Structured Review

Solulink streptavidin agarose
ZCCHC3 binds to dsDNA. a ZCCHC3 binds to dsDNA. HEK293 cells were transfected with the indicated plasmids. Twenty hours later, the cell lysates were incubated with the indicated biotinylated nucleic acids and <t>streptavidin-Sepharose</t> beads for in vitro pull-down assays. The bound proteins were then analyzed by immunoblots with anti-HA. b ZCCHC3 binds to dsDNA through its C-terminal ZF domains. HEK293 cells were transfected with the indicated plasmids. Twenty hours after transfection, the cell lysates were incubated with biotinylated-HSV120 and streptavidin-Sepharose beads. The bound proteins were analyzed by immunoblots with anti-Flag. A schematic representation of ZCCHC3 and its truncation mutants was shown on the left. c ZCCHC3 and cGAS but not RIG-I bind to HSV-1 DNA of infected cells. HEK293 cells were transfected with HA-tagged ZCCHC3, cGAS, and RIG-I. Twenty hours after transfection, cells were infected with HSV-1for 3 h. Cell lysates were then immunoprecipitated with control IgG or anti-HA. The protein-bound DNAs were extracted and analyzed by qPCR analysis with primers corresponding to the indicated regions of HSV-1 genome. Positive ( + ) and negative (-) detections were shown at the top of the schematic presentation of the HSV-1 genome. A representative qPCR results were shown at the left. **P
Streptavidin Agarose, supplied by Solulink, used in various techniques. Bioz Stars score: 93/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/streptavidin agarose/product/Solulink
Average 93 stars, based on 3 article reviews
Price from $9.99 to $1999.99
streptavidin agarose - by Bioz Stars, 2020-01
93/100 stars

Images

1) Product Images from "ZCCHC3 is a co-sensor of cGAS for dsDNA recognition in innate immune response"

Article Title: ZCCHC3 is a co-sensor of cGAS for dsDNA recognition in innate immune response

Journal: Nature Communications

doi: 10.1038/s41467-018-05559-w

ZCCHC3 binds to dsDNA. a ZCCHC3 binds to dsDNA. HEK293 cells were transfected with the indicated plasmids. Twenty hours later, the cell lysates were incubated with the indicated biotinylated nucleic acids and streptavidin-Sepharose beads for in vitro pull-down assays. The bound proteins were then analyzed by immunoblots with anti-HA. b ZCCHC3 binds to dsDNA through its C-terminal ZF domains. HEK293 cells were transfected with the indicated plasmids. Twenty hours after transfection, the cell lysates were incubated with biotinylated-HSV120 and streptavidin-Sepharose beads. The bound proteins were analyzed by immunoblots with anti-Flag. A schematic representation of ZCCHC3 and its truncation mutants was shown on the left. c ZCCHC3 and cGAS but not RIG-I bind to HSV-1 DNA of infected cells. HEK293 cells were transfected with HA-tagged ZCCHC3, cGAS, and RIG-I. Twenty hours after transfection, cells were infected with HSV-1for 3 h. Cell lysates were then immunoprecipitated with control IgG or anti-HA. The protein-bound DNAs were extracted and analyzed by qPCR analysis with primers corresponding to the indicated regions of HSV-1 genome. Positive ( + ) and negative (-) detections were shown at the top of the schematic presentation of the HSV-1 genome. A representative qPCR results were shown at the left. **P
Figure Legend Snippet: ZCCHC3 binds to dsDNA. a ZCCHC3 binds to dsDNA. HEK293 cells were transfected with the indicated plasmids. Twenty hours later, the cell lysates were incubated with the indicated biotinylated nucleic acids and streptavidin-Sepharose beads for in vitro pull-down assays. The bound proteins were then analyzed by immunoblots with anti-HA. b ZCCHC3 binds to dsDNA through its C-terminal ZF domains. HEK293 cells were transfected with the indicated plasmids. Twenty hours after transfection, the cell lysates were incubated with biotinylated-HSV120 and streptavidin-Sepharose beads. The bound proteins were analyzed by immunoblots with anti-Flag. A schematic representation of ZCCHC3 and its truncation mutants was shown on the left. c ZCCHC3 and cGAS but not RIG-I bind to HSV-1 DNA of infected cells. HEK293 cells were transfected with HA-tagged ZCCHC3, cGAS, and RIG-I. Twenty hours after transfection, cells were infected with HSV-1for 3 h. Cell lysates were then immunoprecipitated with control IgG or anti-HA. The protein-bound DNAs were extracted and analyzed by qPCR analysis with primers corresponding to the indicated regions of HSV-1 genome. Positive ( + ) and negative (-) detections were shown at the top of the schematic presentation of the HSV-1 genome. A representative qPCR results were shown at the left. **P

Techniques Used: Transfection, Incubation, In Vitro, Western Blot, Infection, Immunoprecipitation, Real-time Polymerase Chain Reaction

ZCCHC3 binds to dsDNA and facilitates the binding of cGAS to dsDNA. a ZCCHC3 enhances the binding of cGAS to dsDNA. HEK293 cells were transfected with the indicated plasmids. Twenty hours later, the cell lysates were incubated with biotinylated-HSV120 and streptavidin-Sepharose beads for in vitro pull-down assays. The bound proteins were then analyzed by immunoblots with anti-HA and anti-ZCCHC3. b ZCCHC3-deficiency decreases the binding of cGAS to dsDNA in HEK293 cells. ZCCHC3-KO HEK293 clones were generated by the CRISPR-Cas9 method. ZCCHC3-KO and control HEK293 cells were transfected with HA-cGAS. Twenty hours after transfection, cells were collected for in vitro pull-down assays similarly as in a . c ZCCHC3-deficiency decreases the binding of endogenous cGAS to dsDNA in MLFs or MEFs. Zcchc3 +/+ and Zcchc3 − / − MLFs or MEFs were collected for in vitro pull-down assays. The bound proteins were then analyzed by immunoblots with anti-cGAS and anti-ZCCHC3. d MST measurement of binding affinities. Binding affinities between the indicated recombinant proteins as well as between the indicated recombinant proteins and synthetic dsDNA HSV60 were measured by MST. The purified recombinant proteins were stained with Coomassie blue (right gel). e Effects of reconstitution of ZCCHC3 or ZCCHC3 (1-340) on HSV-1-induced transcription of downstream genes in Zcchc3 − / − MLFs. Zcchc3 − / − MLFs were reconstituted with murine ZCCHC3 or ZCCHC3(1-340) by lentiviral-mediated gene transfer. The reconstituted MLFs were left un-infected or infected with HSV-1 for 6 h before qPCR analysis. f Effects of ZCCHC3 on transcription of downstream genes induced by HSV120 in cGas +/+ and cGas − / − L929 cells. cGas +/+ and cGas − / − L929 cells stably expressing ZCCHC3 were transfected with HSV120 (3 μg/ml) for 4 h before qPCR analysis. *P
Figure Legend Snippet: ZCCHC3 binds to dsDNA and facilitates the binding of cGAS to dsDNA. a ZCCHC3 enhances the binding of cGAS to dsDNA. HEK293 cells were transfected with the indicated plasmids. Twenty hours later, the cell lysates were incubated with biotinylated-HSV120 and streptavidin-Sepharose beads for in vitro pull-down assays. The bound proteins were then analyzed by immunoblots with anti-HA and anti-ZCCHC3. b ZCCHC3-deficiency decreases the binding of cGAS to dsDNA in HEK293 cells. ZCCHC3-KO HEK293 clones were generated by the CRISPR-Cas9 method. ZCCHC3-KO and control HEK293 cells were transfected with HA-cGAS. Twenty hours after transfection, cells were collected for in vitro pull-down assays similarly as in a . c ZCCHC3-deficiency decreases the binding of endogenous cGAS to dsDNA in MLFs or MEFs. Zcchc3 +/+ and Zcchc3 − / − MLFs or MEFs were collected for in vitro pull-down assays. The bound proteins were then analyzed by immunoblots with anti-cGAS and anti-ZCCHC3. d MST measurement of binding affinities. Binding affinities between the indicated recombinant proteins as well as between the indicated recombinant proteins and synthetic dsDNA HSV60 were measured by MST. The purified recombinant proteins were stained with Coomassie blue (right gel). e Effects of reconstitution of ZCCHC3 or ZCCHC3 (1-340) on HSV-1-induced transcription of downstream genes in Zcchc3 − / − MLFs. Zcchc3 − / − MLFs were reconstituted with murine ZCCHC3 or ZCCHC3(1-340) by lentiviral-mediated gene transfer. The reconstituted MLFs were left un-infected or infected with HSV-1 for 6 h before qPCR analysis. f Effects of ZCCHC3 on transcription of downstream genes induced by HSV120 in cGas +/+ and cGas − / − L929 cells. cGas +/+ and cGas − / − L929 cells stably expressing ZCCHC3 were transfected with HSV120 (3 μg/ml) for 4 h before qPCR analysis. *P

Techniques Used: Binding Assay, Transfection, Incubation, In Vitro, Western Blot, Clone Assay, Generated, CRISPR, Microscale Thermophoresis, Recombinant, Purification, Staining, Infection, Real-time Polymerase Chain Reaction, Stable Transfection, Expressing

2) Product Images from "ZCCHC3 is a co-sensor of cGAS for dsDNA recognition in innate immune response"

Article Title: ZCCHC3 is a co-sensor of cGAS for dsDNA recognition in innate immune response

Journal: Nature Communications

doi: 10.1038/s41467-018-05559-w

ZCCHC3 binds to dsDNA. a ZCCHC3 binds to dsDNA. HEK293 cells were transfected with the indicated plasmids. Twenty hours later, the cell lysates were incubated with the indicated biotinylated nucleic acids and streptavidin-Sepharose beads for in vitro pull-down assays. The bound proteins were then analyzed by immunoblots with anti-HA. b ZCCHC3 binds to dsDNA through its C-terminal ZF domains. HEK293 cells were transfected with the indicated plasmids. Twenty hours after transfection, the cell lysates were incubated with biotinylated-HSV120 and streptavidin-Sepharose beads. The bound proteins were analyzed by immunoblots with anti-Flag. A schematic representation of ZCCHC3 and its truncation mutants was shown on the left. c ZCCHC3 and cGAS but not RIG-I bind to HSV-1 DNA of infected cells. HEK293 cells were transfected with HA-tagged ZCCHC3, cGAS, and RIG-I. Twenty hours after transfection, cells were infected with HSV-1for 3 h. Cell lysates were then immunoprecipitated with control IgG or anti-HA. The protein-bound DNAs were extracted and analyzed by qPCR analysis with primers corresponding to the indicated regions of HSV-1 genome. Positive ( + ) and negative (-) detections were shown at the top of the schematic presentation of the HSV-1 genome. A representative qPCR results were shown at the left. **P
Figure Legend Snippet: ZCCHC3 binds to dsDNA. a ZCCHC3 binds to dsDNA. HEK293 cells were transfected with the indicated plasmids. Twenty hours later, the cell lysates were incubated with the indicated biotinylated nucleic acids and streptavidin-Sepharose beads for in vitro pull-down assays. The bound proteins were then analyzed by immunoblots with anti-HA. b ZCCHC3 binds to dsDNA through its C-terminal ZF domains. HEK293 cells were transfected with the indicated plasmids. Twenty hours after transfection, the cell lysates were incubated with biotinylated-HSV120 and streptavidin-Sepharose beads. The bound proteins were analyzed by immunoblots with anti-Flag. A schematic representation of ZCCHC3 and its truncation mutants was shown on the left. c ZCCHC3 and cGAS but not RIG-I bind to HSV-1 DNA of infected cells. HEK293 cells were transfected with HA-tagged ZCCHC3, cGAS, and RIG-I. Twenty hours after transfection, cells were infected with HSV-1for 3 h. Cell lysates were then immunoprecipitated with control IgG or anti-HA. The protein-bound DNAs were extracted and analyzed by qPCR analysis with primers corresponding to the indicated regions of HSV-1 genome. Positive ( + ) and negative (-) detections were shown at the top of the schematic presentation of the HSV-1 genome. A representative qPCR results were shown at the left. **P

