peroxidase conjugated streptavidin  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Thermo Fisher peroxidase conjugated streptavidin
    In vitro selection and binding of aptamers. ( a ) Schematic representation of the SELEX process used within this study. ( b ) Schematic illustration of the enzyme linked apta-sorbent assay (ELASA) setup. ( c ) Folded biotinylated aptamers (RA1-RA9, c = 500 nM) were tested for rituximab binding. Bound aptamers were detected by <t>streptavidin-HRP,</t> chemiluminescence ELISA substrate was used for detection and luminescence was measured. Measurements were performed in six replicates; means and standard errors of the mean are given.
    Peroxidase Conjugated Streptavidin, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 2395 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/peroxidase conjugated streptavidin/product/Thermo Fisher
    Average 99 stars, based on 2395 article reviews
    Price from $9.99 to $1999.99
    peroxidase conjugated streptavidin - by Bioz Stars, 2020-04
    99/100 stars

    Images

    1) Product Images from "Aptamers as quality control tool for production, storage and biosimilarity of the anti-CD20 biopharmaceutical rituximab"

    Article Title: Aptamers as quality control tool for production, storage and biosimilarity of the anti-CD20 biopharmaceutical rituximab

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-37624-1

    In vitro selection and binding of aptamers. ( a ) Schematic representation of the SELEX process used within this study. ( b ) Schematic illustration of the enzyme linked apta-sorbent assay (ELASA) setup. ( c ) Folded biotinylated aptamers (RA1-RA9, c = 500 nM) were tested for rituximab binding. Bound aptamers were detected by streptavidin-HRP, chemiluminescence ELISA substrate was used for detection and luminescence was measured. Measurements were performed in six replicates; means and standard errors of the mean are given.
    Figure Legend Snippet: In vitro selection and binding of aptamers. ( a ) Schematic representation of the SELEX process used within this study. ( b ) Schematic illustration of the enzyme linked apta-sorbent assay (ELASA) setup. ( c ) Folded biotinylated aptamers (RA1-RA9, c = 500 nM) were tested for rituximab binding. Bound aptamers were detected by streptavidin-HRP, chemiluminescence ELISA substrate was used for detection and luminescence was measured. Measurements were performed in six replicates; means and standard errors of the mean are given.

    Techniques Used: In Vitro, Selection, Binding Assay, Enzyme-linked Immunosorbent Assay

    2) Product Images from "The Heparan Sulfate Proteoglycan Form of Epithelial CD44v3 Serves as a CD11b/CD18 Counter-receptor during Polymorphonuclear Leukocyte Transepithelial Migration"

    Article Title: The Heparan Sulfate Proteoglycan Form of Epithelial CD44v3 Serves as a CD11b/CD18 Counter-receptor during Polymorphonuclear Leukocyte Transepithelial Migration

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M807805200

    Localization of C3H7 antigen to the basolateral and lateral membranes of epithelium. A , immunofluorescence labeling and confocal microscopy was used to define the pattern of C3H7 antigen expression. Shown here are an X-Z orientation series and an en face image demonstrating nearly complete localization to the basolateral and subapical lateral membranes. B , immunofluorescence labeling of mAb C3H7 in normal human colon tissue sections. Scale bar , 20 μm. C , Western blot analysis of equal amounts of lysates from indicated cell types with mAb C3H7. D , confluent T84 monolayers were biotinylated on the apical ( Ap ) or basolateral ( BL ) surface. Lysates were immunoprecipitated with either C3H7 or isotype-matched control mAb C1F3. Proteins were visualized with streptavidin-HRP to identify only surface biotinylated C3H7 antigen ( upper panel ) or with mAb C3H7 to demonstrate total C3H7 antigen ( lower panel ). The control lane ( lane C ) represents mAb C1F3 immunoprecipitation.
    Figure Legend Snippet: Localization of C3H7 antigen to the basolateral and lateral membranes of epithelium. A , immunofluorescence labeling and confocal microscopy was used to define the pattern of C3H7 antigen expression. Shown here are an X-Z orientation series and an en face image demonstrating nearly complete localization to the basolateral and subapical lateral membranes. B , immunofluorescence labeling of mAb C3H7 in normal human colon tissue sections. Scale bar , 20 μm. C , Western blot analysis of equal amounts of lysates from indicated cell types with mAb C3H7. D , confluent T84 monolayers were biotinylated on the apical ( Ap ) or basolateral ( BL ) surface. Lysates were immunoprecipitated with either C3H7 or isotype-matched control mAb C1F3. Proteins were visualized with streptavidin-HRP to identify only surface biotinylated C3H7 antigen ( upper panel ) or with mAb C3H7 to demonstrate total C3H7 antigen ( lower panel ). The control lane ( lane C ) represents mAb C1F3 immunoprecipitation.

    Techniques Used: Immunofluorescence, Labeling, Confocal Microscopy, Expressing, Western Blot, Immunoprecipitation

    3) Product Images from "Transglutaminase 2 inhibits Rb binding of human papillomavirus E7 by incorporating polyamine"

    Article Title: Transglutaminase 2 inhibits Rb binding of human papillomavirus E7 by incorporating polyamine

    Journal: The EMBO Journal

    doi: 10.1093/emboj/cdg495

    Fig. 4. TGase 2 catalyzes polyamination of HPV18 E7, but not HPV16 E7. ( A ) One hundred micrograms of His-tagged HPV18 E7 and HPV16 E7 were incubated with TGase 2 in the presence of 14 C putrescine. Radioactivity bound to each protein was measured by a liquid scintillation counter. BSA and casein were employed as negative and a positive controls respectively. The figure shows the mean values and SD of three independent experiments. ( B ) HPV18 E7 was incubated with TGase 2 in the presence of 0.1 mM of biotinylated spermine and 0, 0.1, 1 and 10 mM of spermine (lane 1–4). The incorporation of biotinylated spermine was analyzed by dot-blotting using HRP-conjugated streptavidin (SA-HRP). HPV18 E7 was probed with anti-HPV18 E7 antibody. ( C ) The reaction mixtures were subjected to 15% SDS–PAGE and polyaminated HPV E7 was probed with SA-HRP. ( D ) HeLa and Caski cells were treated with 1 mM of biotinylated pentylamine for 1 h in the presence of A23187. Biotinylated pentylamine-incorporated E7s were precipitated by streptavidin-conjugated magnetic beads. Proteins bound to beads were analyzed by western blot using antibodies to HPV18 E7 or HPV16 E7. C33A cells were used as a negative control.
    Figure Legend Snippet: Fig. 4. TGase 2 catalyzes polyamination of HPV18 E7, but not HPV16 E7. ( A ) One hundred micrograms of His-tagged HPV18 E7 and HPV16 E7 were incubated with TGase 2 in the presence of 14 C putrescine. Radioactivity bound to each protein was measured by a liquid scintillation counter. BSA and casein were employed as negative and a positive controls respectively. The figure shows the mean values and SD of three independent experiments. ( B ) HPV18 E7 was incubated with TGase 2 in the presence of 0.1 mM of biotinylated spermine and 0, 0.1, 1 and 10 mM of spermine (lane 1–4). The incorporation of biotinylated spermine was analyzed by dot-blotting using HRP-conjugated streptavidin (SA-HRP). HPV18 E7 was probed with anti-HPV18 E7 antibody. ( C ) The reaction mixtures were subjected to 15% SDS–PAGE and polyaminated HPV E7 was probed with SA-HRP. ( D ) HeLa and Caski cells were treated with 1 mM of biotinylated pentylamine for 1 h in the presence of A23187. Biotinylated pentylamine-incorporated E7s were precipitated by streptavidin-conjugated magnetic beads. Proteins bound to beads were analyzed by western blot using antibodies to HPV18 E7 or HPV16 E7. C33A cells were used as a negative control.

    Techniques Used: Incubation, Radioactivity, SDS Page, Magnetic Beads, Western Blot, Negative Control

    4) Product Images from "Development of viral nanoparticles for efficient intracellular delivery †"

    Article Title: Development of viral nanoparticles for efficient intracellular delivery †

    Journal: Nanoscale

    doi: 10.1039/c2nr30366c

    Characterization of CPMV labeling with the biotinylated R5 peptide. (A) Size exclusion chromatography of wild-type CPMV, CPMV–R5L and CPMV–R5Hat 280 nm. (B) ECL dot blot of purified CPMV particles. The number of biotin labels per particle was determined using standardized biotin concentrations and Chemidoc XRS software. (C) Native gel electrophoresis of intact CPMV particles (10 µg) using a 0.8% (w/v) agarose gel. Particles were visualized under UV light. Lane 1 = CPMV, 2 = CPMV–4FB, 3 = CPMV–R5H, 4 = CPMV–PFB, 5 = CPMV–R5L. (D) SDS–PAGE of CPMV particles (10 µg) using a 4–12% Bis-Tris gel and western blotting using streptavidin–alkaline phosphatase to detect the N-terminal biotin tag of the R5 peptide. (E) Zeta potential of CPMV wild type, CPMV–R5L and CPMV–R5H formulations.
    Figure Legend Snippet: Characterization of CPMV labeling with the biotinylated R5 peptide. (A) Size exclusion chromatography of wild-type CPMV, CPMV–R5L and CPMV–R5Hat 280 nm. (B) ECL dot blot of purified CPMV particles. The number of biotin labels per particle was determined using standardized biotin concentrations and Chemidoc XRS software. (C) Native gel electrophoresis of intact CPMV particles (10 µg) using a 0.8% (w/v) agarose gel. Particles were visualized under UV light. Lane 1 = CPMV, 2 = CPMV–4FB, 3 = CPMV–R5H, 4 = CPMV–PFB, 5 = CPMV–R5L. (D) SDS–PAGE of CPMV particles (10 µg) using a 4–12% Bis-Tris gel and western blotting using streptavidin–alkaline phosphatase to detect the N-terminal biotin tag of the R5 peptide. (E) Zeta potential of CPMV wild type, CPMV–R5L and CPMV–R5H formulations.

    Techniques Used: Labeling, Size-exclusion Chromatography, Dot Blot, Purification, Software, Nucleic Acid Electrophoresis, Agarose Gel Electrophoresis, SDS Page, Western Blot

    5) Product Images from "Maladaptive Sexual Behavior Following Concurrent Methamphetamine and Sexual Experience in Male Rats is Associated with Altered Neural Activity in Frontal Cortex"

    Article Title: Maladaptive Sexual Behavior Following Concurrent Methamphetamine and Sexual Experience in Male Rats is Associated with Altered Neural Activity in Frontal Cortex

    Journal: Neuropsychopharmacology

    doi: 10.1038/npp.2017.1

    Phosphorylated MAP kinase (pERK) is localized in CaMKII neurons in medial prefrontal cortex (mPFC) and orbitofrontal cortex (OFC). (a) Numbers of pERK-immunofluorescent neurons per mm 2 (mean±SEM) in mPFC subregions (ACA, PL, IL) and OFC in males (from experiment 2) pretreated with Saline/sex (saline), or Meth/sex (Meth) and removed from home cage (control; white bars; n =4 saline and n =4 Meth) or exposed to the female (female; black bars; n =4 saline and n =3 Meth). (b) Numbers of neurons co-labeled for pERK and CaMKII per mm 2 (mean±SEM). (c–k) Representative images illustrating the co-localization (c, f; arrows indicate dual labeled neurons) of pERK (green; d,g,j) and CaMKII (red; e,h) and the lack of co-localization (i; arrow heads indicate pERK single-labeled neurons) of pERK (green; j) and GAD (red; k) in PL of representative Meth+Sex Home Cage control (c–e), or Saline/sex exposed to female (f–k) males. Scale bar indicates 50 μm.
    Figure Legend Snippet: Phosphorylated MAP kinase (pERK) is localized in CaMKII neurons in medial prefrontal cortex (mPFC) and orbitofrontal cortex (OFC). (a) Numbers of pERK-immunofluorescent neurons per mm 2 (mean±SEM) in mPFC subregions (ACA, PL, IL) and OFC in males (from experiment 2) pretreated with Saline/sex (saline), or Meth/sex (Meth) and removed from home cage (control; white bars; n =4 saline and n =4 Meth) or exposed to the female (female; black bars; n =4 saline and n =3 Meth). (b) Numbers of neurons co-labeled for pERK and CaMKII per mm 2 (mean±SEM). (c–k) Representative images illustrating the co-localization (c, f; arrows indicate dual labeled neurons) of pERK (green; d,g,j) and CaMKII (red; e,h) and the lack of co-localization (i; arrow heads indicate pERK single-labeled neurons) of pERK (green; j) and GAD (red; k) in PL of representative Meth+Sex Home Cage control (c–e), or Saline/sex exposed to female (f–k) males. Scale bar indicates 50 μm.

    Techniques Used: Labeling

    Representative images of pERK expression in home cage control males (a,c,e,g) and following exposure to the conditioned aversive cue, ie, the female (b,d,f,h) in experiment 1. CeA, central amygdala; cc, corpus callosum; CPu, caudate putamen; LV, lateral ventricle; mPFC, medial prefrontal cortex; OFC, orbitofrontal cortex (l: lateral; m: medial); st, stria terminalis. Circle in h indicates location of CeA. Scale bar indicates 200 μm.
    Figure Legend Snippet: Representative images of pERK expression in home cage control males (a,c,e,g) and following exposure to the conditioned aversive cue, ie, the female (b,d,f,h) in experiment 1. CeA, central amygdala; cc, corpus callosum; CPu, caudate putamen; LV, lateral ventricle; mPFC, medial prefrontal cortex; OFC, orbitofrontal cortex (l: lateral; m: medial); st, stria terminalis. Circle in h indicates location of CeA. Scale bar indicates 200 μm.

    Techniques Used: Expressing

    6) Product Images from "Overexpression of platelet-derived growth factor receptor ? in breast cancer is associated with tumour progression"

    Article Title: Overexpression of platelet-derived growth factor receptor ? in breast cancer is associated with tumour progression

    Journal: Breast Cancer Research

    doi: 10.1186/bcr1304

    PDGFR-α expression in invasive breast carcinomas by immunohistochemistry (streptavidin-biotin-peroxidase). (a) Platelet-derived growth factor receptor α (PDGFR-α) expression in pericytes and smooth muscle cells of a blood vessel: internal control (original magnification × 200); (b) Absence of PDGFR-α expression in neoplastic cells (original magnification × 200); (c) PDGFR-α diffuse cytoplasmic expression in neoplastic cells (original magnification × 200; inset × 400); (d) Neoplastic cells showing strong and diffuse cytoplasmic PDGFR-α expression (original magnification × 400).
    Figure Legend Snippet: PDGFR-α expression in invasive breast carcinomas by immunohistochemistry (streptavidin-biotin-peroxidase). (a) Platelet-derived growth factor receptor α (PDGFR-α) expression in pericytes and smooth muscle cells of a blood vessel: internal control (original magnification × 200); (b) Absence of PDGFR-α expression in neoplastic cells (original magnification × 200); (c) PDGFR-α diffuse cytoplasmic expression in neoplastic cells (original magnification × 200; inset × 400); (d) Neoplastic cells showing strong and diffuse cytoplasmic PDGFR-α expression (original magnification × 400).

    Techniques Used: Expressing, Immunohistochemistry, Derivative Assay

    7) Product Images from "Follicular helper T cells are required for systemic autoimmunity"

    Article Title: Follicular helper T cells are required for systemic autoimmunity

    Journal: The Journal of Experimental Medicine

    doi: 10.1084/jem.20081886

    Lack of IL-21 does not affect the phenotype, T FH cell accumulation, or GC formation of Roquin san/san mice. (a) IgG ANAs in the serum of mice of the genotypes indicated, detected by immunofluorescence using Hep-2 substrate. Data are representative of three independent experiments ( n ≥ 5 mice per group). (b) Score of ANA staining intensity by confocal microscopy from sera taken from mice of the indicated genotypes. Data are representative of three independent experiments ( n ≥ 5 mice per group). (c) Basal serum total IgG, IgG1, and IgE measured by ELISA. Data are representative of two independent experiments ( n = 5 mice per group). (d) Lymph node and spleen weight in grams for mice of the indicated genotypes. Data are representative of two independent experiments ( n ≥ 5 per group). (e) Flow cytometric contour plots and dot plots of PD-1 high CXCR5 + CD4 + T FH cells and (f) GL-7 + CD95 + B220 + GC cells from mice of the indicated genotypes. Data are representative of two independent experiments ( n ≥ 5 mice per group). In e and f, the numbers in the plots represent percentages.
    Figure Legend Snippet: Lack of IL-21 does not affect the phenotype, T FH cell accumulation, or GC formation of Roquin san/san mice. (a) IgG ANAs in the serum of mice of the genotypes indicated, detected by immunofluorescence using Hep-2 substrate. Data are representative of three independent experiments ( n ≥ 5 mice per group). (b) Score of ANA staining intensity by confocal microscopy from sera taken from mice of the indicated genotypes. Data are representative of three independent experiments ( n ≥ 5 mice per group). (c) Basal serum total IgG, IgG1, and IgE measured by ELISA. Data are representative of two independent experiments ( n = 5 mice per group). (d) Lymph node and spleen weight in grams for mice of the indicated genotypes. Data are representative of two independent experiments ( n ≥ 5 per group). (e) Flow cytometric contour plots and dot plots of PD-1 high CXCR5 + CD4 + T FH cells and (f) GL-7 + CD95 + B220 + GC cells from mice of the indicated genotypes. Data are representative of two independent experiments ( n ≥ 5 mice per group). In e and f, the numbers in the plots represent percentages.

    Techniques Used: Mouse Assay, Immunofluorescence, Staining, Confocal Microscopy, Enzyme-linked Immunosorbent Assay, Flow Cytometry

    Spontaneous GC and T FH formation are corrected by loss of SAP in Roquin san/san mice. (a) CD4 + CXCR5 + PD-1 high T FH cells in unimmunized 10-wk-old Roquin san/san and Roquin san/san Sap −/− mice (P = 0.0056). Representative flow cytometric contour plots are shown (right). Data are representative of four independent experiments ( n = 4 per group). (b) B220 + GL-7 + CD95 + GC B cells in unimmunized 10-wk-old Roquin san/san Sap +/+ and Roquin san/san Sap −/− mice (P = 0.0007). Representative flow cytometric contour plots are shown (right). Data are representative of four independent experiments ( n = 4 per group). (c) Photomicrographs of frozen spleen sections from unimmunized 6-mo-old mice of the indicated genotypes stained with IgD (brown; all panels), PNA (blue; left), TCRβ (blue; middle), and PD-1 (blue; right). Bars, 200 µm.
    Figure Legend Snippet: Spontaneous GC and T FH formation are corrected by loss of SAP in Roquin san/san mice. (a) CD4 + CXCR5 + PD-1 high T FH cells in unimmunized 10-wk-old Roquin san/san and Roquin san/san Sap −/− mice (P = 0.0056). Representative flow cytometric contour plots are shown (right). Data are representative of four independent experiments ( n = 4 per group). (b) B220 + GL-7 + CD95 + GC B cells in unimmunized 10-wk-old Roquin san/san Sap +/+ and Roquin san/san Sap −/− mice (P = 0.0007). Representative flow cytometric contour plots are shown (right). Data are representative of four independent experiments ( n = 4 per group). (c) Photomicrographs of frozen spleen sections from unimmunized 6-mo-old mice of the indicated genotypes stained with IgD (brown; all panels), PNA (blue; left), TCRβ (blue; middle), and PD-1 (blue; right). Bars, 200 µm.

    Techniques Used: Mouse Assay, Flow Cytometry, Staining

    Th1 and Th2 cells are present in Roquin san/san mice in the absence of SAP and T FH cells, but not non-T FH effector cells, induce a GC response in wild-type mice. (a) Representative flow cytometric contour plots and (b) graphical analysis of GATA3 + CD44 high CD4 + and Tbet + CD44 high CD4 + cells in mice of the indicated genotypes. Data are representative of two independent experiments ( n ≥ 4 per group). (c) Representative dot plots of lymph node CD4 + PD-1 high CXCR5 + (left), Tbet + CD44 high CD4 + (middle), and GATA3 + CD44 high CD4 + (right) cells. (d) Experimental outline for adoptive transfer of Roquin san/san CD4 + CD45.2 CD44 high PD-1 high CXCR5 + or CD4 + CD45.2 CD44 high PD-1 − CXCR5 − T cells into CD45.1 C57BL/6 mice. (e) Flow cytometric contour plots and (f) dot plots of B220 + GL-7 + CD95 + GC B cells from CD45.1 C57BL/6 recipients 3 wk after adoptive transfer of the indicated cell type. Data were generated from three mice per group (**, P > 0.001). In a, d, and e, the numbers in the plots represent percentages.
    Figure Legend Snippet: Th1 and Th2 cells are present in Roquin san/san mice in the absence of SAP and T FH cells, but not non-T FH effector cells, induce a GC response in wild-type mice. (a) Representative flow cytometric contour plots and (b) graphical analysis of GATA3 + CD44 high CD4 + and Tbet + CD44 high CD4 + cells in mice of the indicated genotypes. Data are representative of two independent experiments ( n ≥ 4 per group). (c) Representative dot plots of lymph node CD4 + PD-1 high CXCR5 + (left), Tbet + CD44 high CD4 + (middle), and GATA3 + CD44 high CD4 + (right) cells. (d) Experimental outline for adoptive transfer of Roquin san/san CD4 + CD45.2 CD44 high PD-1 high CXCR5 + or CD4 + CD45.2 CD44 high PD-1 − CXCR5 − T cells into CD45.1 C57BL/6 mice. (e) Flow cytometric contour plots and (f) dot plots of B220 + GL-7 + CD95 + GC B cells from CD45.1 C57BL/6 recipients 3 wk after adoptive transfer of the indicated cell type. Data were generated from three mice per group (**, P > 0.001). In a, d, and e, the numbers in the plots represent percentages.

    Techniques Used: Mouse Assay, Flow Cytometry, Adoptive Transfer Assay, Generated

    Heterozygosity for Bcl6 reduces the magnitude of the GC response in Roquin +/+ and Roquin san/san mice and ameliorates the lupus-like phenotype of Roquin san/san mice. (a) Flow cytometric contour plots (left) and graphical analysis (right) of B220 + GL-7 + CD95 + GC B cells in 10-wk-old wild-type ( Bcl6 +/+ ) and Bcl6 +/− mice 8 d after SRBC immunization (P = 0.0011). Data are representative of four independent experiments ( n = 4 per group). (b) Flow cytometric contour plots (left) and dot plots (right) showing B220 + GL-7 + CD95 + GC B cells from 10-wk-old naive Roquin san/san Bcl6 +/+ and Roquin san/san Bcl6 +/− mice. Data are representative of five independent experiments ( n ≥ 4 per group). (c) Representative determination of serum IgG anti-dsDNA from 6-mo-old female Roquin +/+ Bcl6 +/+ , Roquin san/san Bcl6 +/+ , and Roquin san/san Bcl6 +/− mice, determined by immunofluorescence staining of C. luciliae substrate. Data shown reflect the occurrence ( n ≥ 6 mice per group); three out of six Roquin san/san Bcl6 +/− mice had low intensity staining (illustrated in the fourth panel from left), and three out of six were negative (illustrated in the third panel from left). (d) Representative images of kidney sections stained with H E (left) or viewed under an electron microscope (right) from 6-mo-old mice of the indicated genotypes. Roquin san/san animals show widespread mesangial proliferative lesions with moderate interstitial infiltrate. There are multiple electron-dense deposits (arrows). Histological changes in Roquin san/san Bcl6 +/− mice were mild, with occasional electron-dense deposits visible on electron microscopy in two individuals (far right). Images are representative ( n ≥ 4 per group). Bars: (H E) 100 µm in all panels; (electron microscopy) 5 µm in the Roquin +/+ Bcl6 +/+ and Roquin san/san Bcl6 +/+ panels, 2 µm in the left Roquin san/san Bcl6 +/− panels, and 10 µm in the right Roquin san/san Bcl6 +/− panel. (e) Nephritis severity score of 6-mo-old female Roquin +/+ , Roquin san/san , and Roquin san/san Bcl6 +/− mice as determined by histological analysis according to the criteria given in Table S1 (available at http://www.jem.org/cgi/content/full/jem.20081886/DC1 ). Horizontal bars indicate medians. In a, b, and e, each symbol represents one mouse; p-values are indicated on the graphs, and the numbers in the plots represent percentages.
    Figure Legend Snippet: Heterozygosity for Bcl6 reduces the magnitude of the GC response in Roquin +/+ and Roquin san/san mice and ameliorates the lupus-like phenotype of Roquin san/san mice. (a) Flow cytometric contour plots (left) and graphical analysis (right) of B220 + GL-7 + CD95 + GC B cells in 10-wk-old wild-type ( Bcl6 +/+ ) and Bcl6 +/− mice 8 d after SRBC immunization (P = 0.0011). Data are representative of four independent experiments ( n = 4 per group). (b) Flow cytometric contour plots (left) and dot plots (right) showing B220 + GL-7 + CD95 + GC B cells from 10-wk-old naive Roquin san/san Bcl6 +/+ and Roquin san/san Bcl6 +/− mice. Data are representative of five independent experiments ( n ≥ 4 per group). (c) Representative determination of serum IgG anti-dsDNA from 6-mo-old female Roquin +/+ Bcl6 +/+ , Roquin san/san Bcl6 +/+ , and Roquin san/san Bcl6 +/− mice, determined by immunofluorescence staining of C. luciliae substrate. Data shown reflect the occurrence ( n ≥ 6 mice per group); three out of six Roquin san/san Bcl6 +/− mice had low intensity staining (illustrated in the fourth panel from left), and three out of six were negative (illustrated in the third panel from left). (d) Representative images of kidney sections stained with H E (left) or viewed under an electron microscope (right) from 6-mo-old mice of the indicated genotypes. Roquin san/san animals show widespread mesangial proliferative lesions with moderate interstitial infiltrate. There are multiple electron-dense deposits (arrows). Histological changes in Roquin san/san Bcl6 +/− mice were mild, with occasional electron-dense deposits visible on electron microscopy in two individuals (far right). Images are representative ( n ≥ 4 per group). Bars: (H E) 100 µm in all panels; (electron microscopy) 5 µm in the Roquin +/+ Bcl6 +/+ and Roquin san/san Bcl6 +/+ panels, 2 µm in the left Roquin san/san Bcl6 +/− panels, and 10 µm in the right Roquin san/san Bcl6 +/− panel. (e) Nephritis severity score of 6-mo-old female Roquin +/+ , Roquin san/san , and Roquin san/san Bcl6 +/− mice as determined by histological analysis according to the criteria given in Table S1 (available at http://www.jem.org/cgi/content/full/jem.20081886/DC1 ). Horizontal bars indicate medians. In a, b, and e, each symbol represents one mouse; p-values are indicated on the graphs, and the numbers in the plots represent percentages.

