streptavidin agarose affinity gel  (Millipore)


Bioz Verified Symbol Millipore is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86

    Structured Review

    Millipore streptavidin agarose affinity gel
    Streptavidin Agarose Affinity Gel, supplied by Millipore, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/streptavidin agarose affinity gel/product/Millipore
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    streptavidin agarose affinity gel - by Bioz Stars, 2020-04
    86/100 stars

    Images

    Related Articles

    Transfection:

    Article Title: Conventional Protein Kinase C-? (PKC-?) and PKC-? Negatively Regulate RIG-I Antiviral Signal Transduction
    Article Snippet: For the RNA binding assay, 1 μg of biotinylated RNA was incubated for 1 h at 25°C with 25 μg of cell extract prepared from HEK293T cells transfected with pEF-Bos-Flag-RIG-I plasmids. .. Following incubation, the mixture was transferred into 400 μl of wash buffer (50 mM Tris, pH 7.5, 150 mM NaCl, 1 mM EDTA, 1% NP-40) containing 30 μl streptavidin agarose affinity gel (Sigma) and rocked at 4°C for 2 h. The RNA-protein complexes were collected by centrifugation and washed three times with wash buffer, followed by SDS-PAGE and immunoblotting with anti-Flag antibody.

    Centrifugation:

    Article Title: Conventional Protein Kinase C-? (PKC-?) and PKC-? Negatively Regulate RIG-I Antiviral Signal Transduction
    Article Snippet: .. Following incubation, the mixture was transferred into 400 μl of wash buffer (50 mM Tris, pH 7.5, 150 mM NaCl, 1 mM EDTA, 1% NP-40) containing 30 μl streptavidin agarose affinity gel (Sigma) and rocked at 4°C for 2 h. The RNA-protein complexes were collected by centrifugation and washed three times with wash buffer, followed by SDS-PAGE and immunoblotting with anti-Flag antibody. .. RIG-I 2CARD was cloned into pGEX-4T-1 vector.

    Purification:

    Article Title: Conventional Protein Kinase C-? (PKC-?) and PKC-? Negatively Regulate RIG-I Antiviral Signal Transduction
    Article Snippet: The DNA template was removed by DNase I treatment, and RNA was purified using Microspin G-25 Columns (GE Healthcare). .. Following incubation, the mixture was transferred into 400 μl of wash buffer (50 mM Tris, pH 7.5, 150 mM NaCl, 1 mM EDTA, 1% NP-40) containing 30 μl streptavidin agarose affinity gel (Sigma) and rocked at 4°C for 2 h. The RNA-protein complexes were collected by centrifugation and washed three times with wash buffer, followed by SDS-PAGE and immunoblotting with anti-Flag antibody.

    Incubation:

    Article Title: Conventional Protein Kinase C-? (PKC-?) and PKC-? Negatively Regulate RIG-I Antiviral Signal Transduction
    Article Snippet: .. Following incubation, the mixture was transferred into 400 μl of wash buffer (50 mM Tris, pH 7.5, 150 mM NaCl, 1 mM EDTA, 1% NP-40) containing 30 μl streptavidin agarose affinity gel (Sigma) and rocked at 4°C for 2 h. The RNA-protein complexes were collected by centrifugation and washed three times with wash buffer, followed by SDS-PAGE and immunoblotting with anti-Flag antibody. .. RIG-I 2CARD was cloned into pGEX-4T-1 vector.

    CTG Assay:

    Article Title: Conventional Protein Kinase C-? (PKC-?) and PKC-? Negatively Regulate RIG-I Antiviral Signal Transduction
    Article Snippet: For transcription, the annealed oligonucleotides 5′CGCGTAATACGACTCACTATA 3′ and 5′ACA TTT TTG CTT TGC AAT TGA CAA TGT CTG TTT TTT CTT TGA TCT GGT TGT TAA GCG TTA TAG TGA GTC GTA TTA CGC G 3′ were used as the template. .. Following incubation, the mixture was transferred into 400 μl of wash buffer (50 mM Tris, pH 7.5, 150 mM NaCl, 1 mM EDTA, 1% NP-40) containing 30 μl streptavidin agarose affinity gel (Sigma) and rocked at 4°C for 2 h. The RNA-protein complexes were collected by centrifugation and washed three times with wash buffer, followed by SDS-PAGE and immunoblotting with anti-Flag antibody.

    RNA Binding Assay:

    Article Title: Conventional Protein Kinase C-? (PKC-?) and PKC-? Negatively Regulate RIG-I Antiviral Signal Transduction
    Article Snippet: For the RNA binding assay, 1 μg of biotinylated RNA was incubated for 1 h at 25°C with 25 μg of cell extract prepared from HEK293T cells transfected with pEF-Bos-Flag-RIG-I plasmids. .. Following incubation, the mixture was transferred into 400 μl of wash buffer (50 mM Tris, pH 7.5, 150 mM NaCl, 1 mM EDTA, 1% NP-40) containing 30 μl streptavidin agarose affinity gel (Sigma) and rocked at 4°C for 2 h. The RNA-protein complexes were collected by centrifugation and washed three times with wash buffer, followed by SDS-PAGE and immunoblotting with anti-Flag antibody.

