streptavidin agarose  (Millipore)


Bioz Verified Symbol Millipore is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 98

    Structured Review

    Millipore streptavidin agarose
    Differential sensitivity to extracellular probes of synaptophysin and transferrin receptor biotinylated at 18°C. PC12 cells were incubated with sulfo-NHS-LC– biotin ( A and B ) or sulfoNHS-SS–biotin ( C and D ) for 60 min at 4°C ( A ) or for 30 min at 18°C ( B–D ), chased for 5 min at 18°C in the presence of glycine ( B–D ) or not chased ( A ), and incubated at 4°C in the absence (−) or presence (+) of extracellularly added avidin ( A and B ) or MesNa ( C and D ). Synaptophysin and transferrin receptor in the postnuclear supernatants were analyzed for binding to <t>streptavidin–agarose</t> by immunoblotting of bound and unbound material with the respective antibodies. Streptavidin-bound biotinylated synaptophysin and transferrin receptor present in the postnuclear supernatant is expressed as percentage of total (sum of streptavidin-bound and streptavidin-unbound synaptophysin and transferrin receptor, respectively). ( A ) Data are the mean of two independent experiments; bars indicate the variation of the individual values from the mean. ( B–D ) Data are the mean of three independent experiments; bars indicate SD.
    Streptavidin Agarose, supplied by Millipore, used in various techniques. Bioz Stars score: 98/100, based on 154 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/streptavidin agarose/product/Millipore
    Average 98 stars, based on 154 article reviews
    Price from $9.99 to $1999.99
    streptavidin agarose - by Bioz Stars, 2020-01
    98/100 stars

    Images

    1) Product Images from "Synaptic-like Microvesicles of Neuroendocrine Cells Originate from a Novel Compartment That Is Continuous with the Plasma Membrane and Devoid of Transferrin Receptor"

    Article Title: Synaptic-like Microvesicles of Neuroendocrine Cells Originate from a Novel Compartment That Is Continuous with the Plasma Membrane and Devoid of Transferrin Receptor

    Journal: The Journal of Cell Biology

    doi:

    Differential sensitivity to extracellular probes of synaptophysin and transferrin receptor biotinylated at 18°C. PC12 cells were incubated with sulfo-NHS-LC– biotin ( A and B ) or sulfoNHS-SS–biotin ( C and D ) for 60 min at 4°C ( A ) or for 30 min at 18°C ( B–D ), chased for 5 min at 18°C in the presence of glycine ( B–D ) or not chased ( A ), and incubated at 4°C in the absence (−) or presence (+) of extracellularly added avidin ( A and B ) or MesNa ( C and D ). Synaptophysin and transferrin receptor in the postnuclear supernatants were analyzed for binding to streptavidin–agarose by immunoblotting of bound and unbound material with the respective antibodies. Streptavidin-bound biotinylated synaptophysin and transferrin receptor present in the postnuclear supernatant is expressed as percentage of total (sum of streptavidin-bound and streptavidin-unbound synaptophysin and transferrin receptor, respectively). ( A ) Data are the mean of two independent experiments; bars indicate the variation of the individual values from the mean. ( B–D ) Data are the mean of three independent experiments; bars indicate SD.
    Figure Legend Snippet: Differential sensitivity to extracellular probes of synaptophysin and transferrin receptor biotinylated at 18°C. PC12 cells were incubated with sulfo-NHS-LC– biotin ( A and B ) or sulfoNHS-SS–biotin ( C and D ) for 60 min at 4°C ( A ) or for 30 min at 18°C ( B–D ), chased for 5 min at 18°C in the presence of glycine ( B–D ) or not chased ( A ), and incubated at 4°C in the absence (−) or presence (+) of extracellularly added avidin ( A and B ) or MesNa ( C and D ). Synaptophysin and transferrin receptor in the postnuclear supernatants were analyzed for binding to streptavidin–agarose by immunoblotting of bound and unbound material with the respective antibodies. Streptavidin-bound biotinylated synaptophysin and transferrin receptor present in the postnuclear supernatant is expressed as percentage of total (sum of streptavidin-bound and streptavidin-unbound synaptophysin and transferrin receptor, respectively). ( A ) Data are the mean of two independent experiments; bars indicate the variation of the individual values from the mean. ( B–D ) Data are the mean of three independent experiments; bars indicate SD.

    Techniques Used: Incubation, Avidin-Biotin Assay, Binding Assay

    SV2 is accessible to MesNa after biotinylation at 18°C. PC12 cells were incubated with sulfo-NHS-SS– biotin for 30 min at 18°C, chased for 5 min at 18°C in the presence of glycine, and incubated at 4°C in the absence ( control ) or presence of extracellularly added MesNa. Transferrin receptor, synaptophysin, and SV2 in the postnuclear supernatants were analyzed for binding to streptavidin–agarose by immunoblotting of bound and unbound material with the respective antibodies. Streptavidin-bound biotinylated transferrin receptor, synaptophysin, and SV2 present in the postnuclear supernatant were calculated as percentage of total (sum of streptavidin-bound plus streptavidinunbound transferrin receptor, synaptophysin, and SV2, respectively), and the individual values obtained after MesNa treatment were expressed as percentage of control. Data are the mean of three independent experiments; bars indicate SD. The mean values of biotinylated protein for the control condition were 25.3% ( transferrin receptor ), 7.5% ( synaptophysin ), and 3.1% ( SV2 ).
    Figure Legend Snippet: SV2 is accessible to MesNa after biotinylation at 18°C. PC12 cells were incubated with sulfo-NHS-SS– biotin for 30 min at 18°C, chased for 5 min at 18°C in the presence of glycine, and incubated at 4°C in the absence ( control ) or presence of extracellularly added MesNa. Transferrin receptor, synaptophysin, and SV2 in the postnuclear supernatants were analyzed for binding to streptavidin–agarose by immunoblotting of bound and unbound material with the respective antibodies. Streptavidin-bound biotinylated transferrin receptor, synaptophysin, and SV2 present in the postnuclear supernatant were calculated as percentage of total (sum of streptavidin-bound plus streptavidinunbound transferrin receptor, synaptophysin, and SV2, respectively), and the individual values obtained after MesNa treatment were expressed as percentage of control. Data are the mean of three independent experiments; bars indicate SD. The mean values of biotinylated protein for the control condition were 25.3% ( transferrin receptor ), 7.5% ( synaptophysin ), and 3.1% ( SV2 ).

    Techniques Used: Incubation, Binding Assay

    SLMV biogenesis involves the MesNa-sensitive population of synaptophysin molecules biotinylated at 18°C. PC12 cells were incubated with sulfo-NHS-SS–biotin for 30 min at 18°C, chased for 5 min at 18°C in the presence of glycine, incubated at 4°C in the absence ( Control ) or presence of extracellularly added MesNa, and chased for 10 min at 37°C. The 66,000- g supernatants prepared from the cells were subjected to glycerol gradient centrifugation, and fractions were analyzed for biotinylated synaptophysin by streptavidin– agarose adsorption followed by immunoblotting of bound material with anti-synaptophysin antibodies. 11% and 4% of the total synaptophysin present in the sum of the 66,000 g pellet plus supernatant bound to streptavidin–agarose without and with MesNa addition before the 37°C chase, respectively.
    Figure Legend Snippet: SLMV biogenesis involves the MesNa-sensitive population of synaptophysin molecules biotinylated at 18°C. PC12 cells were incubated with sulfo-NHS-SS–biotin for 30 min at 18°C, chased for 5 min at 18°C in the presence of glycine, incubated at 4°C in the absence ( Control ) or presence of extracellularly added MesNa, and chased for 10 min at 37°C. The 66,000- g supernatants prepared from the cells were subjected to glycerol gradient centrifugation, and fractions were analyzed for biotinylated synaptophysin by streptavidin– agarose adsorption followed by immunoblotting of bound material with anti-synaptophysin antibodies. 11% and 4% of the total synaptophysin present in the sum of the 66,000 g pellet plus supernatant bound to streptavidin–agarose without and with MesNa addition before the 37°C chase, respectively.

    Techniques Used: Incubation, Gradient Centrifugation, Adsorption

    SLMVs originate from an avidin-protected, MesNa-accessible compartment at 37°C. PC12 cells were incubated with sulfoNHS-SS–biotin for 2 min at 37°C, chased for 10 min at 37°C, and incubated at 4°C in the absence ( Control ) or presence of extracellularly added MesNa ( A , B , and D ) or avidin ( C ). The 66,000 g pellets and supernatants were prepared from the cells and the supernatants subjected to glycerol gradient centrifugation. Synaptophysin in the glycerol gradient fractions ( A ) and transferrin receptor and synaptophysin in the 66,000 g pellets ( B–D ) were analyzed for binding to streptavidin– agarose by immunoblotting of bound and unbound material with the respective antibodies. ( A ) A representative experiment showing biotinylated synaptophysin in the glycerol gradient fractions. ( B–D ) Biotinylated synaptophysin ( B and C ) and transferrin receptor ( D ) in the 66,000 g pellet is expressed as percent of total (sum of streptavidin-bound plus streptavidin-unbound synaptophysin and transferrin receptor, respectively, present in the sum of 66,000 g pellet plus supernatant). Data are the mean of four ( MesNa ) or two ( Avidin ) independent experiments; bars indicate SD or the variation of the individual values from the mean.
    Figure Legend Snippet: SLMVs originate from an avidin-protected, MesNa-accessible compartment at 37°C. PC12 cells were incubated with sulfoNHS-SS–biotin for 2 min at 37°C, chased for 10 min at 37°C, and incubated at 4°C in the absence ( Control ) or presence of extracellularly added MesNa ( A , B , and D ) or avidin ( C ). The 66,000 g pellets and supernatants were prepared from the cells and the supernatants subjected to glycerol gradient centrifugation. Synaptophysin in the glycerol gradient fractions ( A ) and transferrin receptor and synaptophysin in the 66,000 g pellets ( B–D ) were analyzed for binding to streptavidin– agarose by immunoblotting of bound and unbound material with the respective antibodies. ( A ) A representative experiment showing biotinylated synaptophysin in the glycerol gradient fractions. ( B–D ) Biotinylated synaptophysin ( B and C ) and transferrin receptor ( D ) in the 66,000 g pellet is expressed as percent of total (sum of streptavidin-bound plus streptavidin-unbound synaptophysin and transferrin receptor, respectively, present in the sum of 66,000 g pellet plus supernatant). Data are the mean of four ( MesNa ) or two ( Avidin ) independent experiments; bars indicate SD or the variation of the individual values from the mean.

    Techniques Used: Avidin-Biotin Assay, Incubation, Gradient Centrifugation, Binding Assay

    Synaptophysin biotinylated at 18°C is quantitatively extracted from paraformaldehyde-fixed PC12 cells by Triton X-100 ( A ) and is accessible to anti-synaptophysin after digitonin permeabilization of fixed cells ( B ). ( A ) PC12 cells were incubated without (−) or with (+) sulfo-NHS-LC–biotin for 30 min at 18°C, chased for 5 min at 18°C in the presence of glycine, and fixed (+) or not fixed (−), and Triton X-100 extracts were subjected to streptavidin–agarose adsorption. Specific immunoreactivity due to the binding of biotinylated synaptophysin to streptavidin–agarose was determined by incubating the beads without (−) or with (+) anti-synaptophysin antibody ( α-Sy ) followed by HRP-conjugated goat anti–mouse IgG antibody. Data are the mean of values obtained from three coverslips; bars indicate SD. ( B ) PC12 cells were incubated without (−) or with (+) sulfo-NHS-LC– biotin for 30 min at 18°C, chased for 5 min at 18°C in the presence of glycine, fixed, permeabilized with digitonin, incubated without (−) or with (+) anti-synaptophysin ( α-Sy ), and extracted with Triton X-100. The Triton extracts were subjected to streptavidin– agarose adsorption, and anti-synaptophysin bound to the beads via biotinylated synaptophysin was detected by HRP-conjugated goat anti–mouse IgG antibody. Data are the mean of values obtained from three coverslips; bars indicate SD. The lower synaptophysin immunoreactivity in B than A (compare ordinate scales) presumably reflects incomplete accessibility of the anti-synaptophysin to its epitope when added to digitonin-permeabilized fixed cells as compared with anti-synaptophysin addition after Triton X-100 extraction of synaptophysin and its adsorption to streptavidin–agarose beads.
    Figure Legend Snippet: Synaptophysin biotinylated at 18°C is quantitatively extracted from paraformaldehyde-fixed PC12 cells by Triton X-100 ( A ) and is accessible to anti-synaptophysin after digitonin permeabilization of fixed cells ( B ). ( A ) PC12 cells were incubated without (−) or with (+) sulfo-NHS-LC–biotin for 30 min at 18°C, chased for 5 min at 18°C in the presence of glycine, and fixed (+) or not fixed (−), and Triton X-100 extracts were subjected to streptavidin–agarose adsorption. Specific immunoreactivity due to the binding of biotinylated synaptophysin to streptavidin–agarose was determined by incubating the beads without (−) or with (+) anti-synaptophysin antibody ( α-Sy ) followed by HRP-conjugated goat anti–mouse IgG antibody. Data are the mean of values obtained from three coverslips; bars indicate SD. ( B ) PC12 cells were incubated without (−) or with (+) sulfo-NHS-LC– biotin for 30 min at 18°C, chased for 5 min at 18°C in the presence of glycine, fixed, permeabilized with digitonin, incubated without (−) or with (+) anti-synaptophysin ( α-Sy ), and extracted with Triton X-100. The Triton extracts were subjected to streptavidin– agarose adsorption, and anti-synaptophysin bound to the beads via biotinylated synaptophysin was detected by HRP-conjugated goat anti–mouse IgG antibody. Data are the mean of values obtained from three coverslips; bars indicate SD. The lower synaptophysin immunoreactivity in B than A (compare ordinate scales) presumably reflects incomplete accessibility of the anti-synaptophysin to its epitope when added to digitonin-permeabilized fixed cells as compared with anti-synaptophysin addition after Triton X-100 extraction of synaptophysin and its adsorption to streptavidin–agarose beads.

    Techniques Used: Incubation, Adsorption, Binding Assay

    Time course of appearance of biotinylated synaptophysin in SLMVs. PC12 cells were incubated with sulfo-NHS-LC–biotin for 5 min at 37°C and chased at 37°C for various times as indicated ( A ) or for 3 min ( B ) and 180 min ( C ). The 66,000 g ( A ) or 12,000 g ( B and C ) supernatants prepared from the cells were subjected to glycerol gradient centrifugation, and the fractions were analyzed for biotinylated synaptophysin by streptavidin–agarose adsorption followed by immunoblotting of bound material with antisynaptophysin. ( A ) Synaptophysin immunoreactivity in the SLMV-containing fractions is expressed as percent of total biotinylated synaptophysin. Data are the mean of two (0, 10, 180 min) or three (60 min) independent experiments; bars indicate the variation of individual values from the mean or the standard error, respectively. ( B and C ) Immunoblots; 2.5% ( B ) and 11% ( C ) of the total biotinylated synaptophysin was recovered in the SLMV-containing fractions ( B , n 5–8 ; C , n 4–8 ).
    Figure Legend Snippet: Time course of appearance of biotinylated synaptophysin in SLMVs. PC12 cells were incubated with sulfo-NHS-LC–biotin for 5 min at 37°C and chased at 37°C for various times as indicated ( A ) or for 3 min ( B ) and 180 min ( C ). The 66,000 g ( A ) or 12,000 g ( B and C ) supernatants prepared from the cells were subjected to glycerol gradient centrifugation, and the fractions were analyzed for biotinylated synaptophysin by streptavidin–agarose adsorption followed by immunoblotting of bound material with antisynaptophysin. ( A ) Synaptophysin immunoreactivity in the SLMV-containing fractions is expressed as percent of total biotinylated synaptophysin. Data are the mean of two (0, 10, 180 min) or three (60 min) independent experiments; bars indicate the variation of individual values from the mean or the standard error, respectively. ( B and C ) Immunoblots; 2.5% ( B ) and 11% ( C ) of the total biotinylated synaptophysin was recovered in the SLMV-containing fractions ( B , n 5–8 ; C , n 4–8 ).

    Techniques Used: Incubation, Gradient Centrifugation, Adsorption, Western Blot

    Biotinylated synaptophysin does not appear in SLMVs at 18°C. PC12 cells were incubated with sulfoNHS-LC–biotin either for 30 min at 37°C ( A ), for 30 min at 18°C ( B–E ), or for 30 min at 18°C followed by a 30-min chase at 37°C ( F ). The 12,000 g ( A–D ) or 66,000 g ( E and F ) supernatants prepared from the cells were subjected to glycerol gradient centrifugation, and the fractions were analyzed for biotinylated ( BSy ; A , B , and F ) and nonbiotinylated ( NB-Sy ; D and E ) synaptophysin and biotinylated transferrin receptor ( BTfR ; C ) by streptavidin–agarose adsorption followed by immunoblotting of bound ( A–C and F ) and unbound ( D and E ) material with the respective antibodies. The immunoblots shown in ( B ) and ( C ) were obtained from the same filter. 16% ( A ) and 15% ( F ) of the total biotinylated synaptophysin was recovered in the SLMV-containing fractions ( A , n 5–8 ; F , n 4–8 ); the immunoblot shown in F is a longer exposure relative to that shown in A. Note that the ratio of SLMVs to the larger membranes recovered in the bottom fractions of the gradient is greater in E than D , because a 66,000 g and a 12,000 g supernatant, respectively, was subjected to glycerol gradient centrifugation.
    Figure Legend Snippet: Biotinylated synaptophysin does not appear in SLMVs at 18°C. PC12 cells were incubated with sulfoNHS-LC–biotin either for 30 min at 37°C ( A ), for 30 min at 18°C ( B–E ), or for 30 min at 18°C followed by a 30-min chase at 37°C ( F ). The 12,000 g ( A–D ) or 66,000 g ( E and F ) supernatants prepared from the cells were subjected to glycerol gradient centrifugation, and the fractions were analyzed for biotinylated ( BSy ; A , B , and F ) and nonbiotinylated ( NB-Sy ; D and E ) synaptophysin and biotinylated transferrin receptor ( BTfR ; C ) by streptavidin–agarose adsorption followed by immunoblotting of bound ( A–C and F ) and unbound ( D and E ) material with the respective antibodies. The immunoblots shown in ( B ) and ( C ) were obtained from the same filter. 16% ( A ) and 15% ( F ) of the total biotinylated synaptophysin was recovered in the SLMV-containing fractions ( A , n 5–8 ; F , n 4–8 ); the immunoblot shown in F is a longer exposure relative to that shown in A. Note that the ratio of SLMVs to the larger membranes recovered in the bottom fractions of the gradient is greater in E than D , because a 66,000 g and a 12,000 g supernatant, respectively, was subjected to glycerol gradient centrifugation.

    Techniques Used: Incubation, Gradient Centrifugation, Adsorption, Western Blot

    Time course of accumulation of biotinylated synaptophysin and transferrin receptor at 18°C. PC12 cells were incubated with ( open and closed circles ) or without ( closed triangles ) sulfo-NHS-LC–biotin at 18°C for the indicated times. The cells incubated without sulfoNHS-LC–biotin at 18°C were subsequently biotinylated for 30 min at 4°C ( closed triangles ). Postnuclear supernatants prepared from the cells were analyzed for biotinylated and nonbiotinylated synaptophysin and transferrin receptor by streptavidin– agarose adsorption, followed by immunoblotting of bound and unbound material with the respective antibodies. Biotinylated synaptophysin and transferrin receptor is expressed as percent of total (sum of biotinylated plus nonbiotinylated synaptophysin and transferrin receptor, respectively). Data points without error bars represent single determinations. Data points with error bars represent the mean of three ( transferrin receptor ), four ( synaptophysin at 10 and 30 min), or two ( synaptophysin at 20 min) independent determinations; bars indicate SD or the variation of the individual values from the mean.
    Figure Legend Snippet: Time course of accumulation of biotinylated synaptophysin and transferrin receptor at 18°C. PC12 cells were incubated with ( open and closed circles ) or without ( closed triangles ) sulfo-NHS-LC–biotin at 18°C for the indicated times. The cells incubated without sulfoNHS-LC–biotin at 18°C were subsequently biotinylated for 30 min at 4°C ( closed triangles ). Postnuclear supernatants prepared from the cells were analyzed for biotinylated and nonbiotinylated synaptophysin and transferrin receptor by streptavidin– agarose adsorption, followed by immunoblotting of bound and unbound material with the respective antibodies. Biotinylated synaptophysin and transferrin receptor is expressed as percent of total (sum of biotinylated plus nonbiotinylated synaptophysin and transferrin receptor, respectively). Data points without error bars represent single determinations. Data points with error bars represent the mean of three ( transferrin receptor ), four ( synaptophysin at 10 and 30 min), or two ( synaptophysin at 20 min) independent determinations; bars indicate SD or the variation of the individual values from the mean.

    Techniques Used: Incubation, Adsorption

    Biotinylated synaptophysin is sorted to SLMVs. PC12 cells were incubated with sulfo-NHS-LC–biotin for 5 min at 37°C and chased for 180 min at 37°C. The 12,000- g supernatant prepared from the cells was subjected to glycerol gradient centrifugation, and the fractions ( n 1 , bottom ) were analyzed for biotinylated ( A and B , closed circles , same data points for both panels) and nonbiotinylated ( B , open triangles ) synaptophysin and biotinylated transferrin receptor ( A , open circles ) by streptavidin–agarose adsorption followed by immunoblotting of bound and unbound material with the respective antibodies. Bar, SLMVs.
    Figure Legend Snippet: Biotinylated synaptophysin is sorted to SLMVs. PC12 cells were incubated with sulfo-NHS-LC–biotin for 5 min at 37°C and chased for 180 min at 37°C. The 12,000- g supernatant prepared from the cells was subjected to glycerol gradient centrifugation, and the fractions ( n 1 , bottom ) were analyzed for biotinylated ( A and B , closed circles , same data points for both panels) and nonbiotinylated ( B , open triangles ) synaptophysin and biotinylated transferrin receptor ( A , open circles ) by streptavidin–agarose adsorption followed by immunoblotting of bound and unbound material with the respective antibodies. Bar, SLMVs.

    Techniques Used: Incubation, Gradient Centrifugation, Adsorption

    Kinetics of the acquisition of MesNa inaccessibility. PC12 cells were incubated with sulfo-NHS-SS– biotin for 2 min at 37°C, chased for the indicated times at 37°C, and incubated at 4°C in the absence (controls, 0 and 30 min chase only) or presence of MesNa. Synaptophysin and transferrin receptor in the cell lysates were analyzed for binding to streptavidin–agarose by immunoblotting of bound and unbound material with the respective antibodies. Synaptophysin and transferrin receptor bound to streptavidin–agarose were calculated as percentage of total (sum of streptavidin-bound plus streptavidinunbound synaptophysin and transferrin receptor, respectively) and are expressed as percentage of control (mean of the control values at 0 and 30 min of chase, which were very similar to each other). Data are the mean of two independent experiments; bars indicate the variation of the individual values from the mean and, for some time points, are within the size of the symbol. In the control, 4.2 ± 0.3% and 11.0 ± 1.3% of the total synaptophysin and transferrin receptor were biotinylated, respectively.
    Figure Legend Snippet: Kinetics of the acquisition of MesNa inaccessibility. PC12 cells were incubated with sulfo-NHS-SS– biotin for 2 min at 37°C, chased for the indicated times at 37°C, and incubated at 4°C in the absence (controls, 0 and 30 min chase only) or presence of MesNa. Synaptophysin and transferrin receptor in the cell lysates were analyzed for binding to streptavidin–agarose by immunoblotting of bound and unbound material with the respective antibodies. Synaptophysin and transferrin receptor bound to streptavidin–agarose were calculated as percentage of total (sum of streptavidin-bound plus streptavidinunbound synaptophysin and transferrin receptor, respectively) and are expressed as percentage of control (mean of the control values at 0 and 30 min of chase, which were very similar to each other). Data are the mean of two independent experiments; bars indicate the variation of the individual values from the mean and, for some time points, are within the size of the symbol. In the control, 4.2 ± 0.3% and 11.0 ± 1.3% of the total synaptophysin and transferrin receptor were biotinylated, respectively.

    Techniques Used: Incubation, Binding Assay

    2) Product Images from "Dimeric sorting code for concentrative cargo selection by the COPII coat"

    Article Title: Dimeric sorting code for concentrative cargo selection by the COPII coat

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    doi: 10.1073/pnas.1704639115

    Assembly–disassembly cycle of COPII revealed by the proximity assay. ( A ) The SAR1 activator SEC12 promotes labeling of COPII subunits and cargos. 293A cells transfected with the indicated DNA constructs were treated with 15 µM biotin for 4 h. After cell lysis, biotinylated proteins were isolated by streptavidin beads and subjected to SDS/PAGE followed by immunoblotting with the indicated antibodies. ( B ) GTP-dependent cycling of the COPII coats revealed by coimmunoprecipitation ( Left ) and biotinylation ( Right ). 293A cells stably expressing the indicated SAR1B-BirA*-FLAG constructs were treated with 15 µM biotin for 4 h. After cell lysis, proteins were isolated by mouse anti-FLAG beads (FLAG IP) or streptavidin beads (Streptavidin PD) and subjected to SDS/PAGE followed by immunoblotting with the indicated antibodies. Mouse antibodies against BiP yielded strong nonspecific signal with the mouse anti-FLAG IgG used for IP. ( C ) GTP-locked SAR1B (H79G) decreases LMAN1 biotinylation. 293A cells transfected with the indicated DNA constructs were treated with 15 µM biotin for 4 h. After cell lysis, biotinylated proteins were isolated by streptavidin beads and subjected to SDS/PAGE followed by immunoblotting with the indicated antibodies. ( D ) GTP-locked SAR1B (H79G) traps LMAN1 on the ER. 293A cells stably expressing SAR1-BirA* or the H79G mutant were fixed and visualized by immunostaining and confocal microscopy with the indicated antibodies. Smaller boxes outlined in yellow indicate colocalization of LMAN1 and SAR1B. (Scale bars, 8 μm.) ( D , Bottom ) Quantification of the colocalization of green (SAR1B) and red (LMAN1) fluorophores. A total of 10 cells was analyzed for SAR1B H79G and for SAR1B WT. Error bars represent SEM.
    Figure Legend Snippet: Assembly–disassembly cycle of COPII revealed by the proximity assay. ( A ) The SAR1 activator SEC12 promotes labeling of COPII subunits and cargos. 293A cells transfected with the indicated DNA constructs were treated with 15 µM biotin for 4 h. After cell lysis, biotinylated proteins were isolated by streptavidin beads and subjected to SDS/PAGE followed by immunoblotting with the indicated antibodies. ( B ) GTP-dependent cycling of the COPII coats revealed by coimmunoprecipitation ( Left ) and biotinylation ( Right ). 293A cells stably expressing the indicated SAR1B-BirA*-FLAG constructs were treated with 15 µM biotin for 4 h. After cell lysis, proteins were isolated by mouse anti-FLAG beads (FLAG IP) or streptavidin beads (Streptavidin PD) and subjected to SDS/PAGE followed by immunoblotting with the indicated antibodies. Mouse antibodies against BiP yielded strong nonspecific signal with the mouse anti-FLAG IgG used for IP. ( C ) GTP-locked SAR1B (H79G) decreases LMAN1 biotinylation. 293A cells transfected with the indicated DNA constructs were treated with 15 µM biotin for 4 h. After cell lysis, biotinylated proteins were isolated by streptavidin beads and subjected to SDS/PAGE followed by immunoblotting with the indicated antibodies. ( D ) GTP-locked SAR1B (H79G) traps LMAN1 on the ER. 293A cells stably expressing SAR1-BirA* or the H79G mutant were fixed and visualized by immunostaining and confocal microscopy with the indicated antibodies. Smaller boxes outlined in yellow indicate colocalization of LMAN1 and SAR1B. (Scale bars, 8 μm.) ( D , Bottom ) Quantification of the colocalization of green (SAR1B) and red (LMAN1) fluorophores. A total of 10 cells was analyzed for SAR1B H79G and for SAR1B WT. Error bars represent SEM.