    Techniques Used: Mouse Assay, Flow Cytometry, Immunofluorescence, Staining, Microscopy, Electron Microscopy

    8) Product Images from "Isolation of Single-Stranded DNA Aptamers That Distinguish Influenza Virus Hemagglutinin Subtype H1 from H5"

    Article Title: Isolation of Single-Stranded DNA Aptamers That Distinguish Influenza Virus Hemagglutinin Subtype H1 from H5

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0125060

    Western blot analysis using aptamers. Various amounts of GST-H1-HA1, GST-H5-HA1, and GST proteins were separated by SDS-PAGE, incubated with 5′-biotinylated aptamers, detected by streptavidin-HRP and ECL visualization (−, 0 μg; +, 1 μg; ++, 5 μg; +++, 10 μg).
    Figure Legend Snippet: Western blot analysis using aptamers. Various amounts of GST-H1-HA1, GST-H5-HA1, and GST proteins were separated by SDS-PAGE, incubated with 5′-biotinylated aptamers, detected by streptavidin-HRP and ECL visualization (−, 0 μg; +, 1 μg; ++, 5 μg; +++, 10 μg).

    Techniques Used: Western Blot, SDS Page, Incubation

    Affinity measurements of biotinylated ssDNA aptamers by SPR. (A) Biotinylated aptamers immobilized on an NLC sensor chip and interacting with various amounts of GST-H1-HA1. Equilibrium dissociation constants K D were calculated from association and dissociation rate constants (K D = k d /k a ) as 96.6 nM for ApI, 1.09 μM for ApII, and 293 nM for ApIII. (B) Interaction of 10 μM H1-HA1, H5-HA1, or GST with aptamers immobilized on an NLC sensor chip, as measured by SPR.
    Figure Legend Snippet: Affinity measurements of biotinylated ssDNA aptamers by SPR. (A) Biotinylated aptamers immobilized on an NLC sensor chip and interacting with various amounts of GST-H1-HA1. Equilibrium dissociation constants K D were calculated from association and dissociation rate constants (K D = k d /k a ) as 96.6 nM for ApI, 1.09 μM for ApII, and 293 nM for ApIII. (B) Interaction of 10 μM H1-HA1, H5-HA1, or GST with aptamers immobilized on an NLC sensor chip, as measured by SPR.

    Techniques Used: SPR Assay, Chromatin Immunoprecipitation

    Binding analysis of selected ssDNA aptamers by ELISA. (A) Affinity measurements of selected ssDNA aptamers to H1-HA1 by ELISA. Immobilized biotinylated ssDNA aptamers were incubated with increasing concentrations of GST-H1-HA1, and binding was detected with anti-GST antibody-HRP. The biotinylated ssDNA library was used as negative control (◊). Graphs were fitted to the Michaelis-Menten equation, and K d values were calculated as 64.76 ± 18.24 nM for ApI (●), 69.06 ± 12.34 nM for ApII (△), and 50.32 ± 14.07 nM for ApIII (■). (B) 100 nM GST-H1-HA1, GST-H5-HA1, or GST proteins incubated with biotinylated aptamers immobilized on streptavidin-coated plates to compare binding affinities.
    Figure Legend Snippet: Binding analysis of selected ssDNA aptamers by ELISA. (A) Affinity measurements of selected ssDNA aptamers to H1-HA1 by ELISA. Immobilized biotinylated ssDNA aptamers were incubated with increasing concentrations of GST-H1-HA1, and binding was detected with anti-GST antibody-HRP. The biotinylated ssDNA library was used as negative control (◊). Graphs were fitted to the Michaelis-Menten equation, and K d values were calculated as 64.76 ± 18.24 nM for ApI (●), 69.06 ± 12.34 nM for ApII (△), and 50.32 ± 14.07 nM for ApIII (■). (B) 100 nM GST-H1-HA1, GST-H5-HA1, or GST proteins incubated with biotinylated aptamers immobilized on streptavidin-coated plates to compare binding affinities.

    Techniques Used: Binding Assay, Enzyme-linked Immunosorbent Assay, Incubation, Negative Control

    9) Product Images from "Preclinical efficacy and safety of an anti-IL-1β vaccine for the treatment of type 2 diabetes"

    Article Title: Preclinical efficacy and safety of an anti-IL-1β vaccine for the treatment of type 2 diabetes

    Journal: Molecular Therapy. Methods & Clinical Development

    doi: 10.1038/mtm.2014.48

    Characterization of the detoxified vaccine antigen hIL-1b(D145K). ( a ) hIL-1RI binding. Serial dilutions of wild-type hIL-1β or hIL-1b(D145K) were mixed with a constant amount of 1 nmol/l biotinylated hIL-1β and applied to ELISA plates that had been coated with hIL-1RI. Obtained OD values were reciprocally transformed to express % receptor binding of wild-type hIL-1β or hIL-1b(D145K), respectively. ( b ) Formation of the ternary hIL-1RI-hIL-1β-hIL-1RAcP signaling complex. Wild-type human IL-1β (0.4 µg/ml) or hIL-1b(D145K) (100 µg/ml) were incubated with hIL-1RAcP (1 µg/ml) and applied to ELISA plates that had been coated with 1 µg/ml of human IL-1RI. Formation of the ternary complex was detected with a hIL-1RAcP-specific antibody. ( c ) hIL-1RII binding. Experimental conditions were as in a but with hIL-1RII coated on the ELISA plate. ( d ) IL-6 secretion. HeLa cells were incubated with serial dilutions of wild-type hIL-1β or hIL-1b (D145K). After an incubation of 4 hours, IL-6 was quantified in supernatants by Sandwich ELISA. ( e ) Cytopathic effect. A375 cells were incubated with serial dilutions of either wild-type hIL-1β or hIL-1b(D145K). After 7 days, viable adherent cells were stained with crystal violet and quantified by measuring optical densities at 600 nm. Shown are mean values from triplicate measurements ± SEM. ( f ) In vivo inflammatory activity. Groups of female C57BL/6 mice ( n = 4) were injected i.p. with 1 µg of either wild-type hIL-1β or hIL-1b(D145K) or s.c. with 25 µg of the conjugate vaccine Qβ-hIL-1b(D145K). Three hours after injection, sera were collected, and IL-6 levels were quantified with a Quantikine ELISA kit (* P
    Figure Legend Snippet: Characterization of the detoxified vaccine antigen hIL-1b(D145K). ( a ) hIL-1RI binding. Serial dilutions of wild-type hIL-1β or hIL-1b(D145K) were mixed with a constant amount of 1 nmol/l biotinylated hIL-1β and applied to ELISA plates that had been coated with hIL-1RI. Obtained OD values were reciprocally transformed to express % receptor binding of wild-type hIL-1β or hIL-1b(D145K), respectively. ( b ) Formation of the ternary hIL-1RI-hIL-1β-hIL-1RAcP signaling complex. Wild-type human IL-1β (0.4 µg/ml) or hIL-1b(D145K) (100 µg/ml) were incubated with hIL-1RAcP (1 µg/ml) and applied to ELISA plates that had been coated with 1 µg/ml of human IL-1RI. Formation of the ternary complex was detected with a hIL-1RAcP-specific antibody. ( c ) hIL-1RII binding. Experimental conditions were as in a but with hIL-1RII coated on the ELISA plate. ( d ) IL-6 secretion. HeLa cells were incubated with serial dilutions of wild-type hIL-1β or hIL-1b (D145K). After an incubation of 4 hours, IL-6 was quantified in supernatants by Sandwich ELISA. ( e ) Cytopathic effect. A375 cells were incubated with serial dilutions of either wild-type hIL-1β or hIL-1b(D145K). After 7 days, viable adherent cells were stained with crystal violet and quantified by measuring optical densities at 600 nm. Shown are mean values from triplicate measurements ± SEM. ( f ) In vivo inflammatory activity. Groups of female C57BL/6 mice ( n = 4) were injected i.p. with 1 µg of either wild-type hIL-1β or hIL-1b(D145K) or s.c. with 25 µg of the conjugate vaccine Qβ-hIL-1b(D145K). Three hours after injection, sera were collected, and IL-6 levels were quantified with a Quantikine ELISA kit (* P

    Techniques Used: Binding Assay, Enzyme-linked Immunosorbent Assay, Transformation Assay, Incubation, Sandwich ELISA, Staining, In Vivo, Activity Assay, Mouse Assay, Injection

    10) Product Images from "On the Role of Protein Disulfide Isomerase in the Retrograde Cell Transport of Secreted Phospholipases A2"

    Article Title: On the Role of Protein Disulfide Isomerase in the Retrograde Cell Transport of Secreted Phospholipases A2

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0120692

    Atx interacts with several domains of yPDI. (A) yPDI is a multi-domain protein. It consists of domains a, a’, b, b’ and c. Domain b’ is linked to domain a’ by a linker sequence x. Separate domains and their fusions, as schematically presented, were employed in affinity-labelling experiments using photo-reactive sulfo-SBED-Atx. Atx photo-probe was incubated with the wt yPDI (wt-PDI) (B) or its various parts (C) for 30 min, followed by the UV light-initiated reaction of the photo-probe with proteins in close contact, which were thus biotinylated. Samples were analysed on SDS-PAGE under reducing conditions, electro-transferred to a PVDF membrane. Biotin-containing bands on the PVDF membrane were detected using streptavidin-HRP. Labelling specificity in (B) was verified with the addition of 100-fold unlabelled Atx over sulfo-SBED-Atx (wt-PDI+). Black arrowheads in (A) point at those elements of yPDI which bind and react with sulfo-SBED-Atx. In (B) and (C) black arrowheads are pointing at biotinylated yPDI-structures. Positions on the membrane with biotinylated monomer and dimer of Atx are pointed at by white arrowheads. Experimental details are described in section Materials and Methods. Experiment was performed in triplicate.
    Figure Legend Snippet: Atx interacts with several domains of yPDI. (A) yPDI is a multi-domain protein. It consists of domains a, a’, b, b’ and c. Domain b’ is linked to domain a’ by a linker sequence x. Separate domains and their fusions, as schematically presented, were employed in affinity-labelling experiments using photo-reactive sulfo-SBED-Atx. Atx photo-probe was incubated with the wt yPDI (wt-PDI) (B) or its various parts (C) for 30 min, followed by the UV light-initiated reaction of the photo-probe with proteins in close contact, which were thus biotinylated. Samples were analysed on SDS-PAGE under reducing conditions, electro-transferred to a PVDF membrane. Biotin-containing bands on the PVDF membrane were detected using streptavidin-HRP. Labelling specificity in (B) was verified with the addition of 100-fold unlabelled Atx over sulfo-SBED-Atx (wt-PDI+). Black arrowheads in (A) point at those elements of yPDI which bind and react with sulfo-SBED-Atx. In (B) and (C) black arrowheads are pointing at biotinylated yPDI-structures. Positions on the membrane with biotinylated monomer and dimer of Atx are pointed at by white arrowheads. Experimental details are described in section Materials and Methods. Experiment was performed in triplicate.

    Techniques Used: Sequencing, Incubation, SDS Page

    11) Product Images from "Fasudil improves survival and promotes skeletal muscle development in a mouse model of spinal muscular atrophy"

    Article Title: Fasudil improves survival and promotes skeletal muscle development in a mouse model of spinal muscular atrophy

    Journal: BMC Medicine

    doi: 10.1186/1741-7015-10-24

    Fasudil increases endplate (EP) area in the tibialis anterior (TA) and transversus abdominis (TVA) muscles . Muscles were isolated from post-natal (P) day 21 untreated control littermates (n = 3), vehicle-treated Smn 2B/- (n = 4) and fasudil-treated Smn 2B/- mice (n = 3). ( A ) Representative images of TA and TVA EPs stained with α-bungarotoxin (BTX). Scale bars = 25 μm (TA) and 30 μm (TVA). ( B ) Quantification of EP area shows that fasudil-treated Smn 2B/- TA and TVA muscles display significantly larger EPs when compared to vehicle-treated Smn 2B/- muscles. (*** P
    Figure Legend Snippet: Fasudil increases endplate (EP) area in the tibialis anterior (TA) and transversus abdominis (TVA) muscles . Muscles were isolated from post-natal (P) day 21 untreated control littermates (n = 3), vehicle-treated Smn 2B/- (n = 4) and fasudil-treated Smn 2B/- mice (n = 3). ( A ) Representative images of TA and TVA EPs stained with α-bungarotoxin (BTX). Scale bars = 25 μm (TA) and 30 μm (TVA). ( B ) Quantification of EP area shows that fasudil-treated Smn 2B/- TA and TVA muscles display significantly larger EPs when compared to vehicle-treated Smn 2B/- muscles. (*** P

    Techniques Used: Isolation, Mouse Assay, Staining

    12) Product Images from "Microsatellite instability at a tetranucleotide repeat in type I endometrial carcinoma"

    Article Title: Microsatellite instability at a tetranucleotide repeat in type I endometrial carcinoma

    Journal: Journal of Experimental & Clinical Cancer Research : CR

    doi: 10.1186/1756-9966-27-88

    Examples of type I endometrial carcinoma with (A) loss of hMSH2 protein expression, (B) preservation of hMSH2 protein expression, (C) loss of hMLH1 protein expression, and (D) preservation of hMLH1 protein expression . Positive expression for hMSH2 or hMSH1 is noted in non-tumor cells. (A-D, X200).
    Figure Legend Snippet: Examples of type I endometrial carcinoma with (A) loss of hMSH2 protein expression, (B) preservation of hMSH2 protein expression, (C) loss of hMLH1 protein expression, and (D) preservation of hMLH1 protein expression . Positive expression for hMSH2 or hMSH1 is noted in non-tumor cells. (A-D, X200).

    Techniques Used: Expressing, Preserving

    13) Product Images from "Uptake of the antifungal cationic peptide Histatin 5 by Candida albicans Ssa2p requires binding to non-conventional sites within the ATPase domain"

    Article Title: Uptake of the antifungal cationic peptide Histatin 5 by Candida albicans Ssa2p requires binding to non-conventional sites within the ATPase domain

    Journal: Molecular Microbiology

    doi: 10.1111/j.1365-2958.2008.06480.x

    BHst 5 co-elutes with rSsa2p. Purified rSsa2p (5 μM) was mixed with excess BHst 5 (100 μM) for 30 min before loading onto Superose column. Fractions were collected (top) and subjected to 7.5% SDS-PAGE and silver-stained to detect rSsa2p (bottom left). rSsa2p polymer peak and monomer peak fractions were pooled to generate pool A (∼640 μl) and pool B (∼1300 μl) respectively. Both co-eluted BHst 5 and rSsa2 proteins from each pool were quantified by slot blot with corresponding linear loading standards (bottom right). Two slots of each pool were loaded (lane 4) corresponding to 25% and 5% of total volume in order to be within the linear range for quantification. Lane 1: rSsa2p loading standards (300, 150, 75, 37.5, 18.8, 9.4, 4.7 ng); lane 2: BHst 5 loading standards: (125, 100, 50, 25, 12.5, 6.3 ng); lane 3: BHst 5 co-eluted in pool A or pool B was quantified following detection by Streptavidin-HRP antibody; lane 4: quantification of rSsa2p was performed on the same membrane after being stripped and re-probed with Anti-Xpress antibody to detect rSsa2p. Co-eluted BHst 5 and rSsa2p under nucleotide treatment conditions were similarly quantified.
    Figure Legend Snippet: BHst 5 co-elutes with rSsa2p. Purified rSsa2p (5 μM) was mixed with excess BHst 5 (100 μM) for 30 min before loading onto Superose column. Fractions were collected (top) and subjected to 7.5% SDS-PAGE and silver-stained to detect rSsa2p (bottom left). rSsa2p polymer peak and monomer peak fractions were pooled to generate pool A (∼640 μl) and pool B (∼1300 μl) respectively. Both co-eluted BHst 5 and rSsa2 proteins from each pool were quantified by slot blot with corresponding linear loading standards (bottom right). Two slots of each pool were loaded (lane 4) corresponding to 25% and 5% of total volume in order to be within the linear range for quantification. Lane 1: rSsa2p loading standards (300, 150, 75, 37.5, 18.8, 9.4, 4.7 ng); lane 2: BHst 5 loading standards: (125, 100, 50, 25, 12.5, 6.3 ng); lane 3: BHst 5 co-eluted in pool A or pool B was quantified following detection by Streptavidin-HRP antibody; lane 4: quantification of rSsa2p was performed on the same membrane after being stripped and re-probed with Anti-Xpress antibody to detect rSsa2p. Co-eluted BHst 5 and rSsa2p under nucleotide treatment conditions were similarly quantified.

    Techniques Used: Purification, SDS Page, Staining, Dot Blot

    Design and expression of mutated Ssa2 proteins in C. albicans strains. Regions selected for site-directed mutagenesis within Hst 5 binding regions are based upon results of thermolysin limited digestion (green bars, also indicated as T1 and T2 regions) and peptide array (blue bar, also indicated as P1 region). Amino acids selected for Ala substitution are shown in red (top). Cell wall and cytoplasmic proteins were isolated from each strain (bottom): 25 μg of each protein was loaded on 7.5% SDS-PAGE gel and immunoblotted with Hsp70/Hsc70 monoclonal antibody. C. albicans wt cells display two distinct Hsp70 proteins – Ssa1p (lane 1, lower band) and Ssa2p (lane 1, upper band). Only Ssa1p is expressed in the ssa2 Δ knockout (lower band, lane 2), while the gene restoration strain ( ssa2 Δ /SSA2 ) expressed both Ssa2p and Ssa1p comparable with wt cells (lane 3). Gene restoration constructs of SSA2 with three to four amino acid substitutions (lane 4 to lane 7) expressed similar amounts of Ssa2 proteins as wt. However, significantly less mutant Ssa2 (334−338A3) protein was observed in cell wall fraction (lane 7, bottom).
    Figure Legend Snippet: Design and expression of mutated Ssa2 proteins in C. albicans strains. Regions selected for site-directed mutagenesis within Hst 5 binding regions are based upon results of thermolysin limited digestion (green bars, also indicated as T1 and T2 regions) and peptide array (blue bar, also indicated as P1 region). Amino acids selected for Ala substitution are shown in red (top). Cell wall and cytoplasmic proteins were isolated from each strain (bottom): 25 μg of each protein was loaded on 7.5% SDS-PAGE gel and immunoblotted with Hsp70/Hsc70 monoclonal antibody. C. albicans wt cells display two distinct Hsp70 proteins – Ssa1p (lane 1, lower band) and Ssa2p (lane 1, upper band). Only Ssa1p is expressed in the ssa2 Δ knockout (lower band, lane 2), while the gene restoration strain ( ssa2 Δ /SSA2 ) expressed both Ssa2p and Ssa1p comparable with wt cells (lane 3). Gene restoration constructs of SSA2 with three to four amino acid substitutions (lane 4 to lane 7) expressed similar amounts of Ssa2 proteins as wt. However, significantly less mutant Ssa2 (334−338A3) protein was observed in cell wall fraction (lane 7, bottom).

    Techniques Used: Expressing, Mutagenesis, Binding Assay, Peptide Microarray, Isolation, SDS Page, Knock-Out, Construct

    Mutations in Ssa2p Hst 5-binding epitopes reduce Hst 5 uptake and cytotoxicity. C. albicans constructs of SSA2 mutations were tested for sensitivity to Hst 5 (top) and ability to translocate Hst 5 to the cytosol (bottom). Candidacidal assays were performed by incubating cells with 15 μM Hst 5 for 1 h at 30°C, and percentage cell death was calculated compared with untreated cells. Cytosolic translocation of Biotin-Hst 5 (15 μM) was measured for each C. albicans construct using the same conditions as for candidacidal assays. Cytosolic proteins (10 μg) from each construct were subjected to 16% Tricine SDS-PAGE, immunoblotted with Streptavidin-HRP to detect BHst 5, and quantified. Control proteins from each construct are shown to verify equal protein loading. Mutations in Ssa2 (128−132A3) resulted in complete loss of killing and translocation (lane 4) equivalent to the ssa2 Δ knockout, while mutations in Ssa2 (334−338A3) (lane 7) had significant loss of cytotoxic and transport functions. Mutations in Ssa2 (131−135A3) and Ssa2 (150−156A4) (lane 5 and lane 6) resulted in mild to moderate loss of function.
    Figure Legend Snippet: Mutations in Ssa2p Hst 5-binding epitopes reduce Hst 5 uptake and cytotoxicity. C. albicans constructs of SSA2 mutations were tested for sensitivity to Hst 5 (top) and ability to translocate Hst 5 to the cytosol (bottom). Candidacidal assays were performed by incubating cells with 15 μM Hst 5 for 1 h at 30°C, and percentage cell death was calculated compared with untreated cells. Cytosolic translocation of Biotin-Hst 5 (15 μM) was measured for each C. albicans construct using the same conditions as for candidacidal assays. Cytosolic proteins (10 μg) from each construct were subjected to 16% Tricine SDS-PAGE, immunoblotted with Streptavidin-HRP to detect BHst 5, and quantified. Control proteins from each construct are shown to verify equal protein loading. Mutations in Ssa2 (128−132A3) resulted in complete loss of killing and translocation (lane 4) equivalent to the ssa2 Δ knockout, while mutations in Ssa2 (334−338A3) (lane 7) had significant loss of cytotoxic and transport functions. Mutations in Ssa2 (131−135A3) and Ssa2 (150−156A4) (lane 5 and lane 6) resulted in mild to moderate loss of function.

    Techniques Used: Binding Assay, Construct, Translocation Assay, SDS Page, Knock-Out

    Digestion products of rSsa2p are substantially altered by BHst 5 binding. Purified rSsa2p (10 μg) was incubated with 20 μg of BHst 5 in the presence of 2 mM ATP-Mg 2+ and cross-linker for 30 min at room temperature. Stabilized rSsa2p–BHst 5 complexes were isolated by SA beads pull-down. The complexes was then subjected to 5 μg ml −1 thermolysin digestion at 30°C for 1 h. Digestion fragments not associated with the complex binding site were removed by washing, and the remaining bead-retained rSsa2p–BHst 5 complex was recovered and half was subjected to 15% SDS-PAGE and detected by silver staining (lane 4). Ssa2p digestion products differed quite substantially in the presence of Hst 5. Two peptides within the ATPase domain were identified by MS analysis of a digestion fragment (arrow). Lane 1: rSsa2p (0.5 μg); lane 2: thermolysin (0.5 μg); lane 3: thermolysin digestion of rSsa2p without BHst 5; lane 4: thermolysin digestion products from rSsa2p–BHst 5 complex.
    Figure Legend Snippet: Digestion products of rSsa2p are substantially altered by BHst 5 binding. Purified rSsa2p (10 μg) was incubated with 20 μg of BHst 5 in the presence of 2 mM ATP-Mg 2+ and cross-linker for 30 min at room temperature. Stabilized rSsa2p–BHst 5 complexes were isolated by SA beads pull-down. The complexes was then subjected to 5 μg ml −1 thermolysin digestion at 30°C for 1 h. Digestion fragments not associated with the complex binding site were removed by washing, and the remaining bead-retained rSsa2p–BHst 5 complex was recovered and half was subjected to 15% SDS-PAGE and detected by silver staining (lane 4). Ssa2p digestion products differed quite substantially in the presence of Hst 5. Two peptides within the ATPase domain were identified by MS analysis of a digestion fragment (arrow). Lane 1: rSsa2p (0.5 μg); lane 2: thermolysin (0.5 μg); lane 3: thermolysin digestion of rSsa2p without BHst 5; lane 4: thermolysin digestion products from rSsa2p–BHst 5 complex.