Techniques Used: Transfection, Incubation, In Vitro, Western Blot, Infection, Immunoprecipitation, Real-time Polymerase Chain Reaction

ZCCHC3 binds to dsDNA and facilitates the binding of cGAS to dsDNA. a ZCCHC3 enhances the binding of cGAS to dsDNA. HEK293 cells were transfected with the indicated plasmids. Twenty hours later, the cell lysates were incubated with biotinylated-HSV120 and streptavidin-Sepharose beads for in vitro pull-down assays. The bound proteins were then analyzed by immunoblots with anti-HA and anti-ZCCHC3. b ZCCHC3-deficiency decreases the binding of cGAS to dsDNA in HEK293 cells. ZCCHC3-KO HEK293 clones were generated by the CRISPR-Cas9 method. ZCCHC3-KO and control HEK293 cells were transfected with HA-cGAS. Twenty hours after transfection, cells were collected for in vitro pull-down assays similarly as in a . c ZCCHC3-deficiency decreases the binding of endogenous cGAS to dsDNA in MLFs or MEFs. Zcchc3 +/+ and Zcchc3 − / − MLFs or MEFs were collected for in vitro pull-down assays. The bound proteins were then analyzed by immunoblots with anti-cGAS and anti-ZCCHC3. d MST measurement of binding affinities. Binding affinities between the indicated recombinant proteins as well as between the indicated recombinant proteins and synthetic dsDNA HSV60 were measured by MST. The purified recombinant proteins were stained with Coomassie blue (right gel). e Effects of reconstitution of ZCCHC3 or ZCCHC3 (1-340) on HSV-1-induced transcription of downstream genes in Zcchc3 − / − MLFs. Zcchc3 − / − MLFs were reconstituted with murine ZCCHC3 or ZCCHC3(1-340) by lentiviral-mediated gene transfer. The reconstituted MLFs were left un-infected or infected with HSV-1 for 6 h before qPCR analysis. f Effects of ZCCHC3 on transcription of downstream genes induced by HSV120 in cGas +/+ and cGas − / − L929 cells. cGas +/+ and cGas − / − L929 cells stably expressing ZCCHC3 were transfected with HSV120 (3 μg/ml) for 4 h before qPCR analysis. *P
Figure Legend Snippet: ZCCHC3 binds to dsDNA and facilitates the binding of cGAS to dsDNA. a ZCCHC3 enhances the binding of cGAS to dsDNA. HEK293 cells were transfected with the indicated plasmids. Twenty hours later, the cell lysates were incubated with biotinylated-HSV120 and streptavidin-Sepharose beads for in vitro pull-down assays. The bound proteins were then analyzed by immunoblots with anti-HA and anti-ZCCHC3. b ZCCHC3-deficiency decreases the binding of cGAS to dsDNA in HEK293 cells. ZCCHC3-KO HEK293 clones were generated by the CRISPR-Cas9 method. ZCCHC3-KO and control HEK293 cells were transfected with HA-cGAS. Twenty hours after transfection, cells were collected for in vitro pull-down assays similarly as in a . c ZCCHC3-deficiency decreases the binding of endogenous cGAS to dsDNA in MLFs or MEFs. Zcchc3 +/+ and Zcchc3 − / − MLFs or MEFs were collected for in vitro pull-down assays. The bound proteins were then analyzed by immunoblots with anti-cGAS and anti-ZCCHC3. d MST measurement of binding affinities. Binding affinities between the indicated recombinant proteins as well as between the indicated recombinant proteins and synthetic dsDNA HSV60 were measured by MST. The purified recombinant proteins were stained with Coomassie blue (right gel). e Effects of reconstitution of ZCCHC3 or ZCCHC3 (1-340) on HSV-1-induced transcription of downstream genes in Zcchc3 − / − MLFs. Zcchc3 − / − MLFs were reconstituted with murine ZCCHC3 or ZCCHC3(1-340) by lentiviral-mediated gene transfer. The reconstituted MLFs were left un-infected or infected with HSV-1 for 6 h before qPCR analysis. f Effects of ZCCHC3 on transcription of downstream genes induced by HSV120 in cGas +/+ and cGas − / − L929 cells. cGas +/+ and cGas − / − L929 cells stably expressing ZCCHC3 were transfected with HSV120 (3 μg/ml) for 4 h before qPCR analysis. *P

Techniques Used: Binding Assay, Transfection, Incubation, In Vitro, Western Blot, Clone Assay, Generated, CRISPR, Microscale Thermophoresis, Recombinant, Purification, Staining, Infection, Real-time Polymerase Chain Reaction, Stable Transfection, Expressing

3) Product Images from "The RNA-binding protein Mex3B is a coreceptor of Toll-like receptor 3 in innate antiviral response"

Article Title: The RNA-binding protein Mex3B is a coreceptor of Toll-like receptor 3 in innate antiviral response

Journal: Cell Research

doi: 10.1038/cr.2016.16

Mex3B colocalizes with TLR3 in the endosome and promotes the processing, stability and ligand binding of TLR3. (A) Mex3B colocalizes with TLR3 in the endosomes. The 293 cells (1 × 10 5 ) were cotransfected with Mex3B-HA and TLR3-Flag plus KDEL-GFP (ER marker), EEA1-GFP (early endosome marker) or LAMP-1-GFP (lysosome marker). Twenty hours after transfection, cells were fixed with 4% paraformaldehyde, stained with anti-Flag and anti-HA antibodies, and subjected to confocal microscopy. (B) Mex3B is sorted into the lumen of endosomes. HCT116 (Mex3B-3×Flag) cells (4 × 10 8 ) were collected and washed twice with ice-cold PBS. Endosome/lysosome fractions were isolated and either left untreated, treated with proteinase K (5 ng/ml) or treated with proteinase plus 0.1% Triton X-100 for 15 min at room temperature. The samples were then analyzed with the indicated antibodies. (C) Overexpression of Mex3B increases the abundance of processed C-terminal fragment of TLR3. The 293 cells (2 × 10 5 ) were transfected with the indicated plasmids. Twenty-four hours after transfection, cells were treated with poly(I:C) (20 μg/ml) for the indicated times before immunoblot. The relative amount of total TLR3 was quantitated by the Bio-Rad Quantity One program. (D) Knockdown of Mex3B affects the stability of TLR3. The 293 cells (2 × 10 5 ) were transfected with TLR3 (0.5 μg) and Mex3B-RNAi plasmid (1 μg). Transfected cells were selected with puromycin (1 μg/ml) for 24 h and then treated with poly(I:C) for the indicated times before immunoblot. (E) Mex3B enhances binding of poly(I:C) to TLR3. The 293 cells (2 × 10 6 ) were transfected with the indicated plasmids (5 μg each). Cell lysates were mixed at 1:1 ratio as indicated and incubated with biotinylated-poly(I:C) for 1 h before pull-down assays were performed with streptavidin agarose. Precipitates and cell lysates were analyzed by immunoblot with the indicated antibodies.
Figure Legend Snippet: Mex3B colocalizes with TLR3 in the endosome and promotes the processing, stability and ligand binding of TLR3. (A) Mex3B colocalizes with TLR3 in the endosomes. The 293 cells (1 × 10 5 ) were cotransfected with Mex3B-HA and TLR3-Flag plus KDEL-GFP (ER marker), EEA1-GFP (early endosome marker) or LAMP-1-GFP (lysosome marker). Twenty hours after transfection, cells were fixed with 4% paraformaldehyde, stained with anti-Flag and anti-HA antibodies, and subjected to confocal microscopy. (B) Mex3B is sorted into the lumen of endosomes. HCT116 (Mex3B-3×Flag) cells (4 × 10 8 ) were collected and washed twice with ice-cold PBS. Endosome/lysosome fractions were isolated and either left untreated, treated with proteinase K (5 ng/ml) or treated with proteinase plus 0.1% Triton X-100 for 15 min at room temperature. The samples were then analyzed with the indicated antibodies. (C) Overexpression of Mex3B increases the abundance of processed C-terminal fragment of TLR3. The 293 cells (2 × 10 5 ) were transfected with the indicated plasmids. Twenty-four hours after transfection, cells were treated with poly(I:C) (20 μg/ml) for the indicated times before immunoblot. The relative amount of total TLR3 was quantitated by the Bio-Rad Quantity One program. (D) Knockdown of Mex3B affects the stability of TLR3. The 293 cells (2 × 10 5 ) were transfected with TLR3 (0.5 μg) and Mex3B-RNAi plasmid (1 μg). Transfected cells were selected with puromycin (1 μg/ml) for 24 h and then treated with poly(I:C) for the indicated times before immunoblot. (E) Mex3B enhances binding of poly(I:C) to TLR3. The 293 cells (2 × 10 6 ) were transfected with the indicated plasmids (5 μg each). Cell lysates were mixed at 1:1 ratio as indicated and incubated with biotinylated-poly(I:C) for 1 h before pull-down assays were performed with streptavidin agarose. Precipitates and cell lysates were analyzed by immunoblot with the indicated antibodies.

Techniques Used: Ligand Binding Assay, Marker, Transfection, Staining, Confocal Microscopy, Isolation, Over Expression, Plasmid Preparation, Binding Assay, Incubation

Related Articles

Transfection:

Article Title: DHHC5-mediated palmitoylation of S1P receptor subtype 1 determines G-protein coupling
Article Snippet: SH-SY5Y cells transfected with FLAG-S1P1 R were solubilised by lysis buffer (50 mM Tris-HCl (pH 7.4), 150 mM NaCl, 1 mM EDTA, 1% Triton X-100 and protease inhibitors) supplemented with 10 mM NEM and cleared by centrifugation at 15,000 x g for 5 min at 4 °C. .. Samples were then diluted with 20 volumes of buffer D (50 mM Tris-HCl (pH 7.4) 150 mM NaCl, 5 mM EDTA and 1% Triton X-100) and incubated with streptavidin agarose (Solulink) overnight at 4 °C with rotation.