    Techniques Used: Proximity Assay, Labeling, Transfection, Construct, Lysis, Isolation, SDS Page, Stable Transfection, Expressing, Mutagenesis, Immunostaining, Confocal Microscopy

    Development of a proximity-dependent biotinylation assay for COPII-mediated cargo transport. ( A ) Overall scheme of proximity-dependent biotinylation of the COPII machinery using SAR1-BirA*. Activated SAR1 initiates the assembly of the COPII coat, which recruits cargos and/or additional regulatory factors (e.g., the cargo receptor LMAN1) to defined microdomains, allowing biotinylation by BirA* fused to SAR1. ( B ) Time course of biotinylation of the COPII subunit SEC23 by SAR1B-BirA*. 293A cells stably expressing SAR1B-BirA* (with a FLAG tag at the C terminus of BirA*) were treated with 15 µM biotin for different time points as indicated. After cell lysis, biotinylated proteins were isolated by streptavidin bead pull-down (PD) and subjected to SDS/PAGE followed by immunoblotting (IB) with anti-SEC23 ( Top ) or anti-FLAG (recognizing SAR1B; Middle ). Immunoblotting for SAR1B-FLAG in total cell lysates is shown ( Bottom ). The anti-SEC23 antibody recognizes both SEC23A and SEC23B. ( C ) Biotin dose dependence of SEC23 labeling by SAR1B-BirA*. 293A cells stably expressing SAR1B-BirA* were treated for 4 h with different doses of biotin as indicated. After cell lysis, biotinylated proteins were isolated by streptavidin beads and subjected to SDS/PAGE followed by immunoblotting with the indicated antibodies. ( D ) Capture of COPII cargos by SAR1B-BirA* in vivo. 293A cells stably expressing SAR1-BirA* were treated with 15 µM biotin for 4 h. After cell lysis, biotinylated proteins were isolated by streptavidin beads and subjected to SDS/PAGE followed by immunoblotting with the indicated antibodies; “5% input” indicates total cell lysate equivalent to 5% of the material used for streptavidin pull-down in lanes 3 and 4 (“Streptavidin PD”). ( E ) Subcellular localization of biotinylated proteins. 293A cells stably expressing SAR1B-BirA* were treated with 15 µM biotin for 4 h. After cell fixation, biotinylated proteins were visualized by immunostaining and confocal microscopy with an anti-LMAN1 antibody or Alexa Fluor-conjugated streptavidin.
    Figure Legend Snippet: Development of a proximity-dependent biotinylation assay for COPII-mediated cargo transport. ( A ) Overall scheme of proximity-dependent biotinylation of the COPII machinery using SAR1-BirA*. Activated SAR1 initiates the assembly of the COPII coat, which recruits cargos and/or additional regulatory factors (e.g., the cargo receptor LMAN1) to defined microdomains, allowing biotinylation by BirA* fused to SAR1. ( B ) Time course of biotinylation of the COPII subunit SEC23 by SAR1B-BirA*. 293A cells stably expressing SAR1B-BirA* (with a FLAG tag at the C terminus of BirA*) were treated with 15 µM biotin for different time points as indicated. After cell lysis, biotinylated proteins were isolated by streptavidin bead pull-down (PD) and subjected to SDS/PAGE followed by immunoblotting (IB) with anti-SEC23 ( Top ) or anti-FLAG (recognizing SAR1B; Middle ). Immunoblotting for SAR1B-FLAG in total cell lysates is shown ( Bottom ). The anti-SEC23 antibody recognizes both SEC23A and SEC23B. ( C ) Biotin dose dependence of SEC23 labeling by SAR1B-BirA*. 293A cells stably expressing SAR1B-BirA* were treated for 4 h with different doses of biotin as indicated. After cell lysis, biotinylated proteins were isolated by streptavidin beads and subjected to SDS/PAGE followed by immunoblotting with the indicated antibodies. ( D ) Capture of COPII cargos by SAR1B-BirA* in vivo. 293A cells stably expressing SAR1-BirA* were treated with 15 µM biotin for 4 h. After cell lysis, biotinylated proteins were isolated by streptavidin beads and subjected to SDS/PAGE followed by immunoblotting with the indicated antibodies; “5% input” indicates total cell lysate equivalent to 5% of the material used for streptavidin pull-down in lanes 3 and 4 (“Streptavidin PD”). ( E ) Subcellular localization of biotinylated proteins. 293A cells stably expressing SAR1B-BirA* were treated with 15 µM biotin for 4 h. After cell fixation, biotinylated proteins were visualized by immunostaining and confocal microscopy with an anti-LMAN1 antibody or Alexa Fluor-conjugated streptavidin.

    Techniques Used: Cell Surface Biotinylation Assay, Stable Transfection, Expressing, FLAG-tag, Lysis, Isolation, SDS Page, Labeling, In Vivo, Immunostaining, Confocal Microscopy

    Concentrative sorting of LMAN1 by COPII coats. ( A ) Schematics of LMAN1. The luminal domains and amino acid sequences of the cytosolic tails in wild-type LMAN1 and the AA mutant are shown. CRD, carbohydrate-binding domain. The stalk domain mediates LMAN1 oligomerization ( 51 ). ( B ) Enrichment of wild-type LMAN1, but not the LMAN1-AA mutant, by COPII revealed by SAR1B-BirA*. 293A cells stably expressing SAR1B-BirA* were transfected with the indicated LMAN1 constructs and treated with 15 µM biotin for 24 h. After cell lysis, biotinylated proteins were isolated by streptavidin beads and subjected to SDS/PAGE followed by immunoblotting with the indicated antibodies. ( C ) Schematics of the pulse–chase experiment using the RUSH imaging strategy. In the basal state (no biotin), SBP-mCherry-LMAN1 is retained in the ER by streptavidin-KDEL. Addition of biotin releases SBP-mCherry-LMAN1 from streptavidin-KDEL, allowing LMAN1 to be exported from the ER. ( D ) Wild-type LMAN1, but not the LMAN1-AA mutant, is enriched on COPII-coated puncta before ER export. HeLa cells expressing the indicated SBP-mCherry-LMAN1 constructs and streptavidin-KDEL were fixed at different time points following biotin treatment and subjected to immunostaining with an anti-SEC24A antibody, followed by confocal microscopy. Arrows indicate the colocalization of LMAN1 and SEC24A on the ER surface. (Scale bars, 8 µm.)
    Figure Legend Snippet: Concentrative sorting of LMAN1 by COPII coats. ( A ) Schematics of LMAN1. The luminal domains and amino acid sequences of the cytosolic tails in wild-type LMAN1 and the AA mutant are shown. CRD, carbohydrate-binding domain. The stalk domain mediates LMAN1 oligomerization ( 51 ). ( B ) Enrichment of wild-type LMAN1, but not the LMAN1-AA mutant, by COPII revealed by SAR1B-BirA*. 293A cells stably expressing SAR1B-BirA* were transfected with the indicated LMAN1 constructs and treated with 15 µM biotin for 24 h. After cell lysis, biotinylated proteins were isolated by streptavidin beads and subjected to SDS/PAGE followed by immunoblotting with the indicated antibodies. ( C ) Schematics of the pulse–chase experiment using the RUSH imaging strategy. In the basal state (no biotin), SBP-mCherry-LMAN1 is retained in the ER by streptavidin-KDEL. Addition of biotin releases SBP-mCherry-LMAN1 from streptavidin-KDEL, allowing LMAN1 to be exported from the ER. ( D ) Wild-type LMAN1, but not the LMAN1-AA mutant, is enriched on COPII-coated puncta before ER export. HeLa cells expressing the indicated SBP-mCherry-LMAN1 constructs and streptavidin-KDEL were fixed at different time points following biotin treatment and subjected to immunostaining with an anti-SEC24A antibody, followed by confocal microscopy. Arrows indicate the colocalization of LMAN1 and SEC24A on the ER surface. (Scale bars, 8 µm.)

    Techniques Used: Mutagenesis, Binding Assay, Stable Transfection, Expressing, Transfection, Construct, Lysis, Isolation, SDS Page, Pulse Chase, Imaging, Immunostaining, Confocal Microscopy

    Dimeric sorting motifs mediate ER export via the COPII coat. ( A ) Schematics of a homodimeric FF–FF motif or a heterodimeric FF–AA motif. ( B ) LMAN1-AA inhibits ER export of the wild-type LMAN1 revealed by the proximity assay. 293A cells stably expressing SAR1B-BirA* were transfected with the indicated LMAN1 mutants and treated with 15 µM biotin for 4 h. After cell lysis, biotinylated proteins were isolated by streptavidin beads and subjected to SDS/PAGE followed by immunoblotting with the indicated antibodies. ( C ) LMAN1-AA traps wild-type LMAN1 in the ER. HeLa cells expressing the indicated LMAN1 constructs were fixed and subjected to immunostaining with the indicated antibodies, followed by confocal microscopy. (Scale bars, 8 µm.) ( D ) Dimeric FY, LL, LV, and IL sorting motifs in ER export. 293A cells stably expressing SAR1-BirA* were transfected with Myc-LMAN1 mutants with the indicated sorting motifs and treated with 15 µM biotin for 4 h. After cell lysis, biotinylated proteins were isolated by streptavidin beads and subjected to SDS/PAGE followed by immunoblotting with an anti-Myc antibody.
    Figure Legend Snippet: Dimeric sorting motifs mediate ER export via the COPII coat. ( A ) Schematics of a homodimeric FF–FF motif or a heterodimeric FF–AA motif. ( B ) LMAN1-AA inhibits ER export of the wild-type LMAN1 revealed by the proximity assay. 293A cells stably expressing SAR1B-BirA* were transfected with the indicated LMAN1 mutants and treated with 15 µM biotin for 4 h. After cell lysis, biotinylated proteins were isolated by streptavidin beads and subjected to SDS/PAGE followed by immunoblotting with the indicated antibodies. ( C ) LMAN1-AA traps wild-type LMAN1 in the ER. HeLa cells expressing the indicated LMAN1 constructs were fixed and subjected to immunostaining with the indicated antibodies, followed by confocal microscopy. (Scale bars, 8 µm.) ( D ) Dimeric FY, LL, LV, and IL sorting motifs in ER export. 293A cells stably expressing SAR1-BirA* were transfected with Myc-LMAN1 mutants with the indicated sorting motifs and treated with 15 µM biotin for 4 h. After cell lysis, biotinylated proteins were isolated by streptavidin beads and subjected to SDS/PAGE followed by immunoblotting with an anti-Myc antibody.

    Techniques Used: Proximity Assay, Stable Transfection, Expressing, Transfection, Lysis, Isolation, SDS Page, Construct, Immunostaining, Confocal Microscopy

    LMAN1 dimers constitute the minimal unit for export from the ER. ( A ) ER export of LMAN1 dimers and oligomers revealed by the proximity assay. 293A cells stably expressing SAR1B-BirA* were treated with 15 µM biotin for the indicated time points. After cell lysis, biotinylated proteins were isolated by streptavidin beads and subjected to SDS/PAGE without reducing agents followed by immunoblotting with an anti-LMAN1 antibody. ( B ) Cell-free “budding” assay to reconstitute ER export of LMAN1 dimers/oligomers. Semiintact (SI) cells were mixed with cytosol and the indicated reagents to catalyze in vitro vesicle formation from the ER. The isolated vesicles were subjected to immunoblotting without reducing agent ( Top ) or with reducing agent ( Middle and Bottom ) with the indicated antibodies. No dimers or hexamers of LMAN1 were observed in the reducing condition. ATPr, ATP regeneration system. GTPγS is the nonhydrolyzable analog of GTP, and blocks COPII budding from the ER. ( C ) Biotinylation efficiency of LMAN1 mutants in the proximity assay. 293A cells stably expressing SAR1B-BirA* were transfected with the indicated Myc-LMAN1 mutants and treated with 15 µM biotin for 4 h. After cell lysis, biotinylated proteins were isolated by streptavidin beads and subjected to SDS/PAGE followed by immunoblotting with an anti-Myc antibody. ( C , Top ) LMAN1 is depicted in red, with blue bars representing deleted regions within the LMAN1 protein. Error bars represent SEM. ( D ) Dimeric LMAN1 is biotinylated by SAR1B-BirA*. 293A cells stably expressing SAR1B-BirA* were transfected with the indicated Myc-LMAN1 cysteine-to-alanine mutants and treated with 15 µM biotin for 4 h. After cell lysis, biotinylated proteins were isolated by streptavidin beads and subjected to native SDS/PAGE followed by immunoblotting with an anti-Myc antibody. Different oligomerization states of LMAN1 are depicted ( Left ). ( E ) Dimeric LMAN1 is targeted to the ERGICs. Cos-1 cells expressing the indicated LMAN1 constructs were fixed and subjected to immunostaining with the indicated antibodies, followed by confocal microscopy. (Scale bars, 8 µm.)
    Figure Legend Snippet: LMAN1 dimers constitute the minimal unit for export from the ER. ( A ) ER export of LMAN1 dimers and oligomers revealed by the proximity assay. 293A cells stably expressing SAR1B-BirA* were treated with 15 µM biotin for the indicated time points. After cell lysis, biotinylated proteins were isolated by streptavidin beads and subjected to SDS/PAGE without reducing agents followed by immunoblotting with an anti-LMAN1 antibody. ( B ) Cell-free “budding” assay to reconstitute ER export of LMAN1 dimers/oligomers. Semiintact (SI) cells were mixed with cytosol and the indicated reagents to catalyze in vitro vesicle formation from the ER. The isolated vesicles were subjected to immunoblotting without reducing agent ( Top ) or with reducing agent ( Middle and Bottom ) with the indicated antibodies. No dimers or hexamers of LMAN1 were observed in the reducing condition. ATPr, ATP regeneration system. GTPγS is the nonhydrolyzable analog of GTP, and blocks COPII budding from the ER. ( C ) Biotinylation efficiency of LMAN1 mutants in the proximity assay. 293A cells stably expressing SAR1B-BirA* were transfected with the indicated Myc-LMAN1 mutants and treated with 15 µM biotin for 4 h. After cell lysis, biotinylated proteins were isolated by streptavidin beads and subjected to SDS/PAGE followed by immunoblotting with an anti-Myc antibody. ( C , Top ) LMAN1 is depicted in red, with blue bars representing deleted regions within the LMAN1 protein. Error bars represent SEM. ( D ) Dimeric LMAN1 is biotinylated by SAR1B-BirA*. 293A cells stably expressing SAR1B-BirA* were transfected with the indicated Myc-LMAN1 cysteine-to-alanine mutants and treated with 15 µM biotin for 4 h. After cell lysis, biotinylated proteins were isolated by streptavidin beads and subjected to native SDS/PAGE followed by immunoblotting with an anti-Myc antibody. Different oligomerization states of LMAN1 are depicted ( Left ). ( E ) Dimeric LMAN1 is targeted to the ERGICs. Cos-1 cells expressing the indicated LMAN1 constructs were fixed and subjected to immunostaining with the indicated antibodies, followed by confocal microscopy. (Scale bars, 8 µm.)

    Techniques Used: Proximity Assay, Stable Transfection, Expressing, Lysis, Isolation, SDS Page, In Vitro, Transfection, Construct, Immunostaining, Confocal Microscopy

    3) Product Images from "Berberine Targets AP-2/hTERT, NF-?B/COX-2, HIF-1?/VEGF and Cytochrome-c/Caspase Signaling to Suppress Human Cancer Cell Growth"

    Article Title: Berberine Targets AP-2/hTERT, NF-?B/COX-2, HIF-1?/VEGF and Cytochrome-c/Caspase Signaling to Suppress Human Cancer Cell Growth

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0069240

    BBR inhibited AP-2/hTERT signaling. ( A – C ) Human NSCLC A549 cells were treated with BBR at the indicated doses. At 48 hours after treatment, the AP-2 and hTERT proteins ( A ) and mRNA ( B ) were analyzed by Western blotting and RT-PCR, respectively. GAPDH were used as controls for sample loading. The binding of AP-2 to hTERT promoter probe ( C ) was analyzed by a streptavidin-agarose pulldown assay. ( D ) A549 cells were transfected with an AP-2 siRNA or an AP-2-expressing vector for 24 hours, and then treated with BBR (100 µM). At 48 hours after treatment, protein expression and cell viability were determined by Western blot and MTT assay, respectively. The percent cell viability in each treatment group was calculated relative to cells treated with the vehicle control. The data are presented as the mean ± SD of three separate experiments. *, P
    Figure Legend Snippet: BBR inhibited AP-2/hTERT signaling. ( A – C ) Human NSCLC A549 cells were treated with BBR at the indicated doses. At 48 hours after treatment, the AP-2 and hTERT proteins ( A ) and mRNA ( B ) were analyzed by Western blotting and RT-PCR, respectively. GAPDH were used as controls for sample loading. The binding of AP-2 to hTERT promoter probe ( C ) was analyzed by a streptavidin-agarose pulldown assay. ( D ) A549 cells were transfected with an AP-2 siRNA or an AP-2-expressing vector for 24 hours, and then treated with BBR (100 µM). At 48 hours after treatment, protein expression and cell viability were determined by Western blot and MTT assay, respectively. The percent cell viability in each treatment group was calculated relative to cells treated with the vehicle control. The data are presented as the mean ± SD of three separate experiments. *, P

    Techniques Used: Western Blot, Reverse Transcription Polymerase Chain Reaction, Binding Assay, Transfection, Expressing, Plasmid Preparation, MTT Assay

    BBR inhibited NF-κB/COX-2 signaling. ( A ) Human A549 cells were treated with BBR at the indicated doses. At 48 hours after treatment, the COX-2 protein was analyzed by Western blotting. GAPDH were used as controls for sample loading. ( B ) A549 cells were pretreated with the COX-2 selective inhibitor celecoxib (CB, 20 µM) for 24 hours, and then treated with BBR (20 µM). At 48 hours after treatment, cell viability was determined by MTT analysis. The percent cell viability in each treatment group was calculated relative to cells treated with the vehicle control. ( C ) A549 cells were treated with BBR at the indicated doses. At 48 hours after treatment, the binding of p50 and p65 to COX-2 promoter probe was analyzed by a streptavidin-agarose pulldown assay. ( D ) A549 cells were treated with BBR (100 nM). At 48 hours after treatment, the effect of BBR on NF-κB p65 and p50 translocation was analyzed by immunofluorescence assay. The data are presented as the mean ± SD of three separate experiments. *, P
    Figure Legend Snippet: BBR inhibited NF-κB/COX-2 signaling. ( A ) Human A549 cells were treated with BBR at the indicated doses. At 48 hours after treatment, the COX-2 protein was analyzed by Western blotting. GAPDH were used as controls for sample loading. ( B ) A549 cells were pretreated with the COX-2 selective inhibitor celecoxib (CB, 20 µM) for 24 hours, and then treated with BBR (20 µM). At 48 hours after treatment, cell viability was determined by MTT analysis. The percent cell viability in each treatment group was calculated relative to cells treated with the vehicle control. ( C ) A549 cells were treated with BBR at the indicated doses. At 48 hours after treatment, the binding of p50 and p65 to COX-2 promoter probe was analyzed by a streptavidin-agarose pulldown assay. ( D ) A549 cells were treated with BBR (100 nM). At 48 hours after treatment, the effect of BBR on NF-κB p65 and p50 translocation was analyzed by immunofluorescence assay. The data are presented as the mean ± SD of three separate experiments. *, P

    Techniques Used: Western Blot, MTT Assay, Binding Assay, Translocation Assay, Immunofluorescence

    4) Product Images from "Regulation of intracellular trafficking of human CD1d by association with MHC class II molecules"

    Article Title: Regulation of intracellular trafficking of human CD1d by association with MHC class II molecules

    Journal: The EMBO Journal

    doi: 10.1093/emboj/21.7.1650

    Fig. 4. The CD1d–class II association exists in MIICs and on the cell surface. ( A ) C1R.CD1d cells were disrupted by a ball-bearing homogenizer and fractionated using a Percoll density gradient. Aliquots of each fraction were analyzed by SDS–PAGE followed by immunoblotting with D5, R.DRAB (rabbit anti-DR), DM323 (rabbit anti-DM) and MaP.ERp57 (anti-ERp57 mAb). Fraction 1 corresponds to the top of the gradient. ( B ) CD1d–class II complexes were immunoprecipitated from Brij 98-solubilized fractions using L243 and analyzed by SDS–PAGE followed by immunoblotting with D5 or R.DRAB. ( C ) C1R.CD1d cells were radiolabeled for 15 min and chased for 30 min (lanes 1 and 3) or 5 h (lanes 2 and 4). Cell surface proteins were biotinylated with sulfo-NHS-SS-biotin (see Materials and methods) prior to extraction in 1% Brij 98. The extracts were immunoprecipitated with either 51.1.3 (lanes 1 and 2) or L243 (lanes 3 and 4). Precipitated proteins were dissociated from the beads in non-reducing elution buffer containing 1% SDS and the eluates re-precipitated with streptavidin–agarose prior to separation by 12% SDS–PAGE. The bands corresponding to CD1d, and DRα and β chains, are marked on the right of the gel.
    Figure Legend Snippet: Fig. 4. The CD1d–class II association exists in MIICs and on the cell surface. ( A ) C1R.CD1d cells were disrupted by a ball-bearing homogenizer and fractionated using a Percoll density gradient. Aliquots of each fraction were analyzed by SDS–PAGE followed by immunoblotting with D5, R.DRAB (rabbit anti-DR), DM323 (rabbit anti-DM) and MaP.ERp57 (anti-ERp57 mAb). Fraction 1 corresponds to the top of the gradient. ( B ) CD1d–class II complexes were immunoprecipitated from Brij 98-solubilized fractions using L243 and analyzed by SDS–PAGE followed by immunoblotting with D5 or R.DRAB. ( C ) C1R.CD1d cells were radiolabeled for 15 min and chased for 30 min (lanes 1 and 3) or 5 h (lanes 2 and 4). Cell surface proteins were biotinylated with sulfo-NHS-SS-biotin (see Materials and methods) prior to extraction in 1% Brij 98. The extracts were immunoprecipitated with either 51.1.3 (lanes 1 and 2) or L243 (lanes 3 and 4). Precipitated proteins were dissociated from the beads in non-reducing elution buffer containing 1% SDS and the eluates re-precipitated with streptavidin–agarose prior to separation by 12% SDS–PAGE. The bands corresponding to CD1d, and DRα and β chains, are marked on the right of the gel.

    Techniques Used: SDS Page, Immunoprecipitation

    Fig. 2. Human CD1d associates with MHC class II molecules. ( A ) C1R.CD1d cells were labeled with [ 35 S]methionine for 5 h, extracted in 1% Brij 98 and immunoprecipitated with a control mAb W6/32 (anti-class I, lanes 1 and 3), 51.1.3 (anti-CD1d, lane 2), L243 (anti-HLA DRαβ dimer, lane 4) or DA6.147 (anti-DRα-chain, lane 5). SDS/DTT-eluted material was re-precipitated with DA6.147 (lanes 1 and 2) or D5 (anti-CD1d heavy chain, lanes 3–5), and analyzed by 12% SDS–PAGE. ( B ) The interaction of CD1d with class II molecules exists in cells before lysis. In lanes 1 and 2, C1R cells (2 × 10 6 cells/lane), metabolically labeled with [ 35 S]methionine for 5 h, were mixed with unlabeled C1R.CD1d cells (2 × 10 6 cells/lane) and lysed in 1% Brij 98. The lysates were immunoprecipitated with a control mAb GAP.A3 or mAb 51.1.3. In lanes 3 and 4, [ 35 S]methionine-labeled C1R.CD1d cells (2 × 10 6 cells/lane) were lysed, and immunoprecipitated as in lanes 1 and 2. The immunoprecipitates were analyzed by 12% SDS–PAGE. The bands corresponding to CD1d heavy chain and class II αβ chains are indicated. ( C ) .221.TMCD1d.f cells were lysed in 2% Brij 98 and the lysate was passed through an M2-conjugated anti-FLAG affinity column. CD1d and class II complexes were eluted with FLAG peptides. Aliquots of the eluate (top panels) and flow-through (middle and bottom panels) were used for immunoprecipitation with GAP.A3, MaP.CD82 (anti-CD82), H5C6 (anti-CD63), JS-81 (anti-CD81) or L243. HLA-DRα chain was detected by western blotting with R.DRAB (anti-HLA-DRαβ). The bands corresponding to DRα are indicated on the left. ( D ) Monocyte-derived DCs (top panels) and monocyte-depleted lymphocytes (middle panels) were lysed in 2% Brij 98, and the extracts were incubated sequentially with beads conjugated with 28-8-6S (C1), a negative control mAb and with L243. The DR-associated CD1d was eluted with 1% C 12 E 9 , ethanol precipitated, separated by SDS–PAGE and detected by western blotting with biotinylated D5 and HRP-conjugated streptavidin (lanes 1 and 2). To identify free CD1d, the supernatants from the initial L243 immunoprecipitations (the total for DCs, 1/20 of the total for monocyte-depleted lymphocytes) were re-immunoprecipitated with either a negative control mAb, 28-14-8S (C2) or 51.1.3 and detected as above (lanes 3 and 4). As a positive control, C1R.CD1d cells (bottom panels) were subjected to the same procedure. The bands corresponding to CD1d heavy chain are indicated on the left.
    Figure Legend Snippet: Fig. 2. Human CD1d associates with MHC class II molecules. ( A ) C1R.CD1d cells were labeled with [ 35 S]methionine for 5 h, extracted in 1% Brij 98 and immunoprecipitated with a control mAb W6/32 (anti-class I, lanes 1 and 3), 51.1.3 (anti-CD1d, lane 2), L243 (anti-HLA DRαβ dimer, lane 4) or DA6.147 (anti-DRα-chain, lane 5). SDS/DTT-eluted material was re-precipitated with DA6.147 (lanes 1 and 2) or D5 (anti-CD1d heavy chain, lanes 3–5), and analyzed by 12% SDS–PAGE. ( B ) The interaction of CD1d with class II molecules exists in cells before lysis. In lanes 1 and 2, C1R cells (2 × 10 6 cells/lane), metabolically labeled with [ 35 S]methionine for 5 h, were mixed with unlabeled C1R.CD1d cells (2 × 10 6 cells/lane) and lysed in 1% Brij 98. The lysates were immunoprecipitated with a control mAb GAP.A3 or mAb 51.1.3. In lanes 3 and 4, [ 35 S]methionine-labeled C1R.CD1d cells (2 × 10 6 cells/lane) were lysed, and immunoprecipitated as in lanes 1 and 2. The immunoprecipitates were analyzed by 12% SDS–PAGE. The bands corresponding to CD1d heavy chain and class II αβ chains are indicated. ( C ) .221.TMCD1d.f cells were lysed in 2% Brij 98 and the lysate was passed through an M2-conjugated anti-FLAG affinity column. CD1d and class II complexes were eluted with FLAG peptides. Aliquots of the eluate (top panels) and flow-through (middle and bottom panels) were used for immunoprecipitation with GAP.A3, MaP.CD82 (anti-CD82), H5C6 (anti-CD63), JS-81 (anti-CD81) or L243. HLA-DRα chain was detected by western blotting with R.DRAB (anti-HLA-DRαβ). The bands corresponding to DRα are indicated on the left. ( D ) Monocyte-derived DCs (top panels) and monocyte-depleted lymphocytes (middle panels) were lysed in 2% Brij 98, and the extracts were incubated sequentially with beads conjugated with 28-8-6S (C1), a negative control mAb and with L243. The DR-associated CD1d was eluted with 1% C 12 E 9 , ethanol precipitated, separated by SDS–PAGE and detected by western blotting with biotinylated D5 and HRP-conjugated streptavidin (lanes 1 and 2). To identify free CD1d, the supernatants from the initial L243 immunoprecipitations (the total for DCs, 1/20 of the total for monocyte-depleted lymphocytes) were re-immunoprecipitated with either a negative control mAb, 28-14-8S (C2) or 51.1.3 and detected as above (lanes 3 and 4). As a positive control, C1R.CD1d cells (bottom panels) were subjected to the same procedure. The bands corresponding to CD1d heavy chain are indicated on the left.