    Techniques Used: Binding Assay, Purification, Incubation, Isolation, SDS Page, Silver Staining, Mass Spectrometry

    Expression and purification of full-length and truncated Ssa2 proteins. A. Schematic representation of the domain structure of Candida albicans Ssa2p and the design for truncated Ssa2 proteins. B. Each purified recombinant protein obtained from a yeast expression system (1 μg) was subjected to 10% SDS-PAGE and Coomassie blue-stained to visualize C. albicans full-length, rSsa2 1−630 , rSsa2 1−385 , rSsa2 386−645 proteins.
    Figure Legend Snippet: Expression and purification of full-length and truncated Ssa2 proteins. A. Schematic representation of the domain structure of Candida albicans Ssa2p and the design for truncated Ssa2 proteins. B. Each purified recombinant protein obtained from a yeast expression system (1 μg) was subjected to 10% SDS-PAGE and Coomassie blue-stained to visualize C. albicans full-length, rSsa2 1−630 , rSsa2 1−385 , rSsa2 386−645 proteins.

    Techniques Used: Expressing, Purification, Recombinant, SDS Page, Staining

    ATPase domain of Ssa2 is necessary for complex formation with BHst 5. A. Purified full length, rSsa2 1−630 , rSsa2 1−385 or rSsa2 386−645 (input) were incubated with Biotin-Hst 5 (BHst 5) for 2 h at 4°C with or without the presence of cross-linker to allow complex formation, and Streptavidin-agarose (SA) beads were added to the mixture. Resulting complexes were isolated by centrifugation of the SA beads and washed to remove non-specifically bound proteins. Recovered protein complexes were subjected to SDS-PAGE and detected by Western blotting with anti-Xpress-HRP monoclonal antibody and enhanced chemiluminescence (ECL). Lane 1: 10% of input Ssa2 proteins; lane 2: negative control, pull-down Ssa2 proteins without BHst 5; lane 3: pull-down Ssa2 proteins with BHst 5 without cross-linker; lane 4: pull-down Ssa2 proteins by BHst 5 with cross-linker . Complex formation was detected only with proteins containing the ATPase domain. B. A six fold molar excess of Ssa2p C-terminal anchor domain peptide 13mer (EPSNDGPTVEEVD) or 4mer (EEVD) was pre-incubated with BHst 5 for 30 min at 4°C prior to addition of full-length rSsa2p for the pull-down assay described in (A). No inhibition of interactions between Ssa2p and Hst 5 was observed with either peptide (+) compared with Hst 5 and Ssa2p alone (−).
    Figure Legend Snippet: ATPase domain of Ssa2 is necessary for complex formation with BHst 5. A. Purified full length, rSsa2 1−630 , rSsa2 1−385 or rSsa2 386−645 (input) were incubated with Biotin-Hst 5 (BHst 5) for 2 h at 4°C with or without the presence of cross-linker to allow complex formation, and Streptavidin-agarose (SA) beads were added to the mixture. Resulting complexes were isolated by centrifugation of the SA beads and washed to remove non-specifically bound proteins. Recovered protein complexes were subjected to SDS-PAGE and detected by Western blotting with anti-Xpress-HRP monoclonal antibody and enhanced chemiluminescence (ECL). Lane 1: 10% of input Ssa2 proteins; lane 2: negative control, pull-down Ssa2 proteins without BHst 5; lane 3: pull-down Ssa2 proteins with BHst 5 without cross-linker; lane 4: pull-down Ssa2 proteins by BHst 5 with cross-linker . Complex formation was detected only with proteins containing the ATPase domain. B. A six fold molar excess of Ssa2p C-terminal anchor domain peptide 13mer (EPSNDGPTVEEVD) or 4mer (EEVD) was pre-incubated with BHst 5 for 30 min at 4°C prior to addition of full-length rSsa2p for the pull-down assay described in (A). No inhibition of interactions between Ssa2p and Hst 5 was observed with either peptide (+) compared with Hst 5 and Ssa2p alone (−).

    Techniques Used: Purification, Incubation, Isolation, Centrifugation, SDS Page, Western Blot, Negative Control, Pull Down Assay, Inhibition

    14) Product Images from "?-Catenin Phosphorylated at Serine 45 Is Spatially Uncoupled from ?-Catenin Phosphorylated in the GSK3 Domain: Implications for Signaling"

    Article Title: ?-Catenin Phosphorylated at Serine 45 Is Spatially Uncoupled from ?-Catenin Phosphorylated in the GSK3 Domain: Implications for Signaling

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0010184

    N-terminally unphoshorylated β-catenin is a minor, nuclear form of β-catenin. A) Immunofluorescence of SW480 cells for total β-catenin or ABC (active β-catenin). Both monoclonal (mAb) and polyclonal (pAb) antibodies against total β-catenin produce a pan-cellular staining, while ABC predominantly stains nuclei. B) SW480 lysate (20 or 60 µg) was compared to known quantities of purified GST-β-catenin to estimate the relative abundance of total β-catenin to ABC. ABC is approximately 100 times less abundant than total β-catenin. Bars, 10 µm.
    Figure Legend Snippet: N-terminally unphoshorylated β-catenin is a minor, nuclear form of β-catenin. A) Immunofluorescence of SW480 cells for total β-catenin or ABC (active β-catenin). Both monoclonal (mAb) and polyclonal (pAb) antibodies against total β-catenin produce a pan-cellular staining, while ABC predominantly stains nuclei. B) SW480 lysate (20 or 60 µg) was compared to known quantities of purified GST-β-catenin to estimate the relative abundance of total β-catenin to ABC. ABC is approximately 100 times less abundant than total β-catenin. Bars, 10 µm.

    Techniques Used: Immunofluorescence, Staining, Purification

    β-catenin phosphorylated at S552 or S675 localizes to cell contacts and associates with E-cadherin. A) Cadherin-free β-catenin was isolated from an SW480 lysate by affinity precipitation with GST-ICAT, as previously described [48] . LC-MS/MS analysis identified S552 and S675 as two phosphorylation sites in β-catenin. Peptide abundance is plotted as a function of mass/charge (m/z). Identified phospho-sites are shown in red. B) Immunofluorescence of SW480 cells with antibodies to total β-catenin and phospho-S552 or -S675 reveals that phospho-S552 appears punctate, while phospho-S675 and total β-catenin localize uniformly to sites of cell-cell contact. C) Detergent-free lysis of membrane and cytosolic fractions from SW480/E-cad cells. D) Sucrose gradient density centrifugation of the detergent-free membrane preparation from SW480/E-cadherin cells. Note that phospho-S552 or -S675 float with cadherins. E) Cell surface biotinylation of SW480/E-cadherin cells followed by immunoprecipitation with the indicated antibodies and detection with streptavidin-HRP reveals that phospho-S552 and -S675 coimmunoprecipitate with a cell surface protein the same size as E-cadherin. Western blot for total β-catenin demonstrates immunoprecipitation efficiency. Mouse IgG (mIgG) and rabbit IgG (rIgG) controls are shown, as well as a positive control for E-cadherin (IP: E-cad). An LRP6 immunoprecipitation was also performed and neither phospho-S552, -S675 nor N-terminal phospho-forms of β-catenin coimmunoprecipitate with a surface protein of this size. Bars, 10 µm.
    Figure Legend Snippet: β-catenin phosphorylated at S552 or S675 localizes to cell contacts and associates with E-cadherin. A) Cadherin-free β-catenin was isolated from an SW480 lysate by affinity precipitation with GST-ICAT, as previously described [48] . LC-MS/MS analysis identified S552 and S675 as two phosphorylation sites in β-catenin. Peptide abundance is plotted as a function of mass/charge (m/z). Identified phospho-sites are shown in red. B) Immunofluorescence of SW480 cells with antibodies to total β-catenin and phospho-S552 or -S675 reveals that phospho-S552 appears punctate, while phospho-S675 and total β-catenin localize uniformly to sites of cell-cell contact. C) Detergent-free lysis of membrane and cytosolic fractions from SW480/E-cad cells. D) Sucrose gradient density centrifugation of the detergent-free membrane preparation from SW480/E-cadherin cells. Note that phospho-S552 or -S675 float with cadherins. E) Cell surface biotinylation of SW480/E-cadherin cells followed by immunoprecipitation with the indicated antibodies and detection with streptavidin-HRP reveals that phospho-S552 and -S675 coimmunoprecipitate with a cell surface protein the same size as E-cadherin. Western blot for total β-catenin demonstrates immunoprecipitation efficiency. Mouse IgG (mIgG) and rabbit IgG (rIgG) controls are shown, as well as a positive control for E-cadherin (IP: E-cad). An LRP6 immunoprecipitation was also performed and neither phospho-S552, -S675 nor N-terminal phospho-forms of β-catenin coimmunoprecipitate with a surface protein of this size. Bars, 10 µm.

    Techniques Used: Isolation, Affinity Precipitation, Liquid Chromatography with Mass Spectroscopy, Mass Spectrometry, Immunofluorescence, Lysis, Centrifugation, Immunoprecipitation, Western Blot, Positive Control

    N-terminally unphosphorylated β-catenin appears highly sensitive to cadherin expression. A) Control (i. and iii.) and E-cadherin-restored SW480 cells (ii. and iv.) were stained with antibodies against total β-catenin or ABC. Note that ABC appears selectively recruited to sites of cell-cell contact upon cadherin expression relative to the total pool of β-catenin. B) A detergent-free cytosolic fraction from SW480/E-cadherin cells was subjected to gel filtration chromatography. Peak fractions are marked with arrows. The presence of E-cadherin reduces the abundance of monomeric ABC relative to control cells (compare to Fig. 2A ). C) Detergent-free preparations of membrane and cytosolic fractions isolated from control and E-cadherin-restored SW480 cells. Note that E-cadherin appears to selectively recruit ABC to the membrane, leaving a portion of total β-catenin in the cytosol. A non-specific band (*) recognized by ABC [47] serves as a loading control. Bars, 10 µm.
    Figure Legend Snippet: N-terminally unphosphorylated β-catenin appears highly sensitive to cadherin expression. A) Control (i. and iii.) and E-cadherin-restored SW480 cells (ii. and iv.) were stained with antibodies against total β-catenin or ABC. Note that ABC appears selectively recruited to sites of cell-cell contact upon cadherin expression relative to the total pool of β-catenin. B) A detergent-free cytosolic fraction from SW480/E-cadherin cells was subjected to gel filtration chromatography. Peak fractions are marked with arrows. The presence of E-cadherin reduces the abundance of monomeric ABC relative to control cells (compare to Fig. 2A ). C) Detergent-free preparations of membrane and cytosolic fractions isolated from control and E-cadherin-restored SW480 cells. Note that E-cadherin appears to selectively recruit ABC to the membrane, leaving a portion of total β-catenin in the cytosol. A non-specific band (*) recognized by ABC [47] serves as a loading control. Bars, 10 µm.

    Techniques Used: Expressing, Staining, Filtration, Chromatography, Isolation

    Cytosolic N-terminally unphosphorylated β-catenin is primarily monomeric. A detergent-free cytosolic fraction from SW480 control (A) or α-catenin shRNA knock-down (B) cells was subjected to gel filtration chromatography and immunoblot analysis. A) ABC sizes as a monomer (compared to calibration standards (not shown) and purified β-catenin ( Fig. S1 ); peak fraction #42), while total β-catenin sizes evenly between monomer- and β-catenin/α-catenin dimer fractions (peak fraction #36). Peak fractions are marked with arrows. B–D) β-catenin dimer fraction is due to association with α-catenin. B) Size fractionation of cytosol from SW480 cells depleted of α-catenin by shRNA. C) Immunoblot of SW480 control and α-catenin knock down lysates. D) [ 35 S]-methionine/cysteine-labeling of SW480 cells and immunoprecipitation of α-catenin and β-catenin (1∶100, lanes 3 and 5; 1∶300, lanes 4 and 6). Autoradiogram reveals the major binding partner of β-catenin in this cell type is α-catenin. No antibody (lane 1) or non-immune control (lane 2) are also shown.
    Figure Legend Snippet: Cytosolic N-terminally unphosphorylated β-catenin is primarily monomeric. A detergent-free cytosolic fraction from SW480 control (A) or α-catenin shRNA knock-down (B) cells was subjected to gel filtration chromatography and immunoblot analysis. A) ABC sizes as a monomer (compared to calibration standards (not shown) and purified β-catenin ( Fig. S1 ); peak fraction #42), while total β-catenin sizes evenly between monomer- and β-catenin/α-catenin dimer fractions (peak fraction #36). Peak fractions are marked with arrows. B–D) β-catenin dimer fraction is due to association with α-catenin. B) Size fractionation of cytosol from SW480 cells depleted of α-catenin by shRNA. C) Immunoblot of SW480 control and α-catenin knock down lysates. D) [ 35 S]-methionine/cysteine-labeling of SW480 cells and immunoprecipitation of α-catenin and β-catenin (1∶100, lanes 3 and 5; 1∶300, lanes 4 and 6). Autoradiogram reveals the major binding partner of β-catenin in this cell type is α-catenin. No antibody (lane 1) or non-immune control (lane 2) are also shown.

    Techniques Used: shRNA, Filtration, Chromatography, Purification, Fractionation, Labeling, Immunoprecipitation, Binding Assay

    N-terminally phosphorylated β-catenin is largely not associated with E-cadherin. A) SW480 cell lysates were sequentially incubated with GST-cadherin cytoplasmic domain coupled-glutathione sepharose beads. Non-binding lane reflects 5% of the total unbound fraction. Note that while ABC can be affinity precipitated by GST-cadherin, β-catenin phosphorylated at S45, T41/S45, and S33/37/T41 bind to a lesser extent. B) Sucrose gradient density centrifugation of the detergent-free membrane preparation from SW480/E-cadherin cells reveals that N-terminally phosphorylated β-catenin does not appreciably co-fractionate (i.e., float) with cadherins. C) Immunoprecipitation of Axin or E-cadherin from SW480/E-cadherin lysates reveals that β-catenin phosphorylated at S33/37/T41 does not associate with E-cadherin. D) Cell surface biotinylation of SW480/E-cadherin cells followed by immunoprecipitation with the indicated antibodies and detection by streptavidin-HRP reveals that ABC coimmunoprecipitates with a cell surface protein the same size as E-cadherin, while β-catenin phosphorylated at S33/37/T41 does not. Western blot analysis for total β-catenin confirms that the same amount of β-catenin was immunopreciptated with antibodies against T41/S45 and S33/37/T41. Mouse IgG (mIgG) and rabbit IgG (rIgG) controls are shown, as well as a positive control for E-cadherin (IP: E-cad).
    Figure Legend Snippet: N-terminally phosphorylated β-catenin is largely not associated with E-cadherin. A) SW480 cell lysates were sequentially incubated with GST-cadherin cytoplasmic domain coupled-glutathione sepharose beads. Non-binding lane reflects 5% of the total unbound fraction. Note that while ABC can be affinity precipitated by GST-cadherin, β-catenin phosphorylated at S45, T41/S45, and S33/37/T41 bind to a lesser extent. B) Sucrose gradient density centrifugation of the detergent-free membrane preparation from SW480/E-cadherin cells reveals that N-terminally phosphorylated β-catenin does not appreciably co-fractionate (i.e., float) with cadherins. C) Immunoprecipitation of Axin or E-cadherin from SW480/E-cadherin lysates reveals that β-catenin phosphorylated at S33/37/T41 does not associate with E-cadherin. D) Cell surface biotinylation of SW480/E-cadherin cells followed by immunoprecipitation with the indicated antibodies and detection by streptavidin-HRP reveals that ABC coimmunoprecipitates with a cell surface protein the same size as E-cadherin, while β-catenin phosphorylated at S33/37/T41 does not. Western blot analysis for total β-catenin confirms that the same amount of β-catenin was immunopreciptated with antibodies against T41/S45 and S33/37/T41. Mouse IgG (mIgG) and rabbit IgG (rIgG) controls are shown, as well as a positive control for E-cadherin (IP: E-cad).

    Techniques Used: Incubation, Binding Assay, Centrifugation, Immunoprecipitation, Western Blot, Positive Control

    β-catenin phosphorylated at T41/S45 is spatially uncoupled from β-catenin phosphorylated at S33/37/T41. SW480 cells were co-stained with antibodies against β-catenin phosphorylated at S33/37/T41 or T41/S45 and ABC. Merged images reveal that phospho-S33/37/T41 appears excluded from the nucleus, while phospho-T41/S45 is largely nuclear, as is ABC. Bars, 10 µm.
    Figure Legend Snippet: β-catenin phosphorylated at T41/S45 is spatially uncoupled from β-catenin phosphorylated at S33/37/T41. SW480 cells were co-stained with antibodies against β-catenin phosphorylated at S33/37/T41 or T41/S45 and ABC. Merged images reveal that phospho-S33/37/T41 appears excluded from the nucleus, while phospho-T41/S45 is largely nuclear, as is ABC. Bars, 10 µm.

    Techniques Used: Staining

    15) Product Images from "Sulforaphane Improves Ischemia-Induced Detrusor Overactivity by Downregulating the Enhancement of Associated Endoplasmic Reticulum Stress, Autophagy, and Apoptosis in Rat Bladder"

    Article Title: Sulforaphane Improves Ischemia-Induced Detrusor Overactivity by Downregulating the Enhancement of Associated Endoplasmic Reticulum Stress, Autophagy, and Apoptosis in Rat Bladder

    Journal: Scientific Reports

    doi: 10.1038/srep36110

    Changes in bladder expression of ( A ) c-Nrf2, ( B ) Keap1, ( C ) n-Nrf2, ( D ) GRP78 (ER stress), ( E ) CHOP (ER stress), ( F ) caspase 3, ( G ) Beclin-1, ( H ) p62, ( I ) LC3 II, ( J ) muscarinic M 2 receptor, ( K ) muscarinic M 3 receptor, ( L ) purinergic P 2 X 1 receptor, ( M ) purinergic P 2 X 2 receptor, and ( N ) purinergic P 2 X 3 receptor in response to 2WBI, 4WBI, and treatments. All of the experiments were performed in three rats of each group. * p
    Figure Legend Snippet: Changes in bladder expression of ( A ) c-Nrf2, ( B ) Keap1, ( C ) n-Nrf2, ( D ) GRP78 (ER stress), ( E ) CHOP (ER stress), ( F ) caspase 3, ( G ) Beclin-1, ( H ) p62, ( I ) LC3 II, ( J ) muscarinic M 2 receptor, ( K ) muscarinic M 3 receptor, ( L ) purinergic P 2 X 1 receptor, ( M ) purinergic P 2 X 2 receptor, and ( N ) purinergic P 2 X 3 receptor in response to 2WBI, 4WBI, and treatments. All of the experiments were performed in three rats of each group. * p

    Techniques Used: Expressing

    Representative histological findings in response to bladder ischemia. The figure shows ( A – C ) GRP78 staining, ( D – F ) CHOP staining, ( G – I ) Beclin-1 staining, ( J – L ) LC3 II, and ( M – O ) TUNEL staining in the sham, 2WBI, and 4WBI groups. All images are magnified with x400. The scale bar is 50 μm. Respective statistic data are shown in ( P ) GRP78, ( Q ) CHOP, ( R ) Beclin-1, ( S ) LC3 II and ( T ) TUNEL stain (n = 6 in each test) in each group. * p
    Figure Legend Snippet: Representative histological findings in response to bladder ischemia. The figure shows ( A – C ) GRP78 staining, ( D – F ) CHOP staining, ( G – I ) Beclin-1 staining, ( J – L ) LC3 II, and ( M – O ) TUNEL staining in the sham, 2WBI, and 4WBI groups. All images are magnified with x400. The scale bar is 50 μm. Respective statistic data are shown in ( P ) GRP78, ( Q ) CHOP, ( R ) Beclin-1, ( S ) LC3 II and ( T ) TUNEL stain (n = 6 in each test) in each group. * p

    Techniques Used: Staining, TUNEL Assay

    16) Product Images from "Genome-wide methylation analysis reveals differentially methylated loci that are associated with an age-dependent increase in bovine fibroblast response to LPS"

    Article Title: Genome-wide methylation analysis reveals differentially methylated loci that are associated with an age-dependent increase in bovine fibroblast response to LPS

    Journal: BMC Genomics

    doi: 10.1186/s12864-017-3796-1

    Fibroblast Response to LPS in Young versus Old Cultures. Interleukin-8 ( a c ) and Interleukin-6 ( b d ) protein production and gene expression were measured in young and old dermal fibroblasts (n = 6 per group) at various time points post LPS. Protein production is presented in pg/ml following 36 h of LPS stimulation. Gene expression was measured by RT-qPCR and is presented as the change in cycles to threshold (dCT) of gene expression at 0, 2 8 h post LPS in comparison to β-actin. Fold change gene expression (Old > Young) is presented in parentheses above each significant time point. All values are displayed as mean (+/− SEM). Significance was measured using a paired Student’s t test at each time point and ** = P
    Figure Legend Snippet: Fibroblast Response to LPS in Young versus Old Cultures. Interleukin-8 ( a c ) and Interleukin-6 ( b d ) protein production and gene expression were measured in young and old dermal fibroblasts (n = 6 per group) at various time points post LPS. Protein production is presented in pg/ml following 36 h of LPS stimulation. Gene expression was measured by RT-qPCR and is presented as the change in cycles to threshold (dCT) of gene expression at 0, 2 8 h post LPS in comparison to β-actin. Fold change gene expression (Old > Young) is presented in parentheses above each significant time point. All values are displayed as mean (+/− SEM). Significance was measured using a paired Student’s t test at each time point and ** = P

    Techniques Used: Expressing, Quantitative RT-PCR

    17) Product Images from "Mouse Bestrophin-2 Is a Bona fide Cl− Channel"

    Article Title: Mouse Bestrophin-2 Is a Bona fide Cl− Channel

    Journal: The Journal of General Physiology

    doi: 10.1085/jgp.200409031

    Localization of mBest2 in the plasma membrane of HEK-293 cells. Lanes 1 and 2: streptavidin labeling of immunoprecipitated proteins. Nontransfected (lane 2) or mBest2-transfected (lane 1) HEK-293 cells were labeled with membrane-impermeant NHS-LC-biotin and lysed. mBest2 was immunoprecipitated with A7116 antibody, run on SDS-PAGE, and transferred to nitrocellulose. The nitrocellulose was then probed with HRP-conjugated streptavidin. A 64kD band was observed in transfected, but not nontransfected cells. Lanes 3–5: Western blots. Lane 3: total extract from mBest2-transfected cells was probed with antibody to α-actin. Lanes 4 and 5: the extract from mBest2-transfected cells was incubated with streptavidin-beads to collect biotinylated proteins. Biotinylated proteins were then probed with antibody to α-actin (Lane 4) or B4947 mBest2-specific antibody (Lane 5).
    Figure Legend Snippet: Localization of mBest2 in the plasma membrane of HEK-293 cells. Lanes 1 and 2: streptavidin labeling of immunoprecipitated proteins. Nontransfected (lane 2) or mBest2-transfected (lane 1) HEK-293 cells were labeled with membrane-impermeant NHS-LC-biotin and lysed. mBest2 was immunoprecipitated with A7116 antibody, run on SDS-PAGE, and transferred to nitrocellulose. The nitrocellulose was then probed with HRP-conjugated streptavidin. A 64kD band was observed in transfected, but not nontransfected cells. Lanes 3–5: Western blots. Lane 3: total extract from mBest2-transfected cells was probed with antibody to α-actin. Lanes 4 and 5: the extract from mBest2-transfected cells was incubated with streptavidin-beads to collect biotinylated proteins. Biotinylated proteins were then probed with antibody to α-actin (Lane 4) or B4947 mBest2-specific antibody (Lane 5).

    Techniques Used: Labeling, Immunoprecipitation, Transfection, SDS Page, Western Blot, Incubation

    18) Product Images from "Development of a Sphingosylphosphorylcholine Detection System Using RNA Aptamers"

    Article Title: Development of a Sphingosylphosphorylcholine Detection System Using RNA Aptamers

    Journal: Molecules

    doi: 10.3390/molecules15085742

    ELAA. (a) Sensitivity of the m012 aptamer for biotinylated SPC. The amount of biotinylated SPC captured by immobilized m012 was shown as the absorbance at 405 nm. The experiment was repeated three times with each data point measured in duplicates, and a representative result is shown. (b) Competitive ELAA using m012 and biotinylated and unmodified SPC. The biotinylated and serially diluted unmodified SPC were added to the m012-immobilized plate. The amount of biotinylated SPC captured by the immobilized m012 was shown as the absorbance at 405 nm. The experiment was repeated three times with each data point measured in duplicates, and a representative result is shown. (c) Specificity of the m012 aptamer for SPC and S1P. The amount of the biotinylated m012 reacted with the immobilized biotinylated SPC and S1P was shown as the absorbance at 405 nm. The experiment was repeated three times in triplicates, and a representative result is shown. Error bars show standard deviations.
    Figure Legend Snippet: ELAA. (a) Sensitivity of the m012 aptamer for biotinylated SPC. The amount of biotinylated SPC captured by immobilized m012 was shown as the absorbance at 405 nm. The experiment was repeated three times with each data point measured in duplicates, and a representative result is shown. (b) Competitive ELAA using m012 and biotinylated and unmodified SPC. The biotinylated and serially diluted unmodified SPC were added to the m012-immobilized plate. The amount of biotinylated SPC captured by the immobilized m012 was shown as the absorbance at 405 nm. The experiment was repeated three times with each data point measured in duplicates, and a representative result is shown. (c) Specificity of the m012 aptamer for SPC and S1P. The amount of the biotinylated m012 reacted with the immobilized biotinylated SPC and S1P was shown as the absorbance at 405 nm. The experiment was repeated three times in triplicates, and a representative result is shown. Error bars show standard deviations.