Luciferase:

Article Title: The RNA-binding protein Mex3B is a coreceptor of Toll-like receptor 3 in innate antiviral response
Article Snippet: .. Reagents and antibodies Poly(I:C), LPS, R837, PGN, chloroquine (Invivogen); TNFα, IL-1β (R & D Systems); D-galactosamine (Sigma); GM-CSF (peproTech); ELISA kit for murine IFN-β, TNFα, IL-6 (Biolegend); dual-specific luciferase assay kit (Promega); EZ-link Psoralen-PEG3 -Biotin (Thermo); streptavidin agarose (Solulink); lysosome isolation kit (sigma); mouse monoclonal antibodies against Flag, β-actin (Sigma), HA (OriGene), phospho-IBα (Cell Signaling Technology), TLR3 (IMGENEX); rabbit monoclonal antibodies against TLR3, phospho-IRF3 (Cell Signaling Technology); rabbit polyclonal antibodies against IRF3 (Santa Cruz Biotechnology), TRIF (Cell Signaling Technology), TBK1 and phospho-TBK1(EPITOMICS), Flag (MBL); Alexa Fluor 555-conjugated goat anti-rabbit IgG antibody, Alexa Fluor 647-conjugated goat anti-mouse IgG antibody (Invitrogen) were purchased from the indicated manufacturers. .. Mouse antisera against human Mex3B were raised against recombinant human Mex3B fragments containing aa236-517 and aa1-517, respectively.

Article Title: ZCCHC3 is a co-sensor of cGAS for dsDNA recognition in innate immune response
Article Snippet: .. Reagents, antibodies, cells, and viruses Poly(dA:dT), 2′ 3′-cGAMP, and Lipofectamine 2000 (InvivoGen); polybrene (Millipore); SYBR (Bio-Rad); FuGene and Dual-Specific Luciferase Assay Kit (Promega); digitonin (Sigma); puromycin and EZ-link Psoralen-PEG3 -Biotin (Thermo); streptavidin agarose (Solulink); ELISA kits for murine IFN-β (PBL), IL-6 (BioLegend), and CXCL10 (BOSTER); recombinant IFN-β (R & D systems) were purchased for the indicated manufacturers. .. Mouse monoclonal antibodies against HA (BioLegend, 901515; 1:2000), FLAG (Sigma, F3165; 1:2000) and β-actin (Sigma, A2228; 1:3000) and phosphor-IκBα (Cell Signaling Technology, 9246 S; 1:1000); rabbit monoclonal antibodies against cGAS (Cell Signaling Technology, 66546 S/31659 S; 1:1000), phosphor-Tyrosine701-STAT1 (Cell Signaling Technology, 9167 S; 1:1000) and phosphor-IRF3 (Cell Signaling Technology, 4947 S; 1:1000), phosphor-TBK1 (Abcam, ab109272; 1:1000) and TBK1(Abcam, ab40676; 1:2000), IRF3 (Santa Cruz Biotechnology, sc-33641; 1:1000) and STAT1 (Santa Cruz Biotechnology, sc-417; 1:1000) were purchased from the indicated manufacturers.

Article Title: ZCCHC3 is a co-sensor of cGAS for dsDNA recognition in innate immune response
Article Snippet: .. Poly(dA:dT), 2′ 3′-cGAMP, and Lipofectamine 2000 (InvivoGen); polybrene (Millipore); SYBR (Bio-Rad); FuGene and Dual-Specific Luciferase Assay Kit (Promega); digitonin (Sigma); puromycin and EZ-link Psoralen-PEG3 -Biotin (Thermo); streptavidin agarose (Solulink); ELISA kits for murine IFN-β (PBL), IL-6 (BioLegend), and CXCL10 (BOSTER); recombinant IFN-β (R & D systems) were purchased for the indicated manufacturers. .. Mouse monoclonal antibodies against HA (BioLegend, 901515; 1:2000), FLAG (Sigma, F3165; 1:2000) and β-actin (Sigma, A2228; 1:3000) and phosphor-IκBα (Cell Signaling Technology, 9246 S; 1:1000); rabbit monoclonal antibodies against cGAS (Cell Signaling Technology, 66546 S/31659 S; 1:1000), phosphor-Tyrosine701-STAT1 (Cell Signaling Technology, 9167 S; 1:1000) and phosphor-IRF3 (Cell Signaling Technology, 4947 S; 1:1000), phosphor-TBK1 (Abcam, ab109272; 1:1000) and TBK1(Abcam, ab40676; 1:2000), IRF3 (Santa Cruz Biotechnology, sc-33641; 1:1000) and STAT1 (Santa Cruz Biotechnology, sc-417; 1:1000) were purchased from the indicated manufacturers.

Article Title: Human cytomegalovirus protein UL42 antagonizes cGAS/MITA-mediated innate antiviral response
Article Snippet: .. Reagents and antibodies 2’ 3’-cGAMP, and lipofectamine 2000 (Invitrogen); polybrene (Millipore); puromycin and RNase inhibitor (Thermo); dual-specific luciferase assay kit (Promega); SYBR (BIO-RAD); digitonin (Sigma); streptavidin agarose (Solulink); mouse antibodies against Flag, and β-actin (Sigma), and HA (Covance); rabbit monoclonal antibodies against cGAS (66546S/31659S), MITA (13647S), phosphor-MITA (85735S), phosphor-p65, and phosphor-IRF3 (4947S) (Cell Signaling Technology), phosphor-TBK1(ab109272) and TBK1(ab40676) (Abcam), IRF3 (sc-9082), phosphor-Tyrosine701-STAT1(9167S) and STAT1(sc-346) (Santa Cruz Biotechnology) were purchased from the indicated manufacturers. .. Antisera against UL42, UL82, and UL44 were generated by immunizing rabbits or mice with purified recombinant UL42, UL82, and UL44 proteins.

Pull Down Assay:

Article Title: Molecular and Functional Characterization of ssDNA Aptamers that Specifically Bind Leishmania infantum PABP
Article Snippet: .. PABP pull-down assay To test the ability of individual aptamers to specifically bind to and purify the LiPABP presents in lysates, purification experiments using streptavidin agarose (Solulink) were carried out. .. Streptavidin agarose were equilibrated for 30 min at 4°C in buffer A (20 mM Tris-HCl pH 7.6, 1 mM DTT, 1 mM EDTA, 1 mM PMSF, 1 mM benzamidine, 2 mM sodium molybdate, 2 mM sodium β-glycerophosphate, 0.2 mM sodium orthovanadate, 120 mM KCl, 10 μg/mL antipaine, 1 μg/mL leupeptin, 1 μg/mL pepstatin) and 1 mg/ml of cytochrome C to block nonspecific binding.

Generated:

Article Title: ZCCHC3 is a co-sensor of cGAS for dsDNA recognition in innate immune response
Article Snippet: Reagents, antibodies, cells, and viruses Poly(dA:dT), 2′ 3′-cGAMP, and Lipofectamine 2000 (InvivoGen); polybrene (Millipore); SYBR (Bio-Rad); FuGene and Dual-Specific Luciferase Assay Kit (Promega); digitonin (Sigma); puromycin and EZ-link Psoralen-PEG3 -Biotin (Thermo); streptavidin agarose (Solulink); ELISA kits for murine IFN-β (PBL), IL-6 (BioLegend), and CXCL10 (BOSTER); recombinant IFN-β (R & D systems) were purchased for the indicated manufacturers. .. Antisera against ZCCHC3 were generated by immunizing rabbits or mice with purified recombinant ZCCHC3(133-404) (1:1000).

Article Title: ZCCHC3 is a co-sensor of cGAS for dsDNA recognition in innate immune response
Article Snippet: Poly(dA:dT), 2′ 3′-cGAMP, and Lipofectamine 2000 (InvivoGen); polybrene (Millipore); SYBR (Bio-Rad); FuGene and Dual-Specific Luciferase Assay Kit (Promega); digitonin (Sigma); puromycin and EZ-link Psoralen-PEG3 -Biotin (Thermo); streptavidin agarose (Solulink); ELISA kits for murine IFN-β (PBL), IL-6 (BioLegend), and CXCL10 (BOSTER); recombinant IFN-β (R & D systems) were purchased for the indicated manufacturers. .. Antisera against ZCCHC3 were generated by immunizing rabbits or mice with purified recombinant ZCCHC3(133-404) (1:1000).

Article Title: Human cytomegalovirus protein UL42 antagonizes cGAS/MITA-mediated innate antiviral response
Article Snippet: Reagents and antibodies 2’ 3’-cGAMP, and lipofectamine 2000 (Invitrogen); polybrene (Millipore); puromycin and RNase inhibitor (Thermo); dual-specific luciferase assay kit (Promega); SYBR (BIO-RAD); digitonin (Sigma); streptavidin agarose (Solulink); mouse antibodies against Flag, and β-actin (Sigma), and HA (Covance); rabbit monoclonal antibodies against cGAS (66546S/31659S), MITA (13647S), phosphor-MITA (85735S), phosphor-p65, and phosphor-IRF3 (4947S) (Cell Signaling Technology), phosphor-TBK1(ab109272) and TBK1(ab40676) (Abcam), IRF3 (sc-9082), phosphor-Tyrosine701-STAT1(9167S) and STAT1(sc-346) (Santa Cruz Biotechnology) were purchased from the indicated manufacturers. .. Antisera against UL42, UL82, and UL44 were generated by immunizing rabbits or mice with purified recombinant UL42, UL82, and UL44 proteins.

Isolation:

Article Title: The RNA-binding protein Mex3B is a coreceptor of Toll-like receptor 3 in innate antiviral response
Article Snippet: .. Reagents and antibodies Poly(I:C), LPS, R837, PGN, chloroquine (Invivogen); TNFα, IL-1β (R & D Systems); D-galactosamine (Sigma); GM-CSF (peproTech); ELISA kit for murine IFN-β, TNFα, IL-6 (Biolegend); dual-specific luciferase assay kit (Promega); EZ-link Psoralen-PEG3 -Biotin (Thermo); streptavidin agarose (Solulink); lysosome isolation kit (sigma); mouse monoclonal antibodies against Flag, β-actin (Sigma), HA (OriGene), phospho-IBα (Cell Signaling Technology), TLR3 (IMGENEX); rabbit monoclonal antibodies against TLR3, phospho-IRF3 (Cell Signaling Technology); rabbit polyclonal antibodies against IRF3 (Santa Cruz Biotechnology), TRIF (Cell Signaling Technology), TBK1 and phospho-TBK1(EPITOMICS), Flag (MBL); Alexa Fluor 555-conjugated goat anti-rabbit IgG antibody, Alexa Fluor 647-conjugated goat anti-mouse IgG antibody (Invitrogen) were purchased from the indicated manufacturers. .. Mouse antisera against human Mex3B were raised against recombinant human Mex3B fragments containing aa236-517 and aa1-517, respectively.

