was introduced at either P2–P1 or P7–P3 codons using a sense primer overlapping the unique PmlI site or a degenerate antisense (NNN primer) overlapping the unique SauI site. PCR products were inserted into phosphatase-treated PmlI- and SauI-restricted pUC19-API M358R and the resulting plasmid library biologically amplified in E. coli TOP10. 3) EcoRI-and HindIII-restricted total digestion products of the P2–P1 or P7–P3 plasmid libraries, respectively, were then ligated to T7Select10-3b vector arms. 4) The recombinant T7Select10-3b library, containing either the API P2–P1 randomized or the API M358R P7–P3 randomized inserts, was then packaged into phages to create the respective phage display libraries. Pink, light blue, yellow, and purple API-encoding inserts (between steps 2 and 3) indicate the encoding of different variants, and the correspondingly coloured phages (step 4) represent their displayed products. Panel B shows the biopanning procedure. 1) A phage lysate produced by infection of E. coli BLT5615 with a T7Select10-3b API library was reacted with thrombin in solution (green squares), which bound to some displayed sequences (e.g. blue but not yellow or pink). 2) A biotinylated antibody specific to thrombin (Y-shaped symbols) was added to the thrombin-phages mixture, reacting with thrombin bound to phages via API-thrombin serpin-enzyme complexes. 3) Streptavidin-coated magnetic beads (yellow S shown on red circular symbols) were added to the mixture, reacting preferentially with antibody-thrombin-phage complexes. 4) Magnetic bead-streptavidin-thrombin-phage complexes were concentrated using a magnet. 5) After washing, bead assemblies were used to directly infect a fresh culture of E. coli BLT5615 to start the next round of biopanning.

    Techniques Used: Clone Assay, Construct, Polymerase Chain Reaction, Plasmid Preparation, Amplification, Recombinant, Produced, Infection, Magnetic Beads

    59) Product Images from "Development of a dual aptamer-based multiplex protein biosensor"

    Article Title: Development of a dual aptamer-based multiplex protein biosensor

    Journal: Biosensors & bioelectronics

    doi: 10.1016/j.bios.2010.04.034

    Dual-aptamer detection schematic Thrombin and PDGF-BB are represented by triangles and double-ellipses, respectively. The sensing aptamers (MB-T, MB-P) containing thrombin aptamer (Apt 1A) and PDGF-BB aptamer (Apt 2A) are each labeled with an MB tag (MB1 and MB2) and flanked by a pair of universal primers (5′p and 3′p). Capture aptamers (Bio-T and Bio-P) containing thrombin aptamer (Apt 1B) and PDGF-BB aptamer (Apt 2B) are biotinylated to be attached to streptavidin-coated magnetic beads. Oligo(dT)s are used as the spacer between the aptamer sequences and the beads. After separation, eluted sensing aptamers are amplified by multiplex PCR and quantified.
    Figure Legend Snippet: Dual-aptamer detection schematic Thrombin and PDGF-BB are represented by triangles and double-ellipses, respectively. The sensing aptamers (MB-T, MB-P) containing thrombin aptamer (Apt 1A) and PDGF-BB aptamer (Apt 2A) are each labeled with an MB tag (MB1 and MB2) and flanked by a pair of universal primers (5′p and 3′p). Capture aptamers (Bio-T and Bio-P) containing thrombin aptamer (Apt 1B) and PDGF-BB aptamer (Apt 2B) are biotinylated to be attached to streptavidin-coated magnetic beads. Oligo(dT)s are used as the spacer between the aptamer sequences and the beads. After separation, eluted sensing aptamers are amplified by multiplex PCR and quantified.

    Techniques Used: Labeling, Magnetic Beads, Amplification, Multiplex Assay, Polymerase Chain Reaction

    60) Product Images from "Tat Modifies the Activity of CDK9 To Phosphorylate Serine 5 of the RNA Polymerase II Carboxyl-Terminal Domain during Human Immunodeficiency Virus Type 1 Transcription"

    Article Title: Tat Modifies the Activity of CDK9 To Phosphorylate Serine 5 of the RNA Polymerase II Carboxyl-Terminal Domain during Human Immunodeficiency Virus Type 1 Transcription

    Journal: Molecular and Cellular Biology

    doi:

    Phosphorylation of RNAP II CTD in HIV-1 PICs. Biotinylated HIV-1 LTR templates were incubated with mock-depleted, CDK7-depleted, CDK9-depleted, or CDK7- and CDK9-depleted extracts in the absence (lanes 1 to 4) or presence (lanes 5 to 8) of Tat, and PICs were then purified with streptavidin-coated magnetic beads. Kinase reactions were performed with the purified PICs, and phosphorylated RNAP II was labeled with [γ- 32 P]ATP and immunoprecipitated (IP) with anti-CTD monoclonal antibody 8WG16.
    Figure Legend Snippet: Phosphorylation of RNAP II CTD in HIV-1 PICs. Biotinylated HIV-1 LTR templates were incubated with mock-depleted, CDK7-depleted, CDK9-depleted, or CDK7- and CDK9-depleted extracts in the absence (lanes 1 to 4) or presence (lanes 5 to 8) of Tat, and PICs were then purified with streptavidin-coated magnetic beads. Kinase reactions were performed with the purified PICs, and phosphorylated RNAP II was labeled with [γ- 32 P]ATP and immunoprecipitated (IP) with anti-CTD monoclonal antibody 8WG16.

    Techniques Used: Incubation, Purification, Magnetic Beads, Labeling, Immunoprecipitation

    CTD phosphorylation by Tat-modified CDK9 is sensitive to DRB. Biotinylated HIV-1 LTR templates were incubated with CDK7-depleted extract in the presence of Tat, and PICs were then purified with streptavidin-coated magnetic beads. The inhibition assays were performed by incubating the purified PICs with ATP in the presence of different concentrations of DRB. Western blot analyses of the complexes were done with anti-CTD monoclonal antibody H5 or H14, and the activities were determined by direct quantitation using the Molecular Dynamics ImageQuant. The top curve (♦) indicates the inhibition of serine 2 phosphorylation, while the bottom curve (▪) indicates the inhibition of serine 5 phosphorylation.
    Figure Legend Snippet: CTD phosphorylation by Tat-modified CDK9 is sensitive to DRB. Biotinylated HIV-1 LTR templates were incubated with CDK7-depleted extract in the presence of Tat, and PICs were then purified with streptavidin-coated magnetic beads. The inhibition assays were performed by incubating the purified PICs with ATP in the presence of different concentrations of DRB. Western blot analyses of the complexes were done with anti-CTD monoclonal antibody H5 or H14, and the activities were determined by direct quantitation using the Molecular Dynamics ImageQuant. The top curve (♦) indicates the inhibition of serine 2 phosphorylation, while the bottom curve (▪) indicates the inhibition of serine 5 phosphorylation.

    Techniques Used: Modification, Incubation, Purification, Magnetic Beads, Inhibition, Western Blot, Quantitation Assay

    CDK7 and CDK9, but not CDK8, are components of the HIV-1 PIC. Association reactions (30 μl) were performed with 15 μl of HeLa nuclear extract, 1.0 μg of biotinylated HIV-1 LTR templates, and 1.0 μg of poly(dI-dC) in the absence (lanes 1 and 2) or presence (lanes 3 and 4) of Tat. PICs were purified with streptavidin-coated magnetic beads. Western blot analysis of the purified HIV-1 PICs was then done with anti-CDK9, anti-CDK7, anti-cyclin H, anti-Mat1, anti-p62, anti-CDK8, and anti-Tat antibodies. An HIV-1 LTR TATA box mutant (Mut) was used as a parallel control (lanes 2 and 4). WT, wild type.
    Figure Legend Snippet: CDK7 and CDK9, but not CDK8, are components of the HIV-1 PIC. Association reactions (30 μl) were performed with 15 μl of HeLa nuclear extract, 1.0 μg of biotinylated HIV-1 LTR templates, and 1.0 μg of poly(dI-dC) in the absence (lanes 1 and 2) or presence (lanes 3 and 4) of Tat. PICs were purified with streptavidin-coated magnetic beads. Western blot analysis of the purified HIV-1 PICs was then done with anti-CDK9, anti-CDK7, anti-cyclin H, anti-Mat1, anti-p62, anti-CDK8, and anti-Tat antibodies. An HIV-1 LTR TATA box mutant (Mut) was used as a parallel control (lanes 2 and 4). WT, wild type.

    Techniques Used: Purification, Magnetic Beads, Western Blot, Mutagenesis

    The effects of the CTD kinase activities of CDK7 and CDK9 on HIV-1 transcription. (A) Western blot analysis of mock-depleted, CDK7-depleted, CDK9-depleted, or CDK7- and CDK9-depleted extracts with anti-CDK7, anti-CDK9, anti-CDK8, anti-TBP, or anti-CTD of RNAP II antibody. Panels 3, 4, and 5 demonstrate that depletions did not change the level of CDK8, other general transcription factors, or RNAP II. (B) The effects of the CTD kinase activities of CDK7 and CDK9 on HIV-1 transcription. Biotinylated HIV-1 LTR templates were incubated with mock-depleted, CDK8-depleted, CDK7-depleted, CDK9-depleted, and CDK7- and CDK9-depleted extracts in the absence (lanes 1 to 5) or presence (lanes 6 to 10) of Tat, and PICs were then purified with streptavidin-coated magnetic beads. In vitro transcription was done with the purified PICs, and transcripts were labeled with [α- 32 P]UTP and fractionated on 6% denaturing polyacrylamide gel containing 7 M urea in 1× TBE buffer (top). The Western blot analysis of kinase-depleted extracts was done with anti-CDK8 antibody (bottom).
    Figure Legend Snippet: The effects of the CTD kinase activities of CDK7 and CDK9 on HIV-1 transcription. (A) Western blot analysis of mock-depleted, CDK7-depleted, CDK9-depleted, or CDK7- and CDK9-depleted extracts with anti-CDK7, anti-CDK9, anti-CDK8, anti-TBP, or anti-CTD of RNAP II antibody. Panels 3, 4, and 5 demonstrate that depletions did not change the level of CDK8, other general transcription factors, or RNAP II. (B) The effects of the CTD kinase activities of CDK7 and CDK9 on HIV-1 transcription. Biotinylated HIV-1 LTR templates were incubated with mock-depleted, CDK8-depleted, CDK7-depleted, CDK9-depleted, and CDK7- and CDK9-depleted extracts in the absence (lanes 1 to 5) or presence (lanes 6 to 10) of Tat, and PICs were then purified with streptavidin-coated magnetic beads. In vitro transcription was done with the purified PICs, and transcripts were labeled with [α- 32 P]UTP and fractionated on 6% denaturing polyacrylamide gel containing 7 M urea in 1× TBE buffer (top). The Western blot analysis of kinase-depleted extracts was done with anti-CDK8 antibody (bottom).

    Techniques Used: Western Blot, Incubation, Purification, Magnetic Beads, In Vitro, Labeling

    The recruitment of the Tat–P-TEFb complex by TAR binding during elongation. Biotinylated wild-type (WT) or TAR mutant (TM26) HIV-1 LTR templates were incubated with CDK9-depleted extract, and PICs were purified with streptavidin-coated magnetic beads. The transcription complexes were walked stepwise along the templates to +79 (as described in Materials and Methods). The runoff transcription was then performed by incubating the TECs stalled at +79 with ATP, CTP, GTP, and [α- 32 P]UTP. P-TEFb and Tat were added at different sites, as indicated.
    Figure Legend Snippet: The recruitment of the Tat–P-TEFb complex by TAR binding during elongation. Biotinylated wild-type (WT) or TAR mutant (TM26) HIV-1 LTR templates were incubated with CDK9-depleted extract, and PICs were purified with streptavidin-coated magnetic beads. The transcription complexes were walked stepwise along the templates to +79 (as described in Materials and Methods). The runoff transcription was then performed by incubating the TECs stalled at +79 with ATP, CTP, GTP, and [α- 32 P]UTP. P-TEFb and Tat were added at different sites, as indicated.

    Techniques Used: Binding Assay, Mutagenesis, Incubation, Purification, Magnetic Beads

    CDK9 and CDK7 phosphorylated serine 2 and serine 5, respectively, of the RNAP II CTD in HIV-1 PICs. Biotinylated HIV-1 LTR templates were incubated with mock-depleted, CDK7-depleted, CDK9-depleted, or CDK7- and CDK9-depleted extracts in the absence (lanes 1 to 4) or presence (lanes 5 to 8) of Tat. PICs were then purified with streptavidin-coated magnetic beads. The PICs were then incubated with 50 μM ATP for 10 min in order to have RNAP II CTD phosphorylated and washed extensively. Western blot analysis of the PICs was done with anti-CTD monoclonal antibodies 8WG16, H5, or H14.
    Figure Legend Snippet: CDK9 and CDK7 phosphorylated serine 2 and serine 5, respectively, of the RNAP II CTD in HIV-1 PICs. Biotinylated HIV-1 LTR templates were incubated with mock-depleted, CDK7-depleted, CDK9-depleted, or CDK7- and CDK9-depleted extracts in the absence (lanes 1 to 4) or presence (lanes 5 to 8) of Tat. PICs were then purified with streptavidin-coated magnetic beads. The PICs were then incubated with 50 μM ATP for 10 min in order to have RNAP II CTD phosphorylated and washed extensively. Western blot analysis of the PICs was done with anti-CTD monoclonal antibodies 8WG16, H5, or H14.

    Techniques Used: Incubation, Purification, Magnetic Beads, Western Blot

    61) Product Images from "Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase"

    Article Title: Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase

    Journal: Nucleic Acids Research

    doi:

    Streptavidin processivity assay. An immobilized single-stranded DNA molecule of 2000 nt in length was incubated in a reaction containing a primer hybridized to the 5′ end, and polymerase. Extension was initiated by the addition of dNTPs including [α- 32 P]dGTP, Mg 2+ and 0.8 mg/ml activated calf thymus DNA as described in Materials and Methods. Cleavage with restriction enzymes located 18, 96, 492, 1122 and 1898 nt, respectively, from the primer terminus only occurs if primer extension results in a double-stranded DNA substrate. Full extension with 5 U Promega Taq DNA polymerase in the absence of trap DNA allowed the percentage of primers extended to be determined.
    Figure Legend Snippet: Streptavidin processivity assay. An immobilized single-stranded DNA molecule of 2000 nt in length was incubated in a reaction containing a primer hybridized to the 5′ end, and polymerase. Extension was initiated by the addition of dNTPs including [α- 32 P]dGTP, Mg 2+ and 0.8 mg/ml activated calf thymus DNA as described in Materials and Methods. Cleavage with restriction enzymes located 18, 96, 492, 1122 and 1898 nt, respectively, from the primer terminus only occurs if primer extension results in a double-stranded DNA substrate. Full extension with 5 U Promega Taq DNA polymerase in the absence of trap DNA allowed the percentage of primers extended to be determined.