    Techniques Used:

    Bindinganalysis of the m012 aptamer to SPC and S1P using SPR. The biotinylated SPC and S1P were immobilized on each flow cell at similar amounts (~250 RU). 400 nM aptamer was injected over the ligands for 2 min.
    Figure Legend Snippet: Bindinganalysis of the m012 aptamer to SPC and S1P using SPR. The biotinylated SPC and S1P were immobilized on each flow cell at similar amounts (~250 RU). 400 nM aptamer was injected over the ligands for 2 min.

    Techniques Used: SPR Assay, Flow Cytometry, Injection

    19) Product Images from "Glypican-1 Mediates Both Prion Protein Lipid Raft Association and Disease Isoform Formation"

    Article Title: Glypican-1 Mediates Both Prion Protein Lipid Raft Association and Disease Isoform Formation

    Journal: PLoS Pathogens

    doi: 10.1371/journal.ppat.1000666

    Depletion of glypican-1 stimulates the endocytosis of PrP C . SH-SY5Y cells expressing wild type PrP C were treated with either control or glypican-1 siRNA and then incubated for 60 h. Cells were surface biotinylated and incubated in OptiMEM for 1 h at 37°C. Where indicated, cells were treated with trypsin to remove remaining cell surface PrP C . Cells were then lysed and total PrP C immunoprecipitated from the sample using antibody 3F4. ( A ) Samples were subjected to western blot analysis and the biotin-labelled PrP C fraction was detected with peroxidase-conjugated streptavidin. ( B ) Densitometric analysis (mean ± s.e.m.) of multiple blots from three separate experiments in (A) is shown. ( C ) Expression of glypican-1 (in lysate samples treated with heparinase I and heparinase III) and PrP C in the cell lysates from (A). β-actin was used as a loading control. ( D ) SH-SY5Y cells expressing PrP C were treated with either control siRNA or glypican-1 siRNA and then allowed to reach confluence for 48 h. Cells were subsequently surface biotinylated and incubated in OptiMEM for 1 h at 37°C. Cells were homogenised in the presence of 1% (v/v) Triton X-100 and subjected to buoyant sucrose density gradient centrifugation. ( E ) Densitometric analysis of the proportion of total PrP C present in the detergent soluble fractions of the plasma membrane after siRNA treatment from three independent experiments. ( F ) SH-SY5Y cells expressing PrP C were seeded onto glass coverslips and grown to 50% confluency. Cells were fixed, and then incubated with anti-PrP antibody 3F4 and a glypican-1 polyclonal antibody. Finally, cells were incubated with Alexa488-conjugated rabbit anti-mouse and Alexa594-conjugated goat anti-rabbit antibodies and viewed using a DeltaVision Optical Restoration Microscopy System. Images are representative of three individual experiments. Scale bars equal 10 µm. * P
    Figure Legend Snippet: Depletion of glypican-1 stimulates the endocytosis of PrP C . SH-SY5Y cells expressing wild type PrP C were treated with either control or glypican-1 siRNA and then incubated for 60 h. Cells were surface biotinylated and incubated in OptiMEM for 1 h at 37°C. Where indicated, cells were treated with trypsin to remove remaining cell surface PrP C . Cells were then lysed and total PrP C immunoprecipitated from the sample using antibody 3F4. ( A ) Samples were subjected to western blot analysis and the biotin-labelled PrP C fraction was detected with peroxidase-conjugated streptavidin. ( B ) Densitometric analysis (mean ± s.e.m.) of multiple blots from three separate experiments in (A) is shown. ( C ) Expression of glypican-1 (in lysate samples treated with heparinase I and heparinase III) and PrP C in the cell lysates from (A). β-actin was used as a loading control. ( D ) SH-SY5Y cells expressing PrP C were treated with either control siRNA or glypican-1 siRNA and then allowed to reach confluence for 48 h. Cells were subsequently surface biotinylated and incubated in OptiMEM for 1 h at 37°C. Cells were homogenised in the presence of 1% (v/v) Triton X-100 and subjected to buoyant sucrose density gradient centrifugation. ( E ) Densitometric analysis of the proportion of total PrP C present in the detergent soluble fractions of the plasma membrane after siRNA treatment from three independent experiments. ( F ) SH-SY5Y cells expressing PrP C were seeded onto glass coverslips and grown to 50% confluency. Cells were fixed, and then incubated with anti-PrP antibody 3F4 and a glypican-1 polyclonal antibody. Finally, cells were incubated with Alexa488-conjugated rabbit anti-mouse and Alexa594-conjugated goat anti-rabbit antibodies and viewed using a DeltaVision Optical Restoration Microscopy System. Images are representative of three individual experiments. Scale bars equal 10 µm. * P

    Techniques Used: Expressing, Incubation, Immunoprecipitation, Western Blot, Gradient Centrifugation, Microscopy

    Depletion of glypican-1 does not affect cell division or surface levels of PrP C . ( A ) ScN2a cells were seeded into 96 well plates and treated with transfection reagent only or incubated with either control siRNA or one of the four siRNAs targeted to glypican-1. Those experiments exceeding 48 h were dosed with a second treatment of the indicated siRNAs. Cells were then rinsed with PBS and fixed with 70% (v/v) ethanol. Plates were allowed to dry, stained with Hoescht 33342 and the fluorescence measured. ( B ) ScN2a cells were treated with control or glypican-1 siRNA. After 96 h, cell monolayers were labelled with a membrane impermeable biotin reagent. Biotin-labelled cell surface PrP was detected by immunoprecipitation using 6D11 and subsequent immunoblotting using HRP-conjugated streptavidin. Total PrP and PK-resistant PrP (PrP Sc ) were detected by immunoblotting using antibody 6D11. ( C ) Densitometric analysis of the proportion of the relative amount of biotinylated cell surface PrP in the absence or presence of glypican-1 siRNA from three independent experiments.
    Figure Legend Snippet: Depletion of glypican-1 does not affect cell division or surface levels of PrP C . ( A ) ScN2a cells were seeded into 96 well plates and treated with transfection reagent only or incubated with either control siRNA or one of the four siRNAs targeted to glypican-1. Those experiments exceeding 48 h were dosed with a second treatment of the indicated siRNAs. Cells were then rinsed with PBS and fixed with 70% (v/v) ethanol. Plates were allowed to dry, stained with Hoescht 33342 and the fluorescence measured. ( B ) ScN2a cells were treated with control or glypican-1 siRNA. After 96 h, cell monolayers were labelled with a membrane impermeable biotin reagent. Biotin-labelled cell surface PrP was detected by immunoprecipitation using 6D11 and subsequent immunoblotting using HRP-conjugated streptavidin. Total PrP and PK-resistant PrP (PrP Sc ) were detected by immunoblotting using antibody 6D11. ( C ) Densitometric analysis of the proportion of the relative amount of biotinylated cell surface PrP in the absence or presence of glypican-1 siRNA from three independent experiments.

    Techniques Used: Transfection, Incubation, Staining, Fluorescence, Immunoprecipitation

    Heparin stimulates the endocytosis of PrP C in a dose-dependent manner and displaces it from detergent-resistant lipid rafts. ( A ) SH-SY5Y cells expressing PrP C were surface biotinylated and then incubated for 1 h at 37°C in the absence or presence of various concentrations of heparin diluted in OptiMEM. Prior to lysis cells were, where indicated, incubated with trypsin to digest cell surface PrP C . Cells were then lysed and PrP C immunoprecipitated from the sample using antibody 3F4. Samples were subjected to SDS PAGE and western blot analysis and the biotin-labelled PrP C detected with peroxidase-conjugated streptavidin. ( B ) Densitometric analysis of multiple blots from four separate experiments as described in (A) is shown. ( C ) SH-SY5Y cells expressing PrP C were surface biotinylated and then incubated in the absence or presence of 50 µM heparin prepared in OptiMEM for 1 h at 37°C. Cells were homogenised in the presence of 1% (v/v) Triton X-100 and subjected to buoyant sucrose density gradient centrifugation. PrP C was immunoprecipitated from equal volumes of each gradient fraction using 3F4 and subjected to SDS-PAGE and western blotting. The gradient fractions from both the untreated and heparin treated cells were analysed on the same SDS gel and immunoblotted under identical conditions. The biotin-labelled PrP C was detected with peroxidase-conjugated streptavidin. Flotillin-1 and transferrin receptor (TfR) were detected by immunoblotting as markers for DRM and detergent-soluble fractions, respectively. ( D ) Densitometric analysis of the proportion of total PrP C in the detergent soluble fractions of the plasma membrane. ( E ) Untransfected SH-SY5Y cells and SH-SY5Y cells expressing either PrP C or PrP-TM were grown to confluence and then incubated for 1 h in the presence or absence of 50 µM heparin prepared in OptiMEM. Media samples were collected and concentrated and cells harvested and lysed. Cell lysate samples were immunoblotted for PrP C using antibody 3F4, with β-actin used as a loading control. ( F ) Quantification of PrP C and PrP-TM levels after treatment of cells with heparin as in (E). Experiments were performed in triplicate and repeated on three occasions. * P
    Figure Legend Snippet: Heparin stimulates the endocytosis of PrP C in a dose-dependent manner and displaces it from detergent-resistant lipid rafts. ( A ) SH-SY5Y cells expressing PrP C were surface biotinylated and then incubated for 1 h at 37°C in the absence or presence of various concentrations of heparin diluted in OptiMEM. Prior to lysis cells were, where indicated, incubated with trypsin to digest cell surface PrP C . Cells were then lysed and PrP C immunoprecipitated from the sample using antibody 3F4. Samples were subjected to SDS PAGE and western blot analysis and the biotin-labelled PrP C detected with peroxidase-conjugated streptavidin. ( B ) Densitometric analysis of multiple blots from four separate experiments as described in (A) is shown. ( C ) SH-SY5Y cells expressing PrP C were surface biotinylated and then incubated in the absence or presence of 50 µM heparin prepared in OptiMEM for 1 h at 37°C. Cells were homogenised in the presence of 1% (v/v) Triton X-100 and subjected to buoyant sucrose density gradient centrifugation. PrP C was immunoprecipitated from equal volumes of each gradient fraction using 3F4 and subjected to SDS-PAGE and western blotting. The gradient fractions from both the untreated and heparin treated cells were analysed on the same SDS gel and immunoblotted under identical conditions. The biotin-labelled PrP C was detected with peroxidase-conjugated streptavidin. Flotillin-1 and transferrin receptor (TfR) were detected by immunoblotting as markers for DRM and detergent-soluble fractions, respectively. ( D ) Densitometric analysis of the proportion of total PrP C in the detergent soluble fractions of the plasma membrane. ( E ) Untransfected SH-SY5Y cells and SH-SY5Y cells expressing either PrP C or PrP-TM were grown to confluence and then incubated for 1 h in the presence or absence of 50 µM heparin prepared in OptiMEM. Media samples were collected and concentrated and cells harvested and lysed. Cell lysate samples were immunoblotted for PrP C using antibody 3F4, with β-actin used as a loading control. ( F ) Quantification of PrP C and PrP-TM levels after treatment of cells with heparin as in (E). Experiments were performed in triplicate and repeated on three occasions. * P

    Techniques Used: Expressing, Incubation, Lysis, Immunoprecipitation, SDS Page, Western Blot, Gradient Centrifugation, SDS-Gel

    Depletion of glypican-1 inhibits the association of PrP-TM with DRMs. SH-SY5Y cells expressing PrP-TM were treated with either control siRNA or siRNA targeted to glypican-1 and then allowed to reach confluence for 48 h. Cells were subsequently surface biotinylated and incubated in OptiMEM for 1 h at 37°C in the presence of Tyrphostin A23 to block endocytosis. The media was removed and the cells washed in phosphate-buffered saline prior to homogenisation in the presence of 1% (v/v) Triton X-100 and subjected to buoyant sucrose density gradient centrifugation. ( A ) Quantification of glypican-1 and PrP-TM expression in cell lysates. To detect glypican-1, cell lysate samples were treated with heparinase I and heparinase III prior to electrophoresis as described in the materials and methods section. ( B ) PrP-TM was immunoprecipitated from equal volumes of each gradient fraction using 3F4 and then subjected to western blotting with peroxidase-conjugated streptavidin. Flotillin-1 and transferrin receptor (TfR) were detected by immunoblotting as markers for DRM and detergent-soluble fractions, respectively. ( C ) Densitometric analysis of the proportion of total PrP-TM present in the detergent soluble fractions of the plasma membrane after siRNA treatment from multiple blots from three independent experiments. * P
    Figure Legend Snippet: Depletion of glypican-1 inhibits the association of PrP-TM with DRMs. SH-SY5Y cells expressing PrP-TM were treated with either control siRNA or siRNA targeted to glypican-1 and then allowed to reach confluence for 48 h. Cells were subsequently surface biotinylated and incubated in OptiMEM for 1 h at 37°C in the presence of Tyrphostin A23 to block endocytosis. The media was removed and the cells washed in phosphate-buffered saline prior to homogenisation in the presence of 1% (v/v) Triton X-100 and subjected to buoyant sucrose density gradient centrifugation. ( A ) Quantification of glypican-1 and PrP-TM expression in cell lysates. To detect glypican-1, cell lysate samples were treated with heparinase I and heparinase III prior to electrophoresis as described in the materials and methods section. ( B ) PrP-TM was immunoprecipitated from equal volumes of each gradient fraction using 3F4 and then subjected to western blotting with peroxidase-conjugated streptavidin. Flotillin-1 and transferrin receptor (TfR) were detected by immunoblotting as markers for DRM and detergent-soluble fractions, respectively. ( C ) Densitometric analysis of the proportion of total PrP-TM present in the detergent soluble fractions of the plasma membrane after siRNA treatment from multiple blots from three independent experiments. * P

    Techniques Used: Expressing, Incubation, Blocking Assay, Homogenization, Gradient Centrifugation, Electrophoresis, Immunoprecipitation, Western Blot

    The association of PrP-TM with DRMs is disrupted by treatment of cells with either heparin or bacterial PI-PLC. SH-SY5Y cells expressing PrP-TM were surface biotinylated and then ( A ) incubated in the absence or presence of 50 µM heparin prepared in OptiMEM for 1 h at 37°C or ( B ) incubated in the absence or presence of 1 U/ml bacterial PI-PLC for 1 h at 4°C. Cells were homogenised in the presence of 1% (v/v) Triton X-100 and subjected to buoyant sucrose density gradient centrifugation. PrP-TM was immunoprecipitated from equal volumes of each gradient fraction using 3F4 and subjected to western blotting. The biotin-labelled PrP-TM fraction was detected with peroxidase-conjugated streptavidin. Flotillin-1 and transferrin receptor (TfR) were detected by immunoblotting as markers for DRM and detergent-soluble fractions respectively. ( C ) Densitometric analysis of the proportion of total PrP-TM present in the detergent soluble fractions of the plasma membrane after heparin and PI-PLC treatment. Experiments were performed in triplicate and repeated on three occasions. * P
    Figure Legend Snippet: The association of PrP-TM with DRMs is disrupted by treatment of cells with either heparin or bacterial PI-PLC. SH-SY5Y cells expressing PrP-TM were surface biotinylated and then ( A ) incubated in the absence or presence of 50 µM heparin prepared in OptiMEM for 1 h at 37°C or ( B ) incubated in the absence or presence of 1 U/ml bacterial PI-PLC for 1 h at 4°C. Cells were homogenised in the presence of 1% (v/v) Triton X-100 and subjected to buoyant sucrose density gradient centrifugation. PrP-TM was immunoprecipitated from equal volumes of each gradient fraction using 3F4 and subjected to western blotting. The biotin-labelled PrP-TM fraction was detected with peroxidase-conjugated streptavidin. Flotillin-1 and transferrin receptor (TfR) were detected by immunoblotting as markers for DRM and detergent-soluble fractions respectively. ( C ) Densitometric analysis of the proportion of total PrP-TM present in the detergent soluble fractions of the plasma membrane after heparin and PI-PLC treatment. Experiments were performed in triplicate and repeated on three occasions. * P

    Techniques Used: Planar Chromatography, Expressing, Incubation, Gradient Centrifugation, Immunoprecipitation, Western Blot

    20) Product Images from "Quail egg homogenate alleviates food allergy induced eosinophilic esophagitis like disease through modulating PAR-2 transduction pathway in peanut sensitized mice"

    Article Title: Quail egg homogenate alleviates food allergy induced eosinophilic esophagitis like disease through modulating PAR-2 transduction pathway in peanut sensitized mice

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-19309-x

    Oral quail egg treatment reduced PPE specific IgE, IgG1, and the level release of allergic mediators (n = 10). ( A ) PPE and quail egg specific IgE levels ( B ) PPE and quail egg specific IgG1 levels; Allergic mediators: ( C ) histamine, ( D ) tryptase; ( E ) ECP. Results are expressed as mean ± SEM. * P
    Figure Legend Snippet: Oral quail egg treatment reduced PPE specific IgE, IgG1, and the level release of allergic mediators (n = 10). ( A ) PPE and quail egg specific IgE levels ( B ) PPE and quail egg specific IgG1 levels; Allergic mediators: ( C ) histamine, ( D ) tryptase; ( E ) ECP. Results are expressed as mean ± SEM. * P

    Techniques Used:

    21) Product Images from "Chemical labelling for visualizing native AMPA receptors in live neurons"

    Article Title: Chemical labelling for visualizing native AMPA receptors in live neurons

    Journal: Nature Communications

    doi: 10.1038/ncomms14850

    Chemical labelling of native AMPARs in cultured neurons. ( a ) Western blot analyses of cultured neurons after labelling using CAM reagents. Cultured cortical neurons were treated with 1 μM of CAM2(OG) , CAM2(Fl) , CAM2(Ax488) , or CAM2(Bt) in the absence or presence of 10 μM NBQX in serum free Neurobasal medium. The cell lysates were analyzed by western blot using anti-Fl/OG, anti-Ax488, or anti-GluA2 antibody, or by biotin blotting using streptavidin-HRP. * indicates biotinylated proteins endogenously expressed in the neurons. ( b ) Effect of competitive antagonists for glutamate receptors on chemical labelling of native AMPARs in cultured neurons. Western blot analyses of cultured neurons after labelling using CAM reagents are shown. Cultured cortical neurons were treated with 1 μM of CAM2(OG) in the absence or presence of 10 μM NBQX, 10 μM AP5, or 10 μM (2S,4R)-4-methyl glutamate (4MG) to examine selective labelling of AMPARs among the ionotropic glutamate receptor family. ( c ) Analyses of labelled proteins in cultured neurons by immunoprecipitation using anti-Fl/OG antibody. Chemical labelling was conducted with the same procedure described in a . After lysis of labelled cultured neurons by CAM2(Fl) , the cell lysate was immunoprecipitated with anti-Fl/OG antibodies. The immunoprecipitates were analyzed by western blot using glutamate receptor-specific antibodies. ( d – h ) Confocal imaging of cultured neurons after labelling using CAM reagents. Cultured hippocampal neurons labelled with 1 μM CAM2(Fl) were fixed, permeabilized and immunostained using anti-MAP2 (in d , f ), anti-GluA2 (in e , g ) or anti-PSD95 antibody (in h ). White square ROIs indicated in d , e are expanded in f , g , respectively. Scale bars, 10 μm ( d , e ) and 5 μm ( f – h ). Full blots for b and c are shown in Supplementary Fig. 22 .
    Figure Legend Snippet: Chemical labelling of native AMPARs in cultured neurons. ( a ) Western blot analyses of cultured neurons after labelling using CAM reagents. Cultured cortical neurons were treated with 1 μM of CAM2(OG) , CAM2(Fl) , CAM2(Ax488) , or CAM2(Bt) in the absence or presence of 10 μM NBQX in serum free Neurobasal medium. The cell lysates were analyzed by western blot using anti-Fl/OG, anti-Ax488, or anti-GluA2 antibody, or by biotin blotting using streptavidin-HRP. * indicates biotinylated proteins endogenously expressed in the neurons. ( b ) Effect of competitive antagonists for glutamate receptors on chemical labelling of native AMPARs in cultured neurons. Western blot analyses of cultured neurons after labelling using CAM reagents are shown. Cultured cortical neurons were treated with 1 μM of CAM2(OG) in the absence or presence of 10 μM NBQX, 10 μM AP5, or 10 μM (2S,4R)-4-methyl glutamate (4MG) to examine selective labelling of AMPARs among the ionotropic glutamate receptor family. ( c ) Analyses of labelled proteins in cultured neurons by immunoprecipitation using anti-Fl/OG antibody. Chemical labelling was conducted with the same procedure described in a . After lysis of labelled cultured neurons by CAM2(Fl) , the cell lysate was immunoprecipitated with anti-Fl/OG antibodies. The immunoprecipitates were analyzed by western blot using glutamate receptor-specific antibodies. ( d – h ) Confocal imaging of cultured neurons after labelling using CAM reagents. Cultured hippocampal neurons labelled with 1 μM CAM2(Fl) were fixed, permeabilized and immunostained using anti-MAP2 (in d , f ), anti-GluA2 (in e , g ) or anti-PSD95 antibody (in h ). White square ROIs indicated in d , e are expanded in f , g , respectively. Scale bars, 10 μm ( d , e ) and 5 μm ( f – h ). Full blots for b and c are shown in Supplementary Fig. 22 .

    Techniques Used: Cell Culture, Western Blot, Chick Chorioallantoic Membrane Assay, Immunoprecipitation, Lysis, Imaging

    22) Product Images from "Sequence Variation in Promoter of Ica1 Gene, Which Encodes Protein Implicated in Type 1 Diabetes, Causes Transcription Factor Autoimmune Regulator (AIRE) to Increase Its Binding and Down-regulate Expression *"

    Article Title: Sequence Variation in Promoter of Ica1 Gene, Which Encodes Protein Implicated in Type 1 Diabetes, Causes Transcription Factor Autoimmune Regulator (AIRE) to Increase Its Binding and Down-regulate Expression *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M111.319020

    ICA69 autoantigen expression in the human thymus ( A and B ), spleen ( C ), and lymph node ( D ) denoted with arrows . A , a microphotograph of ICA69 using the ICA69 mAb and alkaline phosphatase immunoenzymatic detection. Staining of a paraformaldehyde-fixed section of human thymus with the ICA69 mAb shows selective staining for a cell subtype that is present predominantly in the medulla (×200). B , ICA69-specific staining disappears after absorbing out the ICA69 mAb with the recombinant human ICA69 molecule against which this mAb was produced (×200). C and D , immunostaining of spleen (×400) and lymph node (×200) frozen sections after incubation with the ICA69 mAb detected with the streptavidin-biotin-peroxidase method and the aminoethylcarbazole substrate ( red ) and counterstaining with hematoxylin.
    Figure Legend Snippet: ICA69 autoantigen expression in the human thymus ( A and B ), spleen ( C ), and lymph node ( D ) denoted with arrows . A , a microphotograph of ICA69 using the ICA69 mAb and alkaline phosphatase immunoenzymatic detection. Staining of a paraformaldehyde-fixed section of human thymus with the ICA69 mAb shows selective staining for a cell subtype that is present predominantly in the medulla (×200). B , ICA69-specific staining disappears after absorbing out the ICA69 mAb with the recombinant human ICA69 molecule against which this mAb was produced (×200). C and D , immunostaining of spleen (×400) and lymph node (×200) frozen sections after incubation with the ICA69 mAb detected with the streptavidin-biotin-peroxidase method and the aminoethylcarbazole substrate ( red ) and counterstaining with hematoxylin.

    Techniques Used: Expressing, Staining, Recombinant, Produced, Immunostaining, Incubation

    23) Product Images from "Genomic analysis of between-cow variation in dermal fibroblast response to lipopolysaccharide"

    Article Title: Genomic analysis of between-cow variation in dermal fibroblast response to lipopolysaccharide

    Journal: Journal of dairy science

    doi: 10.3168/jds.2011-5251

    Dermal fibroblasts cells isolated from mid-lactating cows were exposed to LPS (100 ng/mL) for 24 h and the media concentrations of IL-8 (A) and IL-6 (B) were determined by ELISA. The data are from fibroblast cells of six separate cows, with each bar in the chart representing the mean ± S.E of triplicate aliquots of fibroblasts recovered separately from cryopreservation. Based on the IL-8 and IL-6 response to LPS, the lowest responding fibroblast culture (*LR array ) and one of the highest responding fibroblast cultures (†HR array ) were selected for microarray-based gene expression analysis.
    Figure Legend Snippet: Dermal fibroblasts cells isolated from mid-lactating cows were exposed to LPS (100 ng/mL) for 24 h and the media concentrations of IL-8 (A) and IL-6 (B) were determined by ELISA. The data are from fibroblast cells of six separate cows, with each bar in the chart representing the mean ± S.E of triplicate aliquots of fibroblasts recovered separately from cryopreservation. Based on the IL-8 and IL-6 response to LPS, the lowest responding fibroblast culture (*LR array ) and one of the highest responding fibroblast cultures (†HR array ) were selected for microarray-based gene expression analysis.