Centrifugation:

Article Title: DHHC5-mediated palmitoylation of S1P receptor subtype 1 determines G-protein coupling
Article Snippet: SH-SY5Y cells transfected with FLAG-S1P1 R were solubilised by lysis buffer (50 mM Tris-HCl (pH 7.4), 150 mM NaCl, 1 mM EDTA, 1% Triton X-100 and protease inhibitors) supplemented with 10 mM NEM and cleared by centrifugation at 15,000 x g for 5 min at 4 °C. .. Samples were then diluted with 20 volumes of buffer D (50 mM Tris-HCl (pH 7.4) 150 mM NaCl, 5 mM EDTA and 1% Triton X-100) and incubated with streptavidin agarose (Solulink) overnight at 4 °C with rotation.

Blocking Assay:

Article Title: Molecular and Functional Characterization of ssDNA Aptamers that Specifically Bind Leishmania infantum PABP
Article Snippet: PABP pull-down assay To test the ability of individual aptamers to specifically bind to and purify the LiPABP presents in lysates, purification experiments using streptavidin agarose (Solulink) were carried out. .. Streptavidin agarose were equilibrated for 30 min at 4°C in buffer A (20 mM Tris-HCl pH 7.6, 1 mM DTT, 1 mM EDTA, 1 mM PMSF, 1 mM benzamidine, 2 mM sodium molybdate, 2 mM sodium β-glycerophosphate, 0.2 mM sodium orthovanadate, 120 mM KCl, 10 μg/mL antipaine, 1 μg/mL leupeptin, 1 μg/mL pepstatin) and 1 mg/ml of cytochrome C to block nonspecific binding.

Mouse Assay:

Article Title: ZCCHC3 is a co-sensor of cGAS for dsDNA recognition in innate immune response
Article Snippet: Reagents, antibodies, cells, and viruses Poly(dA:dT), 2′ 3′-cGAMP, and Lipofectamine 2000 (InvivoGen); polybrene (Millipore); SYBR (Bio-Rad); FuGene and Dual-Specific Luciferase Assay Kit (Promega); digitonin (Sigma); puromycin and EZ-link Psoralen-PEG3 -Biotin (Thermo); streptavidin agarose (Solulink); ELISA kits for murine IFN-β (PBL), IL-6 (BioLegend), and CXCL10 (BOSTER); recombinant IFN-β (R & D systems) were purchased for the indicated manufacturers. .. Antisera against ZCCHC3 were generated by immunizing rabbits or mice with purified recombinant ZCCHC3(133-404) (1:1000).

Article Title: ZCCHC3 is a co-sensor of cGAS for dsDNA recognition in innate immune response
Article Snippet: Poly(dA:dT), 2′ 3′-cGAMP, and Lipofectamine 2000 (InvivoGen); polybrene (Millipore); SYBR (Bio-Rad); FuGene and Dual-Specific Luciferase Assay Kit (Promega); digitonin (Sigma); puromycin and EZ-link Psoralen-PEG3 -Biotin (Thermo); streptavidin agarose (Solulink); ELISA kits for murine IFN-β (PBL), IL-6 (BioLegend), and CXCL10 (BOSTER); recombinant IFN-β (R & D systems) were purchased for the indicated manufacturers. .. Antisera against ZCCHC3 were generated by immunizing rabbits or mice with purified recombinant ZCCHC3(133-404) (1:1000).

Article Title: Human cytomegalovirus protein UL42 antagonizes cGAS/MITA-mediated innate antiviral response
Article Snippet: Reagents and antibodies 2’ 3’-cGAMP, and lipofectamine 2000 (Invitrogen); polybrene (Millipore); puromycin and RNase inhibitor (Thermo); dual-specific luciferase assay kit (Promega); SYBR (BIO-RAD); digitonin (Sigma); streptavidin agarose (Solulink); mouse antibodies against Flag, and β-actin (Sigma), and HA (Covance); rabbit monoclonal antibodies against cGAS (66546S/31659S), MITA (13647S), phosphor-MITA (85735S), phosphor-p65, and phosphor-IRF3 (4947S) (Cell Signaling Technology), phosphor-TBK1(ab109272) and TBK1(ab40676) (Abcam), IRF3 (sc-9082), phosphor-Tyrosine701-STAT1(9167S) and STAT1(sc-346) (Santa Cruz Biotechnology) were purchased from the indicated manufacturers. .. Antisera against UL42, UL82, and UL44 were generated by immunizing rabbits or mice with purified recombinant UL42, UL82, and UL44 proteins.

Enzyme-linked Immunosorbent Assay:

Article Title: The RNA-binding protein Mex3B is a coreceptor of Toll-like receptor 3 in innate antiviral response
Article Snippet: .. Reagents and antibodies Poly(I:C), LPS, R837, PGN, chloroquine (Invivogen); TNFα, IL-1β (R & D Systems); D-galactosamine (Sigma); GM-CSF (peproTech); ELISA kit for murine IFN-β, TNFα, IL-6 (Biolegend); dual-specific luciferase assay kit (Promega); EZ-link Psoralen-PEG3 -Biotin (Thermo); streptavidin agarose (Solulink); lysosome isolation kit (sigma); mouse monoclonal antibodies against Flag, β-actin (Sigma), HA (OriGene), phospho-IBα (Cell Signaling Technology), TLR3 (IMGENEX); rabbit monoclonal antibodies against TLR3, phospho-IRF3 (Cell Signaling Technology); rabbit polyclonal antibodies against IRF3 (Santa Cruz Biotechnology), TRIF (Cell Signaling Technology), TBK1 and phospho-TBK1(EPITOMICS), Flag (MBL); Alexa Fluor 555-conjugated goat anti-rabbit IgG antibody, Alexa Fluor 647-conjugated goat anti-mouse IgG antibody (Invitrogen) were purchased from the indicated manufacturers. .. Mouse antisera against human Mex3B were raised against recombinant human Mex3B fragments containing aa236-517 and aa1-517, respectively.

Article Title: ZCCHC3 is a co-sensor of cGAS for dsDNA recognition in innate immune response
Article Snippet: .. Reagents, antibodies, cells, and viruses Poly(dA:dT), 2′ 3′-cGAMP, and Lipofectamine 2000 (InvivoGen); polybrene (Millipore); SYBR (Bio-Rad); FuGene and Dual-Specific Luciferase Assay Kit (Promega); digitonin (Sigma); puromycin and EZ-link Psoralen-PEG3 -Biotin (Thermo); streptavidin agarose (Solulink); ELISA kits for murine IFN-β (PBL), IL-6 (BioLegend), and CXCL10 (BOSTER); recombinant IFN-β (R & D systems) were purchased for the indicated manufacturers. .. Mouse monoclonal antibodies against HA (BioLegend, 901515; 1:2000), FLAG (Sigma, F3165; 1:2000) and β-actin (Sigma, A2228; 1:3000) and phosphor-IκBα (Cell Signaling Technology, 9246 S; 1:1000); rabbit monoclonal antibodies against cGAS (Cell Signaling Technology, 66546 S/31659 S; 1:1000), phosphor-Tyrosine701-STAT1 (Cell Signaling Technology, 9167 S; 1:1000) and phosphor-IRF3 (Cell Signaling Technology, 4947 S; 1:1000), phosphor-TBK1 (Abcam, ab109272; 1:1000) and TBK1(Abcam, ab40676; 1:2000), IRF3 (Santa Cruz Biotechnology, sc-33641; 1:1000) and STAT1 (Santa Cruz Biotechnology, sc-417; 1:1000) were purchased from the indicated manufacturers.

Article Title: ZCCHC3 is a co-sensor of cGAS for dsDNA recognition in innate immune response
Article Snippet: .. Poly(dA:dT), 2′ 3′-cGAMP, and Lipofectamine 2000 (InvivoGen); polybrene (Millipore); SYBR (Bio-Rad); FuGene and Dual-Specific Luciferase Assay Kit (Promega); digitonin (Sigma); puromycin and EZ-link Psoralen-PEG3 -Biotin (Thermo); streptavidin agarose (Solulink); ELISA kits for murine IFN-β (PBL), IL-6 (BioLegend), and CXCL10 (BOSTER); recombinant IFN-β (R & D systems) were purchased for the indicated manufacturers. .. Mouse monoclonal antibodies against HA (BioLegend, 901515; 1:2000), FLAG (Sigma, F3165; 1:2000) and β-actin (Sigma, A2228; 1:3000) and phosphor-IκBα (Cell Signaling Technology, 9246 S; 1:1000); rabbit monoclonal antibodies against cGAS (Cell Signaling Technology, 66546 S/31659 S; 1:1000), phosphor-Tyrosine701-STAT1 (Cell Signaling Technology, 9167 S; 1:1000) and phosphor-IRF3 (Cell Signaling Technology, 4947 S; 1:1000), phosphor-TBK1 (Abcam, ab109272; 1:1000) and TBK1(Abcam, ab40676; 1:2000), IRF3 (Santa Cruz Biotechnology, sc-33641; 1:1000) and STAT1 (Santa Cruz Biotechnology, sc-417; 1:1000) were purchased from the indicated manufacturers.

Incubation:

Article Title: DHHC5-mediated palmitoylation of S1P receptor subtype 1 determines G-protein coupling
Article Snippet: .. Samples were then diluted with 20 volumes of buffer D (50 mM Tris-HCl (pH 7.4) 150 mM NaCl, 5 mM EDTA and 1% Triton X-100) and incubated with streptavidin agarose (Solulink) overnight at 4 °C with rotation. .. Beads were washed twice with buffer B and once with 10 mM Tris-HCl (pH 7.4) and bound proteins were eluted with SDS sample buffer containing 10 mM DTT and subjected to immunoblotting with anti-S1P1 R antibody (Santa Cruz).

Article Title: Molecular and Functional Characterization of ssDNA Aptamers that Specifically Bind Leishmania infantum PABP
Article Snippet: PABP pull-down assay To test the ability of individual aptamers to specifically bind to and purify the LiPABP presents in lysates, purification experiments using streptavidin agarose (Solulink) were carried out. .. Meanwhile, 50 μg lysates from HEK293T cells overexpressing Flag-Li PABP were incubated with (125 pmol) of biotin-labeled aptamers for 30 min at 4°C.

Article Title: Human DNA-Damage-Inducible 2 Protein Is Structurally and Functionally Distinct from Its Yeast Ortholog
Article Snippet: .. Biotinylated products were then immobilized on streptavidin agarose (Solulink) by 2 h incubation with mild agitation at room temperature, followed by washing. ..