    Techniques Used: Incubation

    62) Product Images from "Coordination of Transcription Factor Phosphorylation and Histone Methylation by the P-TEFb Kinase during Human Immunodeficiency Virus Type 1 Transcription"

    Article Title: Coordination of Transcription Factor Phosphorylation and Histone Methylation by the P-TEFb Kinase during Human Immunodeficiency Virus Type 1 Transcription

    Journal: Journal of Virology

    doi: 10.1128/JVI.78.24.13522-13533.2004

    The Tat/TAR-dependent kinase activity of P-TEFb to phosphorylate RNAP II CTD, SPT5, and Tat-SF1 during HIV-1 transcription elongation is highly sensitive to flavopiridol. (A) The experimental outline was shown to detect phosphorylation of proteins associated with HIV-1 TECs. PICs assembled on biotinylated HIV-1 LTR templates were purified with streptavidin-coated magnetic beads. Purified PICs were walked to position U14 by incubation with 50 μM dATP, CTP, GTP, and UTP at 30°C for 10 min and washed with transcription buffer. TECs stalled at U14 were incubated with RNAP II-depleted nuclear extract (NE), and unbound proteins were removed by washing with transcription buffer. The TECs stalled at U14 were then walked stepwise to G36 along templates by repeated incubation with different sets of three NTPs and washed with transcription buffer to remove unincorporated NTPs. TECs stalled at G36 were elongated stepwise to A79 with [γ- 32 P]ATP and NTPs, and 32 P-labeled proteins were analyzed by electrophoresis on SDS-4 to 20% polyacrylamide gels followed by autoradiography. (B) Tat/TAR-dependent phosphorylation of proteins associated with HIV-1 TECs during transcription elongation. TECs stalled at G36 were elongated stepwise to A79 with [γ- 32 P]ATP and NTPs, and 32 P-labeled proteins were analyzed by electrophoresis on SDS-4 to 20% polyacrylamide gels followed by autoradiography. The wild-type (WT) HIV-1 LTR template was compared with the TAR-mutated (TM26) HIV-1 LTR template. M indicates the protein molecular weight marker. (C) Tat/TAR-dependent phosphorylation of the RNAP II CTD, SPT5, and Tat-SF1 by P-TEFb during HIV-1 transcription elongation. 32 P-labeled proteins were immunoprecipitated with specific antibodies as indicated in the figure and analyzed by electrophoresis on SDS-4 to 20% polyacrylamide gels followed by autoradiography. (D) Tat/TAR-dependent phosphorylation of the RNAP II CTD, SPT5, and Tat-SF1 by P-TEFb correlated with HIV-1 transcription elongation. Nascent transcripts were labeled with [α- 32 P]UTP and analyzed by electrophoresis through 10% polyacrylamide gels containing 7 M urea in Tris-borate-EDTA buffer followed by autoradiography. (E) Tat/TAR-dependent phosphorylation of the RNAP II CTD, SPT5, and Tat-SF1 by P-TEFb during HIV-1 transcription elongation was inhibited by flavopiridol. To determine flavopiridol sensitivity of the Tat/TAR-dependent kinase activity of P-TEFb during HIV-1 transcription elongation, TECs stalled at G36 were elongated stepwise to A79 in the absence or presence of flavopiridol. 32 P-labeled RNAP II, SPT5, and Tat-SF1 were then immunoprecipitated with specific antibodies and analyzed by electrophoresis on SDS-4 to 20% polyacrylamide gels followed by autoradiography (inset), and three independent experiments performed under similar conditions for each assay were quantitated. The hypophosphorylated (IIa) and hyperphosphorylated (IIo) forms of RNAP II are indicated. (F) Western blot analysis of protein composition of TECs stalled at A79. TECs stalled at G36 were elongated stepwise to A79 in the absence or presence of flavopiridol. Protein composition of TECs stalled at A79 was analyzed with α-RNAP II, α-SPT5, or α-Tat-SF1 antibody.
    Figure Legend Snippet: The Tat/TAR-dependent kinase activity of P-TEFb to phosphorylate RNAP II CTD, SPT5, and Tat-SF1 during HIV-1 transcription elongation is highly sensitive to flavopiridol. (A) The experimental outline was shown to detect phosphorylation of proteins associated with HIV-1 TECs. PICs assembled on biotinylated HIV-1 LTR templates were purified with streptavidin-coated magnetic beads. Purified PICs were walked to position U14 by incubation with 50 μM dATP, CTP, GTP, and UTP at 30°C for 10 min and washed with transcription buffer. TECs stalled at U14 were incubated with RNAP II-depleted nuclear extract (NE), and unbound proteins were removed by washing with transcription buffer. The TECs stalled at U14 were then walked stepwise to G36 along templates by repeated incubation with different sets of three NTPs and washed with transcription buffer to remove unincorporated NTPs. TECs stalled at G36 were elongated stepwise to A79 with [γ- 32 P]ATP and NTPs, and 32 P-labeled proteins were analyzed by electrophoresis on SDS-4 to 20% polyacrylamide gels followed by autoradiography. (B) Tat/TAR-dependent phosphorylation of proteins associated with HIV-1 TECs during transcription elongation. TECs stalled at G36 were elongated stepwise to A79 with [γ- 32 P]ATP and NTPs, and 32 P-labeled proteins were analyzed by electrophoresis on SDS-4 to 20% polyacrylamide gels followed by autoradiography. The wild-type (WT) HIV-1 LTR template was compared with the TAR-mutated (TM26) HIV-1 LTR template. M indicates the protein molecular weight marker. (C) Tat/TAR-dependent phosphorylation of the RNAP II CTD, SPT5, and Tat-SF1 by P-TEFb during HIV-1 transcription elongation. 32 P-labeled proteins were immunoprecipitated with specific antibodies as indicated in the figure and analyzed by electrophoresis on SDS-4 to 20% polyacrylamide gels followed by autoradiography. (D) Tat/TAR-dependent phosphorylation of the RNAP II CTD, SPT5, and Tat-SF1 by P-TEFb correlated with HIV-1 transcription elongation. Nascent transcripts were labeled with [α- 32 P]UTP and analyzed by electrophoresis through 10% polyacrylamide gels containing 7 M urea in Tris-borate-EDTA buffer followed by autoradiography. (E) Tat/TAR-dependent phosphorylation of the RNAP II CTD, SPT5, and Tat-SF1 by P-TEFb during HIV-1 transcription elongation was inhibited by flavopiridol. To determine flavopiridol sensitivity of the Tat/TAR-dependent kinase activity of P-TEFb during HIV-1 transcription elongation, TECs stalled at G36 were elongated stepwise to A79 in the absence or presence of flavopiridol. 32 P-labeled RNAP II, SPT5, and Tat-SF1 were then immunoprecipitated with specific antibodies and analyzed by electrophoresis on SDS-4 to 20% polyacrylamide gels followed by autoradiography (inset), and three independent experiments performed under similar conditions for each assay were quantitated. The hypophosphorylated (IIa) and hyperphosphorylated (IIo) forms of RNAP II are indicated. (F) Western blot analysis of protein composition of TECs stalled at A79. TECs stalled at G36 were elongated stepwise to A79 in the absence or presence of flavopiridol. Protein composition of TECs stalled at A79 was analyzed with α-RNAP II, α-SPT5, or α-Tat-SF1 antibody.

    Techniques Used: Activity Assay, Purification, Magnetic Beads, Incubation, Labeling, Electrophoresis, Autoradiography, Molecular Weight, Marker, Immunoprecipitation, Western Blot

    63) Product Images from "MicroRNA 665 Regulates Dentinogenesis through MicroRNA-Mediated Silencing and Epigenetic Mechanisms"

    Article Title: MicroRNA 665 Regulates Dentinogenesis through MicroRNA-Mediated Silencing and Epigenetic Mechanisms

    Journal: Molecular and Cellular Biology

    doi: 10.1128/MCB.00093-15

    Identification of a functional miR-665 site in the Dlx3 mRNA 3′ UTR. (A) Putative binding sites for miR-9, miR-320, miR-421, and miR-665 (within 1.5 kb distal to the stop codon) conserved across mammalian species identified in Dlx3 ). Nucleotide positions for miR-665 are shown in parentheses. (B) Relative expression levels of miR-9, miR-320, miR-421, and miR-665 obtained by real-time RT-qPCR using total RNA isolated from mouse odontoblasts (M06-G3) induced to differentiate for 21 days. U6 RNA was used as a loading control. (C) Schematic representation of the Dlx3 3′ UTR-Luc reporter vector created by cloning the Dlx3 3′ UTR (1.5 kb) into the pMIR-REPORT Luc reporter vector (top). Relative Luc activity was determined in lysates from M06-G3 cells transfected with Dlx3 3′ UTR-Luc, nonspecific (NS) miRNAs, and individual Dlx3 -targeting miRNAs (bottom). Luc activity was normalized with Renilla Luc activity and expressed in relative luminescence units. (D) Representative Western blot analysis with anti-Luc antibody of lysates from M06-G3 cells transfected with Dlx3 3′ UTR-Luc and individual Dlx3 -targeting miRNAs. (E) Alignment of miR-665 binding to the murine Dlx3 3′ UTR. Lowercase nucleotides indicate the mutations introduced in the seed sequence of the miR-665 binding site within Dlx3 . (F) Relative Luc activity in HEK-293T cells transfected with wild-type (WT) or mutated (MT) Dlx3 3′ UTR constructs along with nonspecific miRNA control (NS), miR-665, or anti-miR-665. Relative Luc activity was normalized with Renilla Luc activity and expressed in relative luminescence units. (G) Representative Western blot showing DLX3 protein expression in MDPC-23 dental pulp cells stably infected with control, miR-665-expressing, or anti-miR-665-expressing lentiviral particles. Tubulin was used as a loading control. (H) Quantitative analysis of the relative Dlx3 mRNA expression levels, normalized to Gapdh , in MDPC-23 dental pulp cells stably infected with control, miR-665-expressing, or anti-miR-665-expressing lentiviral vectors, detected by qPCR after 96 h. *, P ≤ 0.05; **, P ≤ 0.01. (I) Representative RNP-IP assay in MDPC-23 cell lysates incubated with IgG (control) or anti-AGO2 antibody. Data are presented as the amount of miR-665 bound to the Dlx3 3′ UTR fragment (gray bar) relative to the total Dlx3 3′ UTR cDNA input (black bar). Normal IgG was used as a negative control. The RISC was immunoprecipitated with anti-AGO2 antibody, and associated mRNA was reverse transcribed to cDNA, using the miR-665 seed sequence as a primer, and amplified by real-time RT-qPCR with primers specific to miR-665 binding sites in the Dlx3 3′ UTR. (J) Quantitative analysis of miR-665 binding to the Dlx3 3′ UTR associated with the RISC determined by RNA sequencing of AGO2-immunoprecipitated RNA from MDPC-23 dental pulp cells transduced with control, miR-665-overexpressing, and anti-miR-665-expressing lentiviral vectors. Significant changes in transcript expression ( P values of 0.01 to 0.001) were analyzed using Cuffdiff bioinformatics. (K) Streptavidin pulldown to detect Dlx3 mRNA binding to miR-665 in MDPC-23 odontoblast cells transfected with Bi-NS-miR or Bi-miR-665 mimics. The binding of Dlx3 mRNA was analyzed by qRT-PCR and normalized to Gapdh expression. CDS, coding DNA sequence; Ch, chromosome; LUC, luciferase; CON, control; UTR, untranslated region; EV, empty vector; Bi, biotinylated.
    Figure Legend Snippet: Identification of a functional miR-665 site in the Dlx3 mRNA 3′ UTR. (A) Putative binding sites for miR-9, miR-320, miR-421, and miR-665 (within 1.5 kb distal to the stop codon) conserved across mammalian species identified in Dlx3 ). Nucleotide positions for miR-665 are shown in parentheses. (B) Relative expression levels of miR-9, miR-320, miR-421, and miR-665 obtained by real-time RT-qPCR using total RNA isolated from mouse odontoblasts (M06-G3) induced to differentiate for 21 days. U6 RNA was used as a loading control. (C) Schematic representation of the Dlx3 3′ UTR-Luc reporter vector created by cloning the Dlx3 3′ UTR (1.5 kb) into the pMIR-REPORT Luc reporter vector (top). Relative Luc activity was determined in lysates from M06-G3 cells transfected with Dlx3 3′ UTR-Luc, nonspecific (NS) miRNAs, and individual Dlx3 -targeting miRNAs (bottom). Luc activity was normalized with Renilla Luc activity and expressed in relative luminescence units. (D) Representative Western blot analysis with anti-Luc antibody of lysates from M06-G3 cells transfected with Dlx3 3′ UTR-Luc and individual Dlx3 -targeting miRNAs. (E) Alignment of miR-665 binding to the murine Dlx3 3′ UTR. Lowercase nucleotides indicate the mutations introduced in the seed sequence of the miR-665 binding site within Dlx3 . (F) Relative Luc activity in HEK-293T cells transfected with wild-type (WT) or mutated (MT) Dlx3 3′ UTR constructs along with nonspecific miRNA control (NS), miR-665, or anti-miR-665. Relative Luc activity was normalized with Renilla Luc activity and expressed in relative luminescence units. (G) Representative Western blot showing DLX3 protein expression in MDPC-23 dental pulp cells stably infected with control, miR-665-expressing, or anti-miR-665-expressing lentiviral particles. Tubulin was used as a loading control. (H) Quantitative analysis of the relative Dlx3 mRNA expression levels, normalized to Gapdh , in MDPC-23 dental pulp cells stably infected with control, miR-665-expressing, or anti-miR-665-expressing lentiviral vectors, detected by qPCR after 96 h. *, P ≤ 0.05; **, P ≤ 0.01. (I) Representative RNP-IP assay in MDPC-23 cell lysates incubated with IgG (control) or anti-AGO2 antibody. Data are presented as the amount of miR-665 bound to the Dlx3 3′ UTR fragment (gray bar) relative to the total Dlx3 3′ UTR cDNA input (black bar). Normal IgG was used as a negative control. The RISC was immunoprecipitated with anti-AGO2 antibody, and associated mRNA was reverse transcribed to cDNA, using the miR-665 seed sequence as a primer, and amplified by real-time RT-qPCR with primers specific to miR-665 binding sites in the Dlx3 3′ UTR. (J) Quantitative analysis of miR-665 binding to the Dlx3 3′ UTR associated with the RISC determined by RNA sequencing of AGO2-immunoprecipitated RNA from MDPC-23 dental pulp cells transduced with control, miR-665-overexpressing, and anti-miR-665-expressing lentiviral vectors. Significant changes in transcript expression ( P values of 0.01 to 0.001) were analyzed using Cuffdiff bioinformatics. (K) Streptavidin pulldown to detect Dlx3 mRNA binding to miR-665 in MDPC-23 odontoblast cells transfected with Bi-NS-miR or Bi-miR-665 mimics. The binding of Dlx3 mRNA was analyzed by qRT-PCR and normalized to Gapdh expression. CDS, coding DNA sequence; Ch, chromosome; LUC, luciferase; CON, control; UTR, untranslated region; EV, empty vector; Bi, biotinylated.