    Cellular Antioxidant Activity Assay:

    Article Title: Conventional Protein Kinase C-? (PKC-?) and PKC-? Negatively Regulate RIG-I Antiviral Signal Transduction
    Article Snippet: For transcription, the annealed oligonucleotides 5′CGCGTAATACGACTCACTATA 3′ and 5′ACA TTT TTG CTT TGC AAT TGA CAA TGT CTG TTT TTT CTT TGA TCT GGT TGT TAA GCG TTA TAG TGA GTC GTA TTA CGC G 3′ were used as the template. .. Following incubation, the mixture was transferred into 400 μl of wash buffer (50 mM Tris, pH 7.5, 150 mM NaCl, 1 mM EDTA, 1% NP-40) containing 30 μl streptavidin agarose affinity gel (Sigma) and rocked at 4°C for 2 h. The RNA-protein complexes were collected by centrifugation and washed three times with wash buffer, followed by SDS-PAGE and immunoblotting with anti-Flag antibody.

    SDS Page:

    Article Title: Conventional Protein Kinase C-? (PKC-?) and PKC-? Negatively Regulate RIG-I Antiviral Signal Transduction
    Article Snippet: .. Following incubation, the mixture was transferred into 400 μl of wash buffer (50 mM Tris, pH 7.5, 150 mM NaCl, 1 mM EDTA, 1% NP-40) containing 30 μl streptavidin agarose affinity gel (Sigma) and rocked at 4°C for 2 h. The RNA-protein complexes were collected by centrifugation and washed three times with wash buffer, followed by SDS-PAGE and immunoblotting with anti-Flag antibody. .. RIG-I 2CARD was cloned into pGEX-4T-1 vector.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Millipore streptavidin
    ( A ) Binding analyses of Csn2 in the presence and absence of EGTA and free DNA ends on 2% Tris-acetate agarose gel. In each lane 168 ng linear DNA and 7.2 mM CaCl 2 were employed. The numbers above the lanes indicate the order of addition of <t>streptavidin</t> (2 µg), Csn2 (4.7 µg), or EGTA (14 mM) in a total volume of 14.4 µl. Lanes 2–5: Influence of EGTA on Csn2-DNA interaction is shown. Lanes 6–9: 168 ng of the end-biotinylated DNA fragment were incubated first with streptavidin to block the DNA ends. Lanes 10 and 11: Streptavidin was added after binding of Csn2. After separation of the complexes the agarose gel was stained with ethidium bromide. ( B ) Schematic presentation of the binding analysis, shown in (A).
    Streptavidin, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/streptavidin/product/Millipore
    Average 99 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    streptavidin - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results


    ( A ) Binding analyses of Csn2 in the presence and absence of EGTA and free DNA ends on 2% Tris-acetate agarose gel. In each lane 168 ng linear DNA and 7.2 mM CaCl 2 were employed. The numbers above the lanes indicate the order of addition of streptavidin (2 µg), Csn2 (4.7 µg), or EGTA (14 mM) in a total volume of 14.4 µl. Lanes 2–5: Influence of EGTA on Csn2-DNA interaction is shown. Lanes 6–9: 168 ng of the end-biotinylated DNA fragment were incubated first with streptavidin to block the DNA ends. Lanes 10 and 11: Streptavidin was added after binding of Csn2. After separation of the complexes the agarose gel was stained with ethidium bromide. ( B ) Schematic presentation of the binding analysis, shown in (A).

    Journal: Nucleic Acids Research

    Article Title: Double-strand DNA end-binding and sliding of the toroidal CRISPR-associated protein Csn2

    doi: 10.1093/nar/gkt315

    Figure Lengend Snippet: ( A ) Binding analyses of Csn2 in the presence and absence of EGTA and free DNA ends on 2% Tris-acetate agarose gel. In each lane 168 ng linear DNA and 7.2 mM CaCl 2 were employed. The numbers above the lanes indicate the order of addition of streptavidin (2 µg), Csn2 (4.7 µg), or EGTA (14 mM) in a total volume of 14.4 µl. Lanes 2–5: Influence of EGTA on Csn2-DNA interaction is shown. Lanes 6–9: 168 ng of the end-biotinylated DNA fragment were incubated first with streptavidin to block the DNA ends. Lanes 10 and 11: Streptavidin was added after binding of Csn2. After separation of the complexes the agarose gel was stained with ethidium bromide. ( B ) Schematic presentation of the binding analysis, shown in (A).

    Article Snippet: The volumes of the binding reaction without EGTA or streptavidin were adjusted by addition of deionized water (Millipore).

    Techniques: Binding Assay, Agarose Gel Electrophoresis, Incubation, Blocking Assay, Staining