Binding Assay:

Article Title: Molecular and Functional Characterization of ssDNA Aptamers that Specifically Bind Leishmania infantum PABP
Article Snippet: PABP pull-down assay To test the ability of individual aptamers to specifically bind to and purify the LiPABP presents in lysates, purification experiments using streptavidin agarose (Solulink) were carried out. .. Streptavidin agarose were equilibrated for 30 min at 4°C in buffer A (20 mM Tris-HCl pH 7.6, 1 mM DTT, 1 mM EDTA, 1 mM PMSF, 1 mM benzamidine, 2 mM sodium molybdate, 2 mM sodium β-glycerophosphate, 0.2 mM sodium orthovanadate, 120 mM KCl, 10 μg/mL antipaine, 1 μg/mL leupeptin, 1 μg/mL pepstatin) and 1 mg/ml of cytochrome C to block nonspecific binding.

Recombinant:

Article Title: The RNA-binding protein Mex3B is a coreceptor of Toll-like receptor 3 in innate antiviral response
Article Snippet: Reagents and antibodies Poly(I:C), LPS, R837, PGN, chloroquine (Invivogen); TNFα, IL-1β (R & D Systems); D-galactosamine (Sigma); GM-CSF (peproTech); ELISA kit for murine IFN-β, TNFα, IL-6 (Biolegend); dual-specific luciferase assay kit (Promega); EZ-link Psoralen-PEG3 -Biotin (Thermo); streptavidin agarose (Solulink); lysosome isolation kit (sigma); mouse monoclonal antibodies against Flag, β-actin (Sigma), HA (OriGene), phospho-IBα (Cell Signaling Technology), TLR3 (IMGENEX); rabbit monoclonal antibodies against TLR3, phospho-IRF3 (Cell Signaling Technology); rabbit polyclonal antibodies against IRF3 (Santa Cruz Biotechnology), TRIF (Cell Signaling Technology), TBK1 and phospho-TBK1(EPITOMICS), Flag (MBL); Alexa Fluor 555-conjugated goat anti-rabbit IgG antibody, Alexa Fluor 647-conjugated goat anti-mouse IgG antibody (Invitrogen) were purchased from the indicated manufacturers. .. Mouse antisera against human Mex3B were raised against recombinant human Mex3B fragments containing aa236-517 and aa1-517, respectively.

Article Title: ZCCHC3 is a co-sensor of cGAS for dsDNA recognition in innate immune response
Article Snippet: .. Reagents, antibodies, cells, and viruses Poly(dA:dT), 2′ 3′-cGAMP, and Lipofectamine 2000 (InvivoGen); polybrene (Millipore); SYBR (Bio-Rad); FuGene and Dual-Specific Luciferase Assay Kit (Promega); digitonin (Sigma); puromycin and EZ-link Psoralen-PEG3 -Biotin (Thermo); streptavidin agarose (Solulink); ELISA kits for murine IFN-β (PBL), IL-6 (BioLegend), and CXCL10 (BOSTER); recombinant IFN-β (R & D systems) were purchased for the indicated manufacturers. .. Mouse monoclonal antibodies against HA (BioLegend, 901515; 1:2000), FLAG (Sigma, F3165; 1:2000) and β-actin (Sigma, A2228; 1:3000) and phosphor-IκBα (Cell Signaling Technology, 9246 S; 1:1000); rabbit monoclonal antibodies against cGAS (Cell Signaling Technology, 66546 S/31659 S; 1:1000), phosphor-Tyrosine701-STAT1 (Cell Signaling Technology, 9167 S; 1:1000) and phosphor-IRF3 (Cell Signaling Technology, 4947 S; 1:1000), phosphor-TBK1 (Abcam, ab109272; 1:1000) and TBK1(Abcam, ab40676; 1:2000), IRF3 (Santa Cruz Biotechnology, sc-33641; 1:1000) and STAT1 (Santa Cruz Biotechnology, sc-417; 1:1000) were purchased from the indicated manufacturers.

Article Title: Human DNA-Damage-Inducible 2 Protein Is Structurally and Functionally Distinct from Its Yeast Ortholog
Article Snippet: For the endopeptidase assay, peptide library (1 mg/ml) was incubated in 200 μl of 100 mM sodium acetate, 300 mM NaCl, pH 4.0, with 4 μg of recombinant full-length hDdi2. .. Biotinylated products were then immobilized on streptavidin agarose (Solulink) by 2 h incubation with mild agitation at room temperature, followed by washing.

Article Title: ZCCHC3 is a co-sensor of cGAS for dsDNA recognition in innate immune response
Article Snippet: .. Poly(dA:dT), 2′ 3′-cGAMP, and Lipofectamine 2000 (InvivoGen); polybrene (Millipore); SYBR (Bio-Rad); FuGene and Dual-Specific Luciferase Assay Kit (Promega); digitonin (Sigma); puromycin and EZ-link Psoralen-PEG3 -Biotin (Thermo); streptavidin agarose (Solulink); ELISA kits for murine IFN-β (PBL), IL-6 (BioLegend), and CXCL10 (BOSTER); recombinant IFN-β (R & D systems) were purchased for the indicated manufacturers. .. Mouse monoclonal antibodies against HA (BioLegend, 901515; 1:2000), FLAG (Sigma, F3165; 1:2000) and β-actin (Sigma, A2228; 1:3000) and phosphor-IκBα (Cell Signaling Technology, 9246 S; 1:1000); rabbit monoclonal antibodies against cGAS (Cell Signaling Technology, 66546 S/31659 S; 1:1000), phosphor-Tyrosine701-STAT1 (Cell Signaling Technology, 9167 S; 1:1000) and phosphor-IRF3 (Cell Signaling Technology, 4947 S; 1:1000), phosphor-TBK1 (Abcam, ab109272; 1:1000) and TBK1(Abcam, ab40676; 1:2000), IRF3 (Santa Cruz Biotechnology, sc-33641; 1:1000) and STAT1 (Santa Cruz Biotechnology, sc-417; 1:1000) were purchased from the indicated manufacturers.

Article Title: Human cytomegalovirus protein UL42 antagonizes cGAS/MITA-mediated innate antiviral response
Article Snippet: Reagents and antibodies 2’ 3’-cGAMP, and lipofectamine 2000 (Invitrogen); polybrene (Millipore); puromycin and RNase inhibitor (Thermo); dual-specific luciferase assay kit (Promega); SYBR (BIO-RAD); digitonin (Sigma); streptavidin agarose (Solulink); mouse antibodies against Flag, and β-actin (Sigma), and HA (Covance); rabbit monoclonal antibodies against cGAS (66546S/31659S), MITA (13647S), phosphor-MITA (85735S), phosphor-p65, and phosphor-IRF3 (4947S) (Cell Signaling Technology), phosphor-TBK1(ab109272) and TBK1(ab40676) (Abcam), IRF3 (sc-9082), phosphor-Tyrosine701-STAT1(9167S) and STAT1(sc-346) (Santa Cruz Biotechnology) were purchased from the indicated manufacturers. .. Antisera against UL42, UL82, and UL44 were generated by immunizing rabbits or mice with purified recombinant UL42, UL82, and UL44 proteins.

Mass Spectrometry:

Article Title: Human DNA-Damage-Inducible 2 Protein Is Structurally and Functionally Distinct from Its Yeast Ortholog
Article Snippet: Biotinylated products were then immobilized on streptavidin agarose (Solulink) by 2 h incubation with mild agitation at room temperature, followed by washing. .. Immobilized peptides were eluted with 20 mM DTT and desalted using Pepclean C-18 reverse phase cartridges (Thermo Scientific), following the manufacturer’s protocol, and analyzed by mass spectrometry.

Lysis:

Article Title: DHHC5-mediated palmitoylation of S1P receptor subtype 1 determines G-protein coupling
Article Snippet: The beads were washed twice with lysis buffer containing 10 mM NEM, and suspended in buffer B (50 mM Tris-HCl (pH 7.4) 150 mM NaCl, 5 mM EDTA, 1% Triton X-100 and 0.1% SDS) containing 50 mM NEM. .. Samples were then diluted with 20 volumes of buffer D (50 mM Tris-HCl (pH 7.4) 150 mM NaCl, 5 mM EDTA and 1% Triton X-100) and incubated with streptavidin agarose (Solulink) overnight at 4 °C with rotation.

Purification:

Article Title: Molecular and Functional Characterization of ssDNA Aptamers that Specifically Bind Leishmania infantum PABP
Article Snippet: .. PABP pull-down assay To test the ability of individual aptamers to specifically bind to and purify the LiPABP presents in lysates, purification experiments using streptavidin agarose (Solulink) were carried out. .. Streptavidin agarose were equilibrated for 30 min at 4°C in buffer A (20 mM Tris-HCl pH 7.6, 1 mM DTT, 1 mM EDTA, 1 mM PMSF, 1 mM benzamidine, 2 mM sodium molybdate, 2 mM sodium β-glycerophosphate, 0.2 mM sodium orthovanadate, 120 mM KCl, 10 μg/mL antipaine, 1 μg/mL leupeptin, 1 μg/mL pepstatin) and 1 mg/ml of cytochrome C to block nonspecific binding.

Article Title: ZCCHC3 is a co-sensor of cGAS for dsDNA recognition in innate immune response
Article Snippet: Reagents, antibodies, cells, and viruses Poly(dA:dT), 2′ 3′-cGAMP, and Lipofectamine 2000 (InvivoGen); polybrene (Millipore); SYBR (Bio-Rad); FuGene and Dual-Specific Luciferase Assay Kit (Promega); digitonin (Sigma); puromycin and EZ-link Psoralen-PEG3 -Biotin (Thermo); streptavidin agarose (Solulink); ELISA kits for murine IFN-β (PBL), IL-6 (BioLegend), and CXCL10 (BOSTER); recombinant IFN-β (R & D systems) were purchased for the indicated manufacturers. .. Antisera against ZCCHC3 were generated by immunizing rabbits or mice with purified recombinant ZCCHC3(133-404) (1:1000).

Article Title: ZCCHC3 is a co-sensor of cGAS for dsDNA recognition in innate immune response
Article Snippet: Poly(dA:dT), 2′ 3′-cGAMP, and Lipofectamine 2000 (InvivoGen); polybrene (Millipore); SYBR (Bio-Rad); FuGene and Dual-Specific Luciferase Assay Kit (Promega); digitonin (Sigma); puromycin and EZ-link Psoralen-PEG3 -Biotin (Thermo); streptavidin agarose (Solulink); ELISA kits for murine IFN-β (PBL), IL-6 (BioLegend), and CXCL10 (BOSTER); recombinant IFN-β (R & D systems) were purchased for the indicated manufacturers. .. Antisera against ZCCHC3 were generated by immunizing rabbits or mice with purified recombinant ZCCHC3(133-404) (1:1000).