    Techniques Used: Isolation, Enzyme-linked Immunosorbent Assay, Microarray, Expressing

    24) Product Images from "Colonic epithelial cells are a major site of macrophage inflammatory protein 3? (MIP-3?) production in normal colon and inflammatory bowel disease"

    Article Title: Colonic epithelial cells are a major site of macrophage inflammatory protein 3? (MIP-3?) production in normal colon and inflammatory bowel disease

    Journal: Gut

    doi:

    Kinetics of increased steady state macrophage inflammatory protein (MIP)-3α mRNA levels in cytokine stimulated Caco-2 and HT-29 cells. (A) Confluent Caco-2 cell monolayers were exposed to recombinant interleukin (IL)-1β (1 ng/ml) for 0–24 hours. Steady state levels of MIP-3α mRNA and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA were then determined by reverse transcription-polymerase chain reaction (RT-PCR). (B) Confluent HT-29 cell monolayers were exposed to recombinant tumour necrosis factor α (TNF-α 10 ng/ml) for 0–24 hours. Steady state levels of MIP-3α mRNA and GAPDH mRNA were determined by RT-PCR.
    Figure Legend Snippet: Kinetics of increased steady state macrophage inflammatory protein (MIP)-3α mRNA levels in cytokine stimulated Caco-2 and HT-29 cells. (A) Confluent Caco-2 cell monolayers were exposed to recombinant interleukin (IL)-1β (1 ng/ml) for 0–24 hours. Steady state levels of MIP-3α mRNA and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA were then determined by reverse transcription-polymerase chain reaction (RT-PCR). (B) Confluent HT-29 cell monolayers were exposed to recombinant tumour necrosis factor α (TNF-α 10 ng/ml) for 0–24 hours. Steady state levels of MIP-3α mRNA and GAPDH mRNA were determined by RT-PCR.

    Techniques Used: Recombinant, Reverse Transcription Polymerase Chain Reaction

    Time course of macrophage inflammatory protein (MIP)-3α protein production by cytokine stimulated Caco-2 and HT-29 cells. (A) Confluent Caco-2 cell monolayers were incubated with or without recombinant interleukin (IL)-1β (1 ng/ml) for 0–24 hours. Accumulated MIP-3α protein levels in conditioned media from non-stimulated cells or cells treated with IL-1β were then measured by ELISA. Data are expressed as mean (SD) (n=4). (B) Confluent HT-29 cell monolayers were incubated with or without recombinant tumour necrosis factor α (TNF-α 10 ng/ml) for 0–24 h. Accumulated MIP-3α protein levels in conditioned media from non-stimulated cells or cells treated with TNF-α were then measured by ELISA. Data are expressed as mean (SD) (n=4).
    Figure Legend Snippet: Time course of macrophage inflammatory protein (MIP)-3α protein production by cytokine stimulated Caco-2 and HT-29 cells. (A) Confluent Caco-2 cell monolayers were incubated with or without recombinant interleukin (IL)-1β (1 ng/ml) for 0–24 hours. Accumulated MIP-3α protein levels in conditioned media from non-stimulated cells or cells treated with IL-1β were then measured by ELISA. Data are expressed as mean (SD) (n=4). (B) Confluent HT-29 cell monolayers were incubated with or without recombinant tumour necrosis factor α (TNF-α 10 ng/ml) for 0–24 h. Accumulated MIP-3α protein levels in conditioned media from non-stimulated cells or cells treated with TNF-α were then measured by ELISA. Data are expressed as mean (SD) (n=4).

    Techniques Used: Incubation, Recombinant, Enzyme-linked Immunosorbent Assay

    Enterocytes are the primary site of macrophage inflammatory protein (MIP)-3α production in normal colon and inflammatory bowel disease. (A, B) Normal colon. MIP-3α immunoreactivity is principally associated with colonic epithelial cells (B). Minimal staining of enterocytes was observed in normal colon using an isotype control monoclonal IgG 1 antibody (A). (C, D) Ulcerative colitis. Similar to normal colon, MIP-3α immunoreactivity in ulcerative colitis was mainly associated with epithelial cells (D). Little staining of epithelial cells was seen in ulcerative colitis tissue samples stained with the isotype control monoclonal antibody (C). (E, F) Crohn’s disease. Again, in colonic tissues from patients with Crohn’s disease MIP-3α immunoreactivity was primarily observed in epithelial cells (F). In contrast, Crohn’s disease sections treated with the isotype control monoclonal antibody showed little immunostaining (E). (G, H) Antibody controls. Minimal staining of epithelial cells was seen in Crohn’s disease tissue samples when the primary antibody was omitted (G). As expected, no staining of Crohn’s disease tissues was observed on omission of both the primary and secondary antibodies (H). Magnification for each panel, ×200.
    Figure Legend Snippet: Enterocytes are the primary site of macrophage inflammatory protein (MIP)-3α production in normal colon and inflammatory bowel disease. (A, B) Normal colon. MIP-3α immunoreactivity is principally associated with colonic epithelial cells (B). Minimal staining of enterocytes was observed in normal colon using an isotype control monoclonal IgG 1 antibody (A). (C, D) Ulcerative colitis. Similar to normal colon, MIP-3α immunoreactivity in ulcerative colitis was mainly associated with epithelial cells (D). Little staining of epithelial cells was seen in ulcerative colitis tissue samples stained with the isotype control monoclonal antibody (C). (E, F) Crohn’s disease. Again, in colonic tissues from patients with Crohn’s disease MIP-3α immunoreactivity was primarily observed in epithelial cells (F). In contrast, Crohn’s disease sections treated with the isotype control monoclonal antibody showed little immunostaining (E). (G, H) Antibody controls. Minimal staining of epithelial cells was seen in Crohn’s disease tissue samples when the primary antibody was omitted (G). As expected, no staining of Crohn’s disease tissues was observed on omission of both the primary and secondary antibodies (H). Magnification for each panel, ×200.

    Techniques Used: Staining, Immunostaining

    Macrophage inflammatory protein (MIP)-3α mRNA and protein levels are elevated in Crohn’s disease. Colonic tissue samples were obtained from patients undergoing colectomy for ulcerative colitis or Crohn’s colitis and from patients undergoing colectomy for colon cancer to serve as non-inflamed controls. (A) Total RNA derived from each tissue was reverse transcribed and subjected to real time quantitative reverse transcription-polymerase chain reaction (RT-PCR) to evaluate MIP-3α and GAPDH mRNA levels. Results are expressed as the number of MIP-3α amplicons per 10 4 glyceraldehyde-3-phosphate dehydrogenase (GAPDH) amplicons. The horizontal bar represents the mean value for each group. (B) Tissue homogenates from each specimen were subjected to ELISA to quantify MIP-3α protein levels. Results are expressed as ng of MIP-3α per mg of total homogenate protein. The horizontal bar represents the mean value for each group.
    Figure Legend Snippet: Macrophage inflammatory protein (MIP)-3α mRNA and protein levels are elevated in Crohn’s disease. Colonic tissue samples were obtained from patients undergoing colectomy for ulcerative colitis or Crohn’s colitis and from patients undergoing colectomy for colon cancer to serve as non-inflamed controls. (A) Total RNA derived from each tissue was reverse transcribed and subjected to real time quantitative reverse transcription-polymerase chain reaction (RT-PCR) to evaluate MIP-3α and GAPDH mRNA levels. Results are expressed as the number of MIP-3α amplicons per 10 4 glyceraldehyde-3-phosphate dehydrogenase (GAPDH) amplicons. The horizontal bar represents the mean value for each group. (B) Tissue homogenates from each specimen were subjected to ELISA to quantify MIP-3α protein levels. Results are expressed as ng of MIP-3α per mg of total homogenate protein. The horizontal bar represents the mean value for each group.

    Techniques Used: Derivative Assay, Reverse Transcription Polymerase Chain Reaction, Enzyme-linked Immunosorbent Assay

    Macrophage inflammatory protein (MIP)-3α protein production by primary epithelial cells is increased during inflammatory bowel disease. Epithelial cells were isolated from tissue samples obtained from patients undergoing colectomy for ulcerative colitis (UC) or Crohn’s disease (CD), and from tissue samples obtained from patients undergoing colectomy for colon cancer to serve as non-inflamed controls. Homogenates of each tissue were prepared and subjected to ELISA to quantify MIP-3α protein levels. Results are expressed as ng of MIP-3α per mg of total homogenate protein. The horizontal bar represents the mean value for each group.
    Figure Legend Snippet: Macrophage inflammatory protein (MIP)-3α protein production by primary epithelial cells is increased during inflammatory bowel disease. Epithelial cells were isolated from tissue samples obtained from patients undergoing colectomy for ulcerative colitis (UC) or Crohn’s disease (CD), and from tissue samples obtained from patients undergoing colectomy for colon cancer to serve as non-inflamed controls. Homogenates of each tissue were prepared and subjected to ELISA to quantify MIP-3α protein levels. Results are expressed as ng of MIP-3α per mg of total homogenate protein. The horizontal bar represents the mean value for each group.

    Techniques Used: Isolation, Enzyme-linked Immunosorbent Assay

    Human gastrointestinal epithelial cell lines produce macrophage inflammatory protein (MIP)-3α in response to cytokine stimulation. (A) Confluent Caco-2 cell monolayers were exposed to recombinant interleukin (IL)-1β (0.01–100 ng/ml) for 24 hours. MIP-3α protein levels in conditioned media were then measured by ELISA. (B) Confluent HT-29 cell monolayers were exposed to recombinant tumour necrosis factor α (TNF-α 0.01–100 ng/ml) for 24 hours and MIP-3α protein levels in conditioned media were then measured by ELISA. Data are expressed as mean (SEM) (n=4). *p
    Figure Legend Snippet: Human gastrointestinal epithelial cell lines produce macrophage inflammatory protein (MIP)-3α in response to cytokine stimulation. (A) Confluent Caco-2 cell monolayers were exposed to recombinant interleukin (IL)-1β (0.01–100 ng/ml) for 24 hours. MIP-3α protein levels in conditioned media were then measured by ELISA. (B) Confluent HT-29 cell monolayers were exposed to recombinant tumour necrosis factor α (TNF-α 0.01–100 ng/ml) for 24 hours and MIP-3α protein levels in conditioned media were then measured by ELISA. Data are expressed as mean (SEM) (n=4). *p

    Techniques Used: Recombinant, Enzyme-linked Immunosorbent Assay

    25) Product Images from "Real-time in vivo detection of biomaterial-induced reactive oxygen species"

    Article Title: Real-time in vivo detection of biomaterial-induced reactive oxygen species

    Journal: Biomaterials

    doi: 10.1016/j.biomaterials.2010.11.029

    Characterization of myeloperoxidase expression
    Figure Legend Snippet: Characterization of myeloperoxidase expression

    Techniques Used: Expressing

    26) Product Images from "Functional Mapping of Community Acquired Respiratory Distress Syndrome (CARDS) Toxin of Mycoplasma pneumoniae Defines Regions with ADP-ribosyltransferase, Vacuolating, and Receptor-Binding Activities"

    Article Title: Functional Mapping of Community Acquired Respiratory Distress Syndrome (CARDS) Toxin of Mycoplasma pneumoniae Defines Regions with ADP-ribosyltransferase, Vacuolating, and Receptor-Binding Activities

    Journal: Molecular microbiology

    doi: 10.1111/mmi.12680

    Induction of vacuolization in HeLa cells by carboxy region of CARDS toxin A) Equimolar (~140, 350 and 700 pmol) concentrations of FL, trypsin cleaved (TC), carboxy and amino terminal region truncated (CARDS 249 , 178 CARDS, 264 CARDS and 308 CARDS) proteins were added to 60% confluent monolayer cultures of HeLa cells as indicated in Experimental Procedures and observed at 12 h to 60h. Representative images of vacuoles generated by 140 pmol concentration of proteins at 24 h are shown. Vacuoles were generated in HeLa cells by FL CARDS toxin, TC-CARDS toxin and carboxy region retaining CARDS toxin derivatives and not by CARDS 249 . B) Quantification of numbers of CARDS toxin-induced vacuoles in HeLa cells incubated with FL and carboxy region variants of CARDS toxin ( 178 CARDS, 264 CARDS and 308 CARDS) at 24 h. As indicated in section A, cells were incubated with CARDS toxin and its derivatives and vacuoles per cell were counted and compared as described in Experimental Procedures. C) Quantification of percentage of HeLa cells with CARDS-toxin induced vacuoles. As indicated in panel A, cells were incubated 12–60 h with CARDS toxin and its derivatives (140 pmol) and the number of vacuolated cells in random fields was calculated as described in Experimental Procedures.
    Figure Legend Snippet: Induction of vacuolization in HeLa cells by carboxy region of CARDS toxin A) Equimolar (~140, 350 and 700 pmol) concentrations of FL, trypsin cleaved (TC), carboxy and amino terminal region truncated (CARDS 249 , 178 CARDS, 264 CARDS and 308 CARDS) proteins were added to 60% confluent monolayer cultures of HeLa cells as indicated in Experimental Procedures and observed at 12 h to 60h. Representative images of vacuoles generated by 140 pmol concentration of proteins at 24 h are shown. Vacuoles were generated in HeLa cells by FL CARDS toxin, TC-CARDS toxin and carboxy region retaining CARDS toxin derivatives and not by CARDS 249 . B) Quantification of numbers of CARDS toxin-induced vacuoles in HeLa cells incubated with FL and carboxy region variants of CARDS toxin ( 178 CARDS, 264 CARDS and 308 CARDS) at 24 h. As indicated in section A, cells were incubated with CARDS toxin and its derivatives and vacuoles per cell were counted and compared as described in Experimental Procedures. C) Quantification of percentage of HeLa cells with CARDS-toxin induced vacuoles. As indicated in panel A, cells were incubated 12–60 h with CARDS toxin and its derivatives (140 pmol) and the number of vacuolated cells in random fields was calculated as described in Experimental Procedures.

    Techniques Used: Generated, Concentration Assay, Incubation

    N-terminal region of CARDS toxin houses ADPRT activity A) Schematic representation of the ART activity of CARDS toxin and its derivatives. As indicated in Experimental Procedures, FL CARDS toxin, its N-terminal derivatives (truncations) and APDRT-conserved amino acid site-directed mutagenized (SDM) proteins (Arg 10→Ala , His 36→Ala and Glu 132→Ala ) were analyzed for ADPRT activity, and the results are depicted. PT-S1 indicates pertussis toxin S1 catalytic subunit; FL indicates full length CARDS toxin; B) Comparison of ADP-ribosylating activity of FL and different carboxy region-deleted derivatives of CARDS toxin. Purified FL CARDS toxin and its carboxy region-truncated derivatives were individually incubated with HeLa cell lysate in the presence of 32 P NAD as indicated in Experimental Procedures, and the radiolabeled ADP-ribosylated proteins were detected. Each number indicates the truncated proteins depicted in Fig. 2A; CB represents carrier buffer. The two solid black arrows (~50 kDa) indicate the target ADP-ribosylated proteins of CARDS toxin, and the dotted arrow indicates the inherent ADP-ribosylated protein of mammalian cells.
    Figure Legend Snippet: N-terminal region of CARDS toxin houses ADPRT activity A) Schematic representation of the ART activity of CARDS toxin and its derivatives. As indicated in Experimental Procedures, FL CARDS toxin, its N-terminal derivatives (truncations) and APDRT-conserved amino acid site-directed mutagenized (SDM) proteins (Arg 10→Ala , His 36→Ala and Glu 132→Ala ) were analyzed for ADPRT activity, and the results are depicted. PT-S1 indicates pertussis toxin S1 catalytic subunit; FL indicates full length CARDS toxin; B) Comparison of ADP-ribosylating activity of FL and different carboxy region-deleted derivatives of CARDS toxin. Purified FL CARDS toxin and its carboxy region-truncated derivatives were individually incubated with HeLa cell lysate in the presence of 32 P NAD as indicated in Experimental Procedures, and the radiolabeled ADP-ribosylated proteins were detected. Each number indicates the truncated proteins depicted in Fig. 2A; CB represents carrier buffer. The two solid black arrows (~50 kDa) indicate the target ADP-ribosylated proteins of CARDS toxin, and the dotted arrow indicates the inherent ADP-ribosylated protein of mammalian cells.

    Techniques Used: Activity Assay, Purification, Incubation

    Binding and internalization of CARDS toxin ADPRT mutants HeLa cell monolayers were treated with 10 µg (≈140 pmol) of FL CARDS toxin or ADPRT mutants (Arg 10→Ala , His 36→Ala and Glu 132→Ala ) at 37°C for 1h. Cells were fixed, permeabilized with 0.1% Triton X-100 and incubated with anti-CARDS toxin rabbit primary antibodies. Subsequently, cells were treated with AlexaFluor-633 conjugated goat (polyclonal) anti-rabbit secondary antibodies to detect the cellular binding and trafficking of CARDS toxin by confocal laser scanning microscopy. Cell nuclei were stained with DAPI (4',6-diamidino-2-phenylindole dihydrochloride).
    Figure Legend Snippet: Binding and internalization of CARDS toxin ADPRT mutants HeLa cell monolayers were treated with 10 µg (≈140 pmol) of FL CARDS toxin or ADPRT mutants (Arg 10→Ala , His 36→Ala and Glu 132→Ala ) at 37°C for 1h. Cells were fixed, permeabilized with 0.1% Triton X-100 and incubated with anti-CARDS toxin rabbit primary antibodies. Subsequently, cells were treated with AlexaFluor-633 conjugated goat (polyclonal) anti-rabbit secondary antibodies to detect the cellular binding and trafficking of CARDS toxin by confocal laser scanning microscopy. Cell nuclei were stained with DAPI (4',6-diamidino-2-phenylindole dihydrochloride).

    Techniques Used: Binding Assay, Incubation, Confocal Laser Scanning Microscopy, Staining

    Carboxy region of CARDS toxin mediates binding and internalization A) Comparison of binding and internalization of FL, selected C-terminal truncated CARDS toxin derivatives and 178 CARDS toxin. FL toxin and its derivatives were purified as indicated in Experimental Procedures and biotin labeled. Binding : Proteins were incubated with HeLa cells for 1 h at 4°C. Subsequently, cells were washed and bound proteins were quantified as indicated in Experimental Procedures. Internalization : After 1 h incubation at 4°C, bound proteins (FL, selected C-terminal truncated CARDS toxin derivatives and 178 CARDS toxin) were removed by washing, and cells were shifted to 37°C for 1 h with fresh medium. Then, cells were treated with MESNA to remove surface-bound, biotin-labeled CARDS toxin and its derivatives, and internalized proteins were quantified after permeabilizing cells as indicated in Experimental Procedures. Binding and internalization results of FL and variants of CARDS toxin are shown by closed and open symbols respectively. FL - square, 178 CARDS - circle, CARDS 249 - triangle and CARDS 550 -diamond. B) Endocytosis of 178 CARDS toxin and CARDS 550 toxin. HeLa cells were treated with 140 pmol of 178 CARDS toxin or CARDS 550 toxin for 30 min at 4°C, washed to remove unbound toxins and shifted to 37°C for 1 h. Cell preparations were fixed and permeabilized with 0.1% Triton X-100, followed by incubation with anti-CARDS toxin rabbit primary antibodies. Cells were treated with AlexaFluor-633 conjugated anti-rabbit goat (polyclonal) secondary antibodies to detect cellular binding of CARDS toxin derivatives by confocal laser scanning microscopy. Cell nuclei were stained with DAPI.
    Figure Legend Snippet: Carboxy region of CARDS toxin mediates binding and internalization A) Comparison of binding and internalization of FL, selected C-terminal truncated CARDS toxin derivatives and 178 CARDS toxin. FL toxin and its derivatives were purified as indicated in Experimental Procedures and biotin labeled. Binding : Proteins were incubated with HeLa cells for 1 h at 4°C. Subsequently, cells were washed and bound proteins were quantified as indicated in Experimental Procedures. Internalization : After 1 h incubation at 4°C, bound proteins (FL, selected C-terminal truncated CARDS toxin derivatives and 178 CARDS toxin) were removed by washing, and cells were shifted to 37°C for 1 h with fresh medium. Then, cells were treated with MESNA to remove surface-bound, biotin-labeled CARDS toxin and its derivatives, and internalized proteins were quantified after permeabilizing cells as indicated in Experimental Procedures. Binding and internalization results of FL and variants of CARDS toxin are shown by closed and open symbols respectively. FL - square, 178 CARDS - circle, CARDS 249 - triangle and CARDS 550 -diamond. B) Endocytosis of 178 CARDS toxin and CARDS 550 toxin. HeLa cells were treated with 140 pmol of 178 CARDS toxin or CARDS 550 toxin for 30 min at 4°C, washed to remove unbound toxins and shifted to 37°C for 1 h. Cell preparations were fixed and permeabilized with 0.1% Triton X-100, followed by incubation with anti-CARDS toxin rabbit primary antibodies. Cells were treated with AlexaFluor-633 conjugated anti-rabbit goat (polyclonal) secondary antibodies to detect cellular binding of CARDS toxin derivatives by confocal laser scanning microscopy. Cell nuclei were stained with DAPI.

    Techniques Used: Binding Assay, Purification, Labeling, Incubation, Confocal Laser Scanning Microscopy, Staining

    27) Product Images from "Functional roles of cadherin, aminopeptidase-N and alkaline phosphatase from Helicoverpa armigera (Hübner) in the action mechanism of Bacillus thuringiensis Cry2Aa"

    Article Title: Functional roles of cadherin, aminopeptidase-N and alkaline phosphatase from Helicoverpa armigera (Hübner) in the action mechanism of Bacillus thuringiensis Cry2Aa

    Journal: Scientific Reports

    doi: 10.1038/srep46555

    ELISAs to assess the binding the Cry2Aa toxin with the recombinant CAD, APN4 and ALP2 fragments. Binding ELISAs were performed by fixing 1 μg of the CAD ( A ), APN4 ( B ) and ALP2 ( C ) fragments per well in ELISA plates, followed by incubation with different concentrations of the biotinylated Cry2Aa toxin. K d values obtained through SigmaPlot 12.5 analysis are indicated within the graphs.
    Figure Legend Snippet: ELISAs to assess the binding the Cry2Aa toxin with the recombinant CAD, APN4 and ALP2 fragments. Binding ELISAs were performed by fixing 1 μg of the CAD ( A ), APN4 ( B ) and ALP2 ( C ) fragments per well in ELISA plates, followed by incubation with different concentrations of the biotinylated Cry2Aa toxin. K d values obtained through SigmaPlot 12.5 analysis are indicated within the graphs.

    Techniques Used: Binding Assay, Recombinant, Enzyme-linked Immunosorbent Assay, Incubation

    28) Product Images from "Distinct Roles of Adenovirus Vector-Transduced Dendritic Cells, Myoblasts, and Endothelial Cells in Mediating an Immune Response against a Transgene Product"

    Article Title: Distinct Roles of Adenovirus Vector-Transduced Dendritic Cells, Myoblasts, and Endothelial Cells in Mediating an Immune Response against a Transgene Product

    Journal: Journal of Virology

    doi: 10.1128/JVI.76.6.2899-2911.2002

    β-Gal-specific antibody titers in mice immunized with AdβGal or with AdβGal-transduced muscle cells. Mice received one i.m. injection with either 10 9 PFU of AdβGal (Ad) or 5 × 10 4 AdβGal-expressing DC (DC/Ad), myoblasts (Myo/Ad), or EC (EC/Ad). Mice injected with untransduced DC, myoblasts, or EC (DC, Myo, or EC) were used as negative controls. Mice were bled once a week, and β-Gal-specific antibody titers were measured by ELISA. (A) Generation of β-Gal-specific IgG antibodies as a function of time. (B) Levels of IgG1- and IgG2a-specific antibodies at day 42. (C) Kinetics of IgG1 and IgG2a β-Gal-specific antibodies after immunization with AdβGal-transduced DC.
    Figure Legend Snippet: β-Gal-specific antibody titers in mice immunized with AdβGal or with AdβGal-transduced muscle cells. Mice received one i.m. injection with either 10 9 PFU of AdβGal (Ad) or 5 × 10 4 AdβGal-expressing DC (DC/Ad), myoblasts (Myo/Ad), or EC (EC/Ad). Mice injected with untransduced DC, myoblasts, or EC (DC, Myo, or EC) were used as negative controls. Mice were bled once a week, and β-Gal-specific antibody titers were measured by ELISA. (A) Generation of β-Gal-specific IgG antibodies as a function of time. (B) Levels of IgG1- and IgG2a-specific antibodies at day 42. (C) Kinetics of IgG1 and IgG2a β-Gal-specific antibodies after immunization with AdβGal-transduced DC.