    Techniques Used: Labeling, Immunoprecipitation, SDS Page, Lysis, Metabolic Labelling, Affinity Column, Flow Cytometry, Western Blot, Derivative Assay, Incubation, Negative Control, Positive Control

    5) Product Images from "Septin oligomerization regulates persistent expression of ErbB2/HER2 in gastric cancer cells"

    Article Title: Septin oligomerization regulates persistent expression of ErbB2/HER2 in gastric cancer cells

    Journal: The Biochemical journal

    doi: 10.1042/BCJ20160203

    Cathepsin B inhibitor increases the amount of FCF-induced ubiquitylated forms of ErbB2 in cell lysates but not in the plasma membrane fraction HGE-20 cells were incubated with the indicated inhibitors for 6 hours, followed by basolateral biotinylation of surface proteins, streptavidin extraction, and western blot using anti-ErbB2 antibodies. Na + ,K + -ATPase β 1 subunit was used as a loading control. ErbB2 protein levels in the membrane fraction were not protected by any of the indicated inhibitors in the presence of FCF (A). In total cell lysates, ubiquitylated ErbB2, seen as an increased density running above the main ErbB2 band (arrowhead), was increased in the presence of cathepsin B inhibitor CA074-me (B). ErbB2 was immunoprecipitated, followed by western blot using anti-ubiquitin, then anti-ErbB2 antibodies, confirming a significant increase in ubiquitylated forms of ErbB2 in the presence of CA074-me and also showing a moderate increase in the presence of lactacystin (C). Quantification for each blot is shown to the right. Error bars, s.d., n =4 independent experiments, statistics done by Student’s t-test, ns-not significant, * - significant difference from the no-FCF control, P
    Figure Legend Snippet: Cathepsin B inhibitor increases the amount of FCF-induced ubiquitylated forms of ErbB2 in cell lysates but not in the plasma membrane fraction HGE-20 cells were incubated with the indicated inhibitors for 6 hours, followed by basolateral biotinylation of surface proteins, streptavidin extraction, and western blot using anti-ErbB2 antibodies. Na + ,K + -ATPase β 1 subunit was used as a loading control. ErbB2 protein levels in the membrane fraction were not protected by any of the indicated inhibitors in the presence of FCF (A). In total cell lysates, ubiquitylated ErbB2, seen as an increased density running above the main ErbB2 band (arrowhead), was increased in the presence of cathepsin B inhibitor CA074-me (B). ErbB2 was immunoprecipitated, followed by western blot using anti-ubiquitin, then anti-ErbB2 antibodies, confirming a significant increase in ubiquitylated forms of ErbB2 in the presence of CA074-me and also showing a moderate increase in the presence of lactacystin (C). Quantification for each blot is shown to the right. Error bars, s.d., n =4 independent experiments, statistics done by Student’s t-test, ns-not significant, * - significant difference from the no-FCF control, P

    Techniques Used: Incubation, Western Blot, Immunoprecipitation

    FCF induces ubiquitylation of ErbB2 at the plasma membrane There was no difference in FCF-induced decrease in ErbB2 in the presence or absence of cycloheximide, as shown by western blot of total HGE-20 cell lysate, suggesting the effect of FCF is on mature ErbB2 protein (A). Incubation with FCF or vehicle was completed for 12 hours with or without cycloheximide, followed by immunoprecipitation with ErbB2 antibodies. Western blot using ubiquitin antibodies, followed ErbB2 antibodies, showed increased ubiquitylation of ErbB2 in the presence of FCF, independent of new protein synthesis (B). Ubiquitylation induced by FCF is specific to ErbB2, as shown by western blot comparison of ErbB2 immunoprecipitate and total cell lysate using ubiquitin antibodies; β-actin was used as a loading control (C). Cells were incubated with FCF or vehicle, surface proteins were biotinylated from basolateral side, followed by immunoprecipitation with ErbB2 antibodies (IP1), then boiling of eluted proteins in SDS to remove interacting proteins, followed by dilution in non-ionic detergent and repeat immunoprecipitation with ErbB2 antibodies (IP2). Loss of septin-9 and cofilin signals on western blot in IP2 confirms dissociation of ErbB2 from interacting proteins. Increased ubiquitylation of ErbB2 is still seen in the absence of interacting proteins, demonstrating that ErbB2 itself is ubiquitylated. Proteins eluted from the second IP by boiling in SDS were diluted in non-ionic detergent and biotinylated ErbB2 was isolated by streptavidin extraction (SA). As shown by western blot with ubiquitin antibodies, the increased ubiquitylation of ErbB2 induced by FCF is seen in this fraction, demonstrating ubiquitylation occurs at the plasma membrane. The graph shows the FCF-increased ubiquitylation seen in each experiment as compared to control (D). Ub-ubiquitylated ErbB2, UM-unmodified ErbB2, IgG-immunoprecipitation control without cell lysate, SA-streptavidin.
    Figure Legend Snippet: FCF induces ubiquitylation of ErbB2 at the plasma membrane There was no difference in FCF-induced decrease in ErbB2 in the presence or absence of cycloheximide, as shown by western blot of total HGE-20 cell lysate, suggesting the effect of FCF is on mature ErbB2 protein (A). Incubation with FCF or vehicle was completed for 12 hours with or without cycloheximide, followed by immunoprecipitation with ErbB2 antibodies. Western blot using ubiquitin antibodies, followed ErbB2 antibodies, showed increased ubiquitylation of ErbB2 in the presence of FCF, independent of new protein synthesis (B). Ubiquitylation induced by FCF is specific to ErbB2, as shown by western blot comparison of ErbB2 immunoprecipitate and total cell lysate using ubiquitin antibodies; β-actin was used as a loading control (C). Cells were incubated with FCF or vehicle, surface proteins were biotinylated from basolateral side, followed by immunoprecipitation with ErbB2 antibodies (IP1), then boiling of eluted proteins in SDS to remove interacting proteins, followed by dilution in non-ionic detergent and repeat immunoprecipitation with ErbB2 antibodies (IP2). Loss of septin-9 and cofilin signals on western blot in IP2 confirms dissociation of ErbB2 from interacting proteins. Increased ubiquitylation of ErbB2 is still seen in the absence of interacting proteins, demonstrating that ErbB2 itself is ubiquitylated. Proteins eluted from the second IP by boiling in SDS were diluted in non-ionic detergent and biotinylated ErbB2 was isolated by streptavidin extraction (SA). As shown by western blot with ubiquitin antibodies, the increased ubiquitylation of ErbB2 induced by FCF is seen in this fraction, demonstrating ubiquitylation occurs at the plasma membrane. The graph shows the FCF-increased ubiquitylation seen in each experiment as compared to control (D). Ub-ubiquitylated ErbB2, UM-unmodified ErbB2, IgG-immunoprecipitation control without cell lysate, SA-streptavidin.

    Techniques Used: Western Blot, Incubation, Immunoprecipitation, Isolation

    6) Product Images from "RhoA S-nitrosylation as a regulatory mechanism influencing endothelial barrier function in response to G+-bacterial toxins"

    Article Title: RhoA S-nitrosylation as a regulatory mechanism influencing endothelial barrier function in response to G+-bacterial toxins

    Journal: Biochemical pharmacology

    doi: 10.1016/j.bcp.2016.12.014

    RhoA is a substrate for S-nitrosylation. (A) HLMVECs were treated with either vehicle or Cys-NO (100 μM) for 30 min, and the S-nitrosylation of proteins was determined by the biotin-switch assay in the presence of ascorbate and trace levels of copper. Biotinylated proteins were concentrated using streptavidin–agarose beads, and immunoblotted for RhoA (SNO-RhoA, top panel) versus total RhoA in cell lysates (total RhoA, bottom panel). (B) HLMVECs were treated with or without Cys-NO (100 μM) for 30 min, and S-nitrosylated proteins were selected using organomercury columns followed by immunoblotting for RhoA (SNO-RhoA, top panel) versus total RhoA in cell lysates (total RhoA, bottom panel). The relative densitometry of SNO-RhoA vs total-RhoA is expressed as means ± S.E., * P
    Figure Legend Snippet: RhoA is a substrate for S-nitrosylation. (A) HLMVECs were treated with either vehicle or Cys-NO (100 μM) for 30 min, and the S-nitrosylation of proteins was determined by the biotin-switch assay in the presence of ascorbate and trace levels of copper. Biotinylated proteins were concentrated using streptavidin–agarose beads, and immunoblotted for RhoA (SNO-RhoA, top panel) versus total RhoA in cell lysates (total RhoA, bottom panel). (B) HLMVECs were treated with or without Cys-NO (100 μM) for 30 min, and S-nitrosylated proteins were selected using organomercury columns followed by immunoblotting for RhoA (SNO-RhoA, top panel) versus total RhoA in cell lysates (total RhoA, bottom panel). The relative densitometry of SNO-RhoA vs total-RhoA is expressed as means ± S.E., * P

    Techniques Used: Biotin Switch Assay

    Mutation of RhoA on C16, 20, 159S reduces the eNOS-dependent S-nitrosylation of RhoA and protects RhoA from the inhibitory effects of NO. (A) COS-7 cells transfected with WT or mutant C16, 20, 159S RhoA constructs were treated with or without Cys-NO (100 μM) for 30 min. Cells were then lysed, the biotin-switch assay performed and biotinylated proteins concentrated using streptavidin agarose. Total S-nitrosylated proteins were identified using an anti-biotin antibody (top panel) and S-nitrosylated RhoA using a RhoA antibody (lower panel). (B) HEK293-eNOS cells were transfected with RhoA WT or the RhoAC16, 20, 159S mutant, and the degree of S-nitrosylation of RhoA was determined using the biotin-switch assay and immunoblotted for RhoA (SNO-RhoA, top panel) versus total RhoA in cell lysates (total RhoA, bottom panel). (C) COS-7 cells were transfected with WT or mutant C16, 20, 159S RhoA and exposed to the indicated concentrations of Cys-NO for 30 min. Cells were then lysed and RhoA activity determined using the G-LISA RhoA activation assay. Data are expressed as means ± S.E., * P
    Figure Legend Snippet: Mutation of RhoA on C16, 20, 159S reduces the eNOS-dependent S-nitrosylation of RhoA and protects RhoA from the inhibitory effects of NO. (A) COS-7 cells transfected with WT or mutant C16, 20, 159S RhoA constructs were treated with or without Cys-NO (100 μM) for 30 min. Cells were then lysed, the biotin-switch assay performed and biotinylated proteins concentrated using streptavidin agarose. Total S-nitrosylated proteins were identified using an anti-biotin antibody (top panel) and S-nitrosylated RhoA using a RhoA antibody (lower panel). (B) HEK293-eNOS cells were transfected with RhoA WT or the RhoAC16, 20, 159S mutant, and the degree of S-nitrosylation of RhoA was determined using the biotin-switch assay and immunoblotted for RhoA (SNO-RhoA, top panel) versus total RhoA in cell lysates (total RhoA, bottom panel). (C) COS-7 cells were transfected with WT or mutant C16, 20, 159S RhoA and exposed to the indicated concentrations of Cys-NO for 30 min. Cells were then lysed and RhoA activity determined using the G-LISA RhoA activation assay. Data are expressed as means ± S.E., * P

    Techniques Used: Mutagenesis, Transfection, Construct, Biotin Switch Assay, Activity Assay, Activation Assay

    7) Product Images from "Divergent functions and distinct localization of the Notch ligands DLL1 and DLL3 in vivo"

    Article Title: Divergent functions and distinct localization of the Notch ligands DLL1 and DLL3 in vivo

    Journal: The Journal of Cell Biology

    doi: 10.1083/jcb.200702009

    Analysis of Dll1-Dll3 chimeric ligands. (A) Schematic overview of wild-type DLL1 and DLL3 and chimeric constructs used to generate stably expressing CHO cell lines. DLL1 protein is shown in black and DLL3 in red. Numbers indicate the amino acid residue numbers. DSL, DSL domain; E1–E8, EGF-like repeats; the flag tag is indicated by gray ovals and the HA tag in construct H by a black oval. Corresponding EGF repeats of DLL1 and DLL3 are connected by black lines. (B) Western blot analysis of cell lysates (input) and streptavidin immunoprecipitated protein after surface biotinylation (IP). CHO cells stably expressing chimeric ligands show similar (input A and B) or even more (input C–H) expression compared with DLL1-expressing cells. All chimeric ligands are present on the cell surface (IP), chimeric ligands A, C, and G at lower levels and chimeric ligands B, D–F, and H at similar or even higher levels compared with DLL1. (C) Notch transactivation assays. CHO cells stably expressing DLL1 and chimeric ligands as shown in panel A were cocultivated with Notch1-HeLa cells transfected with the (RbpJ) 6 -luciferase reporter gene. Luciferase activity (percentage of activation) of chimeric ligands A–H was measured against negative (CHO wild-type cells) and positive (CHO-Dll1 cells) controls set to 0 and 100% relative activation, respectively. Four cocultivations were performed per construct and analyzed in two independent experiments each, including negative and positive controls.
    Figure Legend Snippet: Analysis of Dll1-Dll3 chimeric ligands. (A) Schematic overview of wild-type DLL1 and DLL3 and chimeric constructs used to generate stably expressing CHO cell lines. DLL1 protein is shown in black and DLL3 in red. Numbers indicate the amino acid residue numbers. DSL, DSL domain; E1–E8, EGF-like repeats; the flag tag is indicated by gray ovals and the HA tag in construct H by a black oval. Corresponding EGF repeats of DLL1 and DLL3 are connected by black lines. (B) Western blot analysis of cell lysates (input) and streptavidin immunoprecipitated protein after surface biotinylation (IP). CHO cells stably expressing chimeric ligands show similar (input A and B) or even more (input C–H) expression compared with DLL1-expressing cells. All chimeric ligands are present on the cell surface (IP), chimeric ligands A, C, and G at lower levels and chimeric ligands B, D–F, and H at similar or even higher levels compared with DLL1. (C) Notch transactivation assays. CHO cells stably expressing DLL1 and chimeric ligands as shown in panel A were cocultivated with Notch1-HeLa cells transfected with the (RbpJ) 6 -luciferase reporter gene. Luciferase activity (percentage of activation) of chimeric ligands A–H was measured against negative (CHO wild-type cells) and positive (CHO-Dll1 cells) controls set to 0 and 100% relative activation, respectively. Four cocultivations were performed per construct and analyzed in two independent experiments each, including negative and positive controls.

    Techniques Used: Construct, Stable Transfection, Expressing, FLAG-tag, Western Blot, Immunoprecipitation, Transfection, Luciferase, Activity Assay, Activation Assay

    Localization of DLL1 and DLL3 proteins. (A) Western blot analysis of cell lysates (input) and streptavidin-immunoprecipitated protein after surface biotinylation (IP). CHO cells stably expressing DLL3 (b and c) at amounts similar to cells expressing DLL1 (a) present significantly less DLL3 on the surface. L cells (mouse fibroblast cell line) coexpressing DLL3flag at significantly higher levels than DLL1HA (compare input lanes d and g) present DLL1 efficiently on the surface but not DLL3 (compare IP lanes d and g). CHO cells coexpressing DLL3HA and DLL1flag (compare input lanes e and f with h and i) present DLL1 efficiently on the surface but DLL3 only in trace amounts (compare IP lanes e and f with h and i). (B) Detection of DLL1 and DLL3 by immunofluorescence. (a–e) Localization of DLL1 and DLL3 in overexpressing CHO cells. CHO cells expressing DLL1 (a and c) show a clear cell surface staining, whereas DLL3 (b and d) is detected almost exclusively inside the cell. DLL1 and DLL3 colocalize only in some vesicular structures (e, arrowheads) but not significantly at the membrane. (f–j) Localization of DLL1 and DLL3 in D. melanogaster wing disc cells. (f) Overview of a wing disc stained for the apical cell membrane marker aPKC and DLL3flag, and Hoechst staining to visualize nuclei. (g and h) Confocal images of two opposed apical cell membranes (red) of an epithelial fold in panel f. DLL3 is found in intracellular granules or vesicles. (i and j) Confocal images of two opposed apical cell membranes (red) of a wing disc stained for aPKC and DLL1flag. DLL1 outlines cell membranes and colocalizes at the apical membrane with aPKC (j, arrowheads). (k–v) Immunofluorescent detection of DLL1 and DLL3 in PSM cells of E9.5 embryos. Endogenous DLL1 is present at the surface (k) and colocalizes with the membrane (m) and in vesicular structures with the cis-Golgi marker GM130 (s). DLL3 does not localize to the membrane (n) and does not colocalize with anti-pancadherin staining (p) but is detected in vesicular structures in the cytoplasm (t), mostly overlapping with GM130 (v). Bars, 10 μm.
    Figure Legend Snippet: Localization of DLL1 and DLL3 proteins. (A) Western blot analysis of cell lysates (input) and streptavidin-immunoprecipitated protein after surface biotinylation (IP). CHO cells stably expressing DLL3 (b and c) at amounts similar to cells expressing DLL1 (a) present significantly less DLL3 on the surface. L cells (mouse fibroblast cell line) coexpressing DLL3flag at significantly higher levels than DLL1HA (compare input lanes d and g) present DLL1 efficiently on the surface but not DLL3 (compare IP lanes d and g). CHO cells coexpressing DLL3HA and DLL1flag (compare input lanes e and f with h and i) present DLL1 efficiently on the surface but DLL3 only in trace amounts (compare IP lanes e and f with h and i). (B) Detection of DLL1 and DLL3 by immunofluorescence. (a–e) Localization of DLL1 and DLL3 in overexpressing CHO cells. CHO cells expressing DLL1 (a and c) show a clear cell surface staining, whereas DLL3 (b and d) is detected almost exclusively inside the cell. DLL1 and DLL3 colocalize only in some vesicular structures (e, arrowheads) but not significantly at the membrane. (f–j) Localization of DLL1 and DLL3 in D. melanogaster wing disc cells. (f) Overview of a wing disc stained for the apical cell membrane marker aPKC and DLL3flag, and Hoechst staining to visualize nuclei. (g and h) Confocal images of two opposed apical cell membranes (red) of an epithelial fold in panel f. DLL3 is found in intracellular granules or vesicles. (i and j) Confocal images of two opposed apical cell membranes (red) of a wing disc stained for aPKC and DLL1flag. DLL1 outlines cell membranes and colocalizes at the apical membrane with aPKC (j, arrowheads). (k–v) Immunofluorescent detection of DLL1 and DLL3 in PSM cells of E9.5 embryos. Endogenous DLL1 is present at the surface (k) and colocalizes with the membrane (m) and in vesicular structures with the cis-Golgi marker GM130 (s). DLL3 does not localize to the membrane (n) and does not colocalize with anti-pancadherin staining (p) but is detected in vesicular structures in the cytoplasm (t), mostly overlapping with GM130 (v). Bars, 10 μm.

    Techniques Used: Western Blot, Immunoprecipitation, Stable Transfection, Expressing, Immunofluorescence, Staining, Marker

    8) Product Images from "Dynamic Interplay between Adhesive and Lateral E-Cadherin Dimers"

    Article Title: Dynamic Interplay between Adhesive and Lateral E-Cadherin Dimers

    Journal: Molecular and Cellular Biology

    doi: 10.1128/MCB.22.21.7449-7458.2002

    Fast incorporation of 35 S-labeled E-cadherin into dimers. A-431 cells were biotinylated and then pulse-labeled with [ 35 S]methionine/cysteine. Next, the cells were chased for 15, 30, 60, or 180 min (chase times in minutes are indicated above the blots). After extraction and precipitation by streptavidin-biotin agarose, proteins were eluted from the beads and then immunoprecipitated with an E-cadherin-specific antibody. The autoradiogram ( 35 S) of the immunoprecipitates shows that the incorporation of the 35 S-labeled E-cadherin into dimers containing a biotinylated form of the same protein reached a plateau after 30 min. Staining the same blot with E-cadherin antibody (Ec) demonstrated that all precipitates contained the same amounts of E-cadherin. In the control experiment (lane C), lysates obtained from biotinylated and metabolically labeled cells (after 30-min chase), were mixed and processed as described above. No E-cadherin-derived signal was detected in the autoradiogram.
    Figure Legend Snippet: Fast incorporation of 35 S-labeled E-cadherin into dimers. A-431 cells were biotinylated and then pulse-labeled with [ 35 S]methionine/cysteine. Next, the cells were chased for 15, 30, 60, or 180 min (chase times in minutes are indicated above the blots). After extraction and precipitation by streptavidin-biotin agarose, proteins were eluted from the beads and then immunoprecipitated with an E-cadherin-specific antibody. The autoradiogram ( 35 S) of the immunoprecipitates shows that the incorporation of the 35 S-labeled E-cadherin into dimers containing a biotinylated form of the same protein reached a plateau after 30 min. Staining the same blot with E-cadherin antibody (Ec) demonstrated that all precipitates contained the same amounts of E-cadherin. In the control experiment (lane C), lysates obtained from biotinylated and metabolically labeled cells (after 30-min chase), were mixed and processed as described above. No E-cadherin-derived signal was detected in the autoradiogram.

    Techniques Used: Labeling, Immunoprecipitation, Staining, Metabolic Labelling, Derivative Assay

    Metabolic stability of the dimeric and monomeric forms of E-cadherin. (A) Surface proteins of AEcM cells grown in 5-cm-diameter dishes were biotinylated and then chased in regular media. The chase times (in hours) are indicated above the blots. Cells were immunoprecipitated with an excess of anti-myc antibody, and the immunoprecipitates were adjusted to 60 μl with SDS-polyacrylamide gel electrophoresis sample buffer. Five microliters of each immunoprecipitate was loaded. The blots were probed either with streptavidin-HRP (Str-HRP) or anti-myc antibody (Myc). Three different exposure times of the blot developed by Str-HRP are shown. After an exposure time of 10 s [Str-HRP (10)], only the Ec1M protein was visualized, allowing us to estimate the half-life of the monomeric E-cadherin. A longer, 60-s exposure [Str-HRP (60)] visualized coimmunoprecipitated endogenous cadherin (Ec). The blots at the bottom of panel A [Str-HRP (E)] show blots of different exposure times equilibrated on the Ec1M signals, which allowed us to demonstrate that the ratio of Ec1M to endogenous cadherin did not change during the chase periods. Panel B is identical to panel A except that cell lysates before anti-myc immunoprecipitation were subjected to sucrose gradient centrifugation either immediately after the biotinylation (blot 0) or after the 16-h chase (blot 16). The exposure time of blot 0 was shorter than that of blot 16, showing that during the 16-h chase the Ec1M/E-cadherin ratio did not change. Note that immunoprecipitation of Ec1M leads to coimmunoprecipitation of the endogenous E-cadherin (Ec) only in fractions 4 to 6. (C) Surface-biotinylated A-431 cells were dissociated by EGTA and either cocultured for additional 8 h with AEcM cells (lane 1) or cultivated separately and combined after lysis (lane 2). The latter served as a control, showing the absence of interactions between cadherin molecules in solution. The small black bars on the left of the blots indicate the positions of molecular mass markers of 116 and 97.4 kDa.
    Figure Legend Snippet: Metabolic stability of the dimeric and monomeric forms of E-cadherin. (A) Surface proteins of AEcM cells grown in 5-cm-diameter dishes were biotinylated and then chased in regular media. The chase times (in hours) are indicated above the blots. Cells were immunoprecipitated with an excess of anti-myc antibody, and the immunoprecipitates were adjusted to 60 μl with SDS-polyacrylamide gel electrophoresis sample buffer. Five microliters of each immunoprecipitate was loaded. The blots were probed either with streptavidin-HRP (Str-HRP) or anti-myc antibody (Myc). Three different exposure times of the blot developed by Str-HRP are shown. After an exposure time of 10 s [Str-HRP (10)], only the Ec1M protein was visualized, allowing us to estimate the half-life of the monomeric E-cadherin. A longer, 60-s exposure [Str-HRP (60)] visualized coimmunoprecipitated endogenous cadherin (Ec). The blots at the bottom of panel A [Str-HRP (E)] show blots of different exposure times equilibrated on the Ec1M signals, which allowed us to demonstrate that the ratio of Ec1M to endogenous cadherin did not change during the chase periods. Panel B is identical to panel A except that cell lysates before anti-myc immunoprecipitation were subjected to sucrose gradient centrifugation either immediately after the biotinylation (blot 0) or after the 16-h chase (blot 16). The exposure time of blot 0 was shorter than that of blot 16, showing that during the 16-h chase the Ec1M/E-cadherin ratio did not change. Note that immunoprecipitation of Ec1M leads to coimmunoprecipitation of the endogenous E-cadherin (Ec) only in fractions 4 to 6. (C) Surface-biotinylated A-431 cells were dissociated by EGTA and either cocultured for additional 8 h with AEcM cells (lane 1) or cultivated separately and combined after lysis (lane 2). The latter served as a control, showing the absence of interactions between cadherin molecules in solution. The small black bars on the left of the blots indicate the positions of molecular mass markers of 116 and 97.4 kDa.