    Techniques Used: Functional Assay, Binding Assay, Expressing, Quantitative RT-PCR, Isolation, Plasmid Preparation, Clone Assay, Activity Assay, Transfection, Western Blot, Sequencing, Construct, Stable Transfection, Infection, Real-time Polymerase Chain Reaction, Incubation, Negative Control, Immunoprecipitation, Amplification, RNA Sequencing Assay, Transduction, Luciferase

    Kat6a is a direct target of miR-665. (A) Schematic illustration of the 3′ UTR of Kat6a mRNA with a conserved miR-665 binding site. Bioinformatics programs (TargetScan and MicroRNA.org) revealed that the 3′ UTR of murine Kat6a has a putative miR-665 binding site. The identified miR-665 binding site (octamer seed sequence, CUCCUGG, is shaded) is evolutionarily conserved among vertebrate species (human, mouse, and rat). (B) Kat6a mRNA nucleotide complementarity with the miR-665 seed sequence at the 3′ UTR is illustrated. Lowercase nucleotides indicate the mutations introduced in the seed sequence of the miR-665 binding site. (C) Relative Luc activity in HEK-293T cells transfected with the wild-type (WT) or mutated (MT) Kat6a 3′ UTR-Luc reporters along with an NS miRNA control (Con), miR-665, or anti-miR-665. Relative Luc activity was normalized with Renilla Luc activity and expressed in relative luminescence units. (D) Quantitative analysis of miR-665 binding to the Kat6a mRNA 3′ UTR associated with the RISC was determined by RNA sequencing of AGO2-immunoprecipitated RNA from MDPC-23 dental pulp cells infected with control, miR-665-overexpressing, and anti-miR-665-expressing lentivirus vectors and GFP sorted. Significant changes in transcript expression ( P values of 0.01 to 0.001) were analyzed using Cuffdiff bioinformatics. (E) Streptavidin pulldown to detect Kat6a mRNA binding to miR-665 in MDPC-23 odontoblast cells transfected with Bi-NS-miR or Bi-miR-665 mimics. The binding of Kat6a mRNA was analyzed by qRT-PCR and normalized to Gapdh expression. (F) Representative Western blot showing KAT6A and acetylated histone H3K9 proteins from MDPC-23 dental pulp cells infected with control or miR-665-overexpressing lentivirus vectors and GFP sorted. Actin was used as the loading control.
    Figure Legend Snippet: Kat6a is a direct target of miR-665. (A) Schematic illustration of the 3′ UTR of Kat6a mRNA with a conserved miR-665 binding site. Bioinformatics programs (TargetScan and MicroRNA.org) revealed that the 3′ UTR of murine Kat6a has a putative miR-665 binding site. The identified miR-665 binding site (octamer seed sequence, CUCCUGG, is shaded) is evolutionarily conserved among vertebrate species (human, mouse, and rat). (B) Kat6a mRNA nucleotide complementarity with the miR-665 seed sequence at the 3′ UTR is illustrated. Lowercase nucleotides indicate the mutations introduced in the seed sequence of the miR-665 binding site. (C) Relative Luc activity in HEK-293T cells transfected with the wild-type (WT) or mutated (MT) Kat6a 3′ UTR-Luc reporters along with an NS miRNA control (Con), miR-665, or anti-miR-665. Relative Luc activity was normalized with Renilla Luc activity and expressed in relative luminescence units. (D) Quantitative analysis of miR-665 binding to the Kat6a mRNA 3′ UTR associated with the RISC was determined by RNA sequencing of AGO2-immunoprecipitated RNA from MDPC-23 dental pulp cells infected with control, miR-665-overexpressing, and anti-miR-665-expressing lentivirus vectors and GFP sorted. Significant changes in transcript expression ( P values of 0.01 to 0.001) were analyzed using Cuffdiff bioinformatics. (E) Streptavidin pulldown to detect Kat6a mRNA binding to miR-665 in MDPC-23 odontoblast cells transfected with Bi-NS-miR or Bi-miR-665 mimics. The binding of Kat6a mRNA was analyzed by qRT-PCR and normalized to Gapdh expression. (F) Representative Western blot showing KAT6A and acetylated histone H3K9 proteins from MDPC-23 dental pulp cells infected with control or miR-665-overexpressing lentivirus vectors and GFP sorted. Actin was used as the loading control.

    Techniques Used: Binding Assay, Sequencing, Activity Assay, Transfection, RNA Sequencing Assay, Immunoprecipitation, Infection, Expressing, Quantitative RT-PCR, Western Blot

    64) Product Images from "Up-regulation of the tumour-associated marker CD44V6 in experimental kidney disease"

    Article Title: Up-regulation of the tumour-associated marker CD44V6 in experimental kidney disease

    Journal: Clinical and Experimental Immunology

    doi: 10.1046/j.1365-2249.2000.01313.x

    Analysis of CD44V6 mRNA isoforms in normal rat kidney and NRK52E tubular epithelial cells. A biotinylated sense V6 oligonucleotide (V6 no. 3) and streptavidin magnetic beads were used to capture cDNA containing the CD44V6 sequence. cDNA samples before (no capture) and after capture (V6 capture) were subjected to reverse transcription-polymerase chain reaction (RT-PCR) using a S2/S7 primer pair. The PCR products were analysed by Southern blotting using: (a) S3 probe, or (b) V6 no. 2 probe. Positions of molecular weight markers (base pair) are shown.
    Figure Legend Snippet: Analysis of CD44V6 mRNA isoforms in normal rat kidney and NRK52E tubular epithelial cells. A biotinylated sense V6 oligonucleotide (V6 no. 3) and streptavidin magnetic beads were used to capture cDNA containing the CD44V6 sequence. cDNA samples before (no capture) and after capture (V6 capture) were subjected to reverse transcription-polymerase chain reaction (RT-PCR) using a S2/S7 primer pair. The PCR products were analysed by Southern blotting using: (a) S3 probe, or (b) V6 no. 2 probe. Positions of molecular weight markers (base pair) are shown.

    Techniques Used: Magnetic Beads, Sequencing, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Southern Blot, Molecular Weight

    65) Product Images from "Braiding DNA: Experiments, Simulations, and Models"

    Article Title: Braiding DNA: Experiments, Simulations, and Models

    Journal: Biophysical Journal

    doi: 10.1529/biophysj.104.056945

    Sketch of the experimental setup. Two DNA molecules are multipally tagged at their extremities with biotin and digoxygenin (DIG), so that they can be attached to a streptavidin-coated superparamagnetic bead and to an anti-DIG-coated glass surface. Translation and rotation of small magnets close to the DNA molecules by a few-mm change of the applied force and the number of braids, respectively. The DNA molecule's extension is measured by tracking the position of the bead using an inverted microscope (see Materials and Methods for details).
    Figure Legend Snippet: Sketch of the experimental setup. Two DNA molecules are multipally tagged at their extremities with biotin and digoxygenin (DIG), so that they can be attached to a streptavidin-coated superparamagnetic bead and to an anti-DIG-coated glass surface. Translation and rotation of small magnets close to the DNA molecules by a few-mm change of the applied force and the number of braids, respectively. The DNA molecule's extension is measured by tracking the position of the bead using an inverted microscope (see Materials and Methods for details).

    Techniques Used: Inverted Microscopy

    66) Product Images from "Architecture of nucleotide excision repair complexes: DNA is wrapped by UvrB before and after damage recognition"

    Article Title: Architecture of nucleotide excision repair complexes: DNA is wrapped by UvrB before and after damage recognition

    Journal: The EMBO Journal

    doi: 10.1093/emboj/20.3.601

    Fig. 1. ( A ) Schematic representation of the construction of the double-stranded AFM substrate. The different DNA strands of the 5′ biotinylated PCR fragments (indicated by small filled circles) are isolated using streptavidin-coated magnetic beads (indicated by large filled circles). The 297 nt top strand is added to the immobilized 1032 nt bottom strand together with the 50 nt phosphorylated ‘AFM-chol’ oligo containing the cholesterol adduct. After hybridization and ligation, the incomplete top strand is extended by T 7 polymerase to produce a completely double-stranded fragment. Digestion with Sma I yields a 1020 bp DNA fragment containing a single cholesterol adduct at position 324 in the top strand. ( B ) DNA sequence of the 50 bp S1 substrate. The cholesterol adduct (Chol) is introduced at position 27 (X) in the top strand. The incision positions are indicated with arrows.
    Figure Legend Snippet: Fig. 1. ( A ) Schematic representation of the construction of the double-stranded AFM substrate. The different DNA strands of the 5′ biotinylated PCR fragments (indicated by small filled circles) are isolated using streptavidin-coated magnetic beads (indicated by large filled circles). The 297 nt top strand is added to the immobilized 1032 nt bottom strand together with the 50 nt phosphorylated ‘AFM-chol’ oligo containing the cholesterol adduct. After hybridization and ligation, the incomplete top strand is extended by T 7 polymerase to produce a completely double-stranded fragment. Digestion with Sma I yields a 1020 bp DNA fragment containing a single cholesterol adduct at position 324 in the top strand. ( B ) DNA sequence of the 50 bp S1 substrate. The cholesterol adduct (Chol) is introduced at position 27 (X) in the top strand. The incision positions are indicated with arrows.

    Techniques Used: Polymerase Chain Reaction, Isolation, Magnetic Beads, Hybridization, Ligation, Sequencing

    67) Product Images from "Cultured basophils but not cultured mast cells induce human IgE synthesis in B cells after immunologic stimulation"

    Article Title: Cultured basophils but not cultured mast cells induce human IgE synthesis in B cells after immunologic stimulation

    Journal: Clinical and Experimental Immunology

    doi: 10.1046/j.1365-2249.1998.00474.x

    Analysis of IgE-dependent expression of FasL on cultured human mast cells or basophils. Mast cells (a) or basophils (b) were stimulated with or without antigen after sensitization with murine IgE. Cells were harvested at the indicated times and stained with biotinylated control antibody (- - -) or anti-FasL MoAb (—) followed by PE-conjugated streptavidin. The stained cells were analysed by flow cytometry. Typical results obtained in three (a) or four (b) independent experiments are shown.
    Figure Legend Snippet: Analysis of IgE-dependent expression of FasL on cultured human mast cells or basophils. Mast cells (a) or basophils (b) were stimulated with or without antigen after sensitization with murine IgE. Cells were harvested at the indicated times and stained with biotinylated control antibody (- - -) or anti-FasL MoAb (—) followed by PE-conjugated streptavidin. The stained cells were analysed by flow cytometry. Typical results obtained in three (a) or four (b) independent experiments are shown.

    Techniques Used: Expressing, Cell Culture, Staining, Flow Cytometry, Cytometry

    68) Product Images from "In Vitro and In Vivo Evidence that Thrombospondin-1 (TSP-1) Contributes to Stirring- and Shear-Dependent Activation of Platelet-Derived TGF-?1"

    Article Title: In Vitro and In Vivo Evidence that Thrombospondin-1 (TSP-1) Contributes to Stirring- and Shear-Dependent Activation of Platelet-Derived TGF-?1

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0006608

    Shear depletes TSP-1 via a thiol-dependent mechanism. (A) The proteins in human platelet releasates were labeled with MPB (100 µM) for 30 min either before (−) or after (+) shear for 2 hours. The labeled proteins were either analyzed directly (left two lanes) or after affinity-purification using Streptavidin-coupled beads (right two lanes). Shearing led to a dramatic decrease in intensity of the HRP reaction in select regions. (B) One of the MPB-labeled proteins (boxed) that was most affected by shearing was identified as TSP-1 by LC-MS/MS analysis. (C) Platelet releasates were passed through either a control-Sepharose column (Con) or a thiol-Sepharose column (Thiol) and then labeled with MPB. Depletion of thiol-reactive proteins by the column was analyzed by reaction of the separated proteins with Streptavidin (left panel) and depletion of TSP-1 protein was measured by immunoblotting with an anti-TSP-1 antibody (right panel). Nearly all of the proteins that labeled with MPB from the control column were not labeled after passage through the thiol-Sepharose column. (D) Effect of increasing time of exposure to shear on depletion of TSP-1 from platelet releasates. MPB labeling of TSP-1 was concordantly reduced with the loss to TSP-1 protein during shear as judged by reaction with Streptavidin-HRP (left panel) and immunoblotting with an anti-TSP-1 antibody (middle panel). TGF-β1 depletion was much less pronounced as judged by immunoblotting with an anti-TGF-β1 antibody (right panel). (E) Addition of MPB (100 µM) before shear partially prevented the loss of TSP-1 protein as shown by immunoblotting with an anti-TSP-1 antibody. Addition of the other thiol-reactive reagents, BMCC (F) or NEM (G), similarly protected against loss of TSP-1. Vertical lines in (F) indicate deletion of intermediate lanes from the same gel.
    Figure Legend Snippet: Shear depletes TSP-1 via a thiol-dependent mechanism. (A) The proteins in human platelet releasates were labeled with MPB (100 µM) for 30 min either before (−) or after (+) shear for 2 hours. The labeled proteins were either analyzed directly (left two lanes) or after affinity-purification using Streptavidin-coupled beads (right two lanes). Shearing led to a dramatic decrease in intensity of the HRP reaction in select regions. (B) One of the MPB-labeled proteins (boxed) that was most affected by shearing was identified as TSP-1 by LC-MS/MS analysis. (C) Platelet releasates were passed through either a control-Sepharose column (Con) or a thiol-Sepharose column (Thiol) and then labeled with MPB. Depletion of thiol-reactive proteins by the column was analyzed by reaction of the separated proteins with Streptavidin (left panel) and depletion of TSP-1 protein was measured by immunoblotting with an anti-TSP-1 antibody (right panel). Nearly all of the proteins that labeled with MPB from the control column were not labeled after passage through the thiol-Sepharose column. (D) Effect of increasing time of exposure to shear on depletion of TSP-1 from platelet releasates. MPB labeling of TSP-1 was concordantly reduced with the loss to TSP-1 protein during shear as judged by reaction with Streptavidin-HRP (left panel) and immunoblotting with an anti-TSP-1 antibody (middle panel). TGF-β1 depletion was much less pronounced as judged by immunoblotting with an anti-TGF-β1 antibody (right panel). (E) Addition of MPB (100 µM) before shear partially prevented the loss of TSP-1 protein as shown by immunoblotting with an anti-TSP-1 antibody. Addition of the other thiol-reactive reagents, BMCC (F) or NEM (G), similarly protected against loss of TSP-1. Vertical lines in (F) indicate deletion of intermediate lanes from the same gel.