    Techniques Used: Mouse Assay, Injection, Expressing, Enzyme-linked Immunosorbent Assay

    29) Product Images from "Upregulated Expression of Indoleamine 2, 3-Dioxygenase in Primary Breast Cancer Correlates with Increase of Infiltrated Regulatory T Cells In Situ and Lymph Node Metastasis"

    Article Title: Upregulated Expression of Indoleamine 2, 3-Dioxygenase in Primary Breast Cancer Correlates with Increase of Infiltrated Regulatory T Cells In Situ and Lymph Node Metastasis

    Journal: Clinical and Developmental Immunology

    doi: 10.1155/2011/469135

    Foxp3 expression in CD3 + T cells was upregulated both at mRNA and protein levels after coculture with IDO/CHO cells. The expression of Foxp3 gene at mRNA and protein levels in treated and untreated T cells were detected using qRT-PCR assay and Western Blot method. (a) After 7 day coculture, the relative mRNA level of Foxp3 in the CD3 + T cells treated with the CHO/IDO cells was significantly higher than that in the CD3 + T cells treated with the CHO/EGFP control cells or untreated CD3 + T cells (lane 1: β -actin in the CD3 + T control cells; lane 2: Foxp3 in the CD3 + T control cells; lane 3: β -actin in the T cells treated with CHO/IDO cells; lane 4: Foxp3 in the T cells treated with CHO/IDO cells; lane 5: β -actin in the T cells treated with CHO/EGFP cells; lane 6: Foxp3 in the T cells treated with CHO/EGFP cells; lane 7: DL2000 Marker. (b) The mRNA amount of Foxp3 in the CD3 + T cells stimulated by the CHO/IDO cells was significantly higher than that in the CD3 + T cells stimulated by the CHO/EGFP cells and the unstimulated CD3 + T cells control. (c) Foxp3 expression at protein level in treated and untreated T cells detected by Western Blot analysis. Foxp3 expression was exclusively detected in the cell lysates of CD3 + T cells treated with CHO/IDO cells, indicating a 48 kD protein band reactive to a Foxp3-specific monoclonal antibody (lane 1: Foxp3 in CD3 + T cells treated with CHO/IDO cells; lane 2: Foxp3 in CD3 + T cells treated with CHO/EGFP cells; lane 3: Foxp3 in control CD3 + T cells).
    Figure Legend Snippet: Foxp3 expression in CD3 + T cells was upregulated both at mRNA and protein levels after coculture with IDO/CHO cells. The expression of Foxp3 gene at mRNA and protein levels in treated and untreated T cells were detected using qRT-PCR assay and Western Blot method. (a) After 7 day coculture, the relative mRNA level of Foxp3 in the CD3 + T cells treated with the CHO/IDO cells was significantly higher than that in the CD3 + T cells treated with the CHO/EGFP control cells or untreated CD3 + T cells (lane 1: β -actin in the CD3 + T control cells; lane 2: Foxp3 in the CD3 + T control cells; lane 3: β -actin in the T cells treated with CHO/IDO cells; lane 4: Foxp3 in the T cells treated with CHO/IDO cells; lane 5: β -actin in the T cells treated with CHO/EGFP cells; lane 6: Foxp3 in the T cells treated with CHO/EGFP cells; lane 7: DL2000 Marker. (b) The mRNA amount of Foxp3 in the CD3 + T cells stimulated by the CHO/IDO cells was significantly higher than that in the CD3 + T cells stimulated by the CHO/EGFP cells and the unstimulated CD3 + T cells control. (c) Foxp3 expression at protein level in treated and untreated T cells detected by Western Blot analysis. Foxp3 expression was exclusively detected in the cell lysates of CD3 + T cells treated with CHO/IDO cells, indicating a 48 kD protein band reactive to a Foxp3-specific monoclonal antibody (lane 1: Foxp3 in CD3 + T cells treated with CHO/IDO cells; lane 2: Foxp3 in CD3 + T cells treated with CHO/EGFP cells; lane 3: Foxp3 in control CD3 + T cells).

    Techniques Used: Expressing, Quantitative RT-PCR, Western Blot, Marker

    IDO expression in PTs was positively correlated with the density of Tregs in PTs and TDLNs. The Foxp3 + Tregs in PTs, TDLNs, benign disease, and normal adjacent tissues were detected using IHC staining method. (a)–(c) The Foxp3 protein appeared in the nuclei of lymphocytes infiltrated into PTs (a) and TDLNs, including nonmetastatic TDLNs (b) and metastatic TDLNs (c). (d)–(i) In the PTs with higher expression of IDO (d), more Foxp3 + Tregs infiltrated into the PTs (e) and corresponding TDLNs (f). In contrast, in the PTs with lower or no expression of IDO (g), less Foxp3 + Tregs were detected in the PTs (h) and corresponding TDLNs (i). (j) and (k) Scatter plots were generated to display the correlation between IDO expression in breast cancer (IDO + SIs in primary tumors) and the density of Foxp3 + Tregs in PTs (Foxp3 + SIs in primary tumors) or in TDLNs (Foxp3 + SIs in TDLNs). The IDO + SIs displayed a positive correlation with the Foxp3 + SIs in PTs with a linear regression equation of Y = 0.832 + 0.140 X (j). Accordingly, the IDO + SIs showed a similarly positive correlation with the Foxp3 + SIs in TDLNs with a linear regression equation of Y = 3.771 + 0.160 X (k).
    Figure Legend Snippet: IDO expression in PTs was positively correlated with the density of Tregs in PTs and TDLNs. The Foxp3 + Tregs in PTs, TDLNs, benign disease, and normal adjacent tissues were detected using IHC staining method. (a)–(c) The Foxp3 protein appeared in the nuclei of lymphocytes infiltrated into PTs (a) and TDLNs, including nonmetastatic TDLNs (b) and metastatic TDLNs (c). (d)–(i) In the PTs with higher expression of IDO (d), more Foxp3 + Tregs infiltrated into the PTs (e) and corresponding TDLNs (f). In contrast, in the PTs with lower or no expression of IDO (g), less Foxp3 + Tregs were detected in the PTs (h) and corresponding TDLNs (i). (j) and (k) Scatter plots were generated to display the correlation between IDO expression in breast cancer (IDO + SIs in primary tumors) and the density of Foxp3 + Tregs in PTs (Foxp3 + SIs in primary tumors) or in TDLNs (Foxp3 + SIs in TDLNs). The IDO + SIs displayed a positive correlation with the Foxp3 + SIs in PTs with a linear regression equation of Y = 0.832 + 0.140 X (j). Accordingly, the IDO + SIs showed a similarly positive correlation with the Foxp3 + SIs in TDLNs with a linear regression equation of Y = 3.771 + 0.160 X (k).

    Techniques Used: Expressing, Immunohistochemistry, Staining, Generated

    30) Product Images from "The isothiocyanate class of bioactive nutrients covalently inhibit the MEKK1 protein kinase"

    Article Title: The isothiocyanate class of bioactive nutrients covalently inhibit the MEKK1 protein kinase

    Journal: BMC Cancer

    doi: 10.1186/1471-2407-7-183

    BioITC inhibits MEKK1, but not the C1238V mutant, by covalent modification . A . Purified MEKK1 or the C1238V mutant on chitin beads were treated with Bio-ITC at the concentrations indicated in 50 mM Tris pH7.8 for 40 minutes at room temperature. Bio-ITC was removed, and the kinase activity measured. Bio-ITC inhibits wild type MEKK1, but not the C1238V mutant in a dose dependent manner. B . Purified wild type MEKK1 or the C1238V mutant were treated as in Panel A with Bio-ITC at the indicated concentrations. The treated protein was used to either assay for kinase activity (top panel) or to detect covalent modification by Bio-ITC using a streptavidin-HRP conjugate (middle panel). Equivalent protein was confirmed by re-probing the streptavidin gel with anti-MEKK1 (bottom panel), using an alkaline phosphatase conjugated secondary antibody and colorimetric detection reagents. Bio-ITC inhibited wild type MEKK1 by stable, covalent modification in a manner that requires C1238V. C . CV-1 cells expressing either wild type MEKK1 or the C1238V mutant were lysed in Tris lysis buffer containing 0.1% NP-40. Clarified lysates were treated by addition of either PEITC (P) or Bio-ITC (B) to final concentration of 250 μM, and incubated at room temperature for 30 minutes. MEKK1 proteins were purified on chitin beads and kinase activity measured. Both PEITC and Bio-ITC completely inhibited wild type MEKK1, but not the C1238V mutant when added to cell lysates.
    Figure Legend Snippet: BioITC inhibits MEKK1, but not the C1238V mutant, by covalent modification . A . Purified MEKK1 or the C1238V mutant on chitin beads were treated with Bio-ITC at the concentrations indicated in 50 mM Tris pH7.8 for 40 minutes at room temperature. Bio-ITC was removed, and the kinase activity measured. Bio-ITC inhibits wild type MEKK1, but not the C1238V mutant in a dose dependent manner. B . Purified wild type MEKK1 or the C1238V mutant were treated as in Panel A with Bio-ITC at the indicated concentrations. The treated protein was used to either assay for kinase activity (top panel) or to detect covalent modification by Bio-ITC using a streptavidin-HRP conjugate (middle panel). Equivalent protein was confirmed by re-probing the streptavidin gel with anti-MEKK1 (bottom panel), using an alkaline phosphatase conjugated secondary antibody and colorimetric detection reagents. Bio-ITC inhibited wild type MEKK1 by stable, covalent modification in a manner that requires C1238V. C . CV-1 cells expressing either wild type MEKK1 or the C1238V mutant were lysed in Tris lysis buffer containing 0.1% NP-40. Clarified lysates were treated by addition of either PEITC (P) or Bio-ITC (B) to final concentration of 250 μM, and incubated at room temperature for 30 minutes. MEKK1 proteins were purified on chitin beads and kinase activity measured. Both PEITC and Bio-ITC completely inhibited wild type MEKK1, but not the C1238V mutant when added to cell lysates.

    Techniques Used: Mutagenesis, Modification, Purification, Activity Assay, Expressing, Lysis, Concentration Assay, Incubation

    Covalent modification of MEKK1 by Bio-ITC is blocked by preincubation of cells with PEITC . CV-1 cells expressing wild type MEKK1 or the C1238V mutant were either left untreated or incubated with 250 μM PEITC for 20 minutes at 37°C. Lysates were prepared in TLB, clarified and then 500 μM Bio-ITC was added to the samples as indicated. MEKK1 proteins were purified from the lysates on chitin beads, and either electrophoresed for detection of biotin labeling using streptavidin-HRP (top panel) or assayed for kinase activity (middle panel). To confirm equivalent protein, the SA-HRP blot was re-probed with anti-MEKK1 as in Figure 5. Lane 2 contains the molecular weight markers. Bio-ITC covalently modifies MEKK1 protein and inhibits its activity in a manner that requires C1238V. The modification by Bio-ITC is completely inhibited by preincubation of the cells with PEITC, suggesting that the modification site is completely occupied by the natural isothiocyanate after exposure of intact cells.
    Figure Legend Snippet: Covalent modification of MEKK1 by Bio-ITC is blocked by preincubation of cells with PEITC . CV-1 cells expressing wild type MEKK1 or the C1238V mutant were either left untreated or incubated with 250 μM PEITC for 20 minutes at 37°C. Lysates were prepared in TLB, clarified and then 500 μM Bio-ITC was added to the samples as indicated. MEKK1 proteins were purified from the lysates on chitin beads, and either electrophoresed for detection of biotin labeling using streptavidin-HRP (top panel) or assayed for kinase activity (middle panel). To confirm equivalent protein, the SA-HRP blot was re-probed with anti-MEKK1 as in Figure 5. Lane 2 contains the molecular weight markers. Bio-ITC covalently modifies MEKK1 protein and inhibits its activity in a manner that requires C1238V. The modification by Bio-ITC is completely inhibited by preincubation of the cells with PEITC, suggesting that the modification site is completely occupied by the natural isothiocyanate after exposure of intact cells.

    Techniques Used: Modification, Expressing, Mutagenesis, Incubation, Purification, Labeling, Activity Assay, Molecular Weight

    31) Product Images from "Unraveling the Redox Properties of the Global Regulator FurA from Anabaena sp. PCC 7120: Disulfide Reductase Activity Based on Its CXXC Motifs"

    Article Title: Unraveling the Redox Properties of the Global Regulator FurA from Anabaena sp. PCC 7120: Disulfide Reductase Activity Based on Its CXXC Motifs

    Journal: Antioxidants & Redox Signaling

    doi: 10.1089/ars.2013.5376

    Analysis of glutathionylation of FurA in vitro . Prereduced FurA was treated or not with H 2 O 2 before being incubated with biotinylated GSH ethyl ester (BioGEE). Western blotting analysis was performed to detect biotinylated GSH, using GST as positive control
    Figure Legend Snippet: Analysis of glutathionylation of FurA in vitro . Prereduced FurA was treated or not with H 2 O 2 before being incubated with biotinylated GSH ethyl ester (BioGEE). Western blotting analysis was performed to detect biotinylated GSH, using GST as positive control

    Techniques Used: In Vitro, Incubation, Western Blot, Positive Control

    32) Product Images from "Poly(ADP-ribose) Polymerase-1 Down-regulates BRCA2 Expression through theBRCA2 Promoter *"

    Article Title: Poly(ADP-ribose) Polymerase-1 Down-regulates BRCA2 Expression through theBRCA2 Promoter *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M803693200

    Parp-1 binds to the BRCA2 promoter. A , MCF-7 cell nuclear extracts were mixed with a biotinylated WT probe and a mutant probe ( M ). The DNA-protein complex was isolated with streptavidin-labeled magnetic beads. The magnetic bead column was washed and eluates were collected. Eluted fractions were separated on 10% acrylamide gels and visualized by silver staining. The 120-kDa protein band indicates a prominent DNA-protein complex. BSA was used as a control, and its position is indicated by a black arrow . The experiment was carried out three times. E1, E2, E3 (WT probe eluates); M , mutant probe eluate. B , mass spectrometry of the ∼120-kDa protein. C , EMSAs and antibody super-shifts were performed in MCF-7 nuclear extracts using WT, mutant probes, and Parp-1 antibody. D , EMSAs were carried out in MCF-7 nuclear extracts using the end-streptavidin blocked-biotin-labeled WT and mutant probes. E , luciferase activity of Del-9 in MCF-7 cells treated with 3-AB/NU1025, two Parp-1 inhibitors, or DMSO for 12 h.
    Figure Legend Snippet: Parp-1 binds to the BRCA2 promoter. A , MCF-7 cell nuclear extracts were mixed with a biotinylated WT probe and a mutant probe ( M ). The DNA-protein complex was isolated with streptavidin-labeled magnetic beads. The magnetic bead column was washed and eluates were collected. Eluted fractions were separated on 10% acrylamide gels and visualized by silver staining. The 120-kDa protein band indicates a prominent DNA-protein complex. BSA was used as a control, and its position is indicated by a black arrow . The experiment was carried out three times. E1, E2, E3 (WT probe eluates); M , mutant probe eluate. B , mass spectrometry of the ∼120-kDa protein. C , EMSAs and antibody super-shifts were performed in MCF-7 nuclear extracts using WT, mutant probes, and Parp-1 antibody. D , EMSAs were carried out in MCF-7 nuclear extracts using the end-streptavidin blocked-biotin-labeled WT and mutant probes. E , luciferase activity of Del-9 in MCF-7 cells treated with 3-AB/NU1025, two Parp-1 inhibitors, or DMSO for 12 h.

    Techniques Used: Mutagenesis, Isolation, Labeling, Magnetic Beads, Silver Staining, Mass Spectrometry, Luciferase, Activity Assay

    33) Product Images from "Nanopeptamers for the Development of Small-Analyte Lateral Flow Tests with a Positive Readout"

    Article Title: Nanopeptamers for the Development of Small-Analyte Lateral Flow Tests with a Positive Readout

    Journal: Analytical chemistry

    doi: 10.1021/ac3031114

    Scheme of PHAIA (phage anti-immunocomplex assay) and the Nanopeptamer noncompetitive assays. Panel A shows the scheme of PHAIA that typically uses filamentous M13 phage (light green) expressing disulfide constrained peptides (~100–200 copies along the ~2700 copies of the coat protein pVIII). Binding of the phage to the analyte-antibody (light blue) immunocomplex is detected with an anti-M13 antibody (pink) coupled to horse radish peroxidase (PO). Panel B schematizes the substitution of the phage particle by a Nanopeptamer (a streptavidin conjugate, combined with four molecules of the biotinylated peptide)
    Figure Legend Snippet: Scheme of PHAIA (phage anti-immunocomplex assay) and the Nanopeptamer noncompetitive assays. Panel A shows the scheme of PHAIA that typically uses filamentous M13 phage (light green) expressing disulfide constrained peptides (~100–200 copies along the ~2700 copies of the coat protein pVIII). Binding of the phage to the analyte-antibody (light blue) immunocomplex is detected with an anti-M13 antibody (pink) coupled to horse radish peroxidase (PO). Panel B schematizes the substitution of the phage particle by a Nanopeptamer (a streptavidin conjugate, combined with four molecules of the biotinylated peptide)

    Techniques Used: Expressing, Binding Assay

    34) Product Images from "Polymer Transfected Primary Myoblasts Mediated Efficient Gene Expression and Angiogenic Proliferation"

    Article Title: Polymer Transfected Primary Myoblasts Mediated Efficient Gene Expression and Angiogenic Proliferation

    Journal: Journal of controlled release : official journal of the Controlled Release Society

    doi: 10.1016/j.jconrel.2009.09.021

    Confocal images of GFP expression from polymer transfected primary myoblasts (× 200). Control: non-treated primary myoblasts. Positive control: bPEI (25kDa)/pCMV-GFP at w/w ratio of 0.6:1. a–d: poly(CBA-DAH)/pCMV-GFP transfected primary
    Figure Legend Snippet: Confocal images of GFP expression from polymer transfected primary myoblasts (× 200). Control: non-treated primary myoblasts. Positive control: bPEI (25kDa)/pCMV-GFP at w/w ratio of 0.6:1. a–d: poly(CBA-DAH)/pCMV-GFP transfected primary

    Techniques Used: Expressing, Transfection, Positive Control

    35) Product Images from "Enhanced Reduction of Helicobacter pylori Load in Precolonized Mice Treated with Combined Famotidine and Urease-Binding Polysaccharides"

    Article Title: Enhanced Reduction of Helicobacter pylori Load in Precolonized Mice Treated with Combined Famotidine and Urease-Binding Polysaccharides

    Journal: Antimicrobial Agents and Chemotherapy

    doi:

    Enhanced inhibition of biotinylated swine gastric mucin adherence to H. pylori native urease protein caused by dextran sulfate in the presence of famotidine. Dextran sulfate exhibited enhanced competitive activity in the presence of a weight-equivalent amount of famotidine using a pH 4.0 adhesion medium containing 20 mM PBS and 0.05% Tween 20. A similar percent inhibition was not observed when the dextran sulfate-omeprazole combination or single-component test inhibitors were used. Symbols: ●, dextran sulfate plus famotidine; ○, dextran sulfate plus omeprazole; ■, dextran sulfate; □, famotidine; ▵, omeprazole; ▴, dextran.
    Figure Legend Snippet: Enhanced inhibition of biotinylated swine gastric mucin adherence to H. pylori native urease protein caused by dextran sulfate in the presence of famotidine. Dextran sulfate exhibited enhanced competitive activity in the presence of a weight-equivalent amount of famotidine using a pH 4.0 adhesion medium containing 20 mM PBS and 0.05% Tween 20. A similar percent inhibition was not observed when the dextran sulfate-omeprazole combination or single-component test inhibitors were used. Symbols: ●, dextran sulfate plus famotidine; ○, dextran sulfate plus omeprazole; ■, dextran sulfate; □, famotidine; ▵, omeprazole; ▴, dextran.

    Techniques Used: Inhibition, Activity Assay

    36) Product Images from "Susceptibility quantitative trait loci for pathogenic leucocytosis in SCG/Kj mice, a spontaneously occurring crescentic glomerulonephritis and vasculitis model"

    Article Title: Susceptibility quantitative trait loci for pathogenic leucocytosis in SCG/Kj mice, a spontaneously occurring crescentic glomerulonephritis and vasculitis model

    Journal: Clinical and Experimental Immunology

    doi: 10.1111/cei.12333

    Increased numbers of Gr-1 + granulocytes (a), F4/80 + macrophages/monocytes (b), dendritic cells (DCs) (c) and CD4 − CD8 − T cells (d) in peripheral blood (PB) of [C57BL/6 × spontaneous crescentic glomerulonephritis-forming/Kinjoh (SCG/Kj)]
    Figure Legend Snippet: Increased numbers of Gr-1 + granulocytes (a), F4/80 + macrophages/monocytes (b), dendritic cells (DCs) (c) and CD4 − CD8 − T cells (d) in peripheral blood (PB) of [C57BL/6 × spontaneous crescentic glomerulonephritis-forming/Kinjoh (SCG/Kj)]

    Techniques Used:

    Distribution of Gr-1 + cells, myeloperoxidase (MPO + ) cells and F4/80 + cells in healthy and glomerulonephritic glomeruli with crescents [Cr (+)] and without crescents [Cr (−)]. Upper photographs: cortical glomeruli, lower photographs: interstitium.
    Figure Legend Snippet: Distribution of Gr-1 + cells, myeloperoxidase (MPO + ) cells and F4/80 + cells in healthy and glomerulonephritic glomeruli with crescents [Cr (+)] and without crescents [Cr (−)]. Upper photographs: cortical glomeruli, lower photographs: interstitium.

    Techniques Used:

    37) Product Images from "Immunosuppression, interleukin-10 synthesis and apoptosis are induced in rats inoculated with Cryptococcus neoformans glucuronoxylomannan"

    Article Title: Immunosuppression, interleukin-10 synthesis and apoptosis are induced in rats inoculated with Cryptococcus neoformans glucuronoxylomannan

    Journal: Immunology

    doi: 10.1111/j.1365-2567.2004.01970.x

    Cytokine production by Con A-stimulated Spm cells from rats after GXM administration. Spm cells (1·5 × 10 6 /ml) from PBS-inoculated (control) and GXM-injected rats were cultured in 5% CO 2 at 37° in presence of 10 µg/ml of Con A. The supernatants for cytokine measurement were collected at 24 hr for IL-2, 48 hr for IFN-γ and 67 hr for IL-10 and TNF-α. ELISA capture assay was used to determine the cytokine levels. Bars represent SEM values. Results are expressed as fold increase of cytokine levels in cell cultures from GXM treated-rats over cytokine levels in cell cultures from control rats. Each point shows the mean ± SEM of three animals in each group and the results are representative of three independent experiments. * P
    Figure Legend Snippet: Cytokine production by Con A-stimulated Spm cells from rats after GXM administration. Spm cells (1·5 × 10 6 /ml) from PBS-inoculated (control) and GXM-injected rats were cultured in 5% CO 2 at 37° in presence of 10 µg/ml of Con A. The supernatants for cytokine measurement were collected at 24 hr for IL-2, 48 hr for IFN-γ and 67 hr for IL-10 and TNF-α. ELISA capture assay was used to determine the cytokine levels. Bars represent SEM values. Results are expressed as fold increase of cytokine levels in cell cultures from GXM treated-rats over cytokine levels in cell cultures from control rats. Each point shows the mean ± SEM of three animals in each group and the results are representative of three independent experiments. * P

    Techniques Used: Injection, Cell Culture, Enzyme-linked Immunosorbent Assay

    38) Product Images from "Dynamics of clathrin-mediated endocytosis and its requirement for organelle biogenesis in Dictyostelium"

    Article Title: Dynamics of clathrin-mediated endocytosis and its requirement for organelle biogenesis in Dictyostelium

    Journal: Journal of Cell Science

    doi: 10.1242/jcs.108837

    Internalization of dajumin-GFP. ( A ) Biotin internalization assay for AX2, Ap2A1–, apm2–, clc– and chcA– cells. Dajumin-GFP was immunoprecipitated from cell lysates. Membranes were probed for biotin with streptavidin-HRP
    Figure Legend Snippet: Internalization of dajumin-GFP. ( A ) Biotin internalization assay for AX2, Ap2A1–, apm2–, clc– and chcA– cells. Dajumin-GFP was immunoprecipitated from cell lysates. Membranes were probed for biotin with streptavidin-HRP

    Techniques Used: Immunoprecipitation

    39) Product Images from "Human and murine inhibitory natural killer cell receptors transfer from natural killer cells to target cells"

    Article Title: Human and murine inhibitory natural killer cell receptors transfer from natural killer cells to target cells

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    doi: 10.1073/pnas.0406240101

    Factors influencing the amount of KIR2DL1-GFP transfer to target cells. ( A ) Conjugates of YTS-TG- and PKH-26-labeled 221/Cw6 cells were isolated by FACS, disrupted with EDTA, and analyzed for expression of MHC class I, MHC class II, CD53, or CD54. Dot
    Figure Legend Snippet: Factors influencing the amount of KIR2DL1-GFP transfer to target cells. ( A ) Conjugates of YTS-TG- and PKH-26-labeled 221/Cw6 cells were isolated by FACS, disrupted with EDTA, and analyzed for expression of MHC class I, MHC class II, CD53, or CD54. Dot

    Techniques Used: Labeling, Isolation, FACS, Expressing

    40) Product Images from "A morphologic and semi-quantitative technique to analyze synthesis and release of specific proteins in cells"

    Article Title: A morphologic and semi-quantitative technique to analyze synthesis and release of specific proteins in cells

    Journal: BMC Cell Biology

    doi: 10.1186/s12860-014-0045-1

    Schematic diagram showed non-radioactive metabolic incorporation followed by azide-biotin or azide-Alex555 labeling, and biotin signals of proteins were detected by streptavidin-HRP by western blot. HPG is incorporated into newly synthesized proteins by metabolism and protein synthesis and the triazole conjugation between newly alkyne proteins labeled HPG and azide labeled either biotin or Alex555 via CuSO4 catalysis (A) . (B-a) The detection of biotin signals from extracted total proteins labeled by labeling reaction. Normal culture medium was changed to replace DMEM free of L-methionine supplemented with HPG after pulse 4 hr, and proteins were extracted in each of group at various time points including 0, 4, 24 and 72 hr. (B-b) Biotin signals of total proteins were detected. 1: Normal culture condition group; 2: HPG plus anisomycin group; 3: HPG group. (B-c,d,e) Biotin signals of Bcl-2, MMP-9 and IgG were individually detected in the immunoprecipitate pulled down by primary antibodies via siRNA post-transfection followed by non-radioactive metabolic labeling. (B-f) Radioactive isotope 35 S-methonine incorporated into synthesized IgG purified by immunoprecipitation was detected by autoradiography. 1: 35 S-methonine treated human choriocarcinoma cell line BeWo group and then antibody against human IgG immunoprecipitated human IgG in extracted total proteins; 2: cycloheximide plus 35 S-methonine treated BeWo group then antibody against human IgG immunoprecipitated human IgG in extracted total proteins; 3: 35 S-methonine treated skin fibroblast and then antibody against human IgG immunoprecipitated human IgG in extracted total proteins.
    Figure Legend Snippet: Schematic diagram showed non-radioactive metabolic incorporation followed by azide-biotin or azide-Alex555 labeling, and biotin signals of proteins were detected by streptavidin-HRP by western blot. HPG is incorporated into newly synthesized proteins by metabolism and protein synthesis and the triazole conjugation between newly alkyne proteins labeled HPG and azide labeled either biotin or Alex555 via CuSO4 catalysis (A) . (B-a) The detection of biotin signals from extracted total proteins labeled by labeling reaction. Normal culture medium was changed to replace DMEM free of L-methionine supplemented with HPG after pulse 4 hr, and proteins were extracted in each of group at various time points including 0, 4, 24 and 72 hr. (B-b) Biotin signals of total proteins were detected. 1: Normal culture condition group; 2: HPG plus anisomycin group; 3: HPG group. (B-c,d,e) Biotin signals of Bcl-2, MMP-9 and IgG were individually detected in the immunoprecipitate pulled down by primary antibodies via siRNA post-transfection followed by non-radioactive metabolic labeling. (B-f) Radioactive isotope 35 S-methonine incorporated into synthesized IgG purified by immunoprecipitation was detected by autoradiography. 1: 35 S-methonine treated human choriocarcinoma cell line BeWo group and then antibody against human IgG immunoprecipitated human IgG in extracted total proteins; 2: cycloheximide plus 35 S-methonine treated BeWo group then antibody against human IgG immunoprecipitated human IgG in extracted total proteins; 3: 35 S-methonine treated skin fibroblast and then antibody against human IgG immunoprecipitated human IgG in extracted total proteins.