    Techniques Used: Immunoprecipitation, Polyacrylamide Gel Electrophoresis, Gradient Centrifugation, Lysis

    9) Product Images from "Matrix metalloproteinase-1 up-regulation by hepatocyte growth factor in human dermal fibroblasts via ERK signaling pathway involves Ets1 and Fli1"

    Article Title: Matrix metalloproteinase-1 up-regulation by hepatocyte growth factor in human dermal fibroblasts via ERK signaling pathway involves Ets1 and Fli1

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gki648

    The binding activity of Ets1 or Fli1 is altered by HGF ( A ) To determine the amounts of Ets1 or Fli1 in cell lysates, human dermal fibroblasts were serum-starved for 24 h and treated with 10 ng/ml HGF for the indicated times. Immunoblotting were performed using anti-Ets1 or Fli1 antibodies. The same membrane was then stripped and reprobed with anti-β-actin antibody to show as a loading control. The levels of Ets1 (open bars) and Fli1 (closed bars) quantitated by scanning densitometry and corrected for the levels of β-actin in the same samples are shown relative to those in untreated cells without HGF stimulation (1.0). Data are expressed as the mean ± SD of four experiments. ( B ) Human dermal fibroblasts were serum-starved for 24 h and pretreated with 10 or 20 μM PD98059 for 1 h before the addition of 10 ng/ml of HGF for 24 h. Cell lysates were subjected to immunoblotting with anti-Ets1 or Fli1 antibodies. ( C ) Nuclear extracts were prepared from dermal fibroblast and incubated with biotin-labeled oligonucleotide as described under ‘Materials and Methods’. Proteins bound to each nucleotide were isolated with streptavidin–agarose beads, and c-jun, Ets1 or Fli1 was detected by immunoblotting. The levels of Ets1 (open bars) and Fli1 (closed bars) quantitated by scanning densitometry are shown relative to the level of untreated cells (1.0). ( D ) Normal and SSc fibroblasts were incubated in serum-free medium for 24 h in the presence or absence of 10 ng/ml of HGF prior to collection of the cell lysates. Cell lysates (normalized for protein concentrations as measured with the Bio-Rad reagent) were subjected to immunoblotting with anti-Ets1 or Fli1 antibody. The same membrane was then stripped and reprobed with anti-β-actin antibody as a loading control. The representative results for two normal and two SSc fibroblasts are shown. ( E ) Ets1 (open bars) or Fli1 (close bars) levels quantitated by scanning densitometry and corrected for the levels of β-actin in the same samples are shown relative to those in normal fibroblasts without HGF stimulation (1.0). Data are expressed as the mean ± SD of independent experiments. The number shows fold-stimulation with HGF relative to those without HGF in each cell type.
    Figure Legend Snippet: The binding activity of Ets1 or Fli1 is altered by HGF ( A ) To determine the amounts of Ets1 or Fli1 in cell lysates, human dermal fibroblasts were serum-starved for 24 h and treated with 10 ng/ml HGF for the indicated times. Immunoblotting were performed using anti-Ets1 or Fli1 antibodies. The same membrane was then stripped and reprobed with anti-β-actin antibody to show as a loading control. The levels of Ets1 (open bars) and Fli1 (closed bars) quantitated by scanning densitometry and corrected for the levels of β-actin in the same samples are shown relative to those in untreated cells without HGF stimulation (1.0). Data are expressed as the mean ± SD of four experiments. ( B ) Human dermal fibroblasts were serum-starved for 24 h and pretreated with 10 or 20 μM PD98059 for 1 h before the addition of 10 ng/ml of HGF for 24 h. Cell lysates were subjected to immunoblotting with anti-Ets1 or Fli1 antibodies. ( C ) Nuclear extracts were prepared from dermal fibroblast and incubated with biotin-labeled oligonucleotide as described under ‘Materials and Methods’. Proteins bound to each nucleotide were isolated with streptavidin–agarose beads, and c-jun, Ets1 or Fli1 was detected by immunoblotting. The levels of Ets1 (open bars) and Fli1 (closed bars) quantitated by scanning densitometry are shown relative to the level of untreated cells (1.0). ( D ) Normal and SSc fibroblasts were incubated in serum-free medium for 24 h in the presence or absence of 10 ng/ml of HGF prior to collection of the cell lysates. Cell lysates (normalized for protein concentrations as measured with the Bio-Rad reagent) were subjected to immunoblotting with anti-Ets1 or Fli1 antibody. The same membrane was then stripped and reprobed with anti-β-actin antibody as a loading control. The representative results for two normal and two SSc fibroblasts are shown. ( E ) Ets1 (open bars) or Fli1 (close bars) levels quantitated by scanning densitometry and corrected for the levels of β-actin in the same samples are shown relative to those in normal fibroblasts without HGF stimulation (1.0). Data are expressed as the mean ± SD of independent experiments. The number shows fold-stimulation with HGF relative to those without HGF in each cell type.

    Techniques Used: Binding Assay, Activity Assay, Incubation, Labeling, Isolation

    10) Product Images from "Redox Proteomics of the Inflammatory Secretome Identifies a Common Set of Redoxins and Other Glutathionylated Proteins Released in Inflammation, Influenza Virus Infection and Oxidative Stress"

    Article Title: Redox Proteomics of the Inflammatory Secretome Identifies a Common Set of Redoxins and Other Glutathionylated Proteins Released in Inflammation, Influenza Virus Infection and Oxidative Stress

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0127086

    Proteins released in glutathionylated form. Proteins in the NEM-blocked supernatants from BioGEE-pretreated, LPS-stimulated cells were immunoprecipitated with anti-PRDX1 (A) or anti-TXN1 (B). Immunoprecipitated proteins were run under non-reducing (two lanes on the left) or reducing conditions (the two lanes with DTT, on the right). Proteins were then visualized by Western blot with streptavidin peroxidase. The same blot was stripped and reprobed with anti-PRDX1 or anti-TXN1 antibody to locate the proteins (left, in both A and B). m, monomer; d, dimer.
    Figure Legend Snippet: Proteins released in glutathionylated form. Proteins in the NEM-blocked supernatants from BioGEE-pretreated, LPS-stimulated cells were immunoprecipitated with anti-PRDX1 (A) or anti-TXN1 (B). Immunoprecipitated proteins were run under non-reducing (two lanes on the left) or reducing conditions (the two lanes with DTT, on the right). Proteins were then visualized by Western blot with streptavidin peroxidase. The same blot was stripped and reprobed with anti-PRDX1 or anti-TXN1 antibody to locate the proteins (left, in both A and B). m, monomer; d, dimer.

    Techniques Used: Immunoprecipitation, Western Blot

    11) Product Images from "CXCL14 Acts as a Specific Carrier of CpG DNA into Dendritic Cells and Activates Toll-like Receptor 9-mediated Adaptive Immunity"

    Article Title: CXCL14 Acts as a Specific Carrier of CpG DNA into Dendritic Cells and Activates Toll-like Receptor 9-mediated Adaptive Immunity

    Journal: EBioMedicine

    doi: 10.1016/j.ebiom.2017.09.012

    Specific binding of CXCL14 to CpG ODN. (a, b) 100 nM Cy3-labeled CpG ODN was incubated with 100 nM biotinylated CXCL14 in the presence or absence of unlabeled CpG ODN (1, 10, or 100 × in A; 100 × in B) at 4 °C for 1 h. The complex was then pulled down with streptavidin-agarose (SA). CpG ODN and CXCL14 in the precipitate were visualized by gel electrophoresis and Western blotting with the indicated antibodies. (c–h) Scatchard plots. Different amounts of Cy3-labeled CpG ODN were subjected to a CXCL14 pulled-down assay. Bound and free Cy3 fluorescence was quantified. (i) Cy3-labeled 100 nM ODN2395 was incubated with 100 nM biotinylated CXCL14 in the presence or absence of unlabeled ODN2395 at pH 7.5 or pH 6.0. CpG ODN and CXCL14 in the precipitate were visualized by gel electrophoresis and Western blotting with the indicated antibodies. (j) Cy3-labeled 100 nM ODN2395 and 100 nM biotinylated CXCL14 were pulled down with SA. The reaction buffer was then replaced by a buffer at pH 6.0 (solid line) or pH 7.0 (broken line), and bound and free Cy3 fluorescence was measured periodically.
    Figure Legend Snippet: Specific binding of CXCL14 to CpG ODN. (a, b) 100 nM Cy3-labeled CpG ODN was incubated with 100 nM biotinylated CXCL14 in the presence or absence of unlabeled CpG ODN (1, 10, or 100 × in A; 100 × in B) at 4 °C for 1 h. The complex was then pulled down with streptavidin-agarose (SA). CpG ODN and CXCL14 in the precipitate were visualized by gel electrophoresis and Western blotting with the indicated antibodies. (c–h) Scatchard plots. Different amounts of Cy3-labeled CpG ODN were subjected to a CXCL14 pulled-down assay. Bound and free Cy3 fluorescence was quantified. (i) Cy3-labeled 100 nM ODN2395 was incubated with 100 nM biotinylated CXCL14 in the presence or absence of unlabeled ODN2395 at pH 7.5 or pH 6.0. CpG ODN and CXCL14 in the precipitate were visualized by gel electrophoresis and Western blotting with the indicated antibodies. (j) Cy3-labeled 100 nM ODN2395 and 100 nM biotinylated CXCL14 were pulled down with SA. The reaction buffer was then replaced by a buffer at pH 6.0 (solid line) or pH 7.0 (broken line), and bound and free Cy3 fluorescence was measured periodically.

    Techniques Used: Binding Assay, Labeling, Incubation, Nucleic Acid Electrophoresis, Western Blot, Fluorescence

    12) Product Images from "Role of the polypeptide N-acetylgalactosaminyltransferase 3 in ovarian cancer progression: possible implications in abnormal mucin O-glycosylation"

    Article Title: Role of the polypeptide N-acetylgalactosaminyltransferase 3 in ovarian cancer progression: possible implications in abnormal mucin O-glycosylation

    Journal: Oncotarget

    doi:

    Analysis of GALNT3-mediated MUC1 glycosylation in EOC cells A. Western blot analysis of GALNT3 and MUC1 endogenous protein expression in different EOC cell lines, including A2780s; β-actin was used as a loading control; B. Semi-quantitative RT-PCR analysis of MUC1 mRNA levels in the control clone (ctrl) and shRNA- GALNT3 clones 1 and 2 (sh-G1 and sh-G2); the GUSB gene was used as an internal control; C. Western blot analysis of MUC1 expression in the ctrl, the sh-G1 and the sh-G2 A2780s clones before (input) and following pull-down assay using biotin-conjugated VVA lectin and streptavidin agarose (pull-down); D. VVA-lectin-mediated immunoblot analysis of GalNAc-conjugated proteins in protein lysates of the ctrl, the sh-G1 and the sh-G2 A2780s clones following VVA lectin pull-down assay (pull-down). The arrow indicates bands corresponding to possible GalNAc-conjugated MUC1 peptides; E. Western blot analysis for E-cadherin and β-catenin expression in the ctrl, the sh-G1 and the sh-G2 A2780s clones; β-actin was used as a loading control
    Figure Legend Snippet: Analysis of GALNT3-mediated MUC1 glycosylation in EOC cells A. Western blot analysis of GALNT3 and MUC1 endogenous protein expression in different EOC cell lines, including A2780s; β-actin was used as a loading control; B. Semi-quantitative RT-PCR analysis of MUC1 mRNA levels in the control clone (ctrl) and shRNA- GALNT3 clones 1 and 2 (sh-G1 and sh-G2); the GUSB gene was used as an internal control; C. Western blot analysis of MUC1 expression in the ctrl, the sh-G1 and the sh-G2 A2780s clones before (input) and following pull-down assay using biotin-conjugated VVA lectin and streptavidin agarose (pull-down); D. VVA-lectin-mediated immunoblot analysis of GalNAc-conjugated proteins in protein lysates of the ctrl, the sh-G1 and the sh-G2 A2780s clones following VVA lectin pull-down assay (pull-down). The arrow indicates bands corresponding to possible GalNAc-conjugated MUC1 peptides; E. Western blot analysis for E-cadherin and β-catenin expression in the ctrl, the sh-G1 and the sh-G2 A2780s clones; β-actin was used as a loading control

    Techniques Used: Western Blot, Expressing, Quantitative RT-PCR, shRNA, Clone Assay, Pull Down Assay

    13) Product Images from "Vpr-Binding Protein Antagonizes p53-Mediated Transcription via Direct Interaction with H3 Tail"

    Article Title: Vpr-Binding Protein Antagonizes p53-Mediated Transcription via Direct Interaction with H3 Tail

    Journal: Molecular and Cellular Biology

    doi: 10.1128/MCB.06037-11

    VprBP-mediated repression of chromatin transcription and H3 acetylation. (A) Analysis of purified VprBP by 8% SDS-PAGE and Coomassie blue staining. (B) Outline of chromatin HAT and transcription assays. Abbreviations: AcCoA, acetyl-CoA; PIC, preinitiation complex; NTPs, nucleotide triphosphates. (C) Repressive effect of VprBP on chromatin transcription. p53ML-601 nucleosome array or histone-free p53ML-601 DNA was transcribed in the presence of p53, p300, Ac-CoA, and/or VprBP as summarized for panel B. Prior to transcription, p300 and VprBP were added together or sequentially as indicated. Heat-inactivated VprBP was used in control transcription reactions, marked by an asterisk (lanes 6, 12, and 18). Data were quantitated by using a phosphorimager, and the results shown are representative of three independent experiments. (D) Repressive effect of VprBP on H3 acetylation. The p53ML-601 nucleosome array was incubated with p53, p300, Ac-CoA, and/or VprBP as summarized in panel B. Acetylation of nucleosome arrays was detected by Western blotting with anti-acetyl H3 and H4 antibodies (AcH3 and AcH4). Western blot analyses of H3 and H4 confirmed equal loading of histones (H3 and H4). (E) Selective interaction of VprBP with H3 N-terminal tail. His-tagged VprBP was tested for binding to GST (lane 2) or GST-histone tail fusion (lanes 3 to 6) proteins. VprBP binding to histone tails was determined by Western blot analysis using anti-His antibody. Lane 1 represents 10% of VprBP used in the binding reactions. (F) Selective interaction of VprBP with unmodified H3 tail. Unmodified (H3) and acetylated (AcH3) H3 peptides (amino acids 1 to 28) were synthesized and incubated with His-tagged VprBP immobilized on Ni-NTA agarose beads. After extensive washing, bound H3 peptides were resolved in a 4 to 20% SDS-PAGE gel and silver stained. Input lanes 1 and 2 represent 10% of tail peptides used in the binding reactions. (G) Preferential binding of VprBP to unmodified nucleosome. Nucleosomes containing wild-type or mutant H3 were reconstituted on biotinylated 207-bp p53 RE and incubated with p300, p53, and/or Ac-CoA. After reconstituted nucleosomes and free DNA were immobilized on streptavidin-agarose beads, the interaction assays were performed with VprBP. The presence of VprBP in the beads was analyzed by Western blotting with anti-His antibody.
    Figure Legend Snippet: VprBP-mediated repression of chromatin transcription and H3 acetylation. (A) Analysis of purified VprBP by 8% SDS-PAGE and Coomassie blue staining. (B) Outline of chromatin HAT and transcription assays. Abbreviations: AcCoA, acetyl-CoA; PIC, preinitiation complex; NTPs, nucleotide triphosphates. (C) Repressive effect of VprBP on chromatin transcription. p53ML-601 nucleosome array or histone-free p53ML-601 DNA was transcribed in the presence of p53, p300, Ac-CoA, and/or VprBP as summarized for panel B. Prior to transcription, p300 and VprBP were added together or sequentially as indicated. Heat-inactivated VprBP was used in control transcription reactions, marked by an asterisk (lanes 6, 12, and 18). Data were quantitated by using a phosphorimager, and the results shown are representative of three independent experiments. (D) Repressive effect of VprBP on H3 acetylation. The p53ML-601 nucleosome array was incubated with p53, p300, Ac-CoA, and/or VprBP as summarized in panel B. Acetylation of nucleosome arrays was detected by Western blotting with anti-acetyl H3 and H4 antibodies (AcH3 and AcH4). Western blot analyses of H3 and H4 confirmed equal loading of histones (H3 and H4). (E) Selective interaction of VprBP with H3 N-terminal tail. His-tagged VprBP was tested for binding to GST (lane 2) or GST-histone tail fusion (lanes 3 to 6) proteins. VprBP binding to histone tails was determined by Western blot analysis using anti-His antibody. Lane 1 represents 10% of VprBP used in the binding reactions. (F) Selective interaction of VprBP with unmodified H3 tail. Unmodified (H3) and acetylated (AcH3) H3 peptides (amino acids 1 to 28) were synthesized and incubated with His-tagged VprBP immobilized on Ni-NTA agarose beads. After extensive washing, bound H3 peptides were resolved in a 4 to 20% SDS-PAGE gel and silver stained. Input lanes 1 and 2 represent 10% of tail peptides used in the binding reactions. (G) Preferential binding of VprBP to unmodified nucleosome. Nucleosomes containing wild-type or mutant H3 were reconstituted on biotinylated 207-bp p53 RE and incubated with p300, p53, and/or Ac-CoA. After reconstituted nucleosomes and free DNA were immobilized on streptavidin-agarose beads, the interaction assays were performed with VprBP. The presence of VprBP in the beads was analyzed by Western blotting with anti-His antibody.

    Techniques Used: Purification, SDS Page, Staining, HAT Assay, Incubation, Western Blot, Binding Assay, Synthesized, Mutagenesis

    14) Product Images from "Functional Analysis of a Breast Cancer-Associated Mutation in the Intracellular Domain of the Metalloprotease ADAM12"

    Article Title: Functional Analysis of a Breast Cancer-Associated Mutation in the Intracellular Domain of the Metalloprotease ADAM12

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0037628

    ADAM12 p.L792F localizes to the cell surface and is internalized similarly to wild-type ADAM12. ( A ) Biotinylation of cell surface ADAM12 WT or ADAM12 p.L792F . 293VnR cells, transiently transfected with ADAM12-GFP or ADAM12-GFP p.L792F were labeled with NHS-SS-Biotin for 30 min at 4°C, with subsequent incubation at 4°C (controls) or at 37°C for indicated time points. Then, the cells were treated with reducing reagent (glutathione) to remove non-internalized biotin from the cell surface (except for total biotinylation control lane 1). The control samples kept at 4°C were included to ensure proper removal of cell surface biotin. Biotinylated proteins were precipitated with streptavidin-conjugated agarose beads and subjected to western blotting with the appropriate antibodies. The ADAM12-GFP proform (proA12) is ∼150 kDa and the mature form (matA12) is ∼130 kDa. Actin was used as a loading control. TCL: Total cell lysate. ( B ) Quantitative analysis of ADAM12 internalization where internalized ADAM12-GFP at 30 or 60 min at 37°C were calculated as fold-change compared to total biotinylated ADAM12-GFP for each WT or mutant sample. The data are shown as +/− standard error of the mean (SEM) (n = 5 independent experiments); “ns.” indicates no statistical difference (p > 0.05, two-tailed unpaired t-test). ( C ) ADAM12 WT or ADAM12 p.L792F internalization and co-localization with the early endosomal marker (EEA1) and clathrin heavy chain (CHC). The images show immunofluorescent staining and confocal laser-scanning microscopy of 293VnR cells transiently transfected with ADAM12 WT or the p.L792F mutant and seeded onto FBS-coated coverslips. Cells were labeled with ADAM12 monoclonal antibody 6E6 for 1 hour at 4°C, washed, and incubated in culture medium for 15 min or 30 min, followed by fixation and permeabilization. Cells were then stained with an EEA1 antibody (top three panels) or CHC antibody (bottom three panels) for 1 h at RT and subsequently with appropriate secondary antibodies and DAPI (n = 2). Merged images show partial co-localization of ADAM12 and EEA1 or CHC. Scale bar = 10 µm.
    Figure Legend Snippet: ADAM12 p.L792F localizes to the cell surface and is internalized similarly to wild-type ADAM12. ( A ) Biotinylation of cell surface ADAM12 WT or ADAM12 p.L792F . 293VnR cells, transiently transfected with ADAM12-GFP or ADAM12-GFP p.L792F were labeled with NHS-SS-Biotin for 30 min at 4°C, with subsequent incubation at 4°C (controls) or at 37°C for indicated time points. Then, the cells were treated with reducing reagent (glutathione) to remove non-internalized biotin from the cell surface (except for total biotinylation control lane 1). The control samples kept at 4°C were included to ensure proper removal of cell surface biotin. Biotinylated proteins were precipitated with streptavidin-conjugated agarose beads and subjected to western blotting with the appropriate antibodies. The ADAM12-GFP proform (proA12) is ∼150 kDa and the mature form (matA12) is ∼130 kDa. Actin was used as a loading control. TCL: Total cell lysate. ( B ) Quantitative analysis of ADAM12 internalization where internalized ADAM12-GFP at 30 or 60 min at 37°C were calculated as fold-change compared to total biotinylated ADAM12-GFP for each WT or mutant sample. The data are shown as +/− standard error of the mean (SEM) (n = 5 independent experiments); “ns.” indicates no statistical difference (p > 0.05, two-tailed unpaired t-test). ( C ) ADAM12 WT or ADAM12 p.L792F internalization and co-localization with the early endosomal marker (EEA1) and clathrin heavy chain (CHC). The images show immunofluorescent staining and confocal laser-scanning microscopy of 293VnR cells transiently transfected with ADAM12 WT or the p.L792F mutant and seeded onto FBS-coated coverslips. Cells were labeled with ADAM12 monoclonal antibody 6E6 for 1 hour at 4°C, washed, and incubated in culture medium for 15 min or 30 min, followed by fixation and permeabilization. Cells were then stained with an EEA1 antibody (top three panels) or CHC antibody (bottom three panels) for 1 h at RT and subsequently with appropriate secondary antibodies and DAPI (n = 2). Merged images show partial co-localization of ADAM12 and EEA1 or CHC. Scale bar = 10 µm.

    Techniques Used: Transfection, Labeling, Incubation, Western Blot, Mutagenesis, Two Tailed Test, Marker, Staining, Confocal Laser Scanning Microscopy

    15) Product Images from "Target-Based Screen Against a Periplasmic Serine Protease That Regulates Intrabacterial pH Homeostasis in Mycobacteriumtuberculosis"

    Article Title: Target-Based Screen Against a Periplasmic Serine Protease That Regulates Intrabacterial pH Homeostasis in Mycobacteriumtuberculosis

    Journal: ACS Chemical Biology

    doi: 10.1021/cb500746z

    BO43T probe to identify additional targets of BO43. (a) pH IB activity of BO43, BO43T, and 2DT on BCG at pH 4.5. (b) CFU activity of BO43, BO43T, and 2DT on BCG at pH 4.5. (c) MarP immunoblot (left) and streptavidin-fluorescence (right) of BO43T treated BCG following in situ labeling and pull-down; ★ indicates MarP homologue (Mb3695c), ★★ indicates HtrA1 homologue (Mb1255). Means ± S. E. M. of triplicate samples shown in a and b represent three independent experiments. Some error bars are smaller than the symbols.
    Figure Legend Snippet: BO43T probe to identify additional targets of BO43. (a) pH IB activity of BO43, BO43T, and 2DT on BCG at pH 4.5. (b) CFU activity of BO43, BO43T, and 2DT on BCG at pH 4.5. (c) MarP immunoblot (left) and streptavidin-fluorescence (right) of BO43T treated BCG following in situ labeling and pull-down; ★ indicates MarP homologue (Mb3695c), ★★ indicates HtrA1 homologue (Mb1255). Means ± S. E. M. of triplicate samples shown in a and b represent three independent experiments. Some error bars are smaller than the symbols.

    Techniques Used: Activity Assay, Fluorescence, In Situ, Labeling

    16) Product Images from "Target-Based Screen Against a Periplasmic Serine Protease That Regulates Intrabacterial pH Homeostasis in Mycobacteriumtuberculosis"

    Article Title: Target-Based Screen Against a Periplasmic Serine Protease That Regulates Intrabacterial pH Homeostasis in Mycobacteriumtuberculosis

    Journal: ACS Chemical Biology

    doi: 10.1021/cb500746z

    BO43T probe to identify additional targets of BO43. (a) pH IB activity of BO43, BO43T, and 2DT on BCG at pH 4.5. (b) CFU activity of BO43, BO43T, and 2DT on BCG at pH 4.5. (c) MarP immunoblot (left) and streptavidin-fluorescence (right) of BO43T treated BCG following in situ labeling and pull-down; ★ indicates MarP homologue (Mb3695c), ★★ indicates HtrA1 homologue (Mb1255). Means ± S. E. M. of triplicate samples shown in a and b represent three independent experiments. Some error bars are smaller than the symbols.
    Figure Legend Snippet: BO43T probe to identify additional targets of BO43. (a) pH IB activity of BO43, BO43T, and 2DT on BCG at pH 4.5. (b) CFU activity of BO43, BO43T, and 2DT on BCG at pH 4.5. (c) MarP immunoblot (left) and streptavidin-fluorescence (right) of BO43T treated BCG following in situ labeling and pull-down; ★ indicates MarP homologue (Mb3695c), ★★ indicates HtrA1 homologue (Mb1255). Means ± S. E. M. of triplicate samples shown in a and b represent three independent experiments. Some error bars are smaller than the symbols.

    Techniques Used: Activity Assay, Fluorescence, In Situ, Labeling

    17) Product Images from "Subcellular Localization and Activity of the Mitogen-Activated Protein Kinase Kinase 7 (MKK7) γ Isoform are Regulated through Binding to the Phosphatase Calcineurin"

    Article Title: Subcellular Localization and Activity of the Mitogen-Activated Protein Kinase Kinase 7 (MKK7) γ Isoform are Regulated through Binding to the Phosphatase Calcineurin

    Journal: Molecular Pharmacology

    doi: 10.1124/mol.118.113159

    MKK7 γ , but not MKK7 β , binds to CaN through a direct PxIxIT motif interaction. (A) Diagram showing the experimental design for detecting PVIVIT-GFP disruption of anti-myc co-IP of CaNA-myc and Flag-MKK7 γ and -MKK7 β in HEK-293 cells. Transfection of HEK-293 cells with higher amounts of plasmid DNA leading to higher levels of VIVIT-GFP expression [middle panel, immunoblotting (IB): GFP] are required to disrupt anti-myc co-IP of Flag-MKK7 γ 1 (B) versus Flag-MKK7 β 1 (C) (top panel, IB: Flag) with CaNA-myc (bottom panel; IB: myc). (D) Diagram showing the experimental design for detecting precipitation of CaNA-myc by biotinylated MKK7 β or MKK7 γ 35–52 peptides coupled to streptavidin agarose beads. (E) MKK7 γ 35–52 and PVIVIT biotinylated peptides precipitate CaNA-myc from HEK-293 cell extracts. MKK7 β 35–52 and negative control (Ht31) biotinylated peptides do not precipitate CaNA-myc. (F) The MKK7 γ 35–52 peptide competes with an affinity similar to PVIVIT for fluorescent-PVIVIT binding to CaN measured by fluorescence polarization (mP). MKK7 β 35–52 only competes for fluorescent PVIVIT binding to CaN at much higher concentrations. All data are representative of three independent experiments.
    Figure Legend Snippet: MKK7 γ , but not MKK7 β , binds to CaN through a direct PxIxIT motif interaction. (A) Diagram showing the experimental design for detecting PVIVIT-GFP disruption of anti-myc co-IP of CaNA-myc and Flag-MKK7 γ and -MKK7 β in HEK-293 cells. Transfection of HEK-293 cells with higher amounts of plasmid DNA leading to higher levels of VIVIT-GFP expression [middle panel, immunoblotting (IB): GFP] are required to disrupt anti-myc co-IP of Flag-MKK7 γ 1 (B) versus Flag-MKK7 β 1 (C) (top panel, IB: Flag) with CaNA-myc (bottom panel; IB: myc). (D) Diagram showing the experimental design for detecting precipitation of CaNA-myc by biotinylated MKK7 β or MKK7 γ 35–52 peptides coupled to streptavidin agarose beads. (E) MKK7 γ 35–52 and PVIVIT biotinylated peptides precipitate CaNA-myc from HEK-293 cell extracts. MKK7 β 35–52 and negative control (Ht31) biotinylated peptides do not precipitate CaNA-myc. (F) The MKK7 γ 35–52 peptide competes with an affinity similar to PVIVIT for fluorescent-PVIVIT binding to CaN measured by fluorescence polarization (mP). MKK7 β 35–52 only competes for fluorescent PVIVIT binding to CaN at much higher concentrations. All data are representative of three independent experiments.