Article Title: Human cytomegalovirus protein UL42 antagonizes cGAS/MITA-mediated innate antiviral response
Article Snippet: Reagents and antibodies 2’ 3’-cGAMP, and lipofectamine 2000 (Invitrogen); polybrene (Millipore); puromycin and RNase inhibitor (Thermo); dual-specific luciferase assay kit (Promega); SYBR (BIO-RAD); digitonin (Sigma); streptavidin agarose (Solulink); mouse antibodies against Flag, and β-actin (Sigma), and HA (Covance); rabbit monoclonal antibodies against cGAS (66546S/31659S), MITA (13647S), phosphor-MITA (85735S), phosphor-p65, and phosphor-IRF3 (4947S) (Cell Signaling Technology), phosphor-TBK1(ab109272) and TBK1(ab40676) (Abcam), IRF3 (sc-9082), phosphor-Tyrosine701-STAT1(9167S) and STAT1(sc-346) (Santa Cruz Biotechnology) were purchased from the indicated manufacturers. .. Antisera against UL42, UL82, and UL44 were generated by immunizing rabbits or mice with purified recombinant UL42, UL82, and UL44 proteins.

In Vitro:

Article Title: Human DNA-Damage-Inducible 2 Protein Is Structurally and Functionally Distinct from Its Yeast Ortholog
Article Snippet: Subsequently, newly formed peptide free N-termini (products of proteolytic cleavage) were biotinylated in vitro by incubation with 350 μM sulfo-NHS-SS-biotin (Thermo-Scientific) for 4 h at room temperature. .. Biotinylated products were then immobilized on streptavidin agarose (Solulink) by 2 h incubation with mild agitation at room temperature, followed by washing.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 83
    Solulink streptavidin agarose ultra performance beads
    Identification of the A1 aptamer region necessary for PCNA binding. ( A ) Pull-down analysis of the binding of A1 aptamer variants shortened at the 5′ or 3′ end to PCNA. Aptamers were bound to <t>streptavidin-agarose</t> resin and incubated with HisTag-PCNA. After washing unbound proteins, bound HisTag-PCNA was denatured, separated by 12% SDS-PAGE and stained with Coomassie brilliant blue. Lane M, protein mass marker; 1, full-length A1; 2, −10/5′ variant; 3, −20/5′ variant; 4, −10/3′ variant; 5, −20/3′ variant; 6, −30/3′ variant (referred to as the α-PCNA aptamer); 7, −40/3′ variant. The presented results are representative. ( B ) Densitometric analysis of HisTag-PCNA bound to A1 aptamer variants presented on panel (A). The results are normalized relative to the signal from the protein sample bound to the full-length aptamer (100%). Results are means of triplicate measurements, and errors represent standard deviation.
    Streptavidin Agarose Ultra Performance Beads, supplied by Solulink, used in various techniques. Bioz Stars score: 83/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/streptavidin agarose ultra performance beads/product/Solulink
    Average 83 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    streptavidin agarose ultra performance beads - by Bioz Stars, 2020-01
    83/100 stars
      Buy from Supplier

    93
    Solulink streptavidin agarose
    ZCCHC3 binds to dsDNA. a ZCCHC3 binds to dsDNA. HEK293 cells were transfected with the indicated plasmids. Twenty hours later, the cell lysates were incubated with the indicated biotinylated nucleic acids and <t>streptavidin-Sepharose</t> beads for in vitro pull-down assays. The bound proteins were then analyzed by immunoblots with anti-HA. b ZCCHC3 binds to dsDNA through its C-terminal ZF domains. HEK293 cells were transfected with the indicated plasmids. Twenty hours after transfection, the cell lysates were incubated with biotinylated-HSV120 and streptavidin-Sepharose beads. The bound proteins were analyzed by immunoblots with anti-Flag. A schematic representation of ZCCHC3 and its truncation mutants was shown on the left. c ZCCHC3 and cGAS but not RIG-I bind to HSV-1 DNA of infected cells. HEK293 cells were transfected with HA-tagged ZCCHC3, cGAS, and RIG-I. Twenty hours after transfection, cells were infected with HSV-1for 3 h. Cell lysates were then immunoprecipitated with control IgG or anti-HA. The protein-bound DNAs were extracted and analyzed by qPCR analysis with primers corresponding to the indicated regions of HSV-1 genome. Positive ( + ) and negative (-) detections were shown at the top of the schematic presentation of the HSV-1 genome. A representative qPCR results were shown at the left. **P
    Streptavidin Agarose, supplied by Solulink, used in various techniques. Bioz Stars score: 93/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/streptavidin agarose/product/Solulink
    Average 93 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    streptavidin agarose - by Bioz Stars, 2020-01
    93/100 stars
      Buy from Supplier

    Image Search Results


    Identification of the A1 aptamer region necessary for PCNA binding. ( A ) Pull-down analysis of the binding of A1 aptamer variants shortened at the 5′ or 3′ end to PCNA. Aptamers were bound to streptavidin-agarose resin and incubated with HisTag-PCNA. After washing unbound proteins, bound HisTag-PCNA was denatured, separated by 12% SDS-PAGE and stained with Coomassie brilliant blue. Lane M, protein mass marker; 1, full-length A1; 2, −10/5′ variant; 3, −20/5′ variant; 4, −10/3′ variant; 5, −20/3′ variant; 6, −30/3′ variant (referred to as the α-PCNA aptamer); 7, −40/3′ variant. The presented results are representative. ( B ) Densitometric analysis of HisTag-PCNA bound to A1 aptamer variants presented on panel (A). The results are normalized relative to the signal from the protein sample bound to the full-length aptamer (100%). Results are means of triplicate measurements, and errors represent standard deviation.

    Journal: Nucleic Acids Research

    Article Title: Inhibition of DNA replication by an anti-PCNA aptamer/PCNA complex

    doi: 10.1093/nar/gkx1184

    Figure Lengend Snippet: Identification of the A1 aptamer region necessary for PCNA binding. ( A ) Pull-down analysis of the binding of A1 aptamer variants shortened at the 5′ or 3′ end to PCNA. Aptamers were bound to streptavidin-agarose resin and incubated with HisTag-PCNA. After washing unbound proteins, bound HisTag-PCNA was denatured, separated by 12% SDS-PAGE and stained with Coomassie brilliant blue. Lane M, protein mass marker; 1, full-length A1; 2, −10/5′ variant; 3, −20/5′ variant; 4, −10/3′ variant; 5, −20/3′ variant; 6, −30/3′ variant (referred to as the α-PCNA aptamer); 7, −40/3′ variant. The presented results are representative. ( B ) Densitometric analysis of HisTag-PCNA bound to A1 aptamer variants presented on panel (A). The results are normalized relative to the signal from the protein sample bound to the full-length aptamer (100%). Results are means of triplicate measurements, and errors represent standard deviation.

    Article Snippet: Impact of α-PCNA aptamer on DNA pol δ and ϵ binding to 30/90-mer primer-template DNA A 100 pmol sample of 30/90-mer DNA template generated by annealing 100 pmol of biotinylated 90-mer template (5′-TGAGGTTCAGCAAGGTGATGCTTTAGATTTTTCATTTGCTGCTGGCTCTCAGCGTGGCACTGT TGCAGGCGGTGTTAATACTGACCGCCT-biotin-3′) with 200 pmol of 30-mer primer (5′-CAGTGCCACGCTGAGAGCCAGCAGCAAATG-3′) was conjugated with 50 μl of Streptavidin Agarose Ultra Performance beads (Solulink, USA).

    Techniques: Binding Assay, Incubation, SDS Page, Staining, Marker, Variant Assay, Standard Deviation

    The impact of the α-PCNA aptamer and PCNA on the 30/90-mer primer-template DNA/DNA pol δ or ϵ complex. A 300 fmol sample of DNA pol δ ( A ) and 400 fmol of DNA pol ϵ ( B ) were incubated with 1 pmol of 30/90-mer primer-template DNA immobilized on streptavidin-agarose beads in buffer with or without 1 pmol of PCNA, and with 500 fmol ( A ) or 250 fmol ( B ) of reference1 (Ref1) or α-PCNA aptamer. After incubation, beads were washed, and bound protein was denatured, separated by 10% SDS-PAGE and subjected to western blotting. DNA pol δ and ϵ were detected using anti-p125 and -p261 antibodies, respectively. The presented results are representative.

    Journal: Nucleic Acids Research

    Article Title: Inhibition of DNA replication by an anti-PCNA aptamer/PCNA complex

    doi: 10.1093/nar/gkx1184

    Figure Lengend Snippet: The impact of the α-PCNA aptamer and PCNA on the 30/90-mer primer-template DNA/DNA pol δ or ϵ complex. A 300 fmol sample of DNA pol δ ( A ) and 400 fmol of DNA pol ϵ ( B ) were incubated with 1 pmol of 30/90-mer primer-template DNA immobilized on streptavidin-agarose beads in buffer with or without 1 pmol of PCNA, and with 500 fmol ( A ) or 250 fmol ( B ) of reference1 (Ref1) or α-PCNA aptamer. After incubation, beads were washed, and bound protein was denatured, separated by 10% SDS-PAGE and subjected to western blotting. DNA pol δ and ϵ were detected using anti-p125 and -p261 antibodies, respectively. The presented results are representative.

    Article Snippet: Impact of α-PCNA aptamer on DNA pol δ and ϵ binding to 30/90-mer primer-template DNA A 100 pmol sample of 30/90-mer DNA template generated by annealing 100 pmol of biotinylated 90-mer template (5′-TGAGGTTCAGCAAGGTGATGCTTTAGATTTTTCATTTGCTGCTGGCTCTCAGCGTGGCACTGT TGCAGGCGGTGTTAATACTGACCGCCT-biotin-3′) with 200 pmol of 30-mer primer (5′-CAGTGCCACGCTGAGAGCCAGCAGCAAATG-3′) was conjugated with 50 μl of Streptavidin Agarose Ultra Performance beads (Solulink, USA).

    Techniques: Incubation, SDS Page, Western Blot

    Determination of the α-PCNA aptamer/PCNA complex dissociation constant by pull-down assay. Biotinylated α-PCNA aptamer (concentration range from 0 to 100 μM) bound to streptavidin-agarose resin was incubated with 100 nM HisTag-PCNA. Unbound protein was denatured, separated by 12% SDS-PAGE and stained with Coomassie brilliant blue. Densitometric analysis of data from pull-down assays was performed using a Multispectral Imaging System IMAGER with Launch VisionWorksLS. The dissociation constant ( K D = 5.1 ± 0.59 μM) of the complex was calculated based on the equilibrium concentration of HisTag-PCNA/α-PCNA aptamer as a function of free α-PCNA aptamer (total aptamer) using GraphPad Prism software. Results are the mean of triplicate measurements, and error bars represent standard deviation.