    Techniques Used: Labeling, Western Blot, Synthesized, Conjugation Assay, Transfection, Purification, Immunoprecipitation, Autoradiography

    41) Product Images from "PA1b Inhibitor Binding to Subunits c and e of the Vacuolar ATPase Reveals Its Insecticidal Mechanism *"

    Article Title: PA1b Inhibitor Binding to Subunits c and e of the Vacuolar ATPase Reveals Its Insecticidal Mechanism *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M113.541250

    Electron microscopy of PA1b-bound V-ATPase. A , representative classes of PA1b-streptavidin-HRP-bound V-ATPase in the absence of ATP. B , as A but in the presence of 2 m m Mg·ATP. The PA1b-streptavidin-HRP density is indicated by an arrow in the far left panel 1 of A. Scale bars in both A and B represent 15 nm. C–E , three-dimensional reconstructions of the V-ATPase viewed perpendicular to the long axis of the complex ( upper image ) and from the extracellular end ( lower image ) bound to PA1b ( C ), bound to PA1b after the addition of Mg·ATP ( D ) and a control with no PA1b ( E ). All models were generated using EMAN, and the picture was produced using Chimera rendered at the same sigma level. In C ( lower ), the decameric c ring (Protein Data Bank ID code 2DB4 ( 53 ) r ainbow colors ) and a subunit model ( red ) have been fitted to the PA1b-streptavidin-HRP V-ATPase reconstruction in the absence of ATP using Chimera. If catalytically active, the c ring would rotate counterclockwise with respect to subunit a when observed from this perspective.
    Figure Legend Snippet: Electron microscopy of PA1b-bound V-ATPase. A , representative classes of PA1b-streptavidin-HRP-bound V-ATPase in the absence of ATP. B , as A but in the presence of 2 m m Mg·ATP. The PA1b-streptavidin-HRP density is indicated by an arrow in the far left panel 1 of A. Scale bars in both A and B represent 15 nm. C–E , three-dimensional reconstructions of the V-ATPase viewed perpendicular to the long axis of the complex ( upper image ) and from the extracellular end ( lower image ) bound to PA1b ( C ), bound to PA1b after the addition of Mg·ATP ( D ) and a control with no PA1b ( E ). All models were generated using EMAN, and the picture was produced using Chimera rendered at the same sigma level. In C ( lower ), the decameric c ring (Protein Data Bank ID code 2DB4 ( 53 ) r ainbow colors ) and a subunit model ( red ) have been fitted to the PA1b-streptavidin-HRP V-ATPase reconstruction in the absence of ATP using Chimera. If catalytically active, the c ring would rotate counterclockwise with respect to subunit a when observed from this perspective.

    Techniques Used: Electron Microscopy, Generated, Produced

    42) Product Images from "CD9 Regulates Major Histocompatibility Complex Class II Trafficking in Monocyte-Derived Dendritic Cells"

    Article Title: CD9 Regulates Major Histocompatibility Complex Class II Trafficking in Monocyte-Derived Dendritic Cells

    Journal: Molecular and Cellular Biology

    doi: 10.1128/MCB.00202-17

    CD9 regulates MHC-II internalization and recycling in mature MoDCs. (A and B) Immature (A) and LPS-matured (B) WT and CD9 KO MoDCs were incubated with biotinylated MHC-II antibodies for 1 h at 4°C, washed, and incubated for different times at 37°C, and then MHC-II surface expression was detected by flow cytometry after streptavidin labeling in CD11c + cells. Data represent mean fold changes ± SEM of results from three independent experiments performed in triplicate and were analyzed by two-way ANOVA with Bonferroni's post hoc multiple-comparison test. (C and D) Measurement of MHC-II internalization (C) and recycling (D) in mature WT and CD9 KO MoDCs by cell biotinylation assay. After incubation with biotin (blue in the schemes) at 4°C, cells were kept at 37°C (internalization), and the remaining surface biotins were removed by MESNA washing. (D) For recycling experiments, cells were further incubated for different times at 37°C (recycling), and surface biotins removed by MESNA washing. Cell lysates were immunoprecipitated with an anti-MHC-II antibody (M5/114), and biotinylated proteins were detected after membrane incubation with streptavidin-HRP (StrepHRP). Membranes were reprobed with MHC-II antibody for loading measurement. The blots shown are from representative experiments. (C) Only a fractional amount from cells incubated at 4°C in the absence of MESNA (0 min) was loaded. The graph shows the biotinylated MHC-II/total MHC-II signal ratio. The graph shows data determined as follows: [1 − (biotinylated MHC-II/total MHC-II signal ratio)]. Data represent mean fold changes ± SEM of results from four (C) and three (D) independent experiments analyzed by two-way ANOVA with Bonferroni's post hoc multiple-comparison test. **, P
    Figure Legend Snippet: CD9 regulates MHC-II internalization and recycling in mature MoDCs. (A and B) Immature (A) and LPS-matured (B) WT and CD9 KO MoDCs were incubated with biotinylated MHC-II antibodies for 1 h at 4°C, washed, and incubated for different times at 37°C, and then MHC-II surface expression was detected by flow cytometry after streptavidin labeling in CD11c + cells. Data represent mean fold changes ± SEM of results from three independent experiments performed in triplicate and were analyzed by two-way ANOVA with Bonferroni's post hoc multiple-comparison test. (C and D) Measurement of MHC-II internalization (C) and recycling (D) in mature WT and CD9 KO MoDCs by cell biotinylation assay. After incubation with biotin (blue in the schemes) at 4°C, cells were kept at 37°C (internalization), and the remaining surface biotins were removed by MESNA washing. (D) For recycling experiments, cells were further incubated for different times at 37°C (recycling), and surface biotins removed by MESNA washing. Cell lysates were immunoprecipitated with an anti-MHC-II antibody (M5/114), and biotinylated proteins were detected after membrane incubation with streptavidin-HRP (StrepHRP). Membranes were reprobed with MHC-II antibody for loading measurement. The blots shown are from representative experiments. (C) Only a fractional amount from cells incubated at 4°C in the absence of MESNA (0 min) was loaded. The graph shows the biotinylated MHC-II/total MHC-II signal ratio. The graph shows data determined as follows: [1 − (biotinylated MHC-II/total MHC-II signal ratio)]. Data represent mean fold changes ± SEM of results from four (C) and three (D) independent experiments analyzed by two-way ANOVA with Bonferroni's post hoc multiple-comparison test. **, P

    Techniques Used: Incubation, Expressing, Flow Cytometry, Cytometry, Labeling, Cell Surface Biotinylation Assay, Immunoprecipitation

    43) Product Images from "Porcine monocyte subsets differ in the expression of CCR2 and in their responsiveness to CCL2"

    Article Title: Porcine monocyte subsets differ in the expression of CCR2 and in their responsiveness to CCL2

    Journal: Veterinary Research

    doi: 10.1051/vetres/2010048

    Expression of recombinant porcine CCL2. (A) CHO cell line stably expressing the porcine CCL2 fused to GFP. The expression of GFP fusion protein was directly analysed by flow cytometry. Non transfected CHO cells were used as negative control (grey histogram). 5 000 cells were acquired. (B) Western blot of CCL2-GFP produced by transfected CHO cells. Different dilutions of supernatant were resolved by 15% SDS-PAGE under reducing conditions and revealed with biotinylated anti-GFP and streptavidin-HRP. Numbers on the left indicate the position of MW markers. (C) Chemotactic activity of CCL2-GFP on porcine blood monocytes. Chemotaxis was assessed with the Transwell cell migration system and subsequent flow cytometry counting of migrated cells by a 45 s acquisition. (1) FSC versus SSC dot plot of migrated cells in response to supernatants from CHO cells expressing CCL2-GFP or the inverted sequence of pCCL2 fused to GFP (InvCCL2-GFP, negative control). (2) Results expressed as migration index, calculated as the ratio of the number of cells migrating to the chemokine and the number of cells in the negative control. Results from one representative experiment out of three performed are shown. (A color version of this figure is available at www.vetres.org. )
    Figure Legend Snippet: Expression of recombinant porcine CCL2. (A) CHO cell line stably expressing the porcine CCL2 fused to GFP. The expression of GFP fusion protein was directly analysed by flow cytometry. Non transfected CHO cells were used as negative control (grey histogram). 5 000 cells were acquired. (B) Western blot of CCL2-GFP produced by transfected CHO cells. Different dilutions of supernatant were resolved by 15% SDS-PAGE under reducing conditions and revealed with biotinylated anti-GFP and streptavidin-HRP. Numbers on the left indicate the position of MW markers. (C) Chemotactic activity of CCL2-GFP on porcine blood monocytes. Chemotaxis was assessed with the Transwell cell migration system and subsequent flow cytometry counting of migrated cells by a 45 s acquisition. (1) FSC versus SSC dot plot of migrated cells in response to supernatants from CHO cells expressing CCL2-GFP or the inverted sequence of pCCL2 fused to GFP (InvCCL2-GFP, negative control). (2) Results expressed as migration index, calculated as the ratio of the number of cells migrating to the chemokine and the number of cells in the negative control. Results from one representative experiment out of three performed are shown. (A color version of this figure is available at www.vetres.org. )

    Techniques Used: Expressing, Recombinant, Stable Transfection, Flow Cytometry, Cytometry, Transfection, Negative Control, Western Blot, Produced, SDS Page, Activity Assay, Chemotaxis Assay, Migration, Sequencing

    44) Product Images from "Prion Nucleation Site Unmasked by Transient Interaction with Phospholipid Cofactor"

    Article Title: Prion Nucleation Site Unmasked by Transient Interaction with Phospholipid Cofactor

    Journal: Biochemistry

    doi: 10.1021/bi4014825

    Photoaffinity labeling of various PrP species. Streptavidin-HRP-probed blots of samples photoaffinity labeled with PA-PBD peptide. (A) Samples containing PrP Int1 or PrP C were incubated with or without PA-PBD and exposed to UV light for varying time periods, as indicated. (B) Samples containing α -helical PrP or PrP Int1 were incubated with PA-PBD and exposed to UV light for 5 min. (C) Samples of PrP Int1 were incubated with varying concentrations of PA-PBD, as indicated, and exposed to UV light for 0 or 5 min, as indicated. (D) Sample containing 7 μ g of PrP Int1 photoaffinity labeled with PA-PBD (PA-PrP Int1 ) is compared to a standard curve of biotinylated AviTag PrP for reference.
    Figure Legend Snippet: Photoaffinity labeling of various PrP species. Streptavidin-HRP-probed blots of samples photoaffinity labeled with PA-PBD peptide. (A) Samples containing PrP Int1 or PrP C were incubated with or without PA-PBD and exposed to UV light for varying time periods, as indicated. (B) Samples containing α -helical PrP or PrP Int1 were incubated with PA-PBD and exposed to UV light for 5 min. (C) Samples of PrP Int1 were incubated with varying concentrations of PA-PBD, as indicated, and exposed to UV light for 0 or 5 min, as indicated. (D) Sample containing 7 μ g of PrP Int1 photoaffinity labeled with PA-PBD (PA-PrP Int1 ) is compared to a standard curve of biotinylated AviTag PrP for reference.

    Techniques Used: Labeling, Incubation

    45) Product Images from "Glycogen synthase kinase 3β ubiquitination by TRAF6 regulates TLR3-mediated pro-inflammatory cytokine production"

    Article Title: Glycogen synthase kinase 3β ubiquitination by TRAF6 regulates TLR3-mediated pro-inflammatory cytokine production

    Journal: Nature Communications

    doi: 10.1038/ncomms7765

    TRAF6-mediated GSK3β ubiquitination at lysine 183 is critical for TLR3-dependent cytokine production. ( a ) BMDMs were stimulated with 10 μg ml −1 poly I:C for 10 min and subjected to immunoprecipitation with an anti-Ub antibody followed by western blotting with an anti-GSK3β antibody. ( b ) HEK293T cells transfected with HA-GSK3β and HA-Ub along with Flag-TRAF6 plasmids were subjected to immunoprecipitation with an anti-GSK3β antibody followed by western blotting with an anti-HA antibody. ( c ) HEK293T cells were transfected with HA-GSK3β and HA-Ub along with TRAF6 (WT) or TRAF6 (C70A) plasmids. These experiments were performed as described in b . ( d ) Traf6 +/+ and Traf6 −/− 3T3 cells stimulated with 10 μg ml −1 poly I:C for 10 min were subjected to immunoprecipitation with an anti-GSK3β antibody followed by western blotting with an anti-Ub antibody. ( e ) GSK3β proteins were incubated with E1, E2 and biotinylated-Ub (Bt-Ub) in the presence or absence of Flag-TRAF6 proteins for in vitro ubiquitination of GSK3β. Ubiquitination of GSK3β was analysed by western blotting with streptavidin-HRP. ( f ) HEK293T cells transfected with Ub and Flag-TRAF6 along with HA-GSK3β WT or various HA-GSK3β mutants were subjected to immunoprecipitation with an anti-HA antibody followed by western blotting with an anti-Ub antibody. ( g ) HEK293-TLR3 cells were transiently transfected with GSK3β (WT) or GSK3β (K183R) plasmids. The levels of IL-6, TNF-α and c-Fos mRNA were determined by real-time PCR analysis (top). GSK3β expression levels were confirmed by western blotting with an anti-HA antibody (bottom). A longer exposure of the HA blot shows the presence of ubiquitin ladder. Data are presented as the mean±s.d. from at least three independent experiments. Statistical analyses were calculated using the Student’s t -test (** P
    Figure Legend Snippet: TRAF6-mediated GSK3β ubiquitination at lysine 183 is critical for TLR3-dependent cytokine production. ( a ) BMDMs were stimulated with 10 μg ml −1 poly I:C for 10 min and subjected to immunoprecipitation with an anti-Ub antibody followed by western blotting with an anti-GSK3β antibody. ( b ) HEK293T cells transfected with HA-GSK3β and HA-Ub along with Flag-TRAF6 plasmids were subjected to immunoprecipitation with an anti-GSK3β antibody followed by western blotting with an anti-HA antibody. ( c ) HEK293T cells were transfected with HA-GSK3β and HA-Ub along with TRAF6 (WT) or TRAF6 (C70A) plasmids. These experiments were performed as described in b . ( d ) Traf6 +/+ and Traf6 −/− 3T3 cells stimulated with 10 μg ml −1 poly I:C for 10 min were subjected to immunoprecipitation with an anti-GSK3β antibody followed by western blotting with an anti-Ub antibody. ( e ) GSK3β proteins were incubated with E1, E2 and biotinylated-Ub (Bt-Ub) in the presence or absence of Flag-TRAF6 proteins for in vitro ubiquitination of GSK3β. Ubiquitination of GSK3β was analysed by western blotting with streptavidin-HRP. ( f ) HEK293T cells transfected with Ub and Flag-TRAF6 along with HA-GSK3β WT or various HA-GSK3β mutants were subjected to immunoprecipitation with an anti-HA antibody followed by western blotting with an anti-Ub antibody. ( g ) HEK293-TLR3 cells were transiently transfected with GSK3β (WT) or GSK3β (K183R) plasmids. The levels of IL-6, TNF-α and c-Fos mRNA were determined by real-time PCR analysis (top). GSK3β expression levels were confirmed by western blotting with an anti-HA antibody (bottom). A longer exposure of the HA blot shows the presence of ubiquitin ladder. Data are presented as the mean±s.d. from at least three independent experiments. Statistical analyses were calculated using the Student’s t -test (** P

    Techniques Used: Immunoprecipitation, Western Blot, Transfection, Incubation, In Vitro, Real-time Polymerase Chain Reaction, Expressing

    46) Product Images from "Longitudinal analysis of antigen specific response in individuals with Schistosoma mansoni infection in an endemic area of Minas Gerais, Brazil"

    Article Title: Longitudinal analysis of antigen specific response in individuals with Schistosoma mansoni infection in an endemic area of Minas Gerais, Brazil

    Journal: Transactions of the Royal Society of Tropical Medicine and Hygiene

    doi: 10.1093/trstmh/trt091

    A receiver operating characteristic (ROC) plot, illustrating the ability of IgG4/IgE anti-SEA antibodies to discriminate infected from uninfected individuals. Higher areas under the curve indicate better discrimination.
    Figure Legend Snippet: A receiver operating characteristic (ROC) plot, illustrating the ability of IgG4/IgE anti-SEA antibodies to discriminate infected from uninfected individuals. Higher areas under the curve indicate better discrimination.

    Techniques Used: Infection

    A receiver operating characteristic (ROC) plot, illustrating the ability of IgG anti-SEA antibodies to discriminate infected from uninfected individuals. Higher areas under the curve indicate better discrimination.
    Figure Legend Snippet: A receiver operating characteristic (ROC) plot, illustrating the ability of IgG anti-SEA antibodies to discriminate infected from uninfected individuals. Higher areas under the curve indicate better discrimination.

    Techniques Used: Infection

    47) Product Images from "Neointima formation in a restenosis model is suppressed in midkine-deficient mice"

    Article Title: Neointima formation in a restenosis model is suppressed in midkine-deficient mice

    Journal: Journal of Clinical Investigation

    doi:

    CD45 staining of paraffin sections from the mouse carotid artery after ligation. ( a and b ) 3 days after ligation; ( c and d ) 7 days after ligation. ( a and c ) Mdk +/+ mice; ( b and d ) Mdk –/– mice. Arrowheads indicate CD45-positive cells. Bar, 50 μm.
    Figure Legend Snippet: CD45 staining of paraffin sections from the mouse carotid artery after ligation. ( a and b ) 3 days after ligation; ( c and d ) 7 days after ligation. ( a and c ) Mdk +/+ mice; ( b and d ) Mdk –/– mice. Arrowheads indicate CD45-positive cells. Bar, 50 μm.

    Techniques Used: Staining, Ligation, Mouse Assay

    48) Product Images from "Proteomic Analysis of Early-Responsive Redox-Sensitive Proteins in Arabidopsis"

    Article Title: Proteomic Analysis of Early-Responsive Redox-Sensitive Proteins in Arabidopsis

    Journal: Journal of Proteome Research

    doi: 10.1021/pr200918f

    Oxidative modification of identified proteins in planta upon H 2 O 2 treatment. Transgenic plants expressing the protein of interest fused with the FLAG tag were vacuum infiltrated with either water (mock) or 5 mM H 2 O 2 . For analysis of AtCIAPIN1, eEF1α, and AtPTP1, free thiols in the total protein were labeled with BIAM during protein extraction. For analysis of AtNAP1;1 and AtPDIL1-1, free thiols in the samples were first alkylated by IAM. Samples were then treated with DTT and newly generated free thiols were labeled by BIAM. After that, FLAG-tagged protein from each sample was affinity purified, separated by SDS-PAGE, and detected by HRP-Conjugated Streptavidin (to determine the amount of BIAM attached to the FLAG-tagged protein) or by the anti-FLAG M2 antibody (to determine the amount of the total recombinant protein).
    Figure Legend Snippet: Oxidative modification of identified proteins in planta upon H 2 O 2 treatment. Transgenic plants expressing the protein of interest fused with the FLAG tag were vacuum infiltrated with either water (mock) or 5 mM H 2 O 2 . For analysis of AtCIAPIN1, eEF1α, and AtPTP1, free thiols in the total protein were labeled with BIAM during protein extraction. For analysis of AtNAP1;1 and AtPDIL1-1, free thiols in the samples were first alkylated by IAM. Samples were then treated with DTT and newly generated free thiols were labeled by BIAM. After that, FLAG-tagged protein from each sample was affinity purified, separated by SDS-PAGE, and detected by HRP-Conjugated Streptavidin (to determine the amount of BIAM attached to the FLAG-tagged protein) or by the anti-FLAG M2 antibody (to determine the amount of the total recombinant protein).

    Techniques Used: Modification, Transgenic Assay, Expressing, FLAG-tag, Labeling, Protein Extraction, Generated, Affinity Purification, SDS Page, Recombinant

    49) Product Images from "Identification of Michael Acceptor-Centric Pharmacophores with Substituents That Yield Strong Thioredoxin Reductase Inhibitory Character Correlated to Antiproliferative Activity"

    Article Title: Identification of Michael Acceptor-Centric Pharmacophores with Substituents That Yield Strong Thioredoxin Reductase Inhibitory Character Correlated to Antiproliferative Activity

    Journal: Antioxidants & Redox Signaling

    doi: 10.1089/ars.2012.4909

    Irreversibility of TrxR inhibition and selenocysteine (Sec) residue targeting by the DPPen and DPPro lead analogs. (A) Oxidized recombinant rat TrxR (110 n M ) in the presence or absence of 200 μ M NADPH was incubated with different concentrations of 2,2′-diOH-5,5′-diF-DPPen or 2-OH-5-F-DPPro for 20 min, and the TrxR activity was determined by the DTNB assay. All data points are means of two independent experiments. (B) Recombinant rat TrxR (0.9 μ M ) was incubated with 20 μ M of 2,2′-diOH-5,5′-diF-DPPen or 2-OH-5-F-DPPro for 20 min in a 50 mM Tris-HCl, 1 mN EDTA, pH 7.5 buffer containing 200 μ M NADPH. The excess drug was removed by passing the protein through a NAP-5-desalting column, followed by determination of the activity of the eluted protein at indicated times using the DTNB assay. (C) Recombinant rat TrxR (0.9 μ M ) was incubated with 200 μ M NADPH and 20 μ M of 2,2′-diOH-5,5′-diF-DPPen or 2-OH-5-F-DPPro. At different timepoints, an aliquot of enzyme mixture was withdrawn for TrxR activity measurement by the DTNB assay and N-(Biotinoyl)-N′-(Iodoacetyl) Ethylenediamine (BIAM) labeling of Sec at pH 6.5 and 8.5. Top panel: time course of TrxR enzyme activity; middle panel: horseradish peroxidase (HRP)-conjugated streptavidin detection of BIAM labeling of free selenol at pH 6.5 at various incubation times; bottom panel: HRP-conjugated streptavidin detection of BIAM labeling of free selenol and sulfhydryls at pH 8.5 at various incubation times. Results shown are representative of three independent experiments.
    Figure Legend Snippet: Irreversibility of TrxR inhibition and selenocysteine (Sec) residue targeting by the DPPen and DPPro lead analogs. (A) Oxidized recombinant rat TrxR (110 n M ) in the presence or absence of 200 μ M NADPH was incubated with different concentrations of 2,2′-diOH-5,5′-diF-DPPen or 2-OH-5-F-DPPro for 20 min, and the TrxR activity was determined by the DTNB assay. All data points are means of two independent experiments. (B) Recombinant rat TrxR (0.9 μ M ) was incubated with 20 μ M of 2,2′-diOH-5,5′-diF-DPPen or 2-OH-5-F-DPPro for 20 min in a 50 mM Tris-HCl, 1 mN EDTA, pH 7.5 buffer containing 200 μ M NADPH. The excess drug was removed by passing the protein through a NAP-5-desalting column, followed by determination of the activity of the eluted protein at indicated times using the DTNB assay. (C) Recombinant rat TrxR (0.9 μ M ) was incubated with 200 μ M NADPH and 20 μ M of 2,2′-diOH-5,5′-diF-DPPen or 2-OH-5-F-DPPro. At different timepoints, an aliquot of enzyme mixture was withdrawn for TrxR activity measurement by the DTNB assay and N-(Biotinoyl)-N′-(Iodoacetyl) Ethylenediamine (BIAM) labeling of Sec at pH 6.5 and 8.5. Top panel: time course of TrxR enzyme activity; middle panel: horseradish peroxidase (HRP)-conjugated streptavidin detection of BIAM labeling of free selenol at pH 6.5 at various incubation times; bottom panel: HRP-conjugated streptavidin detection of BIAM labeling of free selenol and sulfhydryls at pH 8.5 at various incubation times. Results shown are representative of three independent experiments.