    Techniques Used: Co-Immunoprecipitation Assay, Transfection, Plasmid Preparation, Expressing, Negative Control, Binding Assay, Fluorescence

    18) Product Images from "Defective Tibetan PHD2 Binding to p23 Links High Altitude Adaption to Altered Oxygen Sensing *"

    Article Title: Defective Tibetan PHD2 Binding to p23 Links High Altitude Adaption to Altered Oxygen Sensing *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M113.541227

    The D4E/C127S PHD2 haplotype maintains interaction with HSP90. A , schematic diagram of HSP90. The numbers at the top indicate residue numbers. Below are the sequences of the last 22 amino acids from HSP90β and HSP90α from the indicated species. Asterisks indicate P , L , and E of the P X LE motif. The dashed line indicates the MEEVD motif. Shading denotes conservation in the indicated species. B , Sf9 lysates containing HT-Flag-PHD2 were incubated with the indicated biotinylated peptides immobilized on streptavidin-agarose and washed, and the eluates were examined for the presence of PHD2 using anti-Flag antibodies. Input , 1% of total. C , recombinant WT or P709A/L711A/E712A (AAA) HT-HA-HSP90β (2 μg) was incubated with or without HT-FlagPHD2 (2 μg), and the latter was then immunoprecipitated using anti-Flag antibodies. The immunoprecipitates were examined for the presence of HSP90 as shown. Input represents 2% of total. D , recombinant HT-HA-HSP90 (1 μg) was incubated without or with WT or D4E/C127S HT-FlagPHD2 (1 μg), and the latter was then immunoprecipitated using anti-Flag antibodies. The immunoprecipitates were examined for the presence of HSP90 as shown. E , HEK293 FT lysates were incubated without or with recombinant WT or D4E/C127S HT-FlagPHD2 (1 μg), and the latter was then immunoprecipitated using anti-Flag antibodies. The immunoprecipitates and aliquots of lysate were subjected to Western blotting as indicated. F , recombinant HT-HA-p23 (1 μg) was incubated without or with either WT or D4E/C127S HT-FlagPHD2 (1 μg) in the presence of HEK293 FT lysate (100 μg), and the HT-FlagPHD2 was then immunoprecipitated using anti-Flag antibodies. The immunoprecipitates and aliquots of lysate were examined for the presence of HA-p23 as shown. IP , immunoprecipitation; WB , Western blotting.
    Figure Legend Snippet: The D4E/C127S PHD2 haplotype maintains interaction with HSP90. A , schematic diagram of HSP90. The numbers at the top indicate residue numbers. Below are the sequences of the last 22 amino acids from HSP90β and HSP90α from the indicated species. Asterisks indicate P , L , and E of the P X LE motif. The dashed line indicates the MEEVD motif. Shading denotes conservation in the indicated species. B , Sf9 lysates containing HT-Flag-PHD2 were incubated with the indicated biotinylated peptides immobilized on streptavidin-agarose and washed, and the eluates were examined for the presence of PHD2 using anti-Flag antibodies. Input , 1% of total. C , recombinant WT or P709A/L711A/E712A (AAA) HT-HA-HSP90β (2 μg) was incubated with or without HT-FlagPHD2 (2 μg), and the latter was then immunoprecipitated using anti-Flag antibodies. The immunoprecipitates were examined for the presence of HSP90 as shown. Input represents 2% of total. D , recombinant HT-HA-HSP90 (1 μg) was incubated without or with WT or D4E/C127S HT-FlagPHD2 (1 μg), and the latter was then immunoprecipitated using anti-Flag antibodies. The immunoprecipitates were examined for the presence of HSP90 as shown. E , HEK293 FT lysates were incubated without or with recombinant WT or D4E/C127S HT-FlagPHD2 (1 μg), and the latter was then immunoprecipitated using anti-Flag antibodies. The immunoprecipitates and aliquots of lysate were subjected to Western blotting as indicated. F , recombinant HT-HA-p23 (1 μg) was incubated without or with either WT or D4E/C127S HT-FlagPHD2 (1 μg) in the presence of HEK293 FT lysate (100 μg), and the HT-FlagPHD2 was then immunoprecipitated using anti-Flag antibodies. The immunoprecipitates and aliquots of lysate were examined for the presence of HA-p23 as shown. IP , immunoprecipitation; WB , Western blotting.

    Techniques Used: Incubation, Recombinant, Immunoprecipitation, Western Blot

    19) Product Images from "Sequential and ?-secretase-dependent processing of the betacellulin precursor generates a palmitoylated intracellular-domain fragment that inhibits cell growth"

    Article Title: Sequential and ?-secretase-dependent processing of the betacellulin precursor generates a palmitoylated intracellular-domain fragment that inhibits cell growth

    Journal: Journal of Cell Science

    doi: 10.1242/jcs.060830

    BTC-ICD remains attached to the membrane compartment through palmitoylation. ( A ) IMPE-BTC-WT cells were lysed in lysis buffer with or without 50 mM NEM and cellular BTC isoforms precipitated with anti-HA agarose prior to acyl-biotin exchange labeling as described in the Materials and Methods. Eluted biotinylated proteins were re-precipitated with streptavidin-agarose and analyzed by western blot with anti-HA antibody (upper panel). Separate samples were directly analyzed in western blot with anti-HA antibody as loading controls (lower panel). ( B ) IMPE cells expressing either BTC-WT, BTC-Palm or BTC-ΔE were incubated in fatty-acid-free DMEM supplemented with 200 μCi of [ 3 H]palmitic acid for 6 hours at 37°C. Cell lysates were precipitated with anti-HA agarose and analyzed in western blot with anti-HA antibody (right panel) or membranes were used for autoradiography (left panel). ( C ) IMPE-BTC-WT cells were homogenized in the presence or absence of 1 M hydroxylamine-HCl (hydroxylamine) prior to pelleting membranes as described in the Materials and Methods. Cell lysates from membrane fractions and supernatants (S/N) were precipitated with anti-HA agarose and analyzed by western blotting with anti-HA antibody (upper panel: short exposure; lower panel: long exposure shows only BTC-CTF and BTC-ICD).
    Figure Legend Snippet: BTC-ICD remains attached to the membrane compartment through palmitoylation. ( A ) IMPE-BTC-WT cells were lysed in lysis buffer with or without 50 mM NEM and cellular BTC isoforms precipitated with anti-HA agarose prior to acyl-biotin exchange labeling as described in the Materials and Methods. Eluted biotinylated proteins were re-precipitated with streptavidin-agarose and analyzed by western blot with anti-HA antibody (upper panel). Separate samples were directly analyzed in western blot with anti-HA antibody as loading controls (lower panel). ( B ) IMPE cells expressing either BTC-WT, BTC-Palm or BTC-ΔE were incubated in fatty-acid-free DMEM supplemented with 200 μCi of [ 3 H]palmitic acid for 6 hours at 37°C. Cell lysates were precipitated with anti-HA agarose and analyzed in western blot with anti-HA antibody (right panel) or membranes were used for autoradiography (left panel). ( C ) IMPE-BTC-WT cells were homogenized in the presence or absence of 1 M hydroxylamine-HCl (hydroxylamine) prior to pelleting membranes as described in the Materials and Methods. Cell lysates from membrane fractions and supernatants (S/N) were precipitated with anti-HA agarose and analyzed by western blotting with anti-HA antibody (upper panel: short exposure; lower panel: long exposure shows only BTC-CTF and BTC-ICD).

    Techniques Used: Lysis, Labeling, Western Blot, Expressing, Incubation, Autoradiography

    20) Product Images from "Increased Expression of Integrin ?v?5 Induces the Myofibroblastic Differentiation of Dermal Fibroblasts"

    Article Title: Increased Expression of Integrin ?v?5 Induces the Myofibroblastic Differentiation of Dermal Fibroblasts

    Journal: The American Journal of Pathology

    doi: 10.2353/ajpath.2006.041306

    Confirmation of the establishment of β5-transfectants. Total RNAs were extracted from confluent quiescent cells, and the levels of β5 mRNA ( A ) or αv mRNA ( C ) were determined by Northern blotting. Cell surface proteins were labeled with biotin, and whole-cell lysates were subjected to immunoprecipitation using goat anti-β5 antibody ( B , left panel ), goat anti-β1 antibody ( D ), or goat anti-β3 antibody ( E ). Precipitated proteins were subjected to SDS-PAGE, and Western blots were prepared. The blots were probed with streptavidin coupled to horseradish peroxidase. A parallel immunoprecipitation performed with preimmune goat IgG failed to show integrin immunoreactivities ( B , right panel ). The bands in immunoprecipitation were confirmed to be the indicated subunits by a reprobing analysis using specific antibodies to αv-, β1-, β3-, or β5-subunits (data not shown), whereas the identity of α1, α2, α3, and α5 was determined by the size on a gel. Experiments were repeated five times with similar results.
    Figure Legend Snippet: Confirmation of the establishment of β5-transfectants. Total RNAs were extracted from confluent quiescent cells, and the levels of β5 mRNA ( A ) or αv mRNA ( C ) were determined by Northern blotting. Cell surface proteins were labeled with biotin, and whole-cell lysates were subjected to immunoprecipitation using goat anti-β5 antibody ( B , left panel ), goat anti-β1 antibody ( D ), or goat anti-β3 antibody ( E ). Precipitated proteins were subjected to SDS-PAGE, and Western blots were prepared. The blots were probed with streptavidin coupled to horseradish peroxidase. A parallel immunoprecipitation performed with preimmune goat IgG failed to show integrin immunoreactivities ( B , right panel ). The bands in immunoprecipitation were confirmed to be the indicated subunits by a reprobing analysis using specific antibodies to αv-, β1-, β3-, or β5-subunits (data not shown), whereas the identity of α1, α2, α3, and α5 was determined by the size on a gel. Experiments were repeated five times with similar results.

    Techniques Used: Northern Blot, Labeling, Immunoprecipitation, SDS Page, Western Blot

    21) Product Images from "Analysis of metabotropic glutamate receptor 7 as a potential substrate for SUMOylation"

    Article Title: Analysis of metabotropic glutamate receptor 7 as a potential substrate for SUMOylation

    Journal: Neuroscience Letters

    doi: 10.1016/j.neulet.2011.01.032

    Expression and surface trafficking of a wild-type and non-SUMOylatable SEP-mGluR7 in HEK293 cells: (A) SEP-mGluR7 was transfected into HEK293 cells. Thirty-six hours post-transfection, surface proteins were labelled with biotin, the cells lysed and biotinylated surface proteins were isolated on streptavidin beads and subjected to Western blotting alongside total lysate for GFP (SEP). (B) SEP-mGluR7 was transfected into 13DIV primary cortical neurons and imaged for SEP expression 5 days later (upper panel). SEP fluorescence was reduced with a transient exposure to pH 6.0 buffer consistent with the majority of the signal arising from surface expressed SEP-mGluR7. Application of ammonium chloride, which collapses pH gradients across the plasma membrane and transiently equilibrates intracellular compartments to the extracellular pH increased fluorescence showing the total SEP signal (pH 7.4) or minimum signal (pH 6). The fluorescence of the region boxed in the upper panel is shown graphically in the lower panel. (C) SEP-mGluR7 is functional in HEK293 cells, as assayed for its ability to activate the ERK pathway. Data are the mean ± SEM, ** p
    Figure Legend Snippet: Expression and surface trafficking of a wild-type and non-SUMOylatable SEP-mGluR7 in HEK293 cells: (A) SEP-mGluR7 was transfected into HEK293 cells. Thirty-six hours post-transfection, surface proteins were labelled with biotin, the cells lysed and biotinylated surface proteins were isolated on streptavidin beads and subjected to Western blotting alongside total lysate for GFP (SEP). (B) SEP-mGluR7 was transfected into 13DIV primary cortical neurons and imaged for SEP expression 5 days later (upper panel). SEP fluorescence was reduced with a transient exposure to pH 6.0 buffer consistent with the majority of the signal arising from surface expressed SEP-mGluR7. Application of ammonium chloride, which collapses pH gradients across the plasma membrane and transiently equilibrates intracellular compartments to the extracellular pH increased fluorescence showing the total SEP signal (pH 7.4) or minimum signal (pH 6). The fluorescence of the region boxed in the upper panel is shown graphically in the lower panel. (C) SEP-mGluR7 is functional in HEK293 cells, as assayed for its ability to activate the ERK pathway. Data are the mean ± SEM, ** p

    Techniques Used: Expressing, Transfection, Isolation, Western Blot, Fluorescence, Functional Assay

    22) Product Images from "Proapoptotic Bid mediates the Atr-directed DNA damage response to replicative stress"

    Article Title: Proapoptotic Bid mediates the Atr-directed DNA damage response to replicative stress

    Journal: Cell Death and Differentiation

    doi: 10.1038/cdd.2010.151

    Bid associates and co-localizes with Atr/Atrip/RPA complex following replicative stress. ( a ) Bid+/+ and Bid−/− MPCs were treated with 10 mM HU for 2 h. Bid was immunoprecipitated from nuclear extracts using biotin-conjugated anti-Bid antibody and streptavidin–agarose beads. Samples were analyzed using SDS-PAGE followed by immunoblotting with the indicated antibodies. The asterisk ( * ) indicates a crossreacting band. Transcription factor RUNX1 was used as a negative control. ( b ) U2OS cells were treated with 10 mM HU for 2 h. Cells were harvested, and Atrip was immunoprecipitated from nuclear extracts using anti-Atrip (401) antibody. Immunoprecipitates were analyzed using SDS-PAGE followed by immunoblotting with anti-Bid and anti-Atrip antibodies. ( c ) U2OS cells were treated with 10 mM HU for 2 h. Cells were harvested, and RPA was immunoprecipitated from nuclear extracts using anti-RPA70 antibody. Immunoprecipitates were resolved by SDS-PAGE followed by immunoblotting with anti-Bid and anti-RPA70 antibodies. ( d ) The interaction between Bid and Atr complex is independent of DNA. Bid+/+ MPCs were treated with 10 mM HU for 2 h. Then, the nuclear fraction was purified and incubated with 250U Benzonase Nuclease (Novagen). Then, Bid was immunoprecipitated from nuclear extracts using biotin-conjugated anti-Bid antibody and streptavidin–agarose beads. Samples were analyzed using SDS-PAGE followed by immunoblotting with the indicated antibodies. ( e ) Bid−/− MEFs harboring HA-tagged Bid were synchronized in low serum medium (0.1% FBS–DMEM) for 24 h. Following synchronization, cells were released into complete medium (10% FBS–DMEM). At 17 h after release, cells were left untreated (18 h serum) or treated for 1 h with 1 mM HU (18 h serum plus HU). Then, cells were fixed and stained for anti-HA and anti-RPA32 antibodies. Representative images in ( f ) were captured by a Zeiss LSM 510 inverted confocal microscopy. Scale bars represent 10 μ m
    Figure Legend Snippet: Bid associates and co-localizes with Atr/Atrip/RPA complex following replicative stress. ( a ) Bid+/+ and Bid−/− MPCs were treated with 10 mM HU for 2 h. Bid was immunoprecipitated from nuclear extracts using biotin-conjugated anti-Bid antibody and streptavidin–agarose beads. Samples were analyzed using SDS-PAGE followed by immunoblotting with the indicated antibodies. The asterisk ( * ) indicates a crossreacting band. Transcription factor RUNX1 was used as a negative control. ( b ) U2OS cells were treated with 10 mM HU for 2 h. Cells were harvested, and Atrip was immunoprecipitated from nuclear extracts using anti-Atrip (401) antibody. Immunoprecipitates were analyzed using SDS-PAGE followed by immunoblotting with anti-Bid and anti-Atrip antibodies. ( c ) U2OS cells were treated with 10 mM HU for 2 h. Cells were harvested, and RPA was immunoprecipitated from nuclear extracts using anti-RPA70 antibody. Immunoprecipitates were resolved by SDS-PAGE followed by immunoblotting with anti-Bid and anti-RPA70 antibodies. ( d ) The interaction between Bid and Atr complex is independent of DNA. Bid+/+ MPCs were treated with 10 mM HU for 2 h. Then, the nuclear fraction was purified and incubated with 250U Benzonase Nuclease (Novagen). Then, Bid was immunoprecipitated from nuclear extracts using biotin-conjugated anti-Bid antibody and streptavidin–agarose beads. Samples were analyzed using SDS-PAGE followed by immunoblotting with the indicated antibodies. ( e ) Bid−/− MEFs harboring HA-tagged Bid were synchronized in low serum medium (0.1% FBS–DMEM) for 24 h. Following synchronization, cells were released into complete medium (10% FBS–DMEM). At 17 h after release, cells were left untreated (18 h serum) or treated for 1 h with 1 mM HU (18 h serum plus HU). Then, cells were fixed and stained for anti-HA and anti-RPA32 antibodies. Representative images in ( f ) were captured by a Zeiss LSM 510 inverted confocal microscopy. Scale bars represent 10 μ m

    Techniques Used: Recombinase Polymerase Amplification, Immunoprecipitation, SDS Page, Negative Control, Purification, Incubation, Staining, Confocal Microscopy

    23) Product Images from "Initiation of DNA replication requires actin dynamics and formin activity"

    Article Title: Initiation of DNA replication requires actin dynamics and formin activity

    Journal: The EMBO Journal

    doi: 10.15252/embj.201796585

    Disruption of actin dynamics hinders cargo release from importin Scheme: Control extract (Ctl) or extract treated with CytD (CD) or importazole (Imp) was incubated for 30 min and immunoprecipitated with mAb414 (Mock IP, no antibody added). Beads were blotted for the proteins indicated. Scheme: Nuclei, formed in control extract, or with CytD (CD) or SMIFH2 (FH) added at 45 min, were purified at 60 min and used for immunoprecipitation with mAb414; 10% of lysed nuclei were used as input. Beads were blotted with the proteins indicated. Scheme: Nuclei were formed in extract supplemented at 45 min with CytD (CD), then lysed, and pull‐down was performed using GST‐Ran WT covalently coupled to glutathione beads, or control beads (Mock; equal volumes of beads were used in each condition). Beads were blotted with the proteins indicated. In vitro pull‐down between actin–biotin and glutathione‐immobilised GST or GST‐Ran WT, pre‐loaded with either GTP or GDP; beads were blotted for actin or GST. Scheme: Nuclei, formed in control extract, supplemented at 45 min with RanQ69L, CytD (CD), without or with latrunculin A (LA), were lysed and immunoprecipitated with anti‐active Ran antibodies (Mock IP, no antibody added). Beads were blotted for actin and Ran. Proteins binding to actin within nuclei formed in control conditions (Ctl) or with CytD (CD) were pulled down using biotinylated Lifeact peptide and immobilised streptavidin, and analysed by Western blotting for the indicated proteins. Mock: Lifeact peptide was omitted. Source data are available online for this figure.
    Figure Legend Snippet: Disruption of actin dynamics hinders cargo release from importin Scheme: Control extract (Ctl) or extract treated with CytD (CD) or importazole (Imp) was incubated for 30 min and immunoprecipitated with mAb414 (Mock IP, no antibody added). Beads were blotted for the proteins indicated. Scheme: Nuclei, formed in control extract, or with CytD (CD) or SMIFH2 (FH) added at 45 min, were purified at 60 min and used for immunoprecipitation with mAb414; 10% of lysed nuclei were used as input. Beads were blotted with the proteins indicated. Scheme: Nuclei were formed in extract supplemented at 45 min with CytD (CD), then lysed, and pull‐down was performed using GST‐Ran WT covalently coupled to glutathione beads, or control beads (Mock; equal volumes of beads were used in each condition). Beads were blotted with the proteins indicated. In vitro pull‐down between actin–biotin and glutathione‐immobilised GST or GST‐Ran WT, pre‐loaded with either GTP or GDP; beads were blotted for actin or GST. Scheme: Nuclei, formed in control extract, supplemented at 45 min with RanQ69L, CytD (CD), without or with latrunculin A (LA), were lysed and immunoprecipitated with anti‐active Ran antibodies (Mock IP, no antibody added). Beads were blotted for actin and Ran. Proteins binding to actin within nuclei formed in control conditions (Ctl) or with CytD (CD) were pulled down using biotinylated Lifeact peptide and immobilised streptavidin, and analysed by Western blotting for the indicated proteins. Mock: Lifeact peptide was omitted. Source data are available online for this figure.

    Techniques Used: CTL Assay, Incubation, Immunoprecipitation, Purification, In Vitro, Binding Assay, Western Blot

    24) Product Images from "Ubiquitylation of Terminal Deoxynucleotidyltransferase Inhibits Its Activity"

    Article Title: Ubiquitylation of Terminal Deoxynucleotidyltransferase Inhibits Its Activity

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0039511

    TdT ubiquitylation inhibits its nucleotidyltransferase activity. (A) Ubiquitylation of TdT does not effect its DNA-binding property. His-TdT (180 ng) was incubated in the reaction in vitro ubiquitylation mixture with (lane 3) or without (lane 2) biotinylated ssDNA coupled to streptavidin–agarose. The proteins that bound to DNA were subjected to immunoblot analysis using an anti-TdT antibody. (B) Primer extension assay. GST-TdT bound Glutathione Sepharose 4B was added to the ubiquitylation reaction mixture and then incubated with (lanes 2, 4, and 6) or without (lanes 3, 5, and 7) ATP, for the indicated times. After washing, primer extension was performed in reaction mixture containing the Cy5-labeled 20-mer oligo-dT. After 8% SDS page, the products were visualized on a Typhoon 9200 Gel Imager (GE Healthcare).
    Figure Legend Snippet: TdT ubiquitylation inhibits its nucleotidyltransferase activity. (A) Ubiquitylation of TdT does not effect its DNA-binding property. His-TdT (180 ng) was incubated in the reaction in vitro ubiquitylation mixture with (lane 3) or without (lane 2) biotinylated ssDNA coupled to streptavidin–agarose. The proteins that bound to DNA were subjected to immunoblot analysis using an anti-TdT antibody. (B) Primer extension assay. GST-TdT bound Glutathione Sepharose 4B was added to the ubiquitylation reaction mixture and then incubated with (lanes 2, 4, and 6) or without (lanes 3, 5, and 7) ATP, for the indicated times. After washing, primer extension was performed in reaction mixture containing the Cy5-labeled 20-mer oligo-dT. After 8% SDS page, the products were visualized on a Typhoon 9200 Gel Imager (GE Healthcare).

    Techniques Used: Activity Assay, Binding Assay, Incubation, In Vitro, Primer Extension Assay, Labeling, SDS Page

    25) Product Images from "Ubiquitylation of Terminal Deoxynucleotidyltransferase Inhibits Its Activity"

    Article Title: Ubiquitylation of Terminal Deoxynucleotidyltransferase Inhibits Its Activity

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0039511

    TdT ubiquitylation inhibits its nucleotidyltransferase activity. (A) Ubiquitylation of TdT does not effect its DNA-binding property. His-TdT (180 ng) was incubated in the reaction in vitro ubiquitylation mixture with (lane 3) or without (lane 2) biotinylated ssDNA coupled to streptavidin–agarose. The proteins that bound to DNA were subjected to immunoblot analysis using an anti-TdT antibody. (B) Primer extension assay. GST-TdT bound Glutathione Sepharose 4B was added to the ubiquitylation reaction mixture and then incubated with (lanes 2, 4, and 6) or without (lanes 3, 5, and 7) ATP, for the indicated times. After washing, primer extension was performed in reaction mixture containing the Cy5-labeled 20-mer oligo-dT. After 8% SDS page, the products were visualized on a Typhoon 9200 Gel Imager (GE Healthcare).
    Figure Legend Snippet: TdT ubiquitylation inhibits its nucleotidyltransferase activity. (A) Ubiquitylation of TdT does not effect its DNA-binding property. His-TdT (180 ng) was incubated in the reaction in vitro ubiquitylation mixture with (lane 3) or without (lane 2) biotinylated ssDNA coupled to streptavidin–agarose. The proteins that bound to DNA were subjected to immunoblot analysis using an anti-TdT antibody. (B) Primer extension assay. GST-TdT bound Glutathione Sepharose 4B was added to the ubiquitylation reaction mixture and then incubated with (lanes 2, 4, and 6) or without (lanes 3, 5, and 7) ATP, for the indicated times. After washing, primer extension was performed in reaction mixture containing the Cy5-labeled 20-mer oligo-dT. After 8% SDS page, the products were visualized on a Typhoon 9200 Gel Imager (GE Healthcare).