    Techniques Used: Labeling, Affinity Purification, Liquid Chromatography with Mass Spectroscopy, Mass Spectrometry

    69) Product Images from "SIRT7-dependent deacetylation of CDK9 activates RNA polymerase II transcription"

    Article Title: SIRT7-dependent deacetylation of CDK9 activates RNA polymerase II transcription

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkx053

    The N-terminal region of SIRT7 mediates interactions with RNA and proteins. ( A ) The N-terminal part of SIRT7 is required for RNA binding. Nuclear lysates from HEK293T cells expressing Flag-tagged SIRT7 (WT), SIRT7/ΔN32 or SIRT7/ΔN78 were incubated with streptavidin-coated Dynabeads (-RNA) or with Dynabeads containing 5΄ETS-RNA (+RNA). Bound SIRT7 was analyzed on immunoblots (upper panels). Alternatively, bead-bound RNA was incubated with GST-tagged SIRT7/1-81, and binding was monitored with anti-GST antibodies (bottom panel). A scheme illustrating the domain structure of SIRT7 and the deletion mutants is shown above. See also Supplementary Figures S2A and S2B . ( B ) Pull-down assay showing impaired binding of SIRT7/ΔN78 to RNA. Bead-bound Flag-SIRT7 or the indicated deletion mutants were incubated with radiolabeled 5΄ETS-RNA (+10/+389) and SIRT7-associated RNA was analyzed by gel electrophoresis and PhosphorImaging. RNA bound to beads-only served as a negative control (beads). See also Supplementary Figure S2C . ( C ) RNA-immunoprecipitation (CLIP) showing that the N-terminal region of SIRT7 mediates RNA binding in vivo . UV-crosslinked Flag-SIRT7-RNA complexes were captured on anti-Flag beads, and co-precipitated RNA was analyzed by RT-qPCR. The percentage of precipitated RNA relative to input RNA is shown. Error bars denote means ±SD ( n = 3) (* P
    Figure Legend Snippet: The N-terminal region of SIRT7 mediates interactions with RNA and proteins. ( A ) The N-terminal part of SIRT7 is required for RNA binding. Nuclear lysates from HEK293T cells expressing Flag-tagged SIRT7 (WT), SIRT7/ΔN32 or SIRT7/ΔN78 were incubated with streptavidin-coated Dynabeads (-RNA) or with Dynabeads containing 5΄ETS-RNA (+RNA). Bound SIRT7 was analyzed on immunoblots (upper panels). Alternatively, bead-bound RNA was incubated with GST-tagged SIRT7/1-81, and binding was monitored with anti-GST antibodies (bottom panel). A scheme illustrating the domain structure of SIRT7 and the deletion mutants is shown above. See also Supplementary Figures S2A and S2B . ( B ) Pull-down assay showing impaired binding of SIRT7/ΔN78 to RNA. Bead-bound Flag-SIRT7 or the indicated deletion mutants were incubated with radiolabeled 5΄ETS-RNA (+10/+389) and SIRT7-associated RNA was analyzed by gel electrophoresis and PhosphorImaging. RNA bound to beads-only served as a negative control (beads). See also Supplementary Figure S2C . ( C ) RNA-immunoprecipitation (CLIP) showing that the N-terminal region of SIRT7 mediates RNA binding in vivo . UV-crosslinked Flag-SIRT7-RNA complexes were captured on anti-Flag beads, and co-precipitated RNA was analyzed by RT-qPCR. The percentage of precipitated RNA relative to input RNA is shown. Error bars denote means ±SD ( n = 3) (* P

    Techniques Used: RNA Binding Assay, Expressing, Incubation, Western Blot, Binding Assay, Pull Down Assay, Nucleic Acid Electrophoresis, Negative Control, Immunoprecipitation, Cross-linking Immunoprecipitation, In Vivo, Quantitative RT-PCR

    70) Product Images from "Application of targeted enrichment to next-generation sequencing of retroviruses integrated into the host human genome"

    Article Title: Application of targeted enrichment to next-generation sequencing of retroviruses integrated into the host human genome

    Journal: Scientific Reports

    doi: 10.1038/srep28324

    Design of DNA probes and experimental flow for the enrichment of HTLV-1 proviral DNA. ( A ) Design of the probes. One hundred and forty eight probes, 120 bp in length and with a 60 bp tiling, were constructed. ( B ) Experimental flow for the applications of the targeted enrichment. Genomic DNA or chromatin samples extracted from infected cells can be analyzed to render genome-wide or provirus-focused information. The enrichment of genomic DNA samples containing the viral genome may help discover new proviral sequences with more accuracy due to the higher number of reads that are obtained during the process. The enrichment of ChIP DNA could provide information on the epigenetic profile of the provirus. In addition, not enriching the samples could give the genome-wide context of the proviral profile. ( C ) Experimental flow for the enrichment protocol. DNA libraries prepared for NGS are mixed with the virus-specific biotinylated probes to allow the hybridization. Subsequently, streptavidin-coated magnetic beads are added to allow the isolation of the proviral DNA fragments.
    Figure Legend Snippet: Design of DNA probes and experimental flow for the enrichment of HTLV-1 proviral DNA. ( A ) Design of the probes. One hundred and forty eight probes, 120 bp in length and with a 60 bp tiling, were constructed. ( B ) Experimental flow for the applications of the targeted enrichment. Genomic DNA or chromatin samples extracted from infected cells can be analyzed to render genome-wide or provirus-focused information. The enrichment of genomic DNA samples containing the viral genome may help discover new proviral sequences with more accuracy due to the higher number of reads that are obtained during the process. The enrichment of ChIP DNA could provide information on the epigenetic profile of the provirus. In addition, not enriching the samples could give the genome-wide context of the proviral profile. ( C ) Experimental flow for the enrichment protocol. DNA libraries prepared for NGS are mixed with the virus-specific biotinylated probes to allow the hybridization. Subsequently, streptavidin-coated magnetic beads are added to allow the isolation of the proviral DNA fragments.

    Techniques Used: Flow Cytometry, Construct, Infection, Genome Wide, Chromatin Immunoprecipitation, Next-Generation Sequencing, Hybridization, Magnetic Beads, Isolation

    71) Product Images from "ATM activation in the presence of oxidative stress"

    Article Title: ATM activation in the presence of oxidative stress

    Journal: Cell Cycle

    doi: 10.4161/cc.9.24.14323

    , in the presence of various amounts of H 2 O 2 (0.27, 0.81 and 2.4 mM). (B) H 2 O 2 does not affect MRN binding to ATM. Biotinylated MRN was incubated with ATM in the presence or absence of H 2 O 2 (0.5 mM). MRN was isolated with streptavidin beads and analyzed by western blotting for Mre11 and ATM as indicated. (C) H 2 O 2 inhibits MRN binding to linear DNA in a gel shift assay. Purified MRN was incubated with various amounts of H 2 O 2 (34.4, 68.8, 137.5, 275 µM) before binding to a Cy5-labeled 41 bp dsDNA substrate (37°C, 10 minutes). The binding reaction was resolved on an agarose gel (0.7%, 0.5x TBE) and visualized for Cy5 fluorescence.
    Figure Legend Snippet: , in the presence of various amounts of H 2 O 2 (0.27, 0.81 and 2.4 mM). (B) H 2 O 2 does not affect MRN binding to ATM. Biotinylated MRN was incubated with ATM in the presence or absence of H 2 O 2 (0.5 mM). MRN was isolated with streptavidin beads and analyzed by western blotting for Mre11 and ATM as indicated. (C) H 2 O 2 inhibits MRN binding to linear DNA in a gel shift assay. Purified MRN was incubated with various amounts of H 2 O 2 (34.4, 68.8, 137.5, 275 µM) before binding to a Cy5-labeled 41 bp dsDNA substrate (37°C, 10 minutes). The binding reaction was resolved on an agarose gel (0.7%, 0.5x TBE) and visualized for Cy5 fluorescence.

    Techniques Used: Binding Assay, Incubation, Isolation, Western Blot, Electrophoretic Mobility Shift Assay, Purification, Labeling, Agarose Gel Electrophoresis, Fluorescence

    72) Product Images from "PIST (GOPC) modulates the oncogenic voltage-gated potassium channel KV10.1"

    Article Title: PIST (GOPC) modulates the oncogenic voltage-gated potassium channel KV10.1

    Journal: Frontiers in Physiology

    doi: 10.3389/fphys.2013.00201

    (A) Heteromerization of long and short forms of PIST. (A) GFP antibody was used to precipitate CFP-tagged PIST isoforms out of lysates of transfected HEK293 cells. PIST isoforms were detected using a polyclonal antibody against PIST. Bands compatible with both the GFP-tagged forms and with endogenous PIST were detected, indicating association between the transfected CFP-PIST and the endogenous one. (B) Co-precipitation of PIST isoforms with K V 10.1_BBS. Lysates of KV10.1_BBS-expressing cells were labeled with an α-BTX-biotin conjugate and pulled down with streptavidin-coated beads (see Figure 1 ). Anti-PIST specific antibodies detected co-immunoprecipitation of bands compatible with the corresponding CFP-tagged form, together with an endogenous PIST band.
    Figure Legend Snippet: (A) Heteromerization of long and short forms of PIST. (A) GFP antibody was used to precipitate CFP-tagged PIST isoforms out of lysates of transfected HEK293 cells. PIST isoforms were detected using a polyclonal antibody against PIST. Bands compatible with both the GFP-tagged forms and with endogenous PIST were detected, indicating association between the transfected CFP-PIST and the endogenous one. (B) Co-precipitation of PIST isoforms with K V 10.1_BBS. Lysates of KV10.1_BBS-expressing cells were labeled with an α-BTX-biotin conjugate and pulled down with streptavidin-coated beads (see Figure 1 ). Anti-PIST specific antibodies detected co-immunoprecipitation of bands compatible with the corresponding CFP-tagged form, together with an endogenous PIST band.

    Techniques Used: Transfection, Expressing, Labeling, Immunoprecipitation

    Co-precipitation of K V 10.1 and PIST out of (A,B) rat brain lysates and (C) HEK293_K V 10.1_BBS cells. Specific antibodies against PIST (A) or K V 10.1 (B) were used for precipitation out of rat brain lysates using Protein A/G coupled sepharose beads. Isotype control antibodies served as negative controls. Co-precipitation of Kv10.1 by anti PIST immunoprecipitation (A) as well as precipitation of PIST by anti K V 10.1 immunoprecipitation (B) were detected by western blot. (C) K V 10.1_BBS was labeled with an α-bungarotoxin-biotin conjugate after lysis of HEK293_K V 10.1_BBS cells and pulled down with streptavidin-coated beads. Detection on a western blot with and anti-PIST antibody shows bands compatible with precipitation of both CFP-tagged and endogenous PIST.
    Figure Legend Snippet: Co-precipitation of K V 10.1 and PIST out of (A,B) rat brain lysates and (C) HEK293_K V 10.1_BBS cells. Specific antibodies against PIST (A) or K V 10.1 (B) were used for precipitation out of rat brain lysates using Protein A/G coupled sepharose beads. Isotype control antibodies served as negative controls. Co-precipitation of Kv10.1 by anti PIST immunoprecipitation (A) as well as precipitation of PIST by anti K V 10.1 immunoprecipitation (B) were detected by western blot. (C) K V 10.1_BBS was labeled with an α-bungarotoxin-biotin conjugate after lysis of HEK293_K V 10.1_BBS cells and pulled down with streptavidin-coated beads. Detection on a western blot with and anti-PIST antibody shows bands compatible with precipitation of both CFP-tagged and endogenous PIST.

    Techniques Used: Immunoprecipitation, Western Blot, Labeling, Lysis

    73) Product Images from "Dissection of Agonistic and Blocking Effects of CD200 Receptor Antibodies"

    Article Title: Dissection of Agonistic and Blocking Effects of CD200 Receptor Antibodies

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0063325

    The CD200/CD200R interaction can be blocked by OX131 but not OX110 mAb. A) Biotinylated rCD4d3+4 (dashed line), CD200R(1) rCD4d3+d4 (solid black line) and CD200R(2) rCD4d3+4 (solid grey line) proteins were immobilized onto streptavidin coated CM5 chips (681, 726, 704 response units respectively). The changes in response units (RU) upon sequential injection of different soluble proteins (boxed and indicated by vertical dots) are shown. (Both antibodies were injected three consecutive times to ensure saturation on the immobilized proteins.) (B) Table showing the increase in response units upon injection of soluble CD200 compared to the pre-injection states for each flow cell. The values for the control rCD4d3+4 indicate the signal due to the high protein content of the CD200 sample.
    Figure Legend Snippet: The CD200/CD200R interaction can be blocked by OX131 but not OX110 mAb. A) Biotinylated rCD4d3+4 (dashed line), CD200R(1) rCD4d3+d4 (solid black line) and CD200R(2) rCD4d3+4 (solid grey line) proteins were immobilized onto streptavidin coated CM5 chips (681, 726, 704 response units respectively). The changes in response units (RU) upon sequential injection of different soluble proteins (boxed and indicated by vertical dots) are shown. (Both antibodies were injected three consecutive times to ensure saturation on the immobilized proteins.) (B) Table showing the increase in response units upon injection of soluble CD200 compared to the pre-injection states for each flow cell. The values for the control rCD4d3+4 indicate the signal due to the high protein content of the CD200 sample.

    Techniques Used: Injection, Flow Cytometry

    Specificity of OX110, OX131 and OX132 mAb. Streptavidin coupled magnetic beads were coated with biotinylated chimeric proteins containing extracellular domains of members of the mouse CD200R family and rCD4d3+4 and a biotinylation site (as indicated on top of each column). The binding of the mAb indicated in each row was analyzed by flow cytometry. (A) Protein coating levels for each group of magnetic beads were tested by staining with OX68 (CD4 mAb) (tinted solid line) or OX21 (control mAb) (thin line). Flow cytometry plot named rCD4 d3+4 indicates coating level for biotinylated rCD4d3+4 only. (B–D) OX110 (B), OX131 (C) and OX132 (D) mAb were used to stain magnetic beads coated with the chimeric proteins indicated above each column (tinted solid line), or control beads coated with biotinylated rCD4d3+4 only (dashed line). Data are representative of three experiments.
    Figure Legend Snippet: Specificity of OX110, OX131 and OX132 mAb. Streptavidin coupled magnetic beads were coated with biotinylated chimeric proteins containing extracellular domains of members of the mouse CD200R family and rCD4d3+4 and a biotinylation site (as indicated on top of each column). The binding of the mAb indicated in each row was analyzed by flow cytometry. (A) Protein coating levels for each group of magnetic beads were tested by staining with OX68 (CD4 mAb) (tinted solid line) or OX21 (control mAb) (thin line). Flow cytometry plot named rCD4 d3+4 indicates coating level for biotinylated rCD4d3+4 only. (B–D) OX110 (B), OX131 (C) and OX132 (D) mAb were used to stain magnetic beads coated with the chimeric proteins indicated above each column (tinted solid line), or control beads coated with biotinylated rCD4d3+4 only (dashed line). Data are representative of three experiments.