    Journal: Nucleic Acids Research

    Article Title: Inhibition of DNA replication by an anti-PCNA aptamer/PCNA complex

    doi: 10.1093/nar/gkx1184

    Figure Lengend Snippet: Determination of the α-PCNA aptamer/PCNA complex dissociation constant by pull-down assay. Biotinylated α-PCNA aptamer (concentration range from 0 to 100 μM) bound to streptavidin-agarose resin was incubated with 100 nM HisTag-PCNA. Unbound protein was denatured, separated by 12% SDS-PAGE and stained with Coomassie brilliant blue. Densitometric analysis of data from pull-down assays was performed using a Multispectral Imaging System IMAGER with Launch VisionWorksLS. The dissociation constant ( K D = 5.1 ± 0.59 μM) of the complex was calculated based on the equilibrium concentration of HisTag-PCNA/α-PCNA aptamer as a function of free α-PCNA aptamer (total aptamer) using GraphPad Prism software. Results are the mean of triplicate measurements, and error bars represent standard deviation.

    Article Snippet: Impact of α-PCNA aptamer on DNA pol δ and ϵ binding to 30/90-mer primer-template DNA A 100 pmol sample of 30/90-mer DNA template generated by annealing 100 pmol of biotinylated 90-mer template (5′-TGAGGTTCAGCAAGGTGATGCTTTAGATTTTTCATTTGCTGCTGGCTCTCAGCGTGGCACTGT TGCAGGCGGTGTTAATACTGACCGCCT-biotin-3′) with 200 pmol of 30-mer primer (5′-CAGTGCCACGCTGAGAGCCAGCAGCAAATG-3′) was conjugated with 50 μl of Streptavidin Agarose Ultra Performance beads (Solulink, USA).

    Techniques: Pull Down Assay, Concentration Assay, Incubation, SDS Page, Staining, Imaging, Software, Standard Deviation

    ZCCHC3 binds to dsDNA. a ZCCHC3 binds to dsDNA. HEK293 cells were transfected with the indicated plasmids. Twenty hours later, the cell lysates were incubated with the indicated biotinylated nucleic acids and streptavidin-Sepharose beads for in vitro pull-down assays. The bound proteins were then analyzed by immunoblots with anti-HA. b ZCCHC3 binds to dsDNA through its C-terminal ZF domains. HEK293 cells were transfected with the indicated plasmids. Twenty hours after transfection, the cell lysates were incubated with biotinylated-HSV120 and streptavidin-Sepharose beads. The bound proteins were analyzed by immunoblots with anti-Flag. A schematic representation of ZCCHC3 and its truncation mutants was shown on the left. c ZCCHC3 and cGAS but not RIG-I bind to HSV-1 DNA of infected cells. HEK293 cells were transfected with HA-tagged ZCCHC3, cGAS, and RIG-I. Twenty hours after transfection, cells were infected with HSV-1for 3 h. Cell lysates were then immunoprecipitated with control IgG or anti-HA. The protein-bound DNAs were extracted and analyzed by qPCR analysis with primers corresponding to the indicated regions of HSV-1 genome. Positive ( + ) and negative (-) detections were shown at the top of the schematic presentation of the HSV-1 genome. A representative qPCR results were shown at the left. **P

    Journal: Nature Communications

    Article Title: ZCCHC3 is a co-sensor of cGAS for dsDNA recognition in innate immune response

    doi: 10.1038/s41467-018-05559-w

    Figure Lengend Snippet: ZCCHC3 binds to dsDNA. a ZCCHC3 binds to dsDNA. HEK293 cells were transfected with the indicated plasmids. Twenty hours later, the cell lysates were incubated with the indicated biotinylated nucleic acids and streptavidin-Sepharose beads for in vitro pull-down assays. The bound proteins were then analyzed by immunoblots with anti-HA. b ZCCHC3 binds to dsDNA through its C-terminal ZF domains. HEK293 cells were transfected with the indicated plasmids. Twenty hours after transfection, the cell lysates were incubated with biotinylated-HSV120 and streptavidin-Sepharose beads. The bound proteins were analyzed by immunoblots with anti-Flag. A schematic representation of ZCCHC3 and its truncation mutants was shown on the left. c ZCCHC3 and cGAS but not RIG-I bind to HSV-1 DNA of infected cells. HEK293 cells were transfected with HA-tagged ZCCHC3, cGAS, and RIG-I. Twenty hours after transfection, cells were infected with HSV-1for 3 h. Cell lysates were then immunoprecipitated with control IgG or anti-HA. The protein-bound DNAs were extracted and analyzed by qPCR analysis with primers corresponding to the indicated regions of HSV-1 genome. Positive ( + ) and negative (-) detections were shown at the top of the schematic presentation of the HSV-1 genome. A representative qPCR results were shown at the left. **P

    Article Snippet: Poly(dA:dT), 2′ 3′-cGAMP, and Lipofectamine 2000 (InvivoGen); polybrene (Millipore); SYBR (Bio-Rad); FuGene and Dual-Specific Luciferase Assay Kit (Promega); digitonin (Sigma); puromycin and EZ-link Psoralen-PEG3 -Biotin (Thermo); streptavidin agarose (Solulink); ELISA kits for murine IFN-β (PBL), IL-6 (BioLegend), and CXCL10 (BOSTER); recombinant IFN-β (R & D systems) were purchased for the indicated manufacturers.

    Techniques: Transfection, Incubation, In Vitro, Western Blot, Infection, Immunoprecipitation, Real-time Polymerase Chain Reaction

    ZCCHC3 binds to dsDNA and facilitates the binding of cGAS to dsDNA. a ZCCHC3 enhances the binding of cGAS to dsDNA. HEK293 cells were transfected with the indicated plasmids. Twenty hours later, the cell lysates were incubated with biotinylated-HSV120 and streptavidin-Sepharose beads for in vitro pull-down assays. The bound proteins were then analyzed by immunoblots with anti-HA and anti-ZCCHC3. b ZCCHC3-deficiency decreases the binding of cGAS to dsDNA in HEK293 cells. ZCCHC3-KO HEK293 clones were generated by the CRISPR-Cas9 method. ZCCHC3-KO and control HEK293 cells were transfected with HA-cGAS. Twenty hours after transfection, cells were collected for in vitro pull-down assays similarly as in a . c ZCCHC3-deficiency decreases the binding of endogenous cGAS to dsDNA in MLFs or MEFs. Zcchc3 +/+ and Zcchc3 − / − MLFs or MEFs were collected for in vitro pull-down assays. The bound proteins were then analyzed by immunoblots with anti-cGAS and anti-ZCCHC3. d MST measurement of binding affinities. Binding affinities between the indicated recombinant proteins as well as between the indicated recombinant proteins and synthetic dsDNA HSV60 were measured by MST. The purified recombinant proteins were stained with Coomassie blue (right gel). e Effects of reconstitution of ZCCHC3 or ZCCHC3 (1-340) on HSV-1-induced transcription of downstream genes in Zcchc3 − / − MLFs. Zcchc3 − / − MLFs were reconstituted with murine ZCCHC3 or ZCCHC3(1-340) by lentiviral-mediated gene transfer. The reconstituted MLFs were left un-infected or infected with HSV-1 for 6 h before qPCR analysis. f Effects of ZCCHC3 on transcription of downstream genes induced by HSV120 in cGas +/+ and cGas − / − L929 cells. cGas +/+ and cGas − / − L929 cells stably expressing ZCCHC3 were transfected with HSV120 (3 μg/ml) for 4 h before qPCR analysis. *P

    Journal: Nature Communications

    Article Title: ZCCHC3 is a co-sensor of cGAS for dsDNA recognition in innate immune response

    doi: 10.1038/s41467-018-05559-w

    Figure Lengend Snippet: ZCCHC3 binds to dsDNA and facilitates the binding of cGAS to dsDNA. a ZCCHC3 enhances the binding of cGAS to dsDNA. HEK293 cells were transfected with the indicated plasmids. Twenty hours later, the cell lysates were incubated with biotinylated-HSV120 and streptavidin-Sepharose beads for in vitro pull-down assays. The bound proteins were then analyzed by immunoblots with anti-HA and anti-ZCCHC3. b ZCCHC3-deficiency decreases the binding of cGAS to dsDNA in HEK293 cells. ZCCHC3-KO HEK293 clones were generated by the CRISPR-Cas9 method. ZCCHC3-KO and control HEK293 cells were transfected with HA-cGAS. Twenty hours after transfection, cells were collected for in vitro pull-down assays similarly as in a . c ZCCHC3-deficiency decreases the binding of endogenous cGAS to dsDNA in MLFs or MEFs. Zcchc3 +/+ and Zcchc3 − / − MLFs or MEFs were collected for in vitro pull-down assays. The bound proteins were then analyzed by immunoblots with anti-cGAS and anti-ZCCHC3. d MST measurement of binding affinities. Binding affinities between the indicated recombinant proteins as well as between the indicated recombinant proteins and synthetic dsDNA HSV60 were measured by MST. The purified recombinant proteins were stained with Coomassie blue (right gel). e Effects of reconstitution of ZCCHC3 or ZCCHC3 (1-340) on HSV-1-induced transcription of downstream genes in Zcchc3 − / − MLFs. Zcchc3 − / − MLFs were reconstituted with murine ZCCHC3 or ZCCHC3(1-340) by lentiviral-mediated gene transfer. The reconstituted MLFs were left un-infected or infected with HSV-1 for 6 h before qPCR analysis. f Effects of ZCCHC3 on transcription of downstream genes induced by HSV120 in cGas +/+ and cGas − / − L929 cells. cGas +/+ and cGas − / − L929 cells stably expressing ZCCHC3 were transfected with HSV120 (3 μg/ml) for 4 h before qPCR analysis. *P

    Article Snippet: Poly(dA:dT), 2′ 3′-cGAMP, and Lipofectamine 2000 (InvivoGen); polybrene (Millipore); SYBR (Bio-Rad); FuGene and Dual-Specific Luciferase Assay Kit (Promega); digitonin (Sigma); puromycin and EZ-link Psoralen-PEG3 -Biotin (Thermo); streptavidin agarose (Solulink); ELISA kits for murine IFN-β (PBL), IL-6 (BioLegend), and CXCL10 (BOSTER); recombinant IFN-β (R & D systems) were purchased for the indicated manufacturers.