    Techniques Used: Activity Assay, Binding Assay, Incubation, In Vitro, Primer Extension Assay, Labeling, SDS Page

    26) Product Images from "Proapoptotic Bid mediates the Atr-directed DNA damage response to replicative stress"

    Article Title: Proapoptotic Bid mediates the Atr-directed DNA damage response to replicative stress

    Journal: Cell Death and Differentiation

    doi: 10.1038/cdd.2010.151

    Bid associates and co-localizes with Atr/Atrip/RPA complex following replicative stress. ( a ) Bid+/+ and Bid−/− MPCs were treated with 10 mM HU for 2 h. Bid was immunoprecipitated from nuclear extracts using biotin-conjugated anti-Bid antibody and streptavidin–agarose beads. Samples were analyzed using SDS-PAGE followed by immunoblotting with the indicated antibodies. The asterisk ( * ) indicates a crossreacting band. Transcription factor RUNX1 was used as a negative control. ( b ) U2OS cells were treated with 10 mM HU for 2 h. Cells were harvested, and Atrip was immunoprecipitated from nuclear extracts using anti-Atrip (401) antibody. Immunoprecipitates were analyzed using SDS-PAGE followed by immunoblotting with anti-Bid and anti-Atrip antibodies. ( c ) U2OS cells were treated with 10 mM HU for 2 h. Cells were harvested, and RPA was immunoprecipitated from nuclear extracts using anti-RPA70 antibody. Immunoprecipitates were resolved by SDS-PAGE followed by immunoblotting with anti-Bid and anti-RPA70 antibodies. ( d ) The interaction between Bid and Atr complex is independent of DNA. Bid+/+ MPCs were treated with 10 mM HU for 2 h. Then, the nuclear fraction was purified and incubated with 250U Benzonase Nuclease (Novagen). Then, Bid was immunoprecipitated from nuclear extracts using biotin-conjugated anti-Bid antibody and streptavidin–agarose beads. Samples were analyzed using SDS-PAGE followed by immunoblotting with the indicated antibodies. ( e ) Bid−/− MEFs harboring HA-tagged Bid were synchronized in low serum medium (0.1% FBS–DMEM) for 24 h. Following synchronization, cells were released into complete medium (10% FBS–DMEM). At 17 h after release, cells were left untreated (18 h serum) or treated for 1 h with 1 mM HU (18 h serum plus HU). Then, cells were fixed and stained for anti-HA and anti-RPA32 antibodies. Representative images in ( f ) were captured by a Zeiss LSM 510 inverted confocal microscopy. Scale bars represent 10 μ m
    Figure Legend Snippet: Bid associates and co-localizes with Atr/Atrip/RPA complex following replicative stress. ( a ) Bid+/+ and Bid−/− MPCs were treated with 10 mM HU for 2 h. Bid was immunoprecipitated from nuclear extracts using biotin-conjugated anti-Bid antibody and streptavidin–agarose beads. Samples were analyzed using SDS-PAGE followed by immunoblotting with the indicated antibodies. The asterisk ( * ) indicates a crossreacting band. Transcription factor RUNX1 was used as a negative control. ( b ) U2OS cells were treated with 10 mM HU for 2 h. Cells were harvested, and Atrip was immunoprecipitated from nuclear extracts using anti-Atrip (401) antibody. Immunoprecipitates were analyzed using SDS-PAGE followed by immunoblotting with anti-Bid and anti-Atrip antibodies. ( c ) U2OS cells were treated with 10 mM HU for 2 h. Cells were harvested, and RPA was immunoprecipitated from nuclear extracts using anti-RPA70 antibody. Immunoprecipitates were resolved by SDS-PAGE followed by immunoblotting with anti-Bid and anti-RPA70 antibodies. ( d ) The interaction between Bid and Atr complex is independent of DNA. Bid+/+ MPCs were treated with 10 mM HU for 2 h. Then, the nuclear fraction was purified and incubated with 250U Benzonase Nuclease (Novagen). Then, Bid was immunoprecipitated from nuclear extracts using biotin-conjugated anti-Bid antibody and streptavidin–agarose beads. Samples were analyzed using SDS-PAGE followed by immunoblotting with the indicated antibodies. ( e ) Bid−/− MEFs harboring HA-tagged Bid were synchronized in low serum medium (0.1% FBS–DMEM) for 24 h. Following synchronization, cells were released into complete medium (10% FBS–DMEM). At 17 h after release, cells were left untreated (18 h serum) or treated for 1 h with 1 mM HU (18 h serum plus HU). Then, cells were fixed and stained for anti-HA and anti-RPA32 antibodies. Representative images in ( f ) were captured by a Zeiss LSM 510 inverted confocal microscopy. Scale bars represent 10 μ m

    Techniques Used: Recombinase Polymerase Amplification, Immunoprecipitation, SDS Page, Negative Control, Purification, Incubation, Staining, Confocal Microscopy

    27) Product Images from "Ubiquitin-dependent folding of the Wnt signaling coreceptor LRP6"

    Article Title: Ubiquitin-dependent folding of the Wnt signaling coreceptor LRP6

    Journal: eLife

    doi: 10.7554/eLife.19083

    usp19 silencing leads to decrease in LRP6 cell surface expression. Surface Biotinylation assay performed in RPE1 cells upon 24, 48 and 72 hr of usp19 or usp13 gene silencing. Quantification of endogenous LRP6 surface expression at 48 hr of gene silencing in Streptavidin-mediated pull down is shown above the western blot. Errors represent standard deviation (n = 3) and ***
    Figure Legend Snippet: usp19 silencing leads to decrease in LRP6 cell surface expression. Surface Biotinylation assay performed in RPE1 cells upon 24, 48 and 72 hr of usp19 or usp13 gene silencing. Quantification of endogenous LRP6 surface expression at 48 hr of gene silencing in Streptavidin-mediated pull down is shown above the western blot. Errors represent standard deviation (n = 3) and ***

    Techniques Used: Expressing, Surface Biotinylation Assay, Western Blot, Standard Deviation

    28) Product Images from "Cell-surface Processing of the Metalloprotease Pro-ADAMTS9 Is Influenced by the Chaperone GRP94/gp96 *"

    Article Title: Cell-surface Processing of the Metalloprotease Pro-ADAMTS9 Is Influenced by the Chaperone GRP94/gp96 *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M109.039677

    Cell-surface localization of gp96 and BiP in HEK293F cells. Following cell-surface biotinylation (with (+) or without (−) prior trypsinization), Western blotting of streptavidin-agarose-purified proteins with the indicated antibodies demonstrates
    Figure Legend Snippet: Cell-surface localization of gp96 and BiP in HEK293F cells. Following cell-surface biotinylation (with (+) or without (−) prior trypsinization), Western blotting of streptavidin-agarose-purified proteins with the indicated antibodies demonstrates

    Techniques Used: Western Blot, Purification

    29) Product Images from "RNA Affinity Tags for the Rapid Purification and Investigation of RNAs and RNA-Protein Complexes"

    Article Title: RNA Affinity Tags for the Rapid Purification and Investigation of RNAs and RNA-Protein Complexes

    Journal: Methods in molecular biology (Clifton, N.J.)

    doi: 10.1007/978-1-60327-475-3_3

    Affinity tag insertions into both the precursor and the mature RPR1 RNA subunit of RNase P. Individual insertions of both the streptavidin (S1) and Sephadex (D8) aptamers into the RPR1 and pre- RPR1 RNA are shown. The minimal tag sequences are shown with
    Figure Legend Snippet: Affinity tag insertions into both the precursor and the mature RPR1 RNA subunit of RNase P. Individual insertions of both the streptavidin (S1) and Sephadex (D8) aptamers into the RPR1 and pre- RPR1 RNA are shown. The minimal tag sequences are shown with

    Techniques Used:

    30) Product Images from "Characterization of the Ubiquinone Binding Site in Alternative NADH-Quinone Oxidoreductase of Saccharomyces cerevisiae by Photoaffinity Labeling †"

    Article Title: Characterization of the Ubiquinone Binding Site in Alternative NADH-Quinone Oxidoreductase of Saccharomyces cerevisiae by Photoaffinity Labeling †

    Journal: Biochemistry

    doi: 10.1021/bi100005j

    Photoaffinity labeling of Ndi1 by the biotinylated azido-Qs ( 1 - 3 ). The UQ-free Ndi1 was photoirradiated with each azido-Q at an equivalent molar ratio (6.6 μg of protein/mL), and analyzed on 10% Laemmli’s gel with CBB stain and streptavidin-AP (0.5 μg of protein/lane for CBB stain and 0.1 μg of protein/lane for Western blotting). Data shown are representative of four independent experiments.
    Figure Legend Snippet: Photoaffinity labeling of Ndi1 by the biotinylated azido-Qs ( 1 - 3 ). The UQ-free Ndi1 was photoirradiated with each azido-Q at an equivalent molar ratio (6.6 μg of protein/mL), and analyzed on 10% Laemmli’s gel with CBB stain and streptavidin-AP (0.5 μg of protein/lane for CBB stain and 0.1 μg of protein/lane for Western blotting). Data shown are representative of four independent experiments.

    Techniques Used: Labeling, Staining, Western Blot

    31) Product Images from "Characterization of the Ubiquinone Binding Site in Alternative NADH-Quinone Oxidoreductase of Saccharomyces cerevisiae by Photoaffinity Labeling †"

    Article Title: Characterization of the Ubiquinone Binding Site in Alternative NADH-Quinone Oxidoreductase of Saccharomyces cerevisiae by Photoaffinity Labeling †

    Journal: Biochemistry

    doi: 10.1021/bi100005j

    Photoaffinity labeling of Ndi1 by the biotinylated azido-Qs ( 1 - 3 ). The UQ-free Ndi1 was photoirradiated with each azido-Q at an equivalent molar ratio (6.6 μg of protein/mL), and analyzed on 10% Laemmli’s gel with CBB stain and streptavidin-AP (0.5 μg of protein/lane for CBB stain and 0.1 μg of protein/lane for Western blotting). Data shown are representative of four independent experiments.
    Figure Legend Snippet: Photoaffinity labeling of Ndi1 by the biotinylated azido-Qs ( 1 - 3 ). The UQ-free Ndi1 was photoirradiated with each azido-Q at an equivalent molar ratio (6.6 μg of protein/mL), and analyzed on 10% Laemmli’s gel with CBB stain and streptavidin-AP (0.5 μg of protein/lane for CBB stain and 0.1 μg of protein/lane for Western blotting). Data shown are representative of four independent experiments.

    Techniques Used: Labeling, Staining, Western Blot

    32) Product Images from "Activation of Pre-mRNA Splicing by Human RNPS1 Is Regulated by CK2 Phosphorylation †"

    Article Title: Activation of Pre-mRNA Splicing by Human RNPS1 Is Regulated by CK2 Phosphorylation †

    Journal: Molecular and Cellular Biology

    doi: 10.1128/MCB.25.4.1446-1457.2005

    Analyses of spliceosome complexes and RNA products by in vitro splicing assays with δ-crystallin pre-mRNA. (A) Schematic representation of the preparation of immobilized δ-crystallin pre-mRNA on streptavidin-agarose. B and AV indicate
    Figure Legend Snippet: Analyses of spliceosome complexes and RNA products by in vitro splicing assays with δ-crystallin pre-mRNA. (A) Schematic representation of the preparation of immobilized δ-crystallin pre-mRNA on streptavidin-agarose. B and AV indicate

    Techniques Used: In Vitro

    33) Product Images from "Differential N-Linked Glycosylation of Human Immunodeficiency Virus and Ebola Virus Envelope Glycoproteins Modulates Interactions with DC-SIGN and DC-SIGNR"

    Article Title: Differential N-Linked Glycosylation of Human Immunodeficiency Virus and Ebola Virus Envelope Glycoproteins Modulates Interactions with DC-SIGN and DC-SIGNR

    Journal: Journal of Virology

    doi: 10.1128/JVI.77.2.1337-1346.2003

    Infection by Ebola virus GP pseudovirions and analysis of GP glycosylation. (A) 293T cells mock transfected or transfected with DC-SIGN, DC-SIGNR, or ASGP-R were infected with 500 TCID 50 of HIV-luciferase reporter viruses pseudotyped with VSV-G, EboZ-GP, EboS-GP, or EboZ-GP generated in the presence of 2.5 mM DMJ or MDM-derived EboZ-GP. Values are represented as the percent infection, calculated by using luciferase activity normalized to mock-transfected cells. Mean values plus the standard error of the mean are represented. (B) EboZ-GP and EboS-GP obtained from pseudovirions were incubated with the indicated lectin-biotin conjugates and then precipitated with streptavidin-agarose and analyzed by SDS-PAGE and Western blot for GP. Lectins are identified as follows: Vivia villosa lectin (VVL), Ricinus communiz agglutinin (RCA120), concanavalin A (ConA), Datura stramonium lectin (DSL), Erythrina cristagalli lectin (ECL), wheat germ agglutinin (WGA), Galanthus nivalis lectin (GNL), peanut agglutinin (PNA), Jacalin, and Ulex europaeus agglutinin (UEA). Unbound cell lysate is also shown.
    Figure Legend Snippet: Infection by Ebola virus GP pseudovirions and analysis of GP glycosylation. (A) 293T cells mock transfected or transfected with DC-SIGN, DC-SIGNR, or ASGP-R were infected with 500 TCID 50 of HIV-luciferase reporter viruses pseudotyped with VSV-G, EboZ-GP, EboS-GP, or EboZ-GP generated in the presence of 2.5 mM DMJ or MDM-derived EboZ-GP. Values are represented as the percent infection, calculated by using luciferase activity normalized to mock-transfected cells. Mean values plus the standard error of the mean are represented. (B) EboZ-GP and EboS-GP obtained from pseudovirions were incubated with the indicated lectin-biotin conjugates and then precipitated with streptavidin-agarose and analyzed by SDS-PAGE and Western blot for GP. Lectins are identified as follows: Vivia villosa lectin (VVL), Ricinus communiz agglutinin (RCA120), concanavalin A (ConA), Datura stramonium lectin (DSL), Erythrina cristagalli lectin (ECL), wheat germ agglutinin (WGA), Galanthus nivalis lectin (GNL), peanut agglutinin (PNA), Jacalin, and Ulex europaeus agglutinin (UEA). Unbound cell lysate is also shown.

    Techniques Used: Infection, Transfection, Luciferase, Generated, Derivative Assay, Activity Assay, Incubation, SDS Page, Western Blot, Whole Genome Amplification

    34) Product Images from "Interaction of Muscle and Brain Sodium Channels with Multiple Members of the Syntrophin Family of Dystrophin-Associated Proteins"

    Article Title: Interaction of Muscle and Brain Sodium Channels with Multiple Members of the Syntrophin Family of Dystrophin-Associated Proteins

    Journal: The Journal of Neuroscience

    doi: 10.1523/JNEUROSCI.18-01-00128.1998

    The C termini of muscle NaChs bind directly to syntrophin PDZ domains. A , Biotinylated peptides corresponding to the C-terminal 10 amino acids of the SkM1 and SkM2 NaChs or Fas bound to streptavidin–HRP were overlaid onto α1-syntrophin
    Figure Legend Snippet: The C termini of muscle NaChs bind directly to syntrophin PDZ domains. A , Biotinylated peptides corresponding to the C-terminal 10 amino acids of the SkM1 and SkM2 NaChs or Fas bound to streptavidin–HRP were overlaid onto α1-syntrophin

    Techniques Used:

    35) Product Images from "Isomerization of the intersubunit disulphide-bond in Env controls retrovirus fusion"

    Article Title: Isomerization of the intersubunit disulphide-bond in Env controls retrovirus fusion

    Journal: The EMBO Journal

    doi: 10.1038/sj.emboj.7600012

    MLV and HTLV-1 Env carry isomerization activity. ( A ) Thiol mapping of disulphide-linked SU–TM subunits. SU–TM complexes of Env ampho were alkylated with MB, gel isolated and glycanase F treated. Analyses of deglycosylated complexes by nonreducing (lane 1) and reducing (lane 2) SDS–PAGE. Note migration difference of reduced (red) and oxidized (ox) SU. Streptavidin capture of nonreduced (lanes 3 and 5) and reduced (lanes 4 and 6) complexes. ( B ) Thiol mapping of SU and TM after NP-40-induced SU–TM disulphide-bond disruption. Analyses of deglycosylated SU (lane 1) and TM (lane 2) by reducing SDS–PAGE. Streptavidin capture of SU (lanes 3 and 5) and TM (lanes 4 and 6). ( C ) SU and TM are disulphide-linked in HTLV-1 Env. BHK-21 cells expressing the HTLV-1 env gene were labelled with [ 35 S]Cys for 30 min and chased for 5–240 min. Cells and media were lysed in the presence of NEM. Immunoprecipitated Env was analysed by nonreducing (lanes 1–6) or reducing (lanes 7–12) SDS–PAGE. ( D ) HTLV-1 Env can isomerize. Cells expressing HTLV-1 env at 2 h chase time were incubated in NP-40 lysis buffer for 40 min at 30°C with or without NEM. Immunoprecipitated Env was analysed by nonreducing SDS–PAGE. ( E ) RSV Env cannot isomerize. Cells expressing RSV env were labelled as above, chased for 2 h and lysed for 0–2 h at 30°C with or without NEM. Immunoprecipitated Env was analysed by nonreducing (lanes 1–8) or reducing (lanes 9–12) SDS–PAGE.
    Figure Legend Snippet: MLV and HTLV-1 Env carry isomerization activity. ( A ) Thiol mapping of disulphide-linked SU–TM subunits. SU–TM complexes of Env ampho were alkylated with MB, gel isolated and glycanase F treated. Analyses of deglycosylated complexes by nonreducing (lane 1) and reducing (lane 2) SDS–PAGE. Note migration difference of reduced (red) and oxidized (ox) SU. Streptavidin capture of nonreduced (lanes 3 and 5) and reduced (lanes 4 and 6) complexes. ( B ) Thiol mapping of SU and TM after NP-40-induced SU–TM disulphide-bond disruption. Analyses of deglycosylated SU (lane 1) and TM (lane 2) by reducing SDS–PAGE. Streptavidin capture of SU (lanes 3 and 5) and TM (lanes 4 and 6). ( C ) SU and TM are disulphide-linked in HTLV-1 Env. BHK-21 cells expressing the HTLV-1 env gene were labelled with [ 35 S]Cys for 30 min and chased for 5–240 min. Cells and media were lysed in the presence of NEM. Immunoprecipitated Env was analysed by nonreducing (lanes 1–6) or reducing (lanes 7–12) SDS–PAGE. ( D ) HTLV-1 Env can isomerize. Cells expressing HTLV-1 env at 2 h chase time were incubated in NP-40 lysis buffer for 40 min at 30°C with or without NEM. Immunoprecipitated Env was analysed by nonreducing SDS–PAGE. ( E ) RSV Env cannot isomerize. Cells expressing RSV env were labelled as above, chased for 2 h and lysed for 0–2 h at 30°C with or without NEM. Immunoprecipitated Env was analysed by nonreducing (lanes 1–8) or reducing (lanes 9–12) SDS–PAGE.

    Techniques Used: Activity Assay, Isolation, SDS Page, Migration, Expressing, Immunoprecipitation, Incubation, Lysis

    36) Product Images from "Phosphodiesterases Catalyze Hydrolysis of cAMP-bound to Regulatory Subunit of Protein Kinase A and Mediate Signal Termination *"

    Article Title: Phosphodiesterases Catalyze Hydrolysis of cAMP-bound to Regulatory Subunit of Protein Kinase A and Mediate Signal Termination *

    Journal: Molecular & Cellular Proteomics : MCP

    doi: 10.1074/mcp.M110.002295

    RegA primes RIα for reassociation with C-subunit; Biotinylated cAMP-bound RIα (91–244)(R92C) was bound to Streptavidin-agarose and incubated with C-subunit in the presence and absence of RegA as described in materials and methods, the samples were then analyzed by SDS-PAGE. Lane 1: C-subunit and immobilized RIα in the absence of RegA; Lane 2: C-subunit and immobilized RIα in the presence of RegA; Lane 3: C-subunit and Maleimide-polyethylene glycol 2 -Biotin-Streptavidin agarose beads (control).
    Figure Legend Snippet: RegA primes RIα for reassociation with C-subunit; Biotinylated cAMP-bound RIα (91–244)(R92C) was bound to Streptavidin-agarose and incubated with C-subunit in the presence and absence of RegA as described in materials and methods, the samples were then analyzed by SDS-PAGE. Lane 1: C-subunit and immobilized RIα in the absence of RegA; Lane 2: C-subunit and immobilized RIα in the presence of RegA; Lane 3: C-subunit and Maleimide-polyethylene glycol 2 -Biotin-Streptavidin agarose beads (control).

    Techniques Used: Incubation, SDS Page

    Related Articles

    Centrifugation:

    Article Title: Target-Based Screen Against a Periplasmic Serine Protease That Regulates Intrabacterial pH Homeostasis in Mycobacteriumtuberculosis
    Article Snippet: .. One-fifth volume of prewashed streptavidin agarose (Sigma) was added, and the mixture rotated at 4 °C for 1 h. The beads were washed three times in PBS by centrifugation at 13 000g for 5 min, boiled in 4X SDS loading buffer at 95 °C for 10 min, and centrifuged again. ..

    Article Title: Functional Analysis of a Breast Cancer-Associated Mutation in the Intracellular Domain of the Metalloprotease ADAM12
    Article Snippet: .. Cell lysates were cleared by centrifugation for 20 min at 16,000 g and supernatants were incubated with streptavidin-agarose (Sigma) for 2 h at 4°C. .. Beads were washed three times in RIPA buffer and bound proteins were released by heating for 5 min at 95°C in 2× SDS-PAGE sample buffer (0.0625 M Tris pH 6.8, 20% glycerol, 2% SDS, 0.01% bromophenol blue, 5% 2-mercaptoethanol).

    Article Title: Role of the polypeptide N-acetylgalactosaminyltransferase 3 in ovarian cancer progression: possible implications in abnormal mucin O-glycosylation
    Article Snippet: Twenty μl of streptavidin-agarose (Sigma) was then added, and samples were incubated for an additional 2 h at 4°C with rotation. .. Lectin/glycoprotein complexes were collected by brief centrifugation (1400 rpm, 5 min), and washed three times with lysis buffer, followed by one wash with phosphate-buffered saline (PBS).

    Blocking Assay:

    Article Title: Target-Based Screen Against a Periplasmic Serine Protease That Regulates Intrabacterial pH Homeostasis in Mycobacteriumtuberculosis
    Article Snippet: The nitrocellulose membranes were treated with blocking buffer (Odyssey) at RT for 1 h, exposed to a IRDye 800CW Streptavidin (Li-COR) at RT for 1 h, washed with Tris-buffered saline with 0.05% v/v Tween 20 (TBST) buffer three times (10 min each time), and visualized by using an infrared imaging system (Odyssey). .. One-fifth volume of prewashed streptavidin agarose (Sigma) was added, and the mixture rotated at 4 °C for 1 h. The beads were washed three times in PBS by centrifugation at 13 000g for 5 min, boiled in 4X SDS loading buffer at 95 °C for 10 min, and centrifuged again.

    Adsorption:

    Article Title: Synaptic-like Microvesicles of Neuroendocrine Cells Originate from a Novel Compartment That Is Continuous with the Plasma Membrane and Devoid of Transferrin Receptor
    Article Snippet: Paragraph title: Streptavidin–Agarose Adsorption ... The samples were incubated for 30 min on ice followed by addition of 20 μl of a 1:1 slurry of streptavidin–agarose ( Sigma Chemical Co. ) in solubilization buffer.

    Incubation:

    Article Title: Matrix metalloproteinase-1 up-regulation by hepatocyte growth factor in human dermal fibroblasts via ERK signaling pathway involves Ets1 and Fli1
    Article Snippet: .. After incubation, streptavidin–agarose (Sigma) was added to the reaction and incubated. ..

    Article Title: Divergent functions and distinct localization of the Notch ligands DLL1 and DLL3 in vivo
    Article Snippet: Lysates were incubated for 30 min on ice and centrifuged for 10 min at 12,000 g to remove cellular debris. .. The biotinylated proteins were precipitated with streptavidin agarose (Sigma-Aldrich) overnight at 4°C.

    Article Title: Redox Proteomics of the Inflammatory Secretome Identifies a Common Set of Redoxins and Other Glutathionylated Proteins Released in Inflammation, Influenza Virus Infection and Oxidative Stress
    Article Snippet: .. The concentrated proteins were then mixed with 50 μL of streptavidin-agarose (Sigma) and incubated under rotation for 30 min at 4°C. ..

    Article Title: Functional Analysis of a Breast Cancer-Associated Mutation in the Intracellular Domain of the Metalloprotease ADAM12
    Article Snippet: .. Cell lysates were cleared by centrifugation for 20 min at 16,000 g and supernatants were incubated with streptavidin-agarose (Sigma) for 2 h at 4°C. .. Beads were washed three times in RIPA buffer and bound proteins were released by heating for 5 min at 95°C in 2× SDS-PAGE sample buffer (0.0625 M Tris pH 6.8, 20% glycerol, 2% SDS, 0.01% bromophenol blue, 5% 2-mercaptoethanol).

    Article Title: Dimeric sorting code for concentrative cargo selection by the COPII coat
    Article Snippet: .. Cell lysates were then incubated with 10 µL M2 agarose (Sigma-Aldrich) or 20 µL streptavidin agarose (Sigma-Aldrich) for 4 h at 4 °C before washing four times with buffer A. .. Immune complexes were then solubilized with 1× SDS/PAGE sample buffer (Invitrogen) with or without (when indicated) 5% β-mercaptoethanol (β-ME), and separated with 3 to 15% Tris-acetate SDS/PAGE (Invitrogen).

    Article Title: Role of the polypeptide N-acetylgalactosaminyltransferase 3 in ovarian cancer progression: possible implications in abnormal mucin O-glycosylation
    Article Snippet: .. Twenty μl of streptavidin-agarose (Sigma) was then added, and samples were incubated for an additional 2 h at 4°C with rotation. .. Lectin/glycoprotein complexes were collected by brief centrifugation (1400 rpm, 5 min), and washed three times with lysis buffer, followed by one wash with phosphate-buffered saline (PBS).

    Article Title: Regulation of intracellular trafficking of human CD1d by association with MHC class II molecules
    Article Snippet: Cells were metabolically labeled for 15 min and chased for 30 min or 5 h. They were washed twice with phosphate-buffered saline (PBS) containing 0.1 mM CaCl2 and 1 mM MgCl2 and incubated in PBS with 2 mM sulfo-NHS-SS-biotin (Pierce) at 4°C for 30 min. After washing, the cells were extracted with 1% Brij 98 and immunoprecipitated with either 51.1.3 or L243. .. After boiling in 1% SDS for 5 min, the eluates were diluted with 1% Triton X-100/TBS prior to re-precipitation with streptavidin–agarose (Sigma) and SDS–PAGE.

    Article Title: Septin oligomerization regulates persistent expression of ErbB2/HER2 in gastric cancer cells
    Article Snippet: Biotinylated proteins were extracted with streptavidin-agarose (Sigma). .. Identical amounts of protein were incubated overnight with beads, washed x 3 with 0.5% triton X-100 in PBS, then extracted by 5 minutes boiling in 4% SDS, 20% glycerol, 1% β-mercaptoethanol in 0.1 M Tris pH 6.8.

    Article Title: Synaptic-like Microvesicles of Neuroendocrine Cells Originate from a Novel Compartment That Is Continuous with the Plasma Membrane and Devoid of Transferrin Receptor
    Article Snippet: .. The samples were incubated for 30 min on ice followed by addition of 20 μl of a 1:1 slurry of streptavidin–agarose ( Sigma Chemical Co. ) in solubilization buffer. ..

    Article Title: CXCL14 Acts as a Specific Carrier of CpG DNA into Dendritic Cells and Activates Toll-like Receptor 9-mediated Adaptive Immunity
    Article Snippet: .. 2.7 In Vitro Binding Assay CXCL14-bio (10 pmol) was coupled to streptavidin-agarose (Sigma-Aldrich) and incubated with Cy3-ODN [100 nM in 100 μl of binding buffer (50 mM Hepes pH 7.5, 150 mM NaCl, 1 mM CaCl2 , 1 mM MgCl2 , 1% BSA)] for 1 h at 4 °C. .. Precipitates were then washed and eluted in SDS sample buffer at 70 °C for 10 min. Cy3-ODN was separated by TBE-Urea-SDS polyacrylamide gel electrophoresis, and Cy3 fluorescence was measured in a LAS-3000 (Fuji Film, Tokyo, Japan).

    Article Title: RhoA S-nitrosylation as a regulatory mechanism influencing endothelial barrier function in response to G+-bacterial toxins
    Article Snippet: To identify sites of S-nitrosylation, the biotin-switch assay was performed as described above on 1 mg of recombinant RhoA incubated with 100 μM of the S-NO donor, nitrosocysteine for 30 min. RhoA was precipitated, washed and then trypsinized overnight using 5 μg of sequencing-grade trypsin (Promega, Madison, WI) at 37 °C. .. Trypsin was inactivated by addition of 1 mM 4-(2- Aminomethyl) benzenesulfonyl fluoride hydrochloride (AEBSF, Sigma, St. Louis, MO), and biotinylated peptides of RhoA were precipitated with streptavidin–agarose (Sigma, St. Louis, MO) and washed four times with 50 mM ammonium bicarbonate.

    Article Title: Vpr-Binding Protein Antagonizes p53-Mediated Transcription via Direct Interaction with H3 Tail
    Article Snippet: To study the effect of phosphorylation on VprBP-H3 tail interaction, the wild-type or S895-mutated version of Flag-VprBP 751–1507 was phosphorylated by DNA-PK and incubated with immobilized GST-H3 tails. .. For nucleosome binding assays, 2 μg DNA equivalents of mononucleosomes were preacetylated by p53 (150 ng) and p300 (200 ng) supplemented with Ac-CoA (10 μM) and immobilized on streptavidin-agarose (Novagen).

    Stripping Membranes:

    Article Title: Functional Analysis of a Breast Cancer-Associated Mutation in the Intracellular Domain of the Metalloprotease ADAM12
    Article Snippet: After incubation, cells were washed once in cold PBS and non-internalized cell surface biotin was removed by washing 3×10 min in stripping buffer (50 mM L-Glutathione, 75 mM NaCl, 75 mM NaOH, 1% (w/v) bovine serum albumin (BSA) and 10 mM ethylenediaminetetraacetic acid (EDTA) pH 8.0). .. Cell lysates were cleared by centrifugation for 20 min at 16,000 g and supernatants were incubated with streptavidin-agarose (Sigma) for 2 h at 4°C.