    Techniques Used: Magnetic Beads, Binding Assay, Flow Cytometry, Cytometry, Staining

    74) Product Images from "Cortactin Controls Surface Expression of the Voltage-gated Potassium Channel KV10.1"

    Article Title: Cortactin Controls Surface Expression of the Voltage-gated Potassium Channel KV10.1

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M112.372540

    Deleting amino acids 705–755 of K V 10.1 changes its distribution as well as its ability to bind CTTN. A, depletion of CTTN by co-injection of the PTO oligonucleotide was able to reduce current amplitudes of K V 10.1 Δ3 (del705–755) in voltage clamp oocyte recordings as determined by a depolarization step to +80 mV. Restoration of CTTN levels by injection of human CTTN did not rescue the effect of PTO on this mutant. B, the effect of PTO-mediated CTTN depletion on K V 10.1 Δ3 was weaker (reducing current amplitude by 50%) than that observed in full-length K V 10.1 (that reduced current by 80%). Current amplitude of the mutant K V 10.1 Δ3 after CTTN depletion was not rescued by additional expression of human CTTN, in contrast to wild-type K V 10.1. C, membrane K V 10.1-BBS was labeled using a BTX-Alexa 555 conjugate and allowed for internalization for 1 h. Washed cells were analyzed by wide field microscopy. K V 10.1-BBS as well as K V 10.1-BBS Δ8 (del933–962) showed prominent membranous labeling of K V 10.1-BBS, whereas nearly no membrane-bound K V 10.1-BBS Δ3 was observed. Scale bar , 10 μm. D , K V 10.1-BBS and K V 10.1-BBS Δ8 successfully precipitated GST-CTTN, K V 10.1-BBS Δ3 showed much weaker co-precipitation of the full-length CTTN. Mutants K V 10.1-BBS Δ3, K V 10.1-BBS Δ8, or wild-type K V 10.1-BBS were transiently expressed in HEK 293 cells. Lysates were labeled with BTX-biotin ( Bb ) to pull down K V 10.1-BBS using streptavidin-coated beads, unlabeled lysates served as negative control. Subsequent GST-CTTN was added and analyzed for co-precipitation using SDS-PAGE followed by Western blotting using a GST antibody.
    Figure Legend Snippet: Deleting amino acids 705–755 of K V 10.1 changes its distribution as well as its ability to bind CTTN. A, depletion of CTTN by co-injection of the PTO oligonucleotide was able to reduce current amplitudes of K V 10.1 Δ3 (del705–755) in voltage clamp oocyte recordings as determined by a depolarization step to +80 mV. Restoration of CTTN levels by injection of human CTTN did not rescue the effect of PTO on this mutant. B, the effect of PTO-mediated CTTN depletion on K V 10.1 Δ3 was weaker (reducing current amplitude by 50%) than that observed in full-length K V 10.1 (that reduced current by 80%). Current amplitude of the mutant K V 10.1 Δ3 after CTTN depletion was not rescued by additional expression of human CTTN, in contrast to wild-type K V 10.1. C, membrane K V 10.1-BBS was labeled using a BTX-Alexa 555 conjugate and allowed for internalization for 1 h. Washed cells were analyzed by wide field microscopy. K V 10.1-BBS as well as K V 10.1-BBS Δ8 (del933–962) showed prominent membranous labeling of K V 10.1-BBS, whereas nearly no membrane-bound K V 10.1-BBS Δ3 was observed. Scale bar , 10 μm. D , K V 10.1-BBS and K V 10.1-BBS Δ8 successfully precipitated GST-CTTN, K V 10.1-BBS Δ3 showed much weaker co-precipitation of the full-length CTTN. Mutants K V 10.1-BBS Δ3, K V 10.1-BBS Δ8, or wild-type K V 10.1-BBS were transiently expressed in HEK 293 cells. Lysates were labeled with BTX-biotin ( Bb ) to pull down K V 10.1-BBS using streptavidin-coated beads, unlabeled lysates served as negative control. Subsequent GST-CTTN was added and analyzed for co-precipitation using SDS-PAGE followed by Western blotting using a GST antibody.

    Techniques Used: Injection, Mutagenesis, Expressing, Labeling, Microscopy, Negative Control, SDS Page, Western Blot

    K V 10.1 is able to pull down CTTN in vitro . K V 10.1-BBS or K V 10.2-BBS were labeled with BTX-biotin (+Bb) in lysates of HEK293 cells expressing either K V 10.1-BBS or K V 10.2-BBS, pulled down, and washed rigorously using streptavidin-coated beads. The streptavidin-precipitated proteins were then used in pull-down experiments with various GST-CTTN fusion proteins that were then analyzed by SDS-PAGE followed by immunoblotting using an anti-GST antibody (Santa Cruz Biotechnology) ( A , B , and D ) or Coomassie staining ( E ). Unlabeled cell lysates served as a negative control (−Bb). Both K V 10.1 and K V 10.2 were able to precipitate the full-length GST-CTTN ( A ) but not GST alone ( B ). C, schematic representation of the various CTTN domain GST-tagged proteins using pull-down assays with K V 10.1-BBS. Of these CTTN-domain containing fusions only the HP region was precipitated by K V 10.1-BBS ( D ). Specific pull down of GST-HP-region of CTTN by K V 10.1 was also confirmed in Coomassie stained gels ( E ).
    Figure Legend Snippet: K V 10.1 is able to pull down CTTN in vitro . K V 10.1-BBS or K V 10.2-BBS were labeled with BTX-biotin (+Bb) in lysates of HEK293 cells expressing either K V 10.1-BBS or K V 10.2-BBS, pulled down, and washed rigorously using streptavidin-coated beads. The streptavidin-precipitated proteins were then used in pull-down experiments with various GST-CTTN fusion proteins that were then analyzed by SDS-PAGE followed by immunoblotting using an anti-GST antibody (Santa Cruz Biotechnology) ( A , B , and D ) or Coomassie staining ( E ). Unlabeled cell lysates served as a negative control (−Bb). Both K V 10.1 and K V 10.2 were able to precipitate the full-length GST-CTTN ( A ) but not GST alone ( B ). C, schematic representation of the various CTTN domain GST-tagged proteins using pull-down assays with K V 10.1-BBS. Of these CTTN-domain containing fusions only the HP region was precipitated by K V 10.1-BBS ( D ). Specific pull down of GST-HP-region of CTTN by K V 10.1 was also confirmed in Coomassie stained gels ( E ).

    Techniques Used: In Vitro, Labeling, Expressing, SDS Page, Staining, Negative Control

    75) Product Images from "Serotonylation of Vascular Proteins Important to Contraction"

    Article Title: Serotonylation of Vascular Proteins Important to Contraction

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0005682

    5-HT and 5-HT-biotin localize to α-actin and are incorporated into proteins. A. Immunocytochemistry of aortic smooth muscle cells incubated with exogenous 5-HT (12.7 µM; left) or 5-HT biotin (12.7 µM; right) and α-actin for 1 hour prior to fixation and visualization using an antirabbit fluorescent secondary (for 5-HT) or streptavidin-conjugated secondary (for 5-HT biotin). Representative of four different aortic explants. B. Effect of cystamine (10 mM) on 5-HT-biotin localization in aortic smooth muscle cells. Representative of four different aortic explants.
    Figure Legend Snippet: 5-HT and 5-HT-biotin localize to α-actin and are incorporated into proteins. A. Immunocytochemistry of aortic smooth muscle cells incubated with exogenous 5-HT (12.7 µM; left) or 5-HT biotin (12.7 µM; right) and α-actin for 1 hour prior to fixation and visualization using an antirabbit fluorescent secondary (for 5-HT) or streptavidin-conjugated secondary (for 5-HT biotin). Representative of four different aortic explants. B. Effect of cystamine (10 mM) on 5-HT-biotin localization in aortic smooth muscle cells. Representative of four different aortic explants.

    Techniques Used: Immunocytochemistry, Incubation

    α-actin is serotonylated in aortic smooth muscle cells and inhibition of TG activity reduces aortic contraction to 5-HT. A. Immunoprecipitation of smooth muscle α-actin from rat aortic homogenates exposed to 5-HT-biotin in a standard transglutaminase reaction. Blots were developed using a streptavidin secondary (top), or exposed to a primary antibody against α-actin (bottom) and developed using standard horseradish peroxidase secondary antibody. Representative of N = 6 different experiments. B. Effect of vehicle (filled symbol) and cystamine (0.1–1 mM; open symbol) on 5-HT (top) and KCl (bottom)-induced contraction in isolated rat aorta. * indicates statistical difference from vehicle-incubated values. Points and vertical lines represent means±SEM for number of animals in parentheses.
    Figure Legend Snippet: α-actin is serotonylated in aortic smooth muscle cells and inhibition of TG activity reduces aortic contraction to 5-HT. A. Immunoprecipitation of smooth muscle α-actin from rat aortic homogenates exposed to 5-HT-biotin in a standard transglutaminase reaction. Blots were developed using a streptavidin secondary (top), or exposed to a primary antibody against α-actin (bottom) and developed using standard horseradish peroxidase secondary antibody. Representative of N = 6 different experiments. B. Effect of vehicle (filled symbol) and cystamine (0.1–1 mM; open symbol) on 5-HT (top) and KCl (bottom)-induced contraction in isolated rat aorta. * indicates statistical difference from vehicle-incubated values. Points and vertical lines represent means±SEM for number of animals in parentheses.

    Techniques Used: Inhibition, Activity Assay, Immunoprecipitation, Isolation, Incubation

    Related Articles

    Centrifugation:

    Article Title: Galectins control mTOR in response to endomembrane damage
    Article Snippet: The lysates were clarified by centrifugation at 13,000 rpm for 5 min, followed by measuring protein concentrations using a Pierce BCA Protein Assay kit, with freshly made bovine serum albumin (BSA) solutions as standards. .. Streptavidin–coated magnetic beads (ThermoFisher Scientific) were washed with RIPA lysis buffer.

    Amplification:

    Article Title: Borrelia burgdorferi transcriptome in the central nervous system of non-human primates
    Article Snippet: Positive Selection and Amplification. .. Equal amounts of biotinylated cDNA prepared from medulla and heart (normalized based on the levels of flaB transcripts) were hybridized separately to Bb-CAL and the biotinylated cDNA-Bb-CAL hybrids bound to streptavidin-coated magnetic beads (Dynal, Lake Success, NY) as shown in .

    Mass Spectrometry:

    Article Title: Design and synthesis of a photocleavable biotinylated nucleotide for DNA analysis by mass spectrometry
    Article Snippet: Prior to photolysis, the extension reaction products were purified and analyzed by MALDI-TOF MS to verify the incorporation of dUTP-PC-Biotin. .. A portion of the reaction product (20 µl) was mixed with 15 µl of streptavidin-coated magnetic beads (Seradyn, Indianapolis) that had been pre-washed and resuspended in a modified binding and washing (B/W) buffer (0.5 mM Tris–HCl buffer, 2 M NH4 Cl, 1 mM EDTA, pH 7.0), and incubated for 30 min as described ( ).

    Synthesized:

    Article Title: DNA sequencing using biotinylated dideoxynucleotides and mass spectrometry
    Article Snippet: Oligonucleotides were synthesized on a PerSeptive Biosystems Expedite nucleic acid synthesizer. .. Streptavidin-coated magnetic beads were obtained from Dynal Inc. (Oslo, Norway).

    Construct:

    Article Title: Architecture of nucleotide excision repair complexes: DNA is wrapped by UvrB before and after damage recognition
    Article Snippet: The 5′ terminally labelled substrate S1 was constructed by hybridization of the damaged oligo with the complementary bottom strand as described previously ( ). .. The purified biotinylated fragment was incubated with 1 mg of streptavidin-coated magnetic beads (Dynal M-280) for 2 h at 37°C in 200 µl of BW1 buffer (5 mM Tris–HCl pH 7.5, 0.5 mM EDTA, 3 M LiCl).

    Incubation:

    Article Title: Galectins control mTOR in response to endomembrane damage
    Article Snippet: For immunoblotting analysis, cell pellets were lysed with 500 μL ice-cold RIPA lysis buffer (ThermoFisher Scientific) with protease inhibitor cocktail (Roche), 1 mM PMSF (sigma), 10 mM sodium ascorbate, 10 mM sodium azide and 5 mM Trolox, gently pipetted and then the incubated for 30 min. .. Streptavidin–coated magnetic beads (ThermoFisher Scientific) were washed with RIPA lysis buffer.

    Article Title: High Affinity Binders to EphA2 Isolated from Abdurin Scaffold Libraries; Characterization, Binding and Tumor Targeting
    Article Snippet: 83 nM biotinylated EphA2 was added to the blocked IVTT reaction mixture and incubated for 1 hour at RT while mixing on a rotary mixer. .. 100 μl streptavidin coated magnetic beads (M280, Invitrogen, Carlsbad, California, USA) were then added for 15 minutes, to pull down the binders.

    Article Title: Phage-Derived Fully Human Monoclonal Antibody Fragments to Human Vascular Endothelial Growth Factor-C Block Its Interaction with VEGF Receptor-2 and 3
    Article Snippet: Prior to selection, 50 µl streptavidin coated magnetic beads (M-280 Dynabeads, Dynal Biotech, Oslo, Norway) per selection were blocked with 1 ml 3% BSA in PBS for 1 hour at room temperature and resuspended in 50 µl 2% BSA/PBS. .. 1 ml of antibody phage library (approximately 1012 tu in total) in 2% BSA/PBS was incubated with the biotinylated antigen at the above stated concentrations for 1 hour on a rotator at room temperature.

    Article Title: Histone modifications influence mediator interactions with chromatin
    Article Snippet: .. The above components were incubated at 4°C with rotation for 4 h. Twenty microliters of streptavidin coated magnetic beads (Invitrogen) were equilibrated with F-300 + 0.1 mg/ml BSA. .. After the histone tail peptide/Mediator incubation was complete, 10 µl was removed as the ‘input’ and the rest added to the equilibrated streptavidin beads.

    Article Title: Cell-SELEX Based Identification of an RNA Aptamer for Escherichia coli and Its Use in Various Detection Formats
    Article Snippet: .. E. coli Aptamer-bead pull-down assay Truncated aptamer Ec3(31) with 3′ biotin, SQ2 mutant-biotin and N40 primer-biotin controls, were allowed to bind to 20 μl of streptavidin coated magnetic beads (dynabead, Invitrogen, USA) for 15 min at RT. yeast tRNA (0.1 mg/ml) and BSA (1 mg/ml) were added and the incubation was further continued for 45 min. Unbound aptamer were washed-off and this preblocked bead-aptamer complex were incubated with various cell density of E. coli (108 to 105 CFU/ml), in 1 ml of binding buffer, for 30 min at RT. .. The E. coli -aptamer-magnetic bead complex was separated from the unbound cells on a magnetic stand (Invitrogen).

    Article Title: A Novel Microtubule-Binding Drug Attenuates and Reverses Protein Aggregation in Animal Models of Alzheimer’s Disease
    Article Snippet: .. Biotinylated PNR502 was incubated with fresh lysate from AD hippocampus (a pool from three individuals) and captured on streptavidin-coated magnetic beads. .. After stringent washes, proteins eluted from the beads were resuspended in Laemmli buffer at > 95°C, and resolved by SDS-polyacrylamide gel electrophoresis.