    Techniques: Binding Assay, Transfection, Incubation, In Vitro, Western Blot, Clone Assay, Generated, CRISPR, Microscale Thermophoresis, Recombinant, Purification, Staining, Infection, Real-time Polymerase Chain Reaction, Stable Transfection, Expressing

    ZCCHC3 binds to dsDNA. a ZCCHC3 binds to dsDNA. HEK293 cells were transfected with the indicated plasmids. Twenty hours later, the cell lysates were incubated with the indicated biotinylated nucleic acids and streptavidin-Sepharose beads for in vitro pull-down assays. The bound proteins were then analyzed by immunoblots with anti-HA. b ZCCHC3 binds to dsDNA through its C-terminal ZF domains. HEK293 cells were transfected with the indicated plasmids. Twenty hours after transfection, the cell lysates were incubated with biotinylated-HSV120 and streptavidin-Sepharose beads. The bound proteins were analyzed by immunoblots with anti-Flag. A schematic representation of ZCCHC3 and its truncation mutants was shown on the left. c ZCCHC3 and cGAS but not RIG-I bind to HSV-1 DNA of infected cells. HEK293 cells were transfected with HA-tagged ZCCHC3, cGAS, and RIG-I. Twenty hours after transfection, cells were infected with HSV-1for 3 h. Cell lysates were then immunoprecipitated with control IgG or anti-HA. The protein-bound DNAs were extracted and analyzed by qPCR analysis with primers corresponding to the indicated regions of HSV-1 genome. Positive ( + ) and negative (-) detections were shown at the top of the schematic presentation of the HSV-1 genome. A representative qPCR results were shown at the left. **P

    Journal: Nature Communications

    Article Title: ZCCHC3 is a co-sensor of cGAS for dsDNA recognition in innate immune response

    doi: 10.1038/s41467-018-05559-w

    Figure Lengend Snippet: ZCCHC3 binds to dsDNA. a ZCCHC3 binds to dsDNA. HEK293 cells were transfected with the indicated plasmids. Twenty hours later, the cell lysates were incubated with the indicated biotinylated nucleic acids and streptavidin-Sepharose beads for in vitro pull-down assays. The bound proteins were then analyzed by immunoblots with anti-HA. b ZCCHC3 binds to dsDNA through its C-terminal ZF domains. HEK293 cells were transfected with the indicated plasmids. Twenty hours after transfection, the cell lysates were incubated with biotinylated-HSV120 and streptavidin-Sepharose beads. The bound proteins were analyzed by immunoblots with anti-Flag. A schematic representation of ZCCHC3 and its truncation mutants was shown on the left. c ZCCHC3 and cGAS but not RIG-I bind to HSV-1 DNA of infected cells. HEK293 cells were transfected with HA-tagged ZCCHC3, cGAS, and RIG-I. Twenty hours after transfection, cells were infected with HSV-1for 3 h. Cell lysates were then immunoprecipitated with control IgG or anti-HA. The protein-bound DNAs were extracted and analyzed by qPCR analysis with primers corresponding to the indicated regions of HSV-1 genome. Positive ( + ) and negative (-) detections were shown at the top of the schematic presentation of the HSV-1 genome. A representative qPCR results were shown at the left. **P

    Article Snippet: Reagents, antibodies, cells, and viruses Poly(dA:dT), 2′ 3′-cGAMP, and Lipofectamine 2000 (InvivoGen); polybrene (Millipore); SYBR (Bio-Rad); FuGene and Dual-Specific Luciferase Assay Kit (Promega); digitonin (Sigma); puromycin and EZ-link Psoralen-PEG3 -Biotin (Thermo); streptavidin agarose (Solulink); ELISA kits for murine IFN-β (PBL), IL-6 (BioLegend), and CXCL10 (BOSTER); recombinant IFN-β (R & D systems) were purchased for the indicated manufacturers.

    Techniques: Transfection, Incubation, In Vitro, Western Blot, Infection, Immunoprecipitation, Real-time Polymerase Chain Reaction

    ZCCHC3 binds to dsDNA and facilitates the binding of cGAS to dsDNA. a ZCCHC3 enhances the binding of cGAS to dsDNA. HEK293 cells were transfected with the indicated plasmids. Twenty hours later, the cell lysates were incubated with biotinylated-HSV120 and streptavidin-Sepharose beads for in vitro pull-down assays. The bound proteins were then analyzed by immunoblots with anti-HA and anti-ZCCHC3. b ZCCHC3-deficiency decreases the binding of cGAS to dsDNA in HEK293 cells. ZCCHC3-KO HEK293 clones were generated by the CRISPR-Cas9 method. ZCCHC3-KO and control HEK293 cells were transfected with HA-cGAS. Twenty hours after transfection, cells were collected for in vitro pull-down assays similarly as in a . c ZCCHC3-deficiency decreases the binding of endogenous cGAS to dsDNA in MLFs or MEFs. Zcchc3 +/+ and Zcchc3 − / − MLFs or MEFs were collected for in vitro pull-down assays. The bound proteins were then analyzed by immunoblots with anti-cGAS and anti-ZCCHC3. d MST measurement of binding affinities. Binding affinities between the indicated recombinant proteins as well as between the indicated recombinant proteins and synthetic dsDNA HSV60 were measured by MST. The purified recombinant proteins were stained with Coomassie blue (right gel). e Effects of reconstitution of ZCCHC3 or ZCCHC3 (1-340) on HSV-1-induced transcription of downstream genes in Zcchc3 − / − MLFs. Zcchc3 − / − MLFs were reconstituted with murine ZCCHC3 or ZCCHC3(1-340) by lentiviral-mediated gene transfer. The reconstituted MLFs were left un-infected or infected with HSV-1 for 6 h before qPCR analysis. f Effects of ZCCHC3 on transcription of downstream genes induced by HSV120 in cGas +/+ and cGas − / − L929 cells. cGas +/+ and cGas − / − L929 cells stably expressing ZCCHC3 were transfected with HSV120 (3 μg/ml) for 4 h before qPCR analysis. *P

    Journal: Nature Communications

    Article Title: ZCCHC3 is a co-sensor of cGAS for dsDNA recognition in innate immune response

    doi: 10.1038/s41467-018-05559-w

    Figure Lengend Snippet: ZCCHC3 binds to dsDNA and facilitates the binding of cGAS to dsDNA. a ZCCHC3 enhances the binding of cGAS to dsDNA. HEK293 cells were transfected with the indicated plasmids. Twenty hours later, the cell lysates were incubated with biotinylated-HSV120 and streptavidin-Sepharose beads for in vitro pull-down assays. The bound proteins were then analyzed by immunoblots with anti-HA and anti-ZCCHC3. b ZCCHC3-deficiency decreases the binding of cGAS to dsDNA in HEK293 cells. ZCCHC3-KO HEK293 clones were generated by the CRISPR-Cas9 method. ZCCHC3-KO and control HEK293 cells were transfected with HA-cGAS. Twenty hours after transfection, cells were collected for in vitro pull-down assays similarly as in a . c ZCCHC3-deficiency decreases the binding of endogenous cGAS to dsDNA in MLFs or MEFs. Zcchc3 +/+ and Zcchc3 − / − MLFs or MEFs were collected for in vitro pull-down assays. The bound proteins were then analyzed by immunoblots with anti-cGAS and anti-ZCCHC3. d MST measurement of binding affinities. Binding affinities between the indicated recombinant proteins as well as between the indicated recombinant proteins and synthetic dsDNA HSV60 were measured by MST. The purified recombinant proteins were stained with Coomassie blue (right gel). e Effects of reconstitution of ZCCHC3 or ZCCHC3 (1-340) on HSV-1-induced transcription of downstream genes in Zcchc3 − / − MLFs. Zcchc3 − / − MLFs were reconstituted with murine ZCCHC3 or ZCCHC3(1-340) by lentiviral-mediated gene transfer. The reconstituted MLFs were left un-infected or infected with HSV-1 for 6 h before qPCR analysis. f Effects of ZCCHC3 on transcription of downstream genes induced by HSV120 in cGas +/+ and cGas − / − L929 cells. cGas +/+ and cGas − / − L929 cells stably expressing ZCCHC3 were transfected with HSV120 (3 μg/ml) for 4 h before qPCR analysis. *P

    Article Snippet: Reagents, antibodies, cells, and viruses Poly(dA:dT), 2′ 3′-cGAMP, and Lipofectamine 2000 (InvivoGen); polybrene (Millipore); SYBR (Bio-Rad); FuGene and Dual-Specific Luciferase Assay Kit (Promega); digitonin (Sigma); puromycin and EZ-link Psoralen-PEG3 -Biotin (Thermo); streptavidin agarose (Solulink); ELISA kits for murine IFN-β (PBL), IL-6 (BioLegend), and CXCL10 (BOSTER); recombinant IFN-β (R & D systems) were purchased for the indicated manufacturers.

    Techniques: Binding Assay, Transfection, Incubation, In Vitro, Western Blot, Clone Assay, Generated, CRISPR, Microscale Thermophoresis, Recombinant, Purification, Staining, Infection, Real-time Polymerase Chain Reaction, Stable Transfection, Expressing

    Validation of solid-phase, fluoride triggered mAb- 2 elution. (a) Brightfield (i) and fluorescent (ii) images of the solid-phase generator. A spin column loaded with a streptavidin-agarose that binds biotin on mAb- 1 . (b) SDS-PAGE gel of eluent generated

    Journal: Bioconjugate chemistry

    Article Title: New Dioxaborolane Chemistry Enables [18F]-Positron-Emitting, Fluorescent [18F]-Multimodality Biomolecule Generation from the Solid Phase

    doi: 10.1021/acs.bioconjchem.6b00164

    Figure Lengend Snippet: Validation of solid-phase, fluoride triggered mAb- 2 elution. (a) Brightfield (i) and fluorescent (ii) images of the solid-phase generator. A spin column loaded with a streptavidin-agarose that binds biotin on mAb- 1 . (b) SDS-PAGE gel of eluent generated

    Article Snippet: 19.5 μL of mAb- 1 /Cetuximab- 1 (372 pmol) was added to 30 μL streptavidin-agarose (Solulink, N-1000-005) and incubated for 5 min.

    Techniques: SDS Page, Generated

    Radiolabeling of [ 18 F]-mAb- 2 . (a) Radioactive, SEC HPLC of [ 18 F]-mAb- 2 generated by solution fluoridation of mAb- 1 (1 h, [ 18 F]-hydrogen fluoride, pH 3). No streptavidin-agarose was utilized in this synthesis. (b) Radioactive, SEC HPLC [ 18 F]-mAb- 2 fluoride

    Journal: Bioconjugate chemistry

    Article Title: New Dioxaborolane Chemistry Enables [18F]-Positron-Emitting, Fluorescent [18F]-Multimodality Biomolecule Generation from the Solid Phase

    doi: 10.1021/acs.bioconjchem.6b00164

    Figure Lengend Snippet: Radiolabeling of [ 18 F]-mAb- 2 . (a) Radioactive, SEC HPLC of [ 18 F]-mAb- 2 generated by solution fluoridation of mAb- 1 (1 h, [ 18 F]-hydrogen fluoride, pH 3). No streptavidin-agarose was utilized in this synthesis. (b) Radioactive, SEC HPLC [ 18 F]-mAb- 2 fluoride

    Article Snippet: 19.5 μL of mAb- 1 /Cetuximab- 1 (372 pmol) was added to 30 μL streptavidin-agarose (Solulink, N-1000-005) and incubated for 5 min.

    Techniques: Radioactivity, Size-exclusion Chromatography, High Performance Liquid Chromatography, Generated