    Mass Spectrometry:

    Article Title: Target-Based Screen Against a Periplasmic Serine Protease That Regulates Intrabacterial pH Homeostasis in Mycobacteriumtuberculosis
    Article Snippet: One-fifth volume of prewashed streptavidin agarose (Sigma) was added, and the mixture rotated at 4 °C for 1 h. The beads were washed three times in PBS by centrifugation at 13 000g for 5 min, boiled in 4X SDS loading buffer at 95 °C for 10 min, and centrifuged again. .. Excised lanes were treated with trypsin and the resulting peptides analyzed by MALDI-TOF MS.

    Article Title: Redox Proteomics of the Inflammatory Secretome Identifies a Common Set of Redoxins and Other Glutathionylated Proteins Released in Inflammation, Influenza Virus Infection and Oxidative Stress
    Article Snippet: Paragraph title: Mass spectrometry and data analysis ... The concentrated proteins were then mixed with 50 μL of streptavidin-agarose (Sigma) and incubated under rotation for 30 min at 4°C.

    Article Title: RhoA S-nitrosylation as a regulatory mechanism influencing endothelial barrier function in response to G+-bacterial toxins
    Article Snippet: Paragraph title: 2.9. MS analysis ... Trypsin was inactivated by addition of 1 mM 4-(2- Aminomethyl) benzenesulfonyl fluoride hydrochloride (AEBSF, Sigma, St. Louis, MO), and biotinylated peptides of RhoA were precipitated with streptavidin–agarose (Sigma, St. Louis, MO) and washed four times with 50 mM ammonium bicarbonate.

    BIA-KA:

    Article Title: Septin oligomerization regulates persistent expression of ErbB2/HER2 in gastric cancer cells
    Article Snippet: Biotinylated proteins were extracted with streptavidin-agarose (Sigma). .. Biotinylated proteins were extracted with streptavidin-agarose (Sigma).

    Modification:

    Article Title: Dynamic Interplay between Adhesive and Lateral E-Cadherin Dimers
    Article Snippet: .. The cells were then biotinylated as described above and immediately afterward pulse-labeled with 0.25 mCi of [35 S] methionine/cysteine (Amersham, Arlington Heights, Ill.) per plate in the same medium for 20 min. Plates were then washed with Dulbecco modified Eagle medium containing excess cold methionine and cysteine and chased in the regular medium for up to 3 h. After chase periods, cells were lysed in the IP buffer, as described above, and biotinylated proteins were precipitated with streptavidin-agarose (Sigma). ..

    Western Blot:

    Article Title: Divergent functions and distinct localization of the Notch ligands DLL1 and DLL3 in vivo
    Article Snippet: The biotinylated proteins were precipitated with streptavidin agarose (Sigma-Aldrich) overnight at 4°C. .. Equivalent amounts of lysates and precipitates were subjected to SDS-PAGE and analyzed by Western blotting as described.

    Article Title: Vpr-Binding Protein Antagonizes p53-Mediated Transcription via Direct Interaction with H3 Tail
    Article Snippet: After extensive washing with washing buffer (25 mM Tris-HCl, pH 7.8, 0.2 mM EDTA, 20% glycerol, 300 mM KCl, 0.1% Nonidet P-40), the bound VprBP protein was subjected to SDS-PAGE and detected by Western blotting using anti-Flag antibody. .. For nucleosome binding assays, 2 μg DNA equivalents of mononucleosomes were preacetylated by p53 (150 ng) and p300 (200 ng) supplemented with Ac-CoA (10 μM) and immobilized on streptavidin-agarose (Novagen).

    Conjugation Assay:

    Article Title: Target-Based Screen Against a Periplasmic Serine Protease That Regulates Intrabacterial pH Homeostasis in Mycobacteriumtuberculosis
    Article Snippet: Paragraph title: Click Chemistry-Based Conjugation of BO43T and Biotin and Identification of BO43T-Binding Proteins ... One-fifth volume of prewashed streptavidin agarose (Sigma) was added, and the mixture rotated at 4 °C for 1 h. The beads were washed three times in PBS by centrifugation at 13 000g for 5 min, boiled in 4X SDS loading buffer at 95 °C for 10 min, and centrifuged again.

    Transfection:

    Article Title: Functional Analysis of a Breast Cancer-Associated Mutation in the Intracellular Domain of the Metalloprotease ADAM12
    Article Snippet: Transiently transfected 293VnR cells were preincubated at 4°C for 15 min to stop ongoing internalization, washed in cold phosphate buffered saline (PBS, Invitrogen), and incubated for 30 min at 4°C with 0.05 mg/ml EZ-Link™ Sulfo-NHS-SS-Biotin (Pierce, Thermo Scientific, Rockford, IL, USA) in cold PBS. .. Cell lysates were cleared by centrifugation for 20 min at 16,000 g and supernatants were incubated with streptavidin-agarose (Sigma) for 2 h at 4°C.

    Immunoprecipitation:

    Article Title: Dimeric sorting code for concentrative cargo selection by the COPII coat
    Article Snippet: Paragraph title: Immunoprecipitation, Streptavidin Pull-Down, and Immunoblotting. ... Cell lysates were then incubated with 10 µL M2 agarose (Sigma-Aldrich) or 20 µL streptavidin agarose (Sigma-Aldrich) for 4 h at 4 °C before washing four times with buffer A.

    Article Title: Regulation of intracellular trafficking of human CD1d by association with MHC class II molecules
    Article Snippet: Cells were metabolically labeled for 15 min and chased for 30 min or 5 h. They were washed twice with phosphate-buffered saline (PBS) containing 0.1 mM CaCl2 and 1 mM MgCl2 and incubated in PBS with 2 mM sulfo-NHS-SS-biotin (Pierce) at 4°C for 30 min. After washing, the cells were extracted with 1% Brij 98 and immunoprecipitated with either 51.1.3 or L243. .. After boiling in 1% SDS for 5 min, the eluates were diluted with 1% Triton X-100/TBS prior to re-precipitation with streptavidin–agarose (Sigma) and SDS–PAGE.

    Article Title: Dynamic Interplay between Adhesive and Lateral E-Cadherin Dimers
    Article Snippet: In this case, cells were then cultivated for an additional 8 h. To analyze turnover of biotinylated E-cadherin, the cells after biotinylation were chased in the culture media for up to 16 h. After cultivation, cells were extracted in IP buffer and immunoprecipitated as described above. .. The cells were then biotinylated as described above and immediately afterward pulse-labeled with 0.25 mCi of [35 S] methionine/cysteine (Amersham, Arlington Heights, Ill.) per plate in the same medium for 20 min. Plates were then washed with Dulbecco modified Eagle medium containing excess cold methionine and cysteine and chased in the regular medium for up to 3 h. After chase periods, cells were lysed in the IP buffer, as described above, and biotinylated proteins were precipitated with streptavidin-agarose (Sigma).

    Protease Inhibitor:

    Article Title: Dimeric sorting code for concentrative cargo selection by the COPII coat
    Article Snippet: Immunoprecipitation or streptavidin pull-down was carried out with cellular proteins extracted at 4 °C for 30 min with buffer A (100 mM Tris, pH 7.5, 1% Nonidet P-40, 10% glycerol, 130 mM sodium chloride, 5 mM magnesium chloride, 1 mM sodium vanadate, 1 mM sodium fluoride, and 1 mM EDTA) supplemented with protease inhibitor tablets (Roche), according to the manufacturer’s instructions. .. Cell lysates were then incubated with 10 µL M2 agarose (Sigma-Aldrich) or 20 µL streptavidin agarose (Sigma-Aldrich) for 4 h at 4 °C before washing four times with buffer A.

    Cell Culture:

    Article Title: Berberine Targets AP-2/hTERT, NF-?B/COX-2, HIF-1?/VEGF and Cytochrome-c/Caspase Signaling to Suppress Human Cancer Cell Growth
    Article Snippet: Reagents and antibodies Berberine (BBR), U0126, LY294002 and celecoxib were purchased from Sigma (St. Louis, MO) and dissolved in a small amount of DMSO before addition to the complete cell culture medium. .. Streptavidin-agarose was purchased from Sigma (St. Louis, MO).

    Article Title: Redox Proteomics of the Inflammatory Secretome Identifies a Common Set of Redoxins and Other Glutathionylated Proteins Released in Inflammation, Influenza Virus Infection and Oxidative Stress
    Article Snippet: Mass spectrometry and data analysis RAW264.7 cells were cultured in 6-well plates in 1.5 ml of OPTI-MEM as described above. .. The concentrated proteins were then mixed with 50 μL of streptavidin-agarose (Sigma) and incubated under rotation for 30 min at 4°C.

    Imaging:

    Article Title: Target-Based Screen Against a Periplasmic Serine Protease That Regulates Intrabacterial pH Homeostasis in Mycobacteriumtuberculosis
    Article Snippet: The nitrocellulose membranes were treated with blocking buffer (Odyssey) at RT for 1 h, exposed to a IRDye 800CW Streptavidin (Li-COR) at RT for 1 h, washed with Tris-buffered saline with 0.05% v/v Tween 20 (TBST) buffer three times (10 min each time), and visualized by using an infrared imaging system (Odyssey). .. One-fifth volume of prewashed streptavidin agarose (Sigma) was added, and the mixture rotated at 4 °C for 1 h. The beads were washed three times in PBS by centrifugation at 13 000g for 5 min, boiled in 4X SDS loading buffer at 95 °C for 10 min, and centrifuged again.

    Protein Concentration:

    Article Title: Septin oligomerization regulates persistent expression of ErbB2/HER2 in gastric cancer cells
    Article Snippet: Biotinylated proteins were extracted with streptavidin-agarose (Sigma). .. Biotinylated proteins were extracted with streptavidin-agarose (Sigma).

    Sequencing:

    Article Title: Matrix metalloproteinase-1 up-regulation by hepatocyte growth factor in human dermal fibroblasts via ERK signaling pathway involves Ets1 and Fli1
    Article Snippet: The sequence of each oligonucleotide is as follows: (i) MMP1-EBS oligo, 5′-CTATTCATAGCTAATCAAGAGGATGTTATAAAGCATGAGTCAGAC, which corresponds to positions bp −107 to −63 of the human MMP-1 promoter; (ii) MMP1-EBS-M oligo, 5′-CTATTCATAGCTAATCAAGAG T ATGTTATAAAGCATGAGTCAGAC, lacking the EBS, which is able to bind the Ets family of transcription factors. .. After incubation, streptavidin–agarose (Sigma) was added to the reaction and incubated.

    Article Title: RhoA S-nitrosylation as a regulatory mechanism influencing endothelial barrier function in response to G+-bacterial toxins
    Article Snippet: To identify sites of S-nitrosylation, the biotin-switch assay was performed as described above on 1 mg of recombinant RhoA incubated with 100 μM of the S-NO donor, nitrosocysteine for 30 min. RhoA was precipitated, washed and then trypsinized overnight using 5 μg of sequencing-grade trypsin (Promega, Madison, WI) at 37 °C. .. Trypsin was inactivated by addition of 1 mM 4-(2- Aminomethyl) benzenesulfonyl fluoride hydrochloride (AEBSF, Sigma, St. Louis, MO), and biotinylated peptides of RhoA were precipitated with streptavidin–agarose (Sigma, St. Louis, MO) and washed four times with 50 mM ammonium bicarbonate.

    Binding Assay:

    Article Title: CXCL14 Acts as a Specific Carrier of CpG DNA into Dendritic Cells and Activates Toll-like Receptor 9-mediated Adaptive Immunity
    Article Snippet: .. 2.7 In Vitro Binding Assay CXCL14-bio (10 pmol) was coupled to streptavidin-agarose (Sigma-Aldrich) and incubated with Cy3-ODN [100 nM in 100 μl of binding buffer (50 mM Hepes pH 7.5, 150 mM NaCl, 1 mM CaCl2 , 1 mM MgCl2 , 1% BSA)] for 1 h at 4 °C. .. Precipitates were then washed and eluted in SDS sample buffer at 70 °C for 10 min. Cy3-ODN was separated by TBE-Urea-SDS polyacrylamide gel electrophoresis, and Cy3 fluorescence was measured in a LAS-3000 (Fuji Film, Tokyo, Japan).

    Article Title: Vpr-Binding Protein Antagonizes p53-Mediated Transcription via Direct Interaction with H3 Tail
    Article Snippet: .. For nucleosome binding assays, 2 μg DNA equivalents of mononucleosomes were preacetylated by p53 (150 ng) and p300 (200 ng) supplemented with Ac-CoA (10 μM) and immobilized on streptavidin-agarose (Novagen). .. After the beads were washed to remove p53, p300, and Ac-CoA, His-tagged VprBP was added to mononucleosomes and incubated in 500 μl of binding buffer at 4°C for 16 h. The beads were washed three times with binding buffer, and nucleosome-bound VprBP was detected by Western blotting using the anti-His antibody.

    Affinity Precipitation:

    Article Title: Matrix metalloproteinase-1 up-regulation by hepatocyte growth factor in human dermal fibroblasts via ERK signaling pathway involves Ets1 and Fli1
    Article Snippet: Paragraph title: DNA affinity precipitation assay ... After incubation, streptavidin–agarose (Sigma) was added to the reaction and incubated.

    Pull Down Assay:

    Article Title: Role of the polypeptide N-acetylgalactosaminyltransferase 3 in ovarian cancer progression: possible implications in abnormal mucin O-glycosylation
    Article Snippet: Paragraph title: VVA lectin pull-down assay for O-glycosylated (GalNAc-conjugated) proteins ... Twenty μl of streptavidin-agarose (Sigma) was then added, and samples were incubated for an additional 2 h at 4°C with rotation.

    Fluorescence:

    Article Title: CXCL14 Acts as a Specific Carrier of CpG DNA into Dendritic Cells and Activates Toll-like Receptor 9-mediated Adaptive Immunity
    Article Snippet: 2.7 In Vitro Binding Assay CXCL14-bio (10 pmol) was coupled to streptavidin-agarose (Sigma-Aldrich) and incubated with Cy3-ODN [100 nM in 100 μl of binding buffer (50 mM Hepes pH 7.5, 150 mM NaCl, 1 mM CaCl2 , 1 mM MgCl2 , 1% BSA)] for 1 h at 4 °C. .. Precipitates were then washed and eluted in SDS sample buffer at 70 °C for 10 min. Cy3-ODN was separated by TBE-Urea-SDS polyacrylamide gel electrophoresis, and Cy3 fluorescence was measured in a LAS-3000 (Fuji Film, Tokyo, Japan).

    Tandem Mass Spectroscopy:

    Article Title: Redox Proteomics of the Inflammatory Secretome Identifies a Common Set of Redoxins and Other Glutathionylated Proteins Released in Inflammation, Influenza Virus Infection and Oxidative Stress
    Article Snippet: The concentrated proteins were then mixed with 50 μL of streptavidin-agarose (Sigma) and incubated under rotation for 30 min at 4°C. .. Following addition of trypsin, samples were incubated for 18 hours at 37°C, and the digestion reaction was quenched by the addition of TFA to 0.1% prior to LC MS/MS analysis as described below.

    Article Title: RhoA S-nitrosylation as a regulatory mechanism influencing endothelial barrier function in response to G+-bacterial toxins
    Article Snippet: Trypsin was inactivated by addition of 1 mM 4-(2- Aminomethyl) benzenesulfonyl fluoride hydrochloride (AEBSF, Sigma, St. Louis, MO), and biotinylated peptides of RhoA were precipitated with streptavidin–agarose (Sigma, St. Louis, MO) and washed four times with 50 mM ammonium bicarbonate. .. Samples were analyzed by data-dependent acquisition in positive mode using Orbitrap MS analyzer for precursor scan at 120,000 FWHM from 300 to 1500 m / z and ion-trap MS analyzer for MS/MS scans at top speed mode (3-s cycle time).

    Flow Cytometry:

    Article Title: RhoA S-nitrosylation as a regulatory mechanism influencing endothelial barrier function in response to G+-bacterial toxins
    Article Snippet: Trypsin was inactivated by addition of 1 mM 4-(2- Aminomethyl) benzenesulfonyl fluoride hydrochloride (AEBSF, Sigma, St. Louis, MO), and biotinylated peptides of RhoA were precipitated with streptavidin–agarose (Sigma, St. Louis, MO) and washed four times with 50 mM ammonium bicarbonate. .. Two microliters of reconstituted peptide was first trapped and washed on a Pepmap100 C18 trap (5 μm, 0.3 × 5 mm) at 20 μl/min using 2% acetonitrile in water (with 0.1% formic acid) for 10 min and then separated on a Pepman 100 RSLC C18 column (2.0 μm, 75-μm × 150-mm) using a gradient of 2–40% acetonitrile with 0.1% formic acid over 40 min at a flow rate of 300 nl/min and a column temperature of 40 °C.

    Labeling:

    Article Title: Regulation of intracellular trafficking of human CD1d by association with MHC class II molecules
    Article Snippet: Cells were metabolically labeled for 15 min and chased for 30 min or 5 h. They were washed twice with phosphate-buffered saline (PBS) containing 0.1 mM CaCl2 and 1 mM MgCl2 and incubated in PBS with 2 mM sulfo-NHS-SS-biotin (Pierce) at 4°C for 30 min. After washing, the cells were extracted with 1% Brij 98 and immunoprecipitated with either 51.1.3 or L243. .. After boiling in 1% SDS for 5 min, the eluates were diluted with 1% Triton X-100/TBS prior to re-precipitation with streptavidin–agarose (Sigma) and SDS–PAGE.

    Article Title: Dynamic Interplay between Adhesive and Lateral E-Cadherin Dimers
    Article Snippet: Paragraph title: Biotinylation of cell surface proteins and metabolic labeling. ... The cells were then biotinylated as described above and immediately afterward pulse-labeled with 0.25 mCi of [35 S] methionine/cysteine (Amersham, Arlington Heights, Ill.) per plate in the same medium for 20 min. Plates were then washed with Dulbecco modified Eagle medium containing excess cold methionine and cysteine and chased in the regular medium for up to 3 h. After chase periods, cells were lysed in the IP buffer, as described above, and biotinylated proteins were precipitated with streptavidin-agarose (Sigma).

    Metabolic Labelling:

    Article Title: Regulation of intracellular trafficking of human CD1d by association with MHC class II molecules
    Article Snippet: Cells were metabolically labeled for 15 min and chased for 30 min or 5 h. They were washed twice with phosphate-buffered saline (PBS) containing 0.1 mM CaCl2 and 1 mM MgCl2 and incubated in PBS with 2 mM sulfo-NHS-SS-biotin (Pierce) at 4°C for 30 min. After washing, the cells were extracted with 1% Brij 98 and immunoprecipitated with either 51.1.3 or L243. .. After boiling in 1% SDS for 5 min, the eluates were diluted with 1% Triton X-100/TBS prior to re-precipitation with streptavidin–agarose (Sigma) and SDS–PAGE.

    Polyacrylamide Gel Electrophoresis:

    Article Title: CXCL14 Acts as a Specific Carrier of CpG DNA into Dendritic Cells and Activates Toll-like Receptor 9-mediated Adaptive Immunity
    Article Snippet: 2.7 In Vitro Binding Assay CXCL14-bio (10 pmol) was coupled to streptavidin-agarose (Sigma-Aldrich) and incubated with Cy3-ODN [100 nM in 100 μl of binding buffer (50 mM Hepes pH 7.5, 150 mM NaCl, 1 mM CaCl2 , 1 mM MgCl2 , 1% BSA)] for 1 h at 4 °C. .. Precipitates were then washed and eluted in SDS sample buffer at 70 °C for 10 min. Cy3-ODN was separated by TBE-Urea-SDS polyacrylamide gel electrophoresis, and Cy3 fluorescence was measured in a LAS-3000 (Fuji Film, Tokyo, Japan).

    Biotin Switch Assay:

    Article Title: RhoA S-nitrosylation as a regulatory mechanism influencing endothelial barrier function in response to G+-bacterial toxins
    Article Snippet: To identify sites of S-nitrosylation, the biotin-switch assay was performed as described above on 1 mg of recombinant RhoA incubated with 100 μM of the S-NO donor, nitrosocysteine for 30 min. RhoA was precipitated, washed and then trypsinized overnight using 5 μg of sequencing-grade trypsin (Promega, Madison, WI) at 37 °C. .. Trypsin was inactivated by addition of 1 mM 4-(2- Aminomethyl) benzenesulfonyl fluoride hydrochloride (AEBSF, Sigma, St. Louis, MO), and biotinylated peptides of RhoA were precipitated with streptavidin–agarose (Sigma, St. Louis, MO) and washed four times with 50 mM ammonium bicarbonate.

    Silver Staining:

    Article Title: Vpr-Binding Protein Antagonizes p53-Mediated Transcription via Direct Interaction with H3 Tail
    Article Snippet: After washing the beads three times, tail peptides bound to the VprBP protein were resolved by 4 to 20% SDS-PAGE and analyzed by silver staining. .. For nucleosome binding assays, 2 μg DNA equivalents of mononucleosomes were preacetylated by p53 (150 ng) and p300 (200 ng) supplemented with Ac-CoA (10 μM) and immobilized on streptavidin-agarose (Novagen).

    SDS Page:

    Article Title: Target-Based Screen Against a Periplasmic Serine Protease That Regulates Intrabacterial pH Homeostasis in Mycobacteriumtuberculosis
    Article Snippet: The precipitate was collected by centrifugation at 13 000g for 5 min, boiled in 4X SDS loading buffer at 95 °C for 10 min, run on SDS-PAGE, and electrobotted to nitrocellulose membranes. .. One-fifth volume of prewashed streptavidin agarose (Sigma) was added, and the mixture rotated at 4 °C for 1 h. The beads were washed three times in PBS by centrifugation at 13 000g for 5 min, boiled in 4X SDS loading buffer at 95 °C for 10 min, and centrifuged again.

    Article Title: Divergent functions and distinct localization of the Notch ligands DLL1 and DLL3 in vivo
    Article Snippet: The biotinylated proteins were precipitated with streptavidin agarose (Sigma-Aldrich) overnight at 4°C. .. Equivalent amounts of lysates and precipitates were subjected to SDS-PAGE and analyzed by Western blotting as described.

    Article Title: Functional Analysis of a Breast Cancer-Associated Mutation in the Intracellular Domain of the Metalloprotease ADAM12
    Article Snippet: Cell lysates were cleared by centrifugation for 20 min at 16,000 g and supernatants were incubated with streptavidin-agarose (Sigma) for 2 h at 4°C. .. Beads were washed three times in RIPA buffer and bound proteins were released by heating for 5 min at 95°C in 2× SDS-PAGE sample buffer (0.0625 M Tris pH 6.8, 20% glycerol, 2% SDS, 0.01% bromophenol blue, 5% 2-mercaptoethanol).

    Article Title: Dimeric sorting code for concentrative cargo selection by the COPII coat
    Article Snippet: Cell lysates were then incubated with 10 µL M2 agarose (Sigma-Aldrich) or 20 µL streptavidin agarose (Sigma-Aldrich) for 4 h at 4 °C before washing four times with buffer A. .. Immune complexes were then solubilized with 1× SDS/PAGE sample buffer (Invitrogen) with or without (when indicated) 5% β-mercaptoethanol (β-ME), and separated with 3 to 15% Tris-acetate SDS/PAGE (Invitrogen).

    Article Title: Regulation of intracellular trafficking of human CD1d by association with MHC class II molecules
    Article Snippet: .. After boiling in 1% SDS for 5 min, the eluates were diluted with 1% Triton X-100/TBS prior to re-precipitation with streptavidin–agarose (Sigma) and SDS–PAGE. .. Cells (0.5 × 106 ) were stained as described previously ( ) and analyzed using a Becton Dickinson FACScan (Mountain View, CA).

    Article Title: Vpr-Binding Protein Antagonizes p53-Mediated Transcription via Direct Interaction with H3 Tail
    Article Snippet: After extensive washing with washing buffer (25 mM Tris-HCl, pH 7.8, 0.2 mM EDTA, 20% glycerol, 300 mM KCl, 0.1% Nonidet P-40), the bound VprBP protein was subjected to SDS-PAGE and detected by Western blotting using anti-Flag antibody. .. For nucleosome binding assays, 2 μg DNA equivalents of mononucleosomes were preacetylated by p53 (150 ng) and p300 (200 ng) supplemented with Ac-CoA (10 μM) and immobilized on streptavidin-agarose (Novagen).

    In Situ:

    Article Title: Redox Proteomics of the Inflammatory Secretome Identifies a Common Set of Redoxins and Other Glutathionylated Proteins Released in Inflammation, Influenza Virus Infection and Oxidative Stress
    Article Snippet: The concentrated proteins were then mixed with 50 μL of streptavidin-agarose (Sigma) and incubated under rotation for 30 min at 4°C. .. Proteins attached to the beads were then subjected to 2,2,2-Trifluoroethanol-enhanced trypsin digestion in situ , essentially as described [ ].

    Recombinant:

    Article Title: RhoA S-nitrosylation as a regulatory mechanism influencing endothelial barrier function in response to G+-bacterial toxins
    Article Snippet: To identify sites of S-nitrosylation, the biotin-switch assay was performed as described above on 1 mg of recombinant RhoA incubated with 100 μM of the S-NO donor, nitrosocysteine for 30 min. RhoA was precipitated, washed and then trypsinized overnight using 5 μg of sequencing-grade trypsin (Promega, Madison, WI) at 37 °C. .. Trypsin was inactivated by addition of 1 mM 4-(2- Aminomethyl) benzenesulfonyl fluoride hydrochloride (AEBSF, Sigma, St. Louis, MO), and biotinylated peptides of RhoA were precipitated with streptavidin–agarose (Sigma, St. Louis, MO) and washed four times with 50 mM ammonium bicarbonate.

    In Vitro:

    Article Title: CXCL14 Acts as a Specific Carrier of CpG DNA into Dendritic Cells and Activates Toll-like Receptor 9-mediated Adaptive Immunity
    Article Snippet: .. 2.7 In Vitro Binding Assay CXCL14-bio (10 pmol) was coupled to streptavidin-agarose (Sigma-Aldrich) and incubated with Cy3-ODN [100 nM in 100 μl of binding buffer (50 mM Hepes pH 7.5, 150 mM NaCl, 1 mM CaCl2 , 1 mM MgCl2 , 1% BSA)] for 1 h at 4 °C. .. Precipitates were then washed and eluted in SDS sample buffer at 70 °C for 10 min. Cy3-ODN was separated by TBE-Urea-SDS polyacrylamide gel electrophoresis, and Cy3 fluorescence was measured in a LAS-3000 (Fuji Film, Tokyo, Japan).

    Radio Immunoprecipitation:

    Article Title: Functional Analysis of a Breast Cancer-Associated Mutation in the Intracellular Domain of the Metalloprotease ADAM12
    Article Snippet: Finally, cells were washed three times in cold PBS and lysed in radioimmunoprecipitation assay (RIPA) buffer (50 mM Tris pH 7.4; 150 mM NaCl; 0.1% sodium dodecyl sulphate (SDS); 1% Triton X-100 0.5% sodium deoxycholate; 1 mM EDTA, and complete EDTA-free inhibitor cocktail (Roche)). .. Cell lysates were cleared by centrifugation for 20 min at 16,000 g and supernatants were incubated with streptavidin-agarose (Sigma) for 2 h at 4°C.