    Article Title: A CADASIL-mutated Notch 3 receptor exhibits impaired intracellular trafficking and maturation but normal ligand-induced signaling
    Article Snippet: .. The remaining lysate (380 μl) was incubated with 100 μl of streptavidin-coated magnetic beads (Dynal, Oslo) overnight at +4°C. .. Precipitated proteins were recovered in 40 μl of 2× SDS/PAGE loading buffer and further processed by Western blot.

    Article Title: Architecture of nucleotide excision repair complexes: DNA is wrapped by UvrB before and after damage recognition
    Article Snippet: .. The purified biotinylated fragment was incubated with 1 mg of streptavidin-coated magnetic beads (Dynal M-280) for 2 h at 37°C in 200 µl of BW1 buffer (5 mM Tris–HCl pH 7.5, 0.5 mM EDTA, 3 M LiCl). .. Using a magnetic particle concentrator (Dynal), the immobilized DNA was washed three times with 100 µl of 2× BW1 buffer (10 mM Tris–HCl pH 7.5, 1 mM EDTA, 6 M LiCl).

    Article Title: A phosphorylation-and-ubiquitylation circuitry driving ATR activation and homologous recombination
    Article Snippet: .. Protein complex purification To capture SFB-tagged RFWD3 or PRP19 and its derivatives, cells were lysed in NETN buffer (50 mM Tris–HCl pH 7.5, 100 mM NaCl, 1 mM EDTA, 0.5% Igepal) containing protease and phosphatase inhibitors and incubated with streptavidin-coated magnetic beads (Life Technologies). ..

    Article Title: Design and synthesis of a photocleavable biotinylated nucleotide for DNA analysis by mass spectrometry
    Article Snippet: .. A portion of the reaction product (20 µl) was mixed with 15 µl of streptavidin-coated magnetic beads (Seradyn, Indianapolis) that had been pre-washed and resuspended in a modified binding and washing (B/W) buffer (0.5 mM Tris–HCl buffer, 2 M NH4 Cl, 1 mM EDTA, pH 7.0), and incubated for 30 min as described ( ). .. Then the beads were washed with 200 µl each of a modified B/W buffer, 0.1 M TEAA buffer and water.

    Article Title: A Novel Microtubule-Binding Drug Attenuates and Reverses Protein Aggregation in Animal Models of Alzheimer’s Disease
    Article Snippet: Equal protein contents were pooled from three tissue lysates and incubated with biotinyl-PNR502 (10 μM) for 5 h. Retained protein was digested with 5 μg/ml trypsin (Promega) for 2 h at 37°C. .. Bound, lightly digested protein was recovered on streptavidin-coated magnetic beads (Thermo Fisher Scientific, Waltham, MA, USA), and eluted peptides were analyzed by LC-MS/MS as described (Ayyadevara et al., , ).

    Expressing:

    Article Title: High Affinity Binders to EphA2 Isolated from Abdurin Scaffold Libraries; Characterization, Binding and Tumor Targeting
    Article Snippet: After expression, the samples were diluted 5-fold in selection buffer containing 2% bovine serum albumin (BSA), in PBS. .. 100 μl streptavidin coated magnetic beads (M280, Invitrogen, Carlsbad, California, USA) were then added for 15 minutes, to pull down the binders.

    BIA-KA:

    Article Title: Galectins control mTOR in response to endomembrane damage
    Article Snippet: The lysates were clarified by centrifugation at 13,000 rpm for 5 min, followed by measuring protein concentrations using a Pierce BCA Protein Assay kit, with freshly made bovine serum albumin (BSA) solutions as standards. .. Streptavidin–coated magnetic beads (ThermoFisher Scientific) were washed with RIPA lysis buffer.

    Modification:

    Article Title: Design and synthesis of a photocleavable biotinylated nucleotide for DNA analysis by mass spectrometry
    Article Snippet: .. A portion of the reaction product (20 µl) was mixed with 15 µl of streptavidin-coated magnetic beads (Seradyn, Indianapolis) that had been pre-washed and resuspended in a modified binding and washing (B/W) buffer (0.5 mM Tris–HCl buffer, 2 M NH4 Cl, 1 mM EDTA, pH 7.0), and incubated for 30 min as described ( ). .. Then the beads were washed with 200 µl each of a modified B/W buffer, 0.1 M TEAA buffer and water.

    Western Blot:

    Article Title: Coactivator-Associated Arginine Methyltransferase 1 Enhances Transcriptional Activity of the Human T-Cell Lymphotropic Virus Type 1 Long Terminal Repeat through Direct Interaction with Tax
    Article Snippet: Briefly, PICs were assembled by incubating biotinylated HTLV-1 templates (4× TRE G-free cassette) with HeLa nuclear extracts in the absence or presence of the His6 -Tax wild type or mutant (del 151-204) and then purified with streptavidin-coated magnetic beads (Dynal Biotech). .. The protein components of PICs were analyzed by Western blotting with anti-Tab172, -CARM1, -CREB, or -p300 antibody (Upstate).

    Article Title: A CADASIL-mutated Notch 3 receptor exhibits impaired intracellular trafficking and maturation but normal ligand-induced signaling
    Article Snippet: The remaining lysate (380 μl) was incubated with 100 μl of streptavidin-coated magnetic beads (Dynal, Oslo) overnight at +4°C. .. Precipitated proteins were recovered in 40 μl of 2× SDS/PAGE loading buffer and further processed by Western blot.

    Derivative Assay:

    Article Title: Phage-Derived Fully Human Monoclonal Antibody Fragments to Human Vascular Endothelial Growth Factor-C Block Its Interaction with VEGF Receptor-2 and 3
    Article Snippet: This was done to prevent selection of binders that bind only to denatured VEGF-C. Up to 3 biopanning rounds with different concentrations of biotinylated P. pastoris -derived ΔNΔC-VEGF-C (VC2.1 series; 1st round with 3 nM, 30 nM and 300 nM; 2nd round with 30 pM and 3 nM; 3rd round with 30 pM) and biotinylated mammalian cell-derived ΔNΔC-VEGF-C (VC2.2 series; 1st round with 300 pM, 3 nM and 30 nM; 2nd round with 3 nM) were performed. .. Prior to selection, 50 µl streptavidin coated magnetic beads (M-280 Dynabeads, Dynal Biotech, Oslo, Norway) per selection were blocked with 1 ml 3% BSA in PBS for 1 hour at room temperature and resuspended in 50 µl 2% BSA/PBS.

    Hybridization:

    Article Title: Borrelia burgdorferi transcriptome in the central nervous system of non-human primates
    Article Snippet: Equal amounts of biotinylated cDNA prepared from medulla and heart (normalized based on the levels of flaB transcripts) were hybridized separately to Bb-CAL and the biotinylated cDNA-Bb-CAL hybrids bound to streptavidin-coated magnetic beads (Dynal, Lake Success, NY) as shown in . .. Differential Hybridization Analysis Using Whole-Genome Arrays.

    Article Title: Architecture of nucleotide excision repair complexes: DNA is wrapped by UvrB before and after damage recognition
    Article Snippet: The 5′ terminally labelled substrate S1 was constructed by hybridization of the damaged oligo with the complementary bottom strand as described previously ( ). .. The purified biotinylated fragment was incubated with 1 mg of streptavidin-coated magnetic beads (Dynal M-280) for 2 h at 37°C in 200 µl of BW1 buffer (5 mM Tris–HCl pH 7.5, 0.5 mM EDTA, 3 M LiCl).

    Protease Inhibitor:

    Article Title: Galectins control mTOR in response to endomembrane damage
    Article Snippet: For immunoblotting analysis, cell pellets were lysed with 500 μL ice-cold RIPA lysis buffer (ThermoFisher Scientific) with protease inhibitor cocktail (Roche), 1 mM PMSF (sigma), 10 mM sodium ascorbate, 10 mM sodium azide and 5 mM Trolox, gently pipetted and then the incubated for 30 min. .. Streptavidin–coated magnetic beads (ThermoFisher Scientific) were washed with RIPA lysis buffer.

    Infection:

    Article Title: Borrelia burgdorferi transcriptome in the central nervous system of non-human primates
    Article Snippet: RNAs were isolated from the medulla and heart tissue of B. burgdorferi -infected NHPs (≈2–5 g of each tissue) by using the RNAWIZ RNA isolation reagent (Ambion, Austin, TX) according to the manufacturer's protocol. .. Equal amounts of biotinylated cDNA prepared from medulla and heart (normalized based on the levels of flaB transcripts) were hybridized separately to Bb-CAL and the biotinylated cDNA-Bb-CAL hybrids bound to streptavidin-coated magnetic beads (Dynal, Lake Success, NY) as shown in .

    Polymerase Chain Reaction:

    Article Title: Borrelia burgdorferi transcriptome in the central nervous system of non-human primates
    Article Snippet: Equal amounts of biotinylated cDNA prepared from medulla and heart (normalized based on the levels of flaB transcripts) were hybridized separately to Bb-CAL and the biotinylated cDNA-Bb-CAL hybrids bound to streptavidin-coated magnetic beads (Dynal, Lake Success, NY) as shown in . .. The Bb-CAL bound to the beads was eluted by boiling and PCR-amplified by using Uniamp primers, as described , and schematically outlined in .

    Article Title: High Affinity Binders to EphA2 Isolated from Abdurin Scaffold Libraries; Characterization, Binding and Tumor Targeting
    Article Snippet: 100 μl streptavidin coated magnetic beads (M280, Invitrogen, Carlsbad, California, USA) were then added for 15 minutes, to pull down the binders. .. The eluted material was added to a recovery PCR reaction, thereby producing input DNA for the next round of selection.

    Article Title: Architecture of nucleotide excision repair complexes: DNA is wrapped by UvrB before and after damage recognition
    Article Snippet: The PCR product was purified with a GFX™ column (Amersham). .. The purified biotinylated fragment was incubated with 1 mg of streptavidin-coated magnetic beads (Dynal M-280) for 2 h at 37°C in 200 µl of BW1 buffer (5 mM Tris–HCl pH 7.5, 0.5 mM EDTA, 3 M LiCl).

    Binding Assay:

    Article Title: High Affinity Binders to EphA2 Isolated from Abdurin Scaffold Libraries; Characterization, Binding and Tumor Targeting
    Article Snippet: Paragraph title: Affinity maturation of EphA2 binding Abdurins using CIS DNA display ... 100 μl streptavidin coated magnetic beads (M280, Invitrogen, Carlsbad, California, USA) were then added for 15 minutes, to pull down the binders.

    Article Title: Histone modifications influence mediator interactions with chromatin
    Article Snippet: Paragraph title: Histone tail peptide binding experiments ... The above components were incubated at 4°C with rotation for 4 h. Twenty microliters of streptavidin coated magnetic beads (Invitrogen) were equilibrated with F-300 + 0.1 mg/ml BSA.

    Article Title: Cell-SELEX Based Identification of an RNA Aptamer for Escherichia coli and Its Use in Various Detection Formats
    Article Snippet: .. E. coli Aptamer-bead pull-down assay Truncated aptamer Ec3(31) with 3′ biotin, SQ2 mutant-biotin and N40 primer-biotin controls, were allowed to bind to 20 μl of streptavidin coated magnetic beads (dynabead, Invitrogen, USA) for 15 min at RT. yeast tRNA (0.1 mg/ml) and BSA (1 mg/ml) were added and the incubation was further continued for 45 min. Unbound aptamer were washed-off and this preblocked bead-aptamer complex were incubated with various cell density of E. coli (108 to 105 CFU/ml), in 1 ml of binding buffer, for 30 min at RT. .. The E. coli -aptamer-magnetic bead complex was separated from the unbound cells on a magnetic stand (Invitrogen).

    Article Title: Design and synthesis of a photocleavable biotinylated nucleotide for DNA analysis by mass spectrometry
    Article Snippet: .. A portion of the reaction product (20 µl) was mixed with 15 µl of streptavidin-coated magnetic beads (Seradyn, Indianapolis) that had been pre-washed and resuspended in a modified binding and washing (B/W) buffer (0.5 mM Tris–HCl buffer, 2 M NH4 Cl, 1 mM EDTA, pH 7.0), and incubated for 30 min as described ( ). .. Then the beads were washed with 200 µl each of a modified B/W buffer, 0.1 M TEAA buffer and water.

    Article Title: A Novel Microtubule-Binding Drug Attenuates and Reverses Protein Aggregation in Animal Models of Alzheimer’s Disease
    Article Snippet: Paragraph title: Pulldown of PNR502 Binding Targets ... Bound, lightly digested protein was recovered on streptavidin-coated magnetic beads (Thermo Fisher Scientific, Waltham, MA, USA), and eluted peptides were analyzed by LC-MS/MS as described (Ayyadevara et al., , ).

    Pull Down Assay:

    Article Title: Cell-SELEX Based Identification of an RNA Aptamer for Escherichia coli and Its Use in Various Detection Formats
    Article Snippet: .. E. coli Aptamer-bead pull-down assay Truncated aptamer Ec3(31) with 3′ biotin, SQ2 mutant-biotin and N40 primer-biotin controls, were allowed to bind to 20 μl of streptavidin coated magnetic beads (dynabead, Invitrogen, USA) for 15 min at RT. yeast tRNA (0.1 mg/ml) and BSA (1 mg/ml) were added and the incubation was further continued for 45 min. Unbound aptamer were washed-off and this preblocked bead-aptamer complex were incubated with various cell density of E. coli (108 to 105 CFU/ml), in 1 ml of binding buffer, for 30 min at RT. .. The E. coli -aptamer-magnetic bead complex was separated from the unbound cells on a magnetic stand (Invitrogen).

    Magnetic Beads:

    Article Title: Borrelia burgdorferi transcriptome in the central nervous system of non-human primates
    Article Snippet: .. Equal amounts of biotinylated cDNA prepared from medulla and heart (normalized based on the levels of flaB transcripts) were hybridized separately to Bb-CAL and the biotinylated cDNA-Bb-CAL hybrids bound to streptavidin-coated magnetic beads (Dynal, Lake Success, NY) as shown in . .. The Bb-CAL bound to the beads was eluted by boiling and PCR-amplified by using Uniamp primers, as described , and schematically outlined in .

    Article Title: Galectins control mTOR in response to endomembrane damage
    Article Snippet: .. Streptavidin–coated magnetic beads (ThermoFisher Scientific) were washed with RIPA lysis buffer. ..

    Article Title: High Affinity Binders to EphA2 Isolated from Abdurin Scaffold Libraries; Characterization, Binding and Tumor Targeting
    Article Snippet: .. 100 μl streptavidin coated magnetic beads (M280, Invitrogen, Carlsbad, California, USA) were then added for 15 minutes, to pull down the binders. .. The beads were then removed from the selection buffer and washed four times with 1 ml PBS, 0.1% Tween-20 and once with PBS (30 seconds per wash).

    Article Title: Phage-Derived Fully Human Monoclonal Antibody Fragments to Human Vascular Endothelial Growth Factor-C Block Its Interaction with VEGF Receptor-2 and 3
    Article Snippet: .. Prior to selection, 50 µl streptavidin coated magnetic beads (M-280 Dynabeads, Dynal Biotech, Oslo, Norway) per selection were blocked with 1 ml 3% BSA in PBS for 1 hour at room temperature and resuspended in 50 µl 2% BSA/PBS. .. 1 ml of antibody phage library (approximately 1012 tu in total) in 2% BSA/PBS was incubated with the biotinylated antigen at the above stated concentrations for 1 hour on a rotator at room temperature.