    Cell Surface Biotinylation Assay:

    Article Title: Functional Analysis of a Breast Cancer-Associated Mutation in the Intracellular Domain of the Metalloprotease ADAM12
    Article Snippet: Paragraph title: Cell surface biotinylation assay ... Cell lysates were cleared by centrifugation for 20 min at 16,000 g and supernatants were incubated with streptavidin-agarose (Sigma) for 2 h at 4°C.

    Concentration Assay:

    Article Title: Redox Proteomics of the Inflammatory Secretome Identifies a Common Set of Redoxins and Other Glutathionylated Proteins Released in Inflammation, Influenza Virus Infection and Oxidative Stress
    Article Snippet: Twenty-four hours after addition of LPS, the supernatants from the two wells were collected and combined, NEM added to a final concentration of 40 mM, and concentrated to 300 μL using 5 kDa-cutoff Vivaspin columns (GE Healthcare) at 4°C. .. The concentrated proteins were then mixed with 50 μL of streptavidin-agarose (Sigma) and incubated under rotation for 30 min at 4°C.

    Article Title: Dimeric sorting code for concentrative cargo selection by the COPII coat
    Article Snippet: Cell lysates were then incubated with 10 µL M2 agarose (Sigma-Aldrich) or 20 µL streptavidin agarose (Sigma-Aldrich) for 4 h at 4 °C before washing four times with buffer A. .. For streptavidin pull-down experiments, a final concentration of 1 mM biotin was included in the SDS/PAGE sample buffer, as previously described ( ).

    Lysis:

    Article Title: Matrix metalloproteinase-1 up-regulation by hepatocyte growth factor in human dermal fibroblasts via ERK signaling pathway involves Ets1 and Fli1
    Article Snippet: Cell lysates were obtained using lysis buffer ( ). .. After incubation, streptavidin–agarose (Sigma) was added to the reaction and incubated.

    Article Title: Role of the polypeptide N-acetylgalactosaminyltransferase 3 in ovarian cancer progression: possible implications in abnormal mucin O-glycosylation
    Article Snippet: Twenty μl of streptavidin-agarose (Sigma) was then added, and samples were incubated for an additional 2 h at 4°C with rotation. .. Lectin/glycoprotein complexes were collected by brief centrifugation (1400 rpm, 5 min), and washed three times with lysis buffer, followed by one wash with phosphate-buffered saline (PBS).

    Article Title: Septin oligomerization regulates persistent expression of ErbB2/HER2 in gastric cancer cells
    Article Snippet: Paragraph title: Inhibitors, biotinylation, and cell lysis ... Biotinylated proteins were extracted with streptavidin-agarose (Sigma).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • N/A
    Streptavidin Mag Sepharose R is a magnetic bead for simple and efficient enrichment of target proteins by immunoprecipitation and purification of biotinylated biomolecules Streptavidin Mag Sepharose R utilizes the strong
      Buy from Supplier

    99
    Millipore streptavidin agarose beads
    Synchronized MALDI-MSI and fluorescence imaging of 20-member Mass-Tag bead-array. (A) Color-coded MALDI-MSI image of a 5920 × 3640 µm 2 region of a 20-member photocleavable Mass-Tag bead-array (photocleavable biotin peptide Mass-Tags loaded onto <t>streptavidin</t> glass beads). Corresponding masses ( m/z ) for Mass-Tags from representative beads (white circles) are indicated. (B) Color-coded overlaid MALDI-MSI spectra are shown for representative beads in the array (the beads indicated by white circles in (A)). Observed monoisotopic masses are listed. The ‘x-Axis Expansion’ inset shows a zoomed view of two distinct Mass-Tags of similar size, indicating a high mass resolution which can discriminate Mass-Tags separated by approximately 4 m/z units as well as the natural isotopes for each, spaced by 1 m/z unit. (C) One Mass-Tagged bead species in the array was labeled with fluorophore (e.g. as in Fig. 3 (A)). The fluorescence image of this bead species (same region as in panel (A)) is shown (gray/white spots) synchronized with a MALDI-MSI image of its cognate Mass-Tag (blue). For simplicity, MALDI-MSI images for two other Mass-Tags on non-fluorescent bead species are also superimposed (yellow and green).
    Streptavidin Agarose Beads, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 19 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/streptavidin agarose beads/product/Millipore
    Average 99 stars, based on 19 article reviews
    Price from $9.99 to $1999.99
    streptavidin agarose beads - by Bioz Stars, 2020-01
    99/100 stars
      Buy from Supplier

    98
    Millipore streptavidin agarose
    RGS13 interacts with the kinase-inducible domain (KID) of CREB ( A ) Plasmids encoding GFP-RGS13, PKA, and various CREB domains fused to the DNA binding domain of GAL4(aa1-147) were expressed in HEK293T cells. NE were immunoprecipitated with anti-GAL4 followed by immunoblotting with anti-GFP and anti-GAL4. ( B ) Plasmids encoding CREB-V5 (wild-type or point mutants) were transfected into HEK293T cells together with PKA and wild-type GFP-RGS13 as in ( A ). RGS13 was immunoprecipitated from TNE with anti-GFP followed by immunodetection of CREB proteins with anti-V5. Expression of the various CREB-V5 proteins in TNE was assessed by immunoblotting (upper panel). ( C ) Biotinylated CREB proteins (WT or various point mutants) bound to <t>streptavidin</t> beads were incubated with p300 (2 nM) and GST-RGS13 (30 nM). Beads were washed extensively and protein complexes evaluated by immunoblotting. Blots in ( A–C ) represent at least 3 experiments with similar results.
    Streptavidin Agarose, supplied by Millipore, used in various techniques. Bioz Stars score: 98/100, based on 154 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/streptavidin agarose/product/Millipore
    Average 98 stars, based on 154 article reviews
    Price from $9.99 to $1999.99
    streptavidin agarose - by Bioz Stars, 2020-01
    98/100 stars
      Buy from Supplier

    Image Search Results


    Synchronized MALDI-MSI and fluorescence imaging of 20-member Mass-Tag bead-array. (A) Color-coded MALDI-MSI image of a 5920 × 3640 µm 2 region of a 20-member photocleavable Mass-Tag bead-array (photocleavable biotin peptide Mass-Tags loaded onto streptavidin glass beads). Corresponding masses ( m/z ) for Mass-Tags from representative beads (white circles) are indicated. (B) Color-coded overlaid MALDI-MSI spectra are shown for representative beads in the array (the beads indicated by white circles in (A)). Observed monoisotopic masses are listed. The ‘x-Axis Expansion’ inset shows a zoomed view of two distinct Mass-Tags of similar size, indicating a high mass resolution which can discriminate Mass-Tags separated by approximately 4 m/z units as well as the natural isotopes for each, spaced by 1 m/z unit. (C) One Mass-Tagged bead species in the array was labeled with fluorophore (e.g. as in Fig. 3 (A)). The fluorescence image of this bead species (same region as in panel (A)) is shown (gray/white spots) synchronized with a MALDI-MSI image of its cognate Mass-Tag (blue). For simplicity, MALDI-MSI images for two other Mass-Tags on non-fluorescent bead species are also superimposed (yellow and green).

    Journal: Rapid Communications in Mass Spectrometry

    Article Title: Correlated matrix-assisted laser desorption/ionization mass spectrometry and fluorescent imaging of photocleavable peptide-coded random bead-arrays

    doi: 10.1002/rcm.6754

    Figure Lengend Snippet: Synchronized MALDI-MSI and fluorescence imaging of 20-member Mass-Tag bead-array. (A) Color-coded MALDI-MSI image of a 5920 × 3640 µm 2 region of a 20-member photocleavable Mass-Tag bead-array (photocleavable biotin peptide Mass-Tags loaded onto streptavidin glass beads). Corresponding masses ( m/z ) for Mass-Tags from representative beads (white circles) are indicated. (B) Color-coded overlaid MALDI-MSI spectra are shown for representative beads in the array (the beads indicated by white circles in (A)). Observed monoisotopic masses are listed. The ‘x-Axis Expansion’ inset shows a zoomed view of two distinct Mass-Tags of similar size, indicating a high mass resolution which can discriminate Mass-Tags separated by approximately 4 m/z units as well as the natural isotopes for each, spaced by 1 m/z unit. (C) One Mass-Tagged bead species in the array was labeled with fluorophore (e.g. as in Fig. 3 (A)). The fluorescence image of this bead species (same region as in panel (A)) is shown (gray/white spots) synchronized with a MALDI-MSI image of its cognate Mass-Tag (blue). For simplicity, MALDI-MSI images for two other Mass-Tags on non-fluorescent bead species are also superimposed (yellow and green).

    Article Snippet: Streptavidin agarose beads Unless otherwise noted, beads were processed in 0.45 µm pore size spin filtration devices (400 μL capacity Ultrafree-MC Micro-Centrifuge Filter Units, Durapore PVDF Membrane; Millipore).

    Techniques: Fluorescence, Imaging, Labeling

    MALDI-MSI imaging of single beads carrying photocleavable peptide Mass-Tags. (A) Two species of 30 µm streptavidin glass beads were prepared, pooled and used to form a two-dimensionally ordered, random bead-array. ‘Bead 1’ carried a single photocleavable biotin peptide Mass-Tag (blue) and a fluorophore (magenta ‘F’). ‘Bead 2’ carried two different photocleavable biotin peptide Mass-Tags (red and green) but no fluorophore. (B) (‘MALDI’) Color-coded MALDI-MSI image of a 1360 by 800 µm 2 region of the bead-array. Co-localization of the red and green Mass-Tags on Bead 2 appears as yellow. (‘Fluor’) Fluorescence image of same region of the bead-array, showing Bead 1. (‘MALDI Fluor’) Synchronized MALDI-MSI and fluorescence images showing co-localization of the fluorescence marker on Bead 1 (magenta) with the expected Mass-Tag (blue). (C) Color-coded MALDI spectra are shown from the center pixel of representative beads (the beads indicated by white arrows in (B)). The blue spectrum is from Bead 1 and yellow from Bead 2. Observed monoisotopic masses of the Mass-Tags are labeled in the spectra (note that while the scaling of the spectra does not allow visual discrimination of the natural isotopes of each Mass-Tag, separated by 1 m/z , they are resolved; for example, see Fig. 4 (B) ‘x-Axis Expansion’ inset).

    Journal: Rapid Communications in Mass Spectrometry

    Article Title: Correlated matrix-assisted laser desorption/ionization mass spectrometry and fluorescent imaging of photocleavable peptide-coded random bead-arrays

    doi: 10.1002/rcm.6754

    Figure Lengend Snippet: MALDI-MSI imaging of single beads carrying photocleavable peptide Mass-Tags. (A) Two species of 30 µm streptavidin glass beads were prepared, pooled and used to form a two-dimensionally ordered, random bead-array. ‘Bead 1’ carried a single photocleavable biotin peptide Mass-Tag (blue) and a fluorophore (magenta ‘F’). ‘Bead 2’ carried two different photocleavable biotin peptide Mass-Tags (red and green) but no fluorophore. (B) (‘MALDI’) Color-coded MALDI-MSI image of a 1360 by 800 µm 2 region of the bead-array. Co-localization of the red and green Mass-Tags on Bead 2 appears as yellow. (‘Fluor’) Fluorescence image of same region of the bead-array, showing Bead 1. (‘MALDI Fluor’) Synchronized MALDI-MSI and fluorescence images showing co-localization of the fluorescence marker on Bead 1 (magenta) with the expected Mass-Tag (blue). (C) Color-coded MALDI spectra are shown from the center pixel of representative beads (the beads indicated by white arrows in (B)). The blue spectrum is from Bead 1 and yellow from Bead 2. Observed monoisotopic masses of the Mass-Tags are labeled in the spectra (note that while the scaling of the spectra does not allow visual discrimination of the natural isotopes of each Mass-Tag, separated by 1 m/z , they are resolved; for example, see Fig. 4 (B) ‘x-Axis Expansion’ inset).

    Article Snippet: Streptavidin agarose beads Unless otherwise noted, beads were processed in 0.45 µm pore size spin filtration devices (400 μL capacity Ultrafree-MC Micro-Centrifuge Filter Units, Durapore PVDF Membrane; Millipore).

    Techniques: Imaging, Fluorescence, Marker, Labeling

    Bead configuration in Bead-GPS. (A) Mass-Tags, e.g. peptides, are end-labeled with photocleavable biotin using an NHS-activated reagent and then captured onto streptavidin-coated 30 µm glass or 34 µm agarose beads (glass beads depicted; green numbers indicate the sequence of steps). (B) A novel photocleavable primary amine-terminated linker (NHS-PC-tBOC Linker) is attached to 30 µm mono-sized TentaGel® beads, which provides through its primary amine group a substrate for combinatorial synthesis of photocleavable peptide or peptoid libraries. Alternatively, independently synthesized Mass-Tags, e.g. peptides, can be attached to the photocleavable primary amine-terminated linker on the beads. (A and B) Streptavidin (tetrameric) is attached to the bead surface by a non-cleavable biotin (indicated by ‘B’ in figure). In addition to binding the Mass-Tags in some cases (e.g. as in (A)), the streptavidin coating can also facilitate attachment of separate ‘Bait’ molecules such as whole proteins using either a non-cleavable biotin (indicated by ‘B’ in figure) or a streptavidin binding tag (not depicted). See Experimental section for more detail.

    Journal: Rapid Communications in Mass Spectrometry

    Article Title: Correlated matrix-assisted laser desorption/ionization mass spectrometry and fluorescent imaging of photocleavable peptide-coded random bead-arrays

    doi: 10.1002/rcm.6754

    Figure Lengend Snippet: Bead configuration in Bead-GPS. (A) Mass-Tags, e.g. peptides, are end-labeled with photocleavable biotin using an NHS-activated reagent and then captured onto streptavidin-coated 30 µm glass or 34 µm agarose beads (glass beads depicted; green numbers indicate the sequence of steps). (B) A novel photocleavable primary amine-terminated linker (NHS-PC-tBOC Linker) is attached to 30 µm mono-sized TentaGel® beads, which provides through its primary amine group a substrate for combinatorial synthesis of photocleavable peptide or peptoid libraries. Alternatively, independently synthesized Mass-Tags, e.g. peptides, can be attached to the photocleavable primary amine-terminated linker on the beads. (A and B) Streptavidin (tetrameric) is attached to the bead surface by a non-cleavable biotin (indicated by ‘B’ in figure). In addition to binding the Mass-Tags in some cases (e.g. as in (A)), the streptavidin coating can also facilitate attachment of separate ‘Bait’ molecules such as whole proteins using either a non-cleavable biotin (indicated by ‘B’ in figure) or a streptavidin binding tag (not depicted). See Experimental section for more detail.

    Article Snippet: Streptavidin agarose beads Unless otherwise noted, beads were processed in 0.45 µm pore size spin filtration devices (400 μL capacity Ultrafree-MC Micro-Centrifuge Filter Units, Durapore PVDF Membrane; Millipore).

    Techniques: Labeling, Sequencing, Synthesized, Binding Assay

    A19 phosphorylation. (A) Western blot analysis. BS-C-1 cells were infected with vFS-A11 and vFS-A19 in the presence of 100 μCi/ml 32 P i . After 18 h, the cells were lysed, and the soluble extract was bound to streptavidin-agarose beads. Bound proteins

    Journal: Journal of Virology

    Article Title: Vaccinia Virus A19 Protein Participates in the Transformation of Spherical Immature Particles to Barrel-Shaped Infectious Virions

    doi: 10.1128/JVI.01258-13

    Figure Lengend Snippet: A19 phosphorylation. (A) Western blot analysis. BS-C-1 cells were infected with vFS-A11 and vFS-A19 in the presence of 100 μCi/ml 32 P i . After 18 h, the cells were lysed, and the soluble extract was bound to streptavidin-agarose beads. Bound proteins

    Article Snippet: Soluble extracts obtained by low-speed centrifugation were allowed to bind to streptavidin-agarose beads (Millipore, Billerica, MA) for 3 h at 4°C.

    Techniques: Western Blot, Infection

    Expression and characterization of the A19 protein. (A) Schematic representation of the DNA construct used for generating recombinant vFS-A19. The FLAG- and streptavidin-binding peptide tag fused at the N terminus of the A19 ORF (FS) is indicated. The

    Journal: Journal of Virology

    Article Title: Vaccinia Virus A19 Protein Participates in the Transformation of Spherical Immature Particles to Barrel-Shaped Infectious Virions

    doi: 10.1128/JVI.01258-13

    Figure Lengend Snippet: Expression and characterization of the A19 protein. (A) Schematic representation of the DNA construct used for generating recombinant vFS-A19. The FLAG- and streptavidin-binding peptide tag fused at the N terminus of the A19 ORF (FS) is indicated. The

    Article Snippet: Soluble extracts obtained by low-speed centrifugation were allowed to bind to streptavidin-agarose beads (Millipore, Billerica, MA) for 3 h at 4°C.

    Techniques: Expressing, Construct, Recombinant, Binding Assay

    The rate of cell surface expression/appearance/transport of BRI2 is reduced in the absence of N-glycosylation. Wild-type mycBRI2 or mycBRI2/N170A was expressed in HEK293 cells. The newly synthesized proteins were labeled with 35 S in radiolabeling medium for 2 h (pulse) at 16°C and then were incubated in non-radiolabeling medium for 0′, 20′, 40′ and 60′ (chase). ( A ) Cell surface proteins were labeled with biotin and precipitated with streptavidin beads. Precipitated cell surface proteins were eluted from the beads and immunoprecipitated with 9B11 antibody against the myc epitope before electrophoresis and autoradiography. ( B ) Immunoprecipitation of cell extracts with 9B11, electrophoresis and autoradiography were performed to verify the expression levels of BRI2.

    Journal: Glycobiology

    Article Title: Glycosylation of BRI2 on asparagine 170 is involved in its trafficking to the cell surface but not in its processing by furin or ADAM10

    doi: 10.1093/glycob/cwr097

    Figure Lengend Snippet: The rate of cell surface expression/appearance/transport of BRI2 is reduced in the absence of N-glycosylation. Wild-type mycBRI2 or mycBRI2/N170A was expressed in HEK293 cells. The newly synthesized proteins were labeled with 35 S in radiolabeling medium for 2 h (pulse) at 16°C and then were incubated in non-radiolabeling medium for 0′, 20′, 40′ and 60′ (chase). ( A ) Cell surface proteins were labeled with biotin and precipitated with streptavidin beads. Precipitated cell surface proteins were eluted from the beads and immunoprecipitated with 9B11 antibody against the myc epitope before electrophoresis and autoradiography. ( B ) Immunoprecipitation of cell extracts with 9B11, electrophoresis and autoradiography were performed to verify the expression levels of BRI2.

    Article Snippet: The cell extracts were centrifuged at 15,000 × g for 30 min and supernatants were incubated with 50 μL of streptavidin–agarose beads (Millipore) for 1 h at 4°C.

    Techniques: Expressing, Synthesized, Labeling, Radioactivity, Incubation, Immunoprecipitation, Electrophoresis, Autoradiography

    Inhibition of N-glycosylation of BRI2 inhibits its expression at the cell surface. Wild-type mycBRI2 or mycBRI2/N170A was expressed in HEK293 cells. Cell surface proteins were labeled with biotin (lanes 1 and 2) or were not labeled (lanes 3 and 4), as a control for biotinylation specificity. ( A ) Cell extracts were precipitated with streptavidin beads and analyzed with western blot against myc with 9B11 antibody. ( B ) Cell extracts were directly analyzed with western blot as a control for protein expression. The two immunoreactive bands of BRI2 proteins correspond to the furin-cleaved and the non-cleaved wild-type mycBRI2 or mycBRI2/N170A.

    Journal: Glycobiology

    Article Title: Glycosylation of BRI2 on asparagine 170 is involved in its trafficking to the cell surface but not in its processing by furin or ADAM10

    doi: 10.1093/glycob/cwr097

    Figure Lengend Snippet: Inhibition of N-glycosylation of BRI2 inhibits its expression at the cell surface. Wild-type mycBRI2 or mycBRI2/N170A was expressed in HEK293 cells. Cell surface proteins were labeled with biotin (lanes 1 and 2) or were not labeled (lanes 3 and 4), as a control for biotinylation specificity. ( A ) Cell extracts were precipitated with streptavidin beads and analyzed with western blot against myc with 9B11 antibody. ( B ) Cell extracts were directly analyzed with western blot as a control for protein expression. The two immunoreactive bands of BRI2 proteins correspond to the furin-cleaved and the non-cleaved wild-type mycBRI2 or mycBRI2/N170A.

    Article Snippet: The cell extracts were centrifuged at 15,000 × g for 30 min and supernatants were incubated with 50 μL of streptavidin–agarose beads (Millipore) for 1 h at 4°C.

    Techniques: Inhibition, Expressing, Labeling, Western Blot

    RGS13 interacts with the kinase-inducible domain (KID) of CREB ( A ) Plasmids encoding GFP-RGS13, PKA, and various CREB domains fused to the DNA binding domain of GAL4(aa1-147) were expressed in HEK293T cells. NE were immunoprecipitated with anti-GAL4 followed by immunoblotting with anti-GFP and anti-GAL4. ( B ) Plasmids encoding CREB-V5 (wild-type or point mutants) were transfected into HEK293T cells together with PKA and wild-type GFP-RGS13 as in ( A ). RGS13 was immunoprecipitated from TNE with anti-GFP followed by immunodetection of CREB proteins with anti-V5. Expression of the various CREB-V5 proteins in TNE was assessed by immunoblotting (upper panel). ( C ) Biotinylated CREB proteins (WT or various point mutants) bound to streptavidin beads were incubated with p300 (2 nM) and GST-RGS13 (30 nM). Beads were washed extensively and protein complexes evaluated by immunoblotting. Blots in ( A–C ) represent at least 3 experiments with similar results.

    Journal: Molecular cell

    Article Title: RGS13 acts as a nuclear repressor of CREB

    doi: 10.1016/j.molcel.2008.06.024

    Figure Lengend Snippet: RGS13 interacts with the kinase-inducible domain (KID) of CREB ( A ) Plasmids encoding GFP-RGS13, PKA, and various CREB domains fused to the DNA binding domain of GAL4(aa1-147) were expressed in HEK293T cells. NE were immunoprecipitated with anti-GAL4 followed by immunoblotting with anti-GFP and anti-GAL4. ( B ) Plasmids encoding CREB-V5 (wild-type or point mutants) were transfected into HEK293T cells together with PKA and wild-type GFP-RGS13 as in ( A ). RGS13 was immunoprecipitated from TNE with anti-GFP followed by immunodetection of CREB proteins with anti-V5. Expression of the various CREB-V5 proteins in TNE was assessed by immunoblotting (upper panel). ( C ) Biotinylated CREB proteins (WT or various point mutants) bound to streptavidin beads were incubated with p300 (2 nM) and GST-RGS13 (30 nM). Beads were washed extensively and protein complexes evaluated by immunoblotting. Blots in ( A–C ) represent at least 3 experiments with similar results.

    Article Snippet: Biotinylated GFP or GFP-RGS13, or CREB was synthesized from pCDNA3.1 TOPO plasmids using Transcend biotinylated lysine tRNA and TNT T7 quick-coupled in vitro transcription/translation system (Promega) and purified on streptavidin-agarose (EMD Biosciences).

    Techniques: Binding Assay, Immunoprecipitation, Transfection, Immunodetection, Expressing, Incubation

    RGS13 interacts with phosphorylated CREB ( A–B ) Co-immunoprecipitation of RGS13 with wild type (WT) CREB in the presence of PKA. ( A ) HEK293T cells were co-transfected with plasmids for CREB-V5 and GFP or GFP-RGS13 with or without the catalytic subunit of PKA. Cell lysates were immunoprecipitated with anti-V5 antibody followed by immunodetection as indicated. Protein expression in total lysates was assessed by immunoblotting (bottom panel). ( B ) Co-immunoprecipitation was done as in ( A ) except that V5-tagged WT and S133A CREB were analyzed in parallel. Expression of proteins in total NE was determined by immunoblotting (bottom panel). ( C ) p300 is required for pCREB-RGS13 interaction. Recombinant H 6 MBP-CREB ( M r~97 kD) was phosphorylated by PKA prior to incubation with streptadivin-coupled agarose beads containing biotinylated GFP or GFP-RGS13 in the presence or absence of p300. Beads were washed and analyzed by immunoblotting. ( D ) CREB phosphorylation is required for interaction with RGS13. Biotinylated GFP-RGS13 immobilized on streptavidin beads was incubated with unmodified CREB or PKA-phosphorylated CREB in the presence of p300. Beads were washed and analyzed by immunoblotting as in ( C ). 10% of the input CREB was run as an immunoblot control. ( E ) Co-immunoprecipitation of RGS13 and CREB in B lymphocytes. Ramos B cells were left untreated or stimulated with anti-IgM (10 µg/ml) or terbutaline (10 µM) for 15 min. NE were immunoprecipitated with anti-CREB followed by detection of protein complexes by immunoblotting (right panel). Expression of proteins in NE was determined by immunoblotting (left panel). Images represent at least 3 experiments with similar results.

    Journal: Molecular cell

    Article Title: RGS13 acts as a nuclear repressor of CREB

    doi: 10.1016/j.molcel.2008.06.024

    Figure Lengend Snippet: RGS13 interacts with phosphorylated CREB ( A–B ) Co-immunoprecipitation of RGS13 with wild type (WT) CREB in the presence of PKA. ( A ) HEK293T cells were co-transfected with plasmids for CREB-V5 and GFP or GFP-RGS13 with or without the catalytic subunit of PKA. Cell lysates were immunoprecipitated with anti-V5 antibody followed by immunodetection as indicated. Protein expression in total lysates was assessed by immunoblotting (bottom panel). ( B ) Co-immunoprecipitation was done as in ( A ) except that V5-tagged WT and S133A CREB were analyzed in parallel. Expression of proteins in total NE was determined by immunoblotting (bottom panel). ( C ) p300 is required for pCREB-RGS13 interaction. Recombinant H 6 MBP-CREB ( M r~97 kD) was phosphorylated by PKA prior to incubation with streptadivin-coupled agarose beads containing biotinylated GFP or GFP-RGS13 in the presence or absence of p300. Beads were washed and analyzed by immunoblotting. ( D ) CREB phosphorylation is required for interaction with RGS13. Biotinylated GFP-RGS13 immobilized on streptavidin beads was incubated with unmodified CREB or PKA-phosphorylated CREB in the presence of p300. Beads were washed and analyzed by immunoblotting as in ( C ). 10% of the input CREB was run as an immunoblot control. ( E ) Co-immunoprecipitation of RGS13 and CREB in B lymphocytes. Ramos B cells were left untreated or stimulated with anti-IgM (10 µg/ml) or terbutaline (10 µM) for 15 min. NE were immunoprecipitated with anti-CREB followed by detection of protein complexes by immunoblotting (right panel). Expression of proteins in NE was determined by immunoblotting (left panel). Images represent at least 3 experiments with similar results.

    Article Snippet: Biotinylated GFP or GFP-RGS13, or CREB was synthesized from pCDNA3.1 TOPO plasmids using Transcend biotinylated lysine tRNA and TNT T7 quick-coupled in vitro transcription/translation system (Promega) and purified on streptavidin-agarose (EMD Biosciences).

    Techniques: Immunoprecipitation, Transfection, Immunodetection, Expressing, Recombinant, Incubation