    Article Title: Histone modifications influence mediator interactions with chromatin
    Article Snippet: .. The above components were incubated at 4°C with rotation for 4 h. Twenty microliters of streptavidin coated magnetic beads (Invitrogen) were equilibrated with F-300 + 0.1 mg/ml BSA. .. After the histone tail peptide/Mediator incubation was complete, 10 µl was removed as the ‘input’ and the rest added to the equilibrated streptavidin beads.

    Article Title: Coactivator-Associated Arginine Methyltransferase 1 Enhances Transcriptional Activity of the Human T-Cell Lymphotropic Virus Type 1 Long Terminal Repeat through Direct Interaction with Tax
    Article Snippet: .. Briefly, PICs were assembled by incubating biotinylated HTLV-1 templates (4× TRE G-free cassette) with HeLa nuclear extracts in the absence or presence of the His6 -Tax wild type or mutant (del 151-204) and then purified with streptavidin-coated magnetic beads (Dynal Biotech). .. The protein components of PICs were analyzed by Western blotting with anti-Tab172, -CARM1, -CREB, or -p300 antibody (Upstate).

    Article Title: DNA sequencing using biotinylated dideoxynucleotides and mass spectrometry
    Article Snippet: .. Streptavidin-coated magnetic beads were obtained from Dynal Inc. (Oslo, Norway). ..

    Article Title: Cell-SELEX Based Identification of an RNA Aptamer for Escherichia coli and Its Use in Various Detection Formats
    Article Snippet: .. E. coli Aptamer-bead pull-down assay Truncated aptamer Ec3(31) with 3′ biotin, SQ2 mutant-biotin and N40 primer-biotin controls, were allowed to bind to 20 μl of streptavidin coated magnetic beads (dynabead, Invitrogen, USA) for 15 min at RT. yeast tRNA (0.1 mg/ml) and BSA (1 mg/ml) were added and the incubation was further continued for 45 min. Unbound aptamer were washed-off and this preblocked bead-aptamer complex were incubated with various cell density of E. coli (108 to 105 CFU/ml), in 1 ml of binding buffer, for 30 min at RT. .. The E. coli -aptamer-magnetic bead complex was separated from the unbound cells on a magnetic stand (Invitrogen).

    Article Title: Local palmitoylation cycles define activity-regulated postsynaptic subdomains
    Article Snippet: .. The lysates were spun at 20,000 g for 30 min at 4°C and the supernatants were mixed with streptavidin-coated magnetic beads (SA Dynabeads M-280; Invitrogen) for 2 h at 4°C. ..

    Article Title: A Novel Microtubule-Binding Drug Attenuates and Reverses Protein Aggregation in Animal Models of Alzheimer’s Disease
    Article Snippet: .. Biotinylated PNR502 was incubated with fresh lysate from AD hippocampus (a pool from three individuals) and captured on streptavidin-coated magnetic beads. .. After stringent washes, proteins eluted from the beads were resuspended in Laemmli buffer at > 95°C, and resolved by SDS-polyacrylamide gel electrophoresis.

    Article Title: A CADASIL-mutated Notch 3 receptor exhibits impaired intracellular trafficking and maturation but normal ligand-induced signaling
    Article Snippet: .. The remaining lysate (380 μl) was incubated with 100 μl of streptavidin-coated magnetic beads (Dynal, Oslo) overnight at +4°C. .. Precipitated proteins were recovered in 40 μl of 2× SDS/PAGE loading buffer and further processed by Western blot.

    Article Title: Architecture of nucleotide excision repair complexes: DNA is wrapped by UvrB before and after damage recognition
    Article Snippet: .. The purified biotinylated fragment was incubated with 1 mg of streptavidin-coated magnetic beads (Dynal M-280) for 2 h at 37°C in 200 µl of BW1 buffer (5 mM Tris–HCl pH 7.5, 0.5 mM EDTA, 3 M LiCl). .. Using a magnetic particle concentrator (Dynal), the immobilized DNA was washed three times with 100 µl of 2× BW1 buffer (10 mM Tris–HCl pH 7.5, 1 mM EDTA, 6 M LiCl).

    Article Title: A phosphorylation-and-ubiquitylation circuitry driving ATR activation and homologous recombination
    Article Snippet: .. Protein complex purification To capture SFB-tagged RFWD3 or PRP19 and its derivatives, cells were lysed in NETN buffer (50 mM Tris–HCl pH 7.5, 100 mM NaCl, 1 mM EDTA, 0.5% Igepal) containing protease and phosphatase inhibitors and incubated with streptavidin-coated magnetic beads (Life Technologies). ..

    Article Title: Design and synthesis of a photocleavable biotinylated nucleotide for DNA analysis by mass spectrometry
    Article Snippet: .. A portion of the reaction product (20 µl) was mixed with 15 µl of streptavidin-coated magnetic beads (Seradyn, Indianapolis) that had been pre-washed and resuspended in a modified binding and washing (B/W) buffer (0.5 mM Tris–HCl buffer, 2 M NH4 Cl, 1 mM EDTA, pH 7.0), and incubated for 30 min as described ( ). .. Then the beads were washed with 200 µl each of a modified B/W buffer, 0.1 M TEAA buffer and water.

    Article Title: A Novel Microtubule-Binding Drug Attenuates and Reverses Protein Aggregation in Animal Models of Alzheimer’s Disease
    Article Snippet: .. Bound, lightly digested protein was recovered on streptavidin-coated magnetic beads (Thermo Fisher Scientific, Waltham, MA, USA), and eluted peptides were analyzed by LC-MS/MS as described (Ayyadevara et al., , ). ..

    Mutagenesis:

    Article Title: Coactivator-Associated Arginine Methyltransferase 1 Enhances Transcriptional Activity of the Human T-Cell Lymphotropic Virus Type 1 Long Terminal Repeat through Direct Interaction with Tax
    Article Snippet: .. Briefly, PICs were assembled by incubating biotinylated HTLV-1 templates (4× TRE G-free cassette) with HeLa nuclear extracts in the absence or presence of the His6 -Tax wild type or mutant (del 151-204) and then purified with streptavidin-coated magnetic beads (Dynal Biotech). .. The protein components of PICs were analyzed by Western blotting with anti-Tab172, -CARM1, -CREB, or -p300 antibody (Upstate).

    Article Title: Cell-SELEX Based Identification of an RNA Aptamer for Escherichia coli and Its Use in Various Detection Formats
    Article Snippet: .. E. coli Aptamer-bead pull-down assay Truncated aptamer Ec3(31) with 3′ biotin, SQ2 mutant-biotin and N40 primer-biotin controls, were allowed to bind to 20 μl of streptavidin coated magnetic beads (dynabead, Invitrogen, USA) for 15 min at RT. yeast tRNA (0.1 mg/ml) and BSA (1 mg/ml) were added and the incubation was further continued for 45 min. Unbound aptamer were washed-off and this preblocked bead-aptamer complex were incubated with various cell density of E. coli (108 to 105 CFU/ml), in 1 ml of binding buffer, for 30 min at RT. .. The E. coli -aptamer-magnetic bead complex was separated from the unbound cells on a magnetic stand (Invitrogen).

    Isolation:

    Article Title: Borrelia burgdorferi transcriptome in the central nervous system of non-human primates
    Article Snippet: RNAs were isolated from the medulla and heart tissue of B. burgdorferi -infected NHPs (≈2–5 g of each tissue) by using the RNAWIZ RNA isolation reagent (Ambion, Austin, TX) according to the manufacturer's protocol. .. Equal amounts of biotinylated cDNA prepared from medulla and heart (normalized based on the levels of flaB transcripts) were hybridized separately to Bb-CAL and the biotinylated cDNA-Bb-CAL hybrids bound to streptavidin-coated magnetic beads (Dynal, Lake Success, NY) as shown in .

    Article Title: A Novel Microtubule-Binding Drug Attenuates and Reverses Protein Aggregation in Animal Models of Alzheimer’s Disease
    Article Snippet: Pulldown of PNR502 Binding Targets AD hippocampal tissue was flash frozen and stored at −80°C, and then pulverized in a mortar and pestle cooled on dry ice, just prior to isolation of total protein as described previously (Ayyadevara et al., ). .. Bound, lightly digested protein was recovered on streptavidin-coated magnetic beads (Thermo Fisher Scientific, Waltham, MA, USA), and eluted peptides were analyzed by LC-MS/MS as described (Ayyadevara et al., , ).

    Purification:

    Article Title: Histone modifications influence mediator interactions with chromatin
    Article Snippet: Histone tail peptide binding experiments Histone tail peptide binding reactions (110 µl) were performed in F-300 buffer [25 mM HEPES KOH (pH 7.6), 10% glycerol, 0.01% NP-40, 300 mM KOAc, 1 mM DTT] containing 0.1 mg/ml BSA combined with varying concentrations of biotinylated histone tail peptides (Millipore, US Biologicals) and purified untagged Mediator as specified in the figures. .. The above components were incubated at 4°C with rotation for 4 h. Twenty microliters of streptavidin coated magnetic beads (Invitrogen) were equilibrated with F-300 + 0.1 mg/ml BSA.

    Article Title: Coactivator-Associated Arginine Methyltransferase 1 Enhances Transcriptional Activity of the Human T-Cell Lymphotropic Virus Type 1 Long Terminal Repeat through Direct Interaction with Tax
    Article Snippet: .. Briefly, PICs were assembled by incubating biotinylated HTLV-1 templates (4× TRE G-free cassette) with HeLa nuclear extracts in the absence or presence of the His6 -Tax wild type or mutant (del 151-204) and then purified with streptavidin-coated magnetic beads (Dynal Biotech). .. The protein components of PICs were analyzed by Western blotting with anti-Tab172, -CARM1, -CREB, or -p300 antibody (Upstate).

    Article Title: Local palmitoylation cycles define activity-regulated postsynaptic subdomains
    Article Snippet: Paragraph title: Purification of palmitoylated PSD-95 ... The lysates were spun at 20,000 g for 30 min at 4°C and the supernatants were mixed with streptavidin-coated magnetic beads (SA Dynabeads M-280; Invitrogen) for 2 h at 4°C.

    Article Title: Architecture of nucleotide excision repair complexes: DNA is wrapped by UvrB before and after damage recognition
    Article Snippet: .. The purified biotinylated fragment was incubated with 1 mg of streptavidin-coated magnetic beads (Dynal M-280) for 2 h at 37°C in 200 µl of BW1 buffer (5 mM Tris–HCl pH 7.5, 0.5 mM EDTA, 3 M LiCl). .. Using a magnetic particle concentrator (Dynal), the immobilized DNA was washed three times with 100 µl of 2× BW1 buffer (10 mM Tris–HCl pH 7.5, 1 mM EDTA, 6 M LiCl).

    Article Title: A phosphorylation-and-ubiquitylation circuitry driving ATR activation and homologous recombination
    Article Snippet: .. Protein complex purification To capture SFB-tagged RFWD3 or PRP19 and its derivatives, cells were lysed in NETN buffer (50 mM Tris–HCl pH 7.5, 100 mM NaCl, 1 mM EDTA, 0.5% Igepal) containing protease and phosphatase inhibitors and incubated with streptavidin-coated magnetic beads (Life Technologies). ..

    Article Title: Design and synthesis of a photocleavable biotinylated nucleotide for DNA analysis by mass spectrometry
    Article Snippet: Prior to photolysis, the extension reaction products were purified and analyzed by MALDI-TOF MS to verify the incorporation of dUTP-PC-Biotin. .. A portion of the reaction product (20 µl) was mixed with 15 µl of streptavidin-coated magnetic beads (Seradyn, Indianapolis) that had been pre-washed and resuspended in a modified binding and washing (B/W) buffer (0.5 mM Tris–HCl buffer, 2 M NH4 Cl, 1 mM EDTA, pH 7.0), and incubated for 30 min as described ( ).

    SDS Page:

    Article Title: A CADASIL-mutated Notch 3 receptor exhibits impaired intracellular trafficking and maturation but normal ligand-induced signaling
    Article Snippet: The remaining lysate (380 μl) was incubated with 100 μl of streptavidin-coated magnetic beads (Dynal, Oslo) overnight at +4°C. .. Precipitated proteins were recovered in 40 μl of 2× SDS/PAGE loading buffer and further processed by Western blot.

    Plasmid Preparation:

    Article Title: Local palmitoylation cycles define activity-regulated postsynaptic subdomains
    Article Snippet: Purification of palmitoylated PSD-95 To purify full-length palmitoylated PSD-95 as the antigen, PSD-95-GFP was fused to a PSTCD tag (see Plasmid constructions), which undergoes biotinylation by endogenous enzymes in mammalian cells ( ). .. The lysates were spun at 20,000 g for 30 min at 4°C and the supernatants were mixed with streptavidin-coated magnetic beads (SA Dynabeads M-280; Invitrogen) for 2 h at 4°C.

    Multiplex Assay:

    Article Title: Design and synthesis of a photocleavable biotinylated nucleotide for DNA analysis by mass spectrometry
    Article Snippet: The extension reaction consisted of 25 cycles of 94°C for 20 s, 48°C for 40 s and 72°C for 20 s. For the multiplex extension reaction, 60 pmol of template 1 , 20 pmol of template 2 and 50 pmol each of four primers were mixed with 320 pmol of dUTP-PC-Biotin, 200 pmol of ddGTP, 10 µl of 10× reaction buffer and 8 U of DNA polymerase Thermo Sequenase in a total volume of 100 µl. .. A portion of the reaction product (20 µl) was mixed with 15 µl of streptavidin-coated magnetic beads (Seradyn, Indianapolis) that had been pre-washed and resuspended in a modified binding and washing (B/W) buffer (0.5 mM Tris–HCl buffer, 2 M NH4 Cl, 1 mM EDTA, pH 7.0), and incubated for 30 min as described ( ).

    Selection:

    Article Title: Borrelia burgdorferi transcriptome in the central nervous system of non-human primates
    Article Snippet: Positive Selection and Amplification. .. Equal amounts of biotinylated cDNA prepared from medulla and heart (normalized based on the levels of flaB transcripts) were hybridized separately to Bb-CAL and the biotinylated cDNA-Bb-CAL hybrids bound to streptavidin-coated magnetic beads (Dynal, Lake Success, NY) as shown in .

    Article Title: High Affinity Binders to EphA2 Isolated from Abdurin Scaffold Libraries; Characterization, Binding and Tumor Targeting
    Article Snippet: After expression, the samples were diluted 5-fold in selection buffer containing 2% bovine serum albumin (BSA), in PBS. .. 100 μl streptavidin coated magnetic beads (M280, Invitrogen, Carlsbad, California, USA) were then added for 15 minutes, to pull down the binders.

    Article Title: Phage-Derived Fully Human Monoclonal Antibody Fragments to Human Vascular Endothelial Growth Factor-C Block Its Interaction with VEGF Receptor-2 and 3
    Article Snippet: .. Prior to selection, 50 µl streptavidin coated magnetic beads (M-280 Dynabeads, Dynal Biotech, Oslo, Norway) per selection were blocked with 1 ml 3% BSA in PBS for 1 hour at room temperature and resuspended in 50 µl 2% BSA/PBS. .. 1 ml of antibody phage library (approximately 1012 tu in total) in 2% BSA/PBS was incubated with the biotinylated antigen at the above stated concentrations for 1 hour on a rotator at room temperature.

    In Vitro:

    Article Title: High Affinity Binders to EphA2 Isolated from Abdurin Scaffold Libraries; Characterization, Binding and Tumor Targeting
    Article Snippet: Generally, in vitro transcription and translations (IVTT) were performed as previously described [ , ]. .. 100 μl streptavidin coated magnetic beads (M280, Invitrogen, Carlsbad, California, USA) were then added for 15 minutes, to pull down the binders.

    Random Hexamer Labeling:

    Article Title: Borrelia burgdorferi transcriptome in the central nervous system of non-human primates
    Article Snippet: One microgram of total RNA was used to prepare biotinylated cDNA by using biotinylated random hexamer primers, biotin-dATP, and the SuperScript First Strand synthesis system for reverse transcription (Life Technologies, Gaithersburg, MD), essentially as described ( ). .. Equal amounts of biotinylated cDNA prepared from medulla and heart (normalized based on the levels of flaB transcripts) were hybridized separately to Bb-CAL and the biotinylated cDNA-Bb-CAL hybrids bound to streptavidin-coated magnetic beads (Dynal, Lake Success, NY) as shown in .

    Produced:

    Article Title: Architecture of nucleotide excision repair complexes: DNA is wrapped by UvrB before and after damage recognition
    Article Snippet: Using the URA3 gene from S.cerevisiae as a template, PCR with primers U3 (GAAGGAAGAACGAAGGAAGGAGC) and UH4NB, which is 5′ biotinylated (TTTCCCGGGGGGCCCGGGTAATAACTGATATAATT), produced a fragment of 1032 nucleotides. .. The purified biotinylated fragment was incubated with 1 mg of streptavidin-coated magnetic beads (Dynal M-280) for 2 h at 37°C in 200 µl of BW1 buffer (5 mM Tris–HCl pH 7.5, 0.5 mM EDTA, 3 M LiCl).

    Concentration Assay:

    Article Title: Cell-SELEX Based Identification of an RNA Aptamer for Escherichia coli and Its Use in Various Detection Formats
    Article Snippet: E. coli Aptamer-bead pull-down assay Truncated aptamer Ec3(31) with 3′ biotin, SQ2 mutant-biotin and N40 primer-biotin controls, were allowed to bind to 20 μl of streptavidin coated magnetic beads (dynabead, Invitrogen, USA) for 15 min at RT. yeast tRNA (0.1 mg/ml) and BSA (1 mg/ml) were added and the incubation was further continued for 45 min. Unbound aptamer were washed-off and this preblocked bead-aptamer complex were incubated with various cell density of E. coli (108 to 105 CFU/ml), in 1 ml of binding buffer, for 30 min at RT. .. To calculate the colony forming units/ml (CFU/ml), innoculum from serial dilutions of the starting E. coli cell concentration was plated on the LB plate.

    Lysis:

    Article Title: Galectins control mTOR in response to endomembrane damage
    Article Snippet: .. Streptavidin–coated magnetic beads (ThermoFisher Scientific) were washed with RIPA lysis buffer. ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Thermo Fisher streptavidin coated magnetic beads
    Gal8 is in dynamic complexes with mTOR and its regulators and adaptors (A) Galectin puncta formation in response to GPN. Cells expressing YFP-galectin fusions were treated with 100 μM GPN or without (Ctrl) in full medium for 1 h and galectin puncta quantified by HC. Left, images of galectins 1, 3, 8, and 9. White masks, algorithm-defined cell boundaries (primary objects); green masks, computer-identified galectin puncta (target objects). (B) Co-immunoprecipitation (Co-IP) analysis of galectins and mTOR or RagA. Cells expressing FLAG-tagged galectins were subjected to anti-FLAG immunoprecipitation followed by immunoblotting for endogenous mTOR or RagA. (C) Co-IP analysis of endogenous proteins in macrophage-like cells treated with 100 μM GPN in full medium1 h. IP: anti-Gal8; immunoblotting: endogenous RagA, p14, mTOR and Raptor. (D) APEX2 proximity biotinylation analysis. Cells were transfected with APEX2 fusions with Gal3, 8 and 9, incubated or not with biotin-phenol, pulsed with H 2 O 2 , and biotinylated proteins affinity-isolated on <t>streptavidin-beads</t> analyzed by immunoblotting. (E) Proximity biotinylation as in D in response to GPN. BP, biotin-phenol. (F)(i-ii) GST pulldown assay of in vitro translated and radiolabeled Myc-tagged p18 with GST, or GST-tagged Gal8 and Gal9. Data (% binding). (G)(i-ii) GST pulldown assay of in vitro translated Myc-tagged Gal8 or Gal9 with GST or GST-tagged RagB/D. Data as in F. (H) Cells transfected with GFP-Gal8 and FLAG-tagged metap2 (negative control) or RagB variants (RagB WT , RagB T54L or RagB Q99L ) were subjected to anti-GFP IP, followed by immunoblotting for FLAG-tagged proteins or GFP. (I) Cells transfected with GFP-Gal8 and FLAG-tagged metap2 or RagC variants (RagC WT , RagC S75L or RagC Q120L .
    Streptavidin Coated Magnetic Beads, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 385 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/streptavidin coated magnetic beads/product/Thermo Fisher
    Average 90 stars, based on 385 article reviews
    Price from $9.99 to $1999.99
    streptavidin coated magnetic beads - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    Image Search Results


    Gal8 is in dynamic complexes with mTOR and its regulators and adaptors (A) Galectin puncta formation in response to GPN. Cells expressing YFP-galectin fusions were treated with 100 μM GPN or without (Ctrl) in full medium for 1 h and galectin puncta quantified by HC. Left, images of galectins 1, 3, 8, and 9. White masks, algorithm-defined cell boundaries (primary objects); green masks, computer-identified galectin puncta (target objects). (B) Co-immunoprecipitation (Co-IP) analysis of galectins and mTOR or RagA. Cells expressing FLAG-tagged galectins were subjected to anti-FLAG immunoprecipitation followed by immunoblotting for endogenous mTOR or RagA. (C) Co-IP analysis of endogenous proteins in macrophage-like cells treated with 100 μM GPN in full medium1 h. IP: anti-Gal8; immunoblotting: endogenous RagA, p14, mTOR and Raptor. (D) APEX2 proximity biotinylation analysis. Cells were transfected with APEX2 fusions with Gal3, 8 and 9, incubated or not with biotin-phenol, pulsed with H 2 O 2 , and biotinylated proteins affinity-isolated on streptavidin-beads analyzed by immunoblotting. (E) Proximity biotinylation as in D in response to GPN. BP, biotin-phenol. (F)(i-ii) GST pulldown assay of in vitro translated and radiolabeled Myc-tagged p18 with GST, or GST-tagged Gal8 and Gal9. Data (% binding). (G)(i-ii) GST pulldown assay of in vitro translated Myc-tagged Gal8 or Gal9 with GST or GST-tagged RagB/D. Data as in F. (H) Cells transfected with GFP-Gal8 and FLAG-tagged metap2 (negative control) or RagB variants (RagB WT , RagB T54L or RagB Q99L ) were subjected to anti-GFP IP, followed by immunoblotting for FLAG-tagged proteins or GFP. (I) Cells transfected with GFP-Gal8 and FLAG-tagged metap2 or RagC variants (RagC WT , RagC S75L or RagC Q120L .

    Journal: Molecular cell

    Article Title: Galectins control mTOR in response to endomembrane damage

    doi: 10.1016/j.molcel.2018.03.009

    Figure Lengend Snippet: Gal8 is in dynamic complexes with mTOR and its regulators and adaptors (A) Galectin puncta formation in response to GPN. Cells expressing YFP-galectin fusions were treated with 100 μM GPN or without (Ctrl) in full medium for 1 h and galectin puncta quantified by HC. Left, images of galectins 1, 3, 8, and 9. White masks, algorithm-defined cell boundaries (primary objects); green masks, computer-identified galectin puncta (target objects). (B) Co-immunoprecipitation (Co-IP) analysis of galectins and mTOR or RagA. Cells expressing FLAG-tagged galectins were subjected to anti-FLAG immunoprecipitation followed by immunoblotting for endogenous mTOR or RagA. (C) Co-IP analysis of endogenous proteins in macrophage-like cells treated with 100 μM GPN in full medium1 h. IP: anti-Gal8; immunoblotting: endogenous RagA, p14, mTOR and Raptor. (D) APEX2 proximity biotinylation analysis. Cells were transfected with APEX2 fusions with Gal3, 8 and 9, incubated or not with biotin-phenol, pulsed with H 2 O 2 , and biotinylated proteins affinity-isolated on streptavidin-beads analyzed by immunoblotting. (E) Proximity biotinylation as in D in response to GPN. BP, biotin-phenol. (F)(i-ii) GST pulldown assay of in vitro translated and radiolabeled Myc-tagged p18 with GST, or GST-tagged Gal8 and Gal9. Data (% binding). (G)(i-ii) GST pulldown assay of in vitro translated Myc-tagged Gal8 or Gal9 with GST or GST-tagged RagB/D. Data as in F. (H) Cells transfected with GFP-Gal8 and FLAG-tagged metap2 (negative control) or RagB variants (RagB WT , RagB T54L or RagB Q99L ) were subjected to anti-GFP IP, followed by immunoblotting for FLAG-tagged proteins or GFP. (I) Cells transfected with GFP-Gal8 and FLAG-tagged metap2 or RagC variants (RagC WT , RagC S75L or RagC Q120L .

    Article Snippet: Streptavidin–coated magnetic beads (ThermoFisher Scientific) were washed with RIPA lysis buffer.

    Techniques: Expressing, Immunoprecipitation, Co-Immunoprecipitation Assay, Transfection, Incubation, Isolation, GST Pulldown Assay, In Vitro, Binding Assay, Negative Control

    3D Schematic of the presented mechanism for bacteria detection using electrical sensing of pathogen lysate Process flow for bacteria capture and detection: (i) Sample containing target pathogen is suspended with magnetic beads coated with streptavidin and conjugated with biotinylated antibodies and incubated for 30 minutes, (ii) The conjugated beads are isolated using a magnetic stand, (iii) The beads are washed using 10 % glycerol in DI water 4 times to remove unbound bacteria and electrically conductive solution. The captured bacteria are then lysed using 5 % Triton X-100 solution and sonication, (iv) Beads are isolated using magnetic stand, (v) The bacteria lysate is loaded onto a microchip with interdigitated electrodes for detection through impedance spectroscopy.

    Journal: Biosensors & bioelectronics

    Article Title: Label-free electrical sensing of bacteria in eye wash samples: A step towards point-of-care detection of pathogens in patients with infectious keratitis

    doi: 10.1016/j.bios.2016.12.035

    Figure Lengend Snippet: 3D Schematic of the presented mechanism for bacteria detection using electrical sensing of pathogen lysate Process flow for bacteria capture and detection: (i) Sample containing target pathogen is suspended with magnetic beads coated with streptavidin and conjugated with biotinylated antibodies and incubated for 30 minutes, (ii) The conjugated beads are isolated using a magnetic stand, (iii) The beads are washed using 10 % glycerol in DI water 4 times to remove unbound bacteria and electrically conductive solution. The captured bacteria are then lysed using 5 % Triton X-100 solution and sonication, (iv) Beads are isolated using magnetic stand, (v) The bacteria lysate is loaded onto a microchip with interdigitated electrodes for detection through impedance spectroscopy.

    Article Snippet: Streptavidin-coated magnetic beads (1 µm diameter, Thermo fisher scientific-Pierce™ Streptavidin Magnetic Beads 88816) were washed three times using PBS in a micro-centrifuge tube.

    Techniques: Flow Cytometry, Magnetic Beads, Incubation, Isolation, Sonication, MicroChIP Assay, Impedance Spectroscopy

    Biotinylated PNR502 localizes to aggregates in AM141 worms and is used to recover drug-adherent proteins. (A) Structure of biotinyl-PNR502. (B,C) AM141 adult worms were either untreated (B) or treated 26 h (C) with 10-μM PNR502 and then fed Alexa594-conjugated streptavidin (Thermo Fisher Scientific, Waltham, MA, USA). Fluorescence images were captured with a Nikon DS-Fi2 camera mounted on a Nikon C2 inverted microscope. Q40::YFP is displayed as green, and Alexa594 as red fluorescence. Yellow fluorescence in (C) indicates the superposition of Q40::YFP with PNR502-Alexa594. (D) Caudal hippocampi, from normal age-matched controls (AMC) or AD patients (pools of three per group), were lysed and incubated 2 h at 4°C with 5-μM PNR502 or biotinyl-PNR502. M , size markers; lanes 1–4, proteins recovered from: 1 , unmodified PNR502; 2 , biotinyl-PNR502; 3 , equivalent portion of flow-through for unmodified PNR502; 4 , flow-through from biotinyl-PNR502.

    Journal: Frontiers in Molecular Neuroscience

    Article Title: A Novel Microtubule-Binding Drug Attenuates and Reverses Protein Aggregation in Animal Models of Alzheimer’s Disease

    doi: 10.3389/fnmol.2019.00310

    Figure Lengend Snippet: Biotinylated PNR502 localizes to aggregates in AM141 worms and is used to recover drug-adherent proteins. (A) Structure of biotinyl-PNR502. (B,C) AM141 adult worms were either untreated (B) or treated 26 h (C) with 10-μM PNR502 and then fed Alexa594-conjugated streptavidin (Thermo Fisher Scientific, Waltham, MA, USA). Fluorescence images were captured with a Nikon DS-Fi2 camera mounted on a Nikon C2 inverted microscope. Q40::YFP is displayed as green, and Alexa594 as red fluorescence. Yellow fluorescence in (C) indicates the superposition of Q40::YFP with PNR502-Alexa594. (D) Caudal hippocampi, from normal age-matched controls (AMC) or AD patients (pools of three per group), were lysed and incubated 2 h at 4°C with 5-μM PNR502 or biotinyl-PNR502. M , size markers; lanes 1–4, proteins recovered from: 1 , unmodified PNR502; 2 , biotinyl-PNR502; 3 , equivalent portion of flow-through for unmodified PNR502; 4 , flow-through from biotinyl-PNR502.

    Article Snippet: Bound, lightly digested protein was recovered on streptavidin-coated magnetic beads (Thermo Fisher Scientific, Waltham, MA, USA), and eluted peptides were analyzed by LC-MS/MS as described (Ayyadevara et al., , ).

    Techniques: Fluorescence, Inverted Microscopy, Incubation, Flow Cytometry