    Techniques Used: Inhibition, Size-exclusion Chromatography, Recombinant, Incubation, Activity Assay, DTNB Assay, Labeling

    50) Product Images from "Detecting N-myristoylation and S-acylation of host and pathogen proteins in plants using click chemistry"

    Article Title: Detecting N-myristoylation and S-acylation of host and pathogen proteins in plants using click chemistry

    Journal: Plant Methods

    doi: 10.1186/s13007-016-0138-2

    Fatty acid modifications of proteins involved in plant immunity. a Arabidopsis protoplasts were transformed with HA epitope-tagged FLS2 wild-type (WT) or an fls2 mutant encoding C830S, C831S. Protoplasts were treated with 10 μM Alk14, incubated for 6 h, and cells collected. Total protein was extracted, FLS2 proteins immunoprecipitated using anti-HA resin, and click chemistry performed. Incorporated Alk14 was visualized by fluorescence imaging and total protein was detected by anti-HA western blotting. b Transgenic Arabidopsis plants conditionally expressing avrPto were treated with 20 μM dexamethasone to induce transgene expression. Leaves were infiltrated twice with 10 μM Alk12, 6 h after induction and 6 h before sampling. Tissue was collected 30 h after induction and total protein extracted. AvrPto was immunoprecipitated using anti-AvrPto resin and a biotin tag added using click chemistry. Streptavidin-HRP western blotting was used to detect incorporation of Alk12. Anti-AvrPto western blotting was used to verify equal amounts of protein in all samples. c Nicotiana benthamiana leaves were infiltrated with Agrobacterium strains carrying avrPto - YFP fusion constructs encoding the WT protein or a G2A mutant. 10 μM Alk12 was infiltrated twice, 24 h after Agrobacterium infiltration and 6 h before sampling. Tissue was collected 48 h after transformation and total protein extracted. AvrPto proteins were immunoprecipitated using anti-GFP resin and a biotin tag attached using click chemistry. Incorporated Alk12 was detected by streptavidin-HRP western blotting. The anti-GFP western blot shows relative protein levels. d Nicotiana benthamiana was used to transiently express Pto - YFP fusions encoding the WT protein or a G2A mutant. 10 μM Alk12 was infiltrated twice, 24 h after Agrobacterium infiltration and 6 h before sampling. Tissue was collected 48 h after transformation, total protein extracted, and Pto proteins immunoprecipitated using anti-GFP resin. A biotin tag was attached using click chemistry and incorporation of Alk12 was detected by streptavidin-HRP western blotting. Protein levels were visualized by anti-GFP western blotting
    Figure Legend Snippet: Fatty acid modifications of proteins involved in plant immunity. a Arabidopsis protoplasts were transformed with HA epitope-tagged FLS2 wild-type (WT) or an fls2 mutant encoding C830S, C831S. Protoplasts were treated with 10 μM Alk14, incubated for 6 h, and cells collected. Total protein was extracted, FLS2 proteins immunoprecipitated using anti-HA resin, and click chemistry performed. Incorporated Alk14 was visualized by fluorescence imaging and total protein was detected by anti-HA western blotting. b Transgenic Arabidopsis plants conditionally expressing avrPto were treated with 20 μM dexamethasone to induce transgene expression. Leaves were infiltrated twice with 10 μM Alk12, 6 h after induction and 6 h before sampling. Tissue was collected 30 h after induction and total protein extracted. AvrPto was immunoprecipitated using anti-AvrPto resin and a biotin tag added using click chemistry. Streptavidin-HRP western blotting was used to detect incorporation of Alk12. Anti-AvrPto western blotting was used to verify equal amounts of protein in all samples. c Nicotiana benthamiana leaves were infiltrated with Agrobacterium strains carrying avrPto - YFP fusion constructs encoding the WT protein or a G2A mutant. 10 μM Alk12 was infiltrated twice, 24 h after Agrobacterium infiltration and 6 h before sampling. Tissue was collected 48 h after transformation and total protein extracted. AvrPto proteins were immunoprecipitated using anti-GFP resin and a biotin tag attached using click chemistry. Incorporated Alk12 was detected by streptavidin-HRP western blotting. The anti-GFP western blot shows relative protein levels. d Nicotiana benthamiana was used to transiently express Pto - YFP fusions encoding the WT protein or a G2A mutant. 10 μM Alk12 was infiltrated twice, 24 h after Agrobacterium infiltration and 6 h before sampling. Tissue was collected 48 h after transformation, total protein extracted, and Pto proteins immunoprecipitated using anti-GFP resin. A biotin tag was attached using click chemistry and incorporation of Alk12 was detected by streptavidin-HRP western blotting. Protein levels were visualized by anti-GFP western blotting

    Techniques Used: Transformation Assay, Mutagenesis, Incubation, Immunoprecipitation, Fluorescence, Imaging, Western Blot, Transgenic Assay, Expressing, Sampling, Construct

    51) Product Images from "Live-cell mapping of organelle-associated RNAs via proximity biotinylation combined with protein-RNA crosslinking"

    Article Title: Live-cell mapping of organelle-associated RNAs via proximity biotinylation combined with protein-RNA crosslinking

    Journal: eLife

    doi: 10.7554/eLife.29224

    Characterization of APEX2 fusion constructs. HEK 293 T cells stably expressing the indicated constructs ( right ) were labeled and crosslinked via Protocol II ( Figure 1—figure supplement 1A ). Cell lysates were analyzed by SDS-PAGE, blotting with streptavidin-HRP, anti-V5 and anti-FLAG. L: ladder; U: untransfected HEK 293T cells. Anti-V5 and anti-FLAG blots ( bottom left ) measure fusion construct expression.
    Figure Legend Snippet: Characterization of APEX2 fusion constructs. HEK 293 T cells stably expressing the indicated constructs ( right ) were labeled and crosslinked via Protocol II ( Figure 1—figure supplement 1A ). Cell lysates were analyzed by SDS-PAGE, blotting with streptavidin-HRP, anti-V5 and anti-FLAG. L: ladder; U: untransfected HEK 293T cells. Anti-V5 and anti-FLAG blots ( bottom left ) measure fusion construct expression.

    Techniques Used: Construct, Stable Transfection, Expressing, Labeling, SDS Page

    52) Product Images from "Modulation of Antibody Responses to the V1V2 and V3 Regions of HIV-1 Envelope by Immune Complex Vaccines"

    Article Title: Modulation of Antibody Responses to the V1V2 and V3 Regions of HIV-1 Envelope by Immune Complex Vaccines

    Journal: Frontiers in Immunology

    doi: 10.3389/fimmu.2018.02441

    Serum Ab responses induced by gp120 A244 /mAb complex vaccines. Mice were immunized with gp120 AE.A244 in complex with human IgG1 mAbs specific for V2i (2158), V2i (697), CD4bs (1331E), V3 (2219), or with no mAb in the presence of adjuvant MPL/DDA. (A–C) Sera collected 2 weeks after the fourth immunization were tested in ELISA for IgG reactivity to gp120 (A) , V3 (B) , and V1V2 (C) . (D) Sera were also evaluated for cross-reactivity with V3 and V1V2 from viruses of different HIV-1 subtypes. (E) Further mapping of V2 epitope was performed using overlapping V2 peptides P1 to P9. V2 sequence logo is shown to indicate amino-acid variability within the defined epitope region (orange-shaded box). (F) Sera were subjected to competition ELISA using V1V2 C.ZM109-1FD6 to assess the presence of V1V2-specific serum Abs able to compete with conformation-dependent V2i mAb 830A. **** p
    Figure Legend Snippet: Serum Ab responses induced by gp120 A244 /mAb complex vaccines. Mice were immunized with gp120 AE.A244 in complex with human IgG1 mAbs specific for V2i (2158), V2i (697), CD4bs (1331E), V3 (2219), or with no mAb in the presence of adjuvant MPL/DDA. (A–C) Sera collected 2 weeks after the fourth immunization were tested in ELISA for IgG reactivity to gp120 (A) , V3 (B) , and V1V2 (C) . (D) Sera were also evaluated for cross-reactivity with V3 and V1V2 from viruses of different HIV-1 subtypes. (E) Further mapping of V2 epitope was performed using overlapping V2 peptides P1 to P9. V2 sequence logo is shown to indicate amino-acid variability within the defined epitope region (orange-shaded box). (F) Sera were subjected to competition ELISA using V1V2 C.ZM109-1FD6 to assess the presence of V1V2-specific serum Abs able to compete with conformation-dependent V2i mAb 830A. **** p

    Techniques Used: Mouse Assay, Enzyme-linked Immunosorbent Assay, Sequencing

    ADCP activity of immune sera from animals that received with gp120 A244 or gp120 A244 /mAb complexes. (A–C) Pooled sera from groups of mice immunized with gp120 AE.A244 in complex with different mAbs or no mAb were tested for the ability to mediate ADCP using phagocytic THP-1 cells and fluorescent beads coated with gp120 (A) , V1V2-1FD6 (B) , or cyclic V2 peptide (C) . No significant difference was observed among the groups. Sera from animals that received adjuvant MPL/DDA and PBS (no gp120) were included as negative controls. ADCP score was calculated by multiplying the percentage of bead-bearing cells with the geometric mean intensity of the cells and subtracting the background score. Cutoff value (dotted lines) was determined based on ADCP scores of cells and beads without serum.
    Figure Legend Snippet: ADCP activity of immune sera from animals that received with gp120 A244 or gp120 A244 /mAb complexes. (A–C) Pooled sera from groups of mice immunized with gp120 AE.A244 in complex with different mAbs or no mAb were tested for the ability to mediate ADCP using phagocytic THP-1 cells and fluorescent beads coated with gp120 (A) , V1V2-1FD6 (B) , or cyclic V2 peptide (C) . No significant difference was observed among the groups. Sera from animals that received adjuvant MPL/DDA and PBS (no gp120) were included as negative controls. ADCP score was calculated by multiplying the percentage of bead-bearing cells with the geometric mean intensity of the cells and subtracting the background score. Cutoff value (dotted lines) was determined based on ADCP scores of cells and beads without serum.

    Techniques Used: Activity Assay, Mouse Assay

    53) Product Images from "Bladder filling and voiding affect umbrella cell tight junction organization and function"

    Article Title: Bladder filling and voiding affect umbrella cell tight junction organization and function

    Journal: American Journal of Physiology - Renal Physiology

    doi: 10.1152/ajprenal.00282.2013

    TJ integrity is maintained in stretched uroepithelium. Bladder mucosa mounted in Ussing chambers was maintained in a quiescent, unstretched condition ( A ) or subjected to stretch ( B ). Ruthenium red permeability was used to assess the integrity of the TJs by TEM. The location of the TJ is indicated by arrows, and the upper portion of the lateral membrane is indicated by arrowheads. C : bladder uroepithelium mounted in Ussing chambers remained in a quiescent state (control) or stretched in the absence or presence of EGTA. Following 30 min, sulfo-NHS-biotin was added to the mucosal hemichamber for 15 min, and the tissue was then fixed in situ. Cryosections of frozen tissue were labeled with Alexa-488-streptavidin (green), TRITC-phalloidin (red), and ToPro-3 (blue). Note the diffusion of biotin into the underlying tissues in control samples treated with EGTA. Images are representative of three independent experiments.
    Figure Legend Snippet: TJ integrity is maintained in stretched uroepithelium. Bladder mucosa mounted in Ussing chambers was maintained in a quiescent, unstretched condition ( A ) or subjected to stretch ( B ). Ruthenium red permeability was used to assess the integrity of the TJs by TEM. The location of the TJ is indicated by arrows, and the upper portion of the lateral membrane is indicated by arrowheads. C : bladder uroepithelium mounted in Ussing chambers remained in a quiescent state (control) or stretched in the absence or presence of EGTA. Following 30 min, sulfo-NHS-biotin was added to the mucosal hemichamber for 15 min, and the tissue was then fixed in situ. Cryosections of frozen tissue were labeled with Alexa-488-streptavidin (green), TRITC-phalloidin (red), and ToPro-3 (blue). Note the diffusion of biotin into the underlying tissues in control samples treated with EGTA. Images are representative of three independent experiments.

    Techniques Used: Permeability, Transmission Electron Microscopy, In Situ, Labeling, Diffusion-based Assay

    Filling promotes expansion of the TJ ring, which is reversed upon voiding. A : en face view of the umbrella cell layer in full , voided , and quiescent bladders stained with an antibody to claudin-8. Image is a projection of a confocal Z-series. B : 3-D reconstruction of bladder epithelium stained with TRITC-phalloidin (red) and ToPro-3 (blue). C : 3-D reconstruction of umbrella cell layer from stretched tissues stained with antibodies to claudin-8 (green), TRITC-phalloidin (red), and ToPro-3 (blue). D : average length of TJ per umbrella cell (mean ± SE, n = 4). Values for voided and quiescent tissues are significantly different from those of full bladders ( P
    Figure Legend Snippet: Filling promotes expansion of the TJ ring, which is reversed upon voiding. A : en face view of the umbrella cell layer in full , voided , and quiescent bladders stained with an antibody to claudin-8. Image is a projection of a confocal Z-series. B : 3-D reconstruction of bladder epithelium stained with TRITC-phalloidin (red) and ToPro-3 (blue). C : 3-D reconstruction of umbrella cell layer from stretched tissues stained with antibodies to claudin-8 (green), TRITC-phalloidin (red), and ToPro-3 (blue). D : average length of TJ per umbrella cell (mean ± SE, n = 4). Values for voided and quiescent tissues are significantly different from those of full bladders ( P

    Techniques Used: Staining

    Cell shape changes and claudin and ZO-1 expression in full , voided , and quiescent rat bladders. A : cross-sections of bladder tissue were stained with antibodies to ZO-1 (green), TRITC-phalloidin (red), and ToPro-3 (blue). B : tissues were stained with an antibody to claudin-8 (green) and TRITC-phalloidin (red). The position of the TJ is indicated by arrows. Umbrella cells are outlined with dashed lines. Bottom : higher magnification views of the boxed region. C : Western blots of claudin-8 and -4 in full (F), voided (V), and quiescent (Q) bladders. GAPDH and actin expression were used as loading controls.
    Figure Legend Snippet: Cell shape changes and claudin and ZO-1 expression in full , voided , and quiescent rat bladders. A : cross-sections of bladder tissue were stained with antibodies to ZO-1 (green), TRITC-phalloidin (red), and ToPro-3 (blue). B : tissues were stained with an antibody to claudin-8 (green) and TRITC-phalloidin (red). The position of the TJ is indicated by arrows. Umbrella cells are outlined with dashed lines. Bottom : higher magnification views of the boxed region. C : Western blots of claudin-8 and -4 in full (F), voided (V), and quiescent (Q) bladders. GAPDH and actin expression were used as loading controls.

    Techniques Used: Expressing, Staining, Western Blot

    54) Product Images from "Bladder filling and voiding affect umbrella cell tight junction organization and function"

    Article Title: Bladder filling and voiding affect umbrella cell tight junction organization and function

    Journal: American Journal of Physiology - Renal Physiology

    doi: 10.1152/ajprenal.00282.2013

    TJ integrity is maintained in stretched uroepithelium. Bladder mucosa mounted in Ussing chambers was maintained in a quiescent, unstretched condition ( A ) or subjected to stretch ( B ). Ruthenium red permeability was used to assess the integrity of the TJs by TEM. The location of the TJ is indicated by arrows, and the upper portion of the lateral membrane is indicated by arrowheads. C : bladder uroepithelium mounted in Ussing chambers remained in a quiescent state (control) or stretched in the absence or presence of EGTA. Following 30 min, sulfo-NHS-biotin was added to the mucosal hemichamber for 15 min, and the tissue was then fixed in situ. Cryosections of frozen tissue were labeled with Alexa-488-streptavidin (green), TRITC-phalloidin (red), and ToPro-3 (blue). Note the diffusion of biotin into the underlying tissues in control samples treated with EGTA. Images are representative of three independent experiments.
    Figure Legend Snippet: TJ integrity is maintained in stretched uroepithelium. Bladder mucosa mounted in Ussing chambers was maintained in a quiescent, unstretched condition ( A ) or subjected to stretch ( B ). Ruthenium red permeability was used to assess the integrity of the TJs by TEM. The location of the TJ is indicated by arrows, and the upper portion of the lateral membrane is indicated by arrowheads. C : bladder uroepithelium mounted in Ussing chambers remained in a quiescent state (control) or stretched in the absence or presence of EGTA. Following 30 min, sulfo-NHS-biotin was added to the mucosal hemichamber for 15 min, and the tissue was then fixed in situ. Cryosections of frozen tissue were labeled with Alexa-488-streptavidin (green), TRITC-phalloidin (red), and ToPro-3 (blue). Note the diffusion of biotin into the underlying tissues in control samples treated with EGTA. Images are representative of three independent experiments.

    Techniques Used: Permeability, Transmission Electron Microscopy, In Situ, Labeling, Diffusion-based Assay

    55) Product Images from "The Interaction between Cell Adhesion Molecule L1, Matrix Metalloproteinase 14, and Adenine Nucleotide Translocator at the Plasma Membrane Regulates L1-Mediated Neurite Outgrowth of Murine Cerebellar Neurons"

    Article Title: The Interaction between Cell Adhesion Molecule L1, Matrix Metalloproteinase 14, and Adenine Nucleotide Translocator at the Plasma Membrane Regulates L1-Mediated Neurite Outgrowth of Murine Cerebellar Neurons

    Journal: The Journal of Neuroscience

    doi: 10.1523/JNEUROSCI.6165-11.2012

    Cell surface localization of ANT1 and ANT2. A – D , After cell surface biotinylation of live cerebellar neurons, biotinylated cell surface proteins were isolated using streptavidin-coupled beads ( A–C ), and ANT1 and ANT2 were immunoprecipitated using ANT1- and ANT2-specific antibodies ( D ). Cell lysates (input), isolated biotinylated proteins (surface) and the ANT1 and ANT2 immunoprecipitates (IP) were subjected to Western blot (WB) analysis using either ANT1-specific (ANT1; A ), ANT2-specific (ANT2; B ), or tubulin ( C ) antibodies or using HRP-conjugated streptavidin ( D ). The 60 kDa ANT protein seen after short time exposure (top) and the 32 kDa ANT protein seen after long time exposure (bottom) are indicated.
    Figure Legend Snippet: Cell surface localization of ANT1 and ANT2. A – D , After cell surface biotinylation of live cerebellar neurons, biotinylated cell surface proteins were isolated using streptavidin-coupled beads ( A–C ), and ANT1 and ANT2 were immunoprecipitated using ANT1- and ANT2-specific antibodies ( D ). Cell lysates (input), isolated biotinylated proteins (surface) and the ANT1 and ANT2 immunoprecipitates (IP) were subjected to Western blot (WB) analysis using either ANT1-specific (ANT1; A ), ANT2-specific (ANT2; B ), or tubulin ( C ) antibodies or using HRP-conjugated streptavidin ( D ). The 60 kDa ANT protein seen after short time exposure (top) and the 32 kDa ANT protein seen after long time exposure (bottom) are indicated.

    Techniques Used: Isolation, Immunoprecipitation, Western Blot

    56) Product Images from "Ischemic-Reperfusion Injury Increases Matrix Metalloproteinases and Tissue Metalloproteinase Inhibitors in Fetal Sheep Brain"

    Article Title: Ischemic-Reperfusion Injury Increases Matrix Metalloproteinases and Tissue Metalloproteinase Inhibitors in Fetal Sheep Brain

    Journal: Developmental neuroscience

    doi: 10.1159/000489700

    TIMP-1, −2, and −3 protein expression as the ratio to the internal control (IC) standard plotted against MMP-8 and −13 values normalized as the ratio to IC. Linear regression analysis shows a positive correlation between TIMP-1 and MMP-8 ( r = 0.67, n = 17, p
    Figure Legend Snippet: TIMP-1, −2, and −3 protein expression as the ratio to the internal control (IC) standard plotted against MMP-8 and −13 values normalized as the ratio to IC. Linear regression analysis shows a positive correlation between TIMP-1 and MMP-8 ( r = 0.67, n = 17, p

    Techniques Used: Expressing

    Representative Western immunoblots and bar graphs of MMP-8 and MMP-13 expression in the fetal cerebral cortex obtained from the sham ( n = 5), ischemia/reperfusion (I/R)-4 ( n = 5), −24 ( n = 5), and −48 ( n = 5) sheep. MMP-8 and MMP-13 expression gradually increased after ischemia. MMP-8 protein expression ( a ) was significantly higher 48 h after ischemia than in the sham group (Kruskal-Wallis, p = 0.04). However, statistical significance in MMP-13 expression ( b ) was not detected among the study groups (Kruskal-Wallis, p = 0.06). Means ± SD. IC, internal control. * p = 0.05.
    Figure Legend Snippet: Representative Western immunoblots and bar graphs of MMP-8 and MMP-13 expression in the fetal cerebral cortex obtained from the sham ( n = 5), ischemia/reperfusion (I/R)-4 ( n = 5), −24 ( n = 5), and −48 ( n = 5) sheep. MMP-8 and MMP-13 expression gradually increased after ischemia. MMP-8 protein expression ( a ) was significantly higher 48 h after ischemia than in the sham group (Kruskal-Wallis, p = 0.04). However, statistical significance in MMP-13 expression ( b ) was not detected among the study groups (Kruskal-Wallis, p = 0.06). Means ± SD. IC, internal control. * p = 0.05.

    Techniques Used: Western Blot, Expressing

    57) Product Images from "Ischemic-Reperfusion Injury Increases Matrix Metalloproteinases and Tissue Metalloproteinase Inhibitors in Fetal Sheep Brain"

    Article Title: Ischemic-Reperfusion Injury Increases Matrix Metalloproteinases and Tissue Metalloproteinase Inhibitors in Fetal Sheep Brain

    Journal: Developmental neuroscience

    doi: 10.1159/000489700

    TIMP-1, −2, and −3 protein expression as the ratio to the internal control (IC) standard plotted against MMP-8 and −13 values normalized as the ratio to IC. Linear regression analysis shows a positive correlation between TIMP-1 and MMP-8 ( r = 0.67, n = 17, p
    Figure Legend Snippet: TIMP-1, −2, and −3 protein expression as the ratio to the internal control (IC) standard plotted against MMP-8 and −13 values normalized as the ratio to IC. Linear regression analysis shows a positive correlation between TIMP-1 and MMP-8 ( r = 0.67, n = 17, p

    Techniques Used: Expressing

    Representative Western immunoblots and bar graphs of TIMP-1 ( a ), TIMP-2 ( b ), TIMP-3 ( c ), and TIMP-4 ( d ) expression in the fetal cerebral cortex obtained from the sham ( n = 5), I/R-4 ( n = 5), I/R-24 ( n = 5), and I/R-48 ( n = 5) sheep. TIMP-1, −2, and −3 expression levels were higher 24 than 4 h after ischemia. TIMP-1 and −3 expression levels were also higher in the I/R-24 group than in the sham group. TIMP-4 did not differ among groups (KruskalWallis, p = 0.15). Means ± SD. IC, internal control. * p
    Figure Legend Snippet: Representative Western immunoblots and bar graphs of TIMP-1 ( a ), TIMP-2 ( b ), TIMP-3 ( c ), and TIMP-4 ( d ) expression in the fetal cerebral cortex obtained from the sham ( n = 5), I/R-4 ( n = 5), I/R-24 ( n = 5), and I/R-48 ( n = 5) sheep. TIMP-1, −2, and −3 expression levels were higher 24 than 4 h after ischemia. TIMP-1 and −3 expression levels were also higher in the I/R-24 group than in the sham group. TIMP-4 did not differ among groups (KruskalWallis, p = 0.15). Means ± SD. IC, internal control. * p

    Techniques Used: Western Blot, Expressing

    58) Product Images from "Ischemic-Reperfusion Injury Increases Matrix Metalloproteinases and Tissue Metalloproteinase Inhibitors in Fetal Sheep Brain"

    Article Title: Ischemic-Reperfusion Injury Increases Matrix Metalloproteinases and Tissue Metalloproteinase Inhibitors in Fetal Sheep Brain

    Journal: Developmental neuroscience

    doi: 10.1159/000489700

    Representative Western immunoblots and bar graphs of TIMP-1 ( a ), TIMP-2 ( b ), TIMP-3 ( c ), and TIMP-4 ( d ) expression in the fetal cerebral cortex obtained from the sham ( n = 5), I/R-4 ( n = 5), I/R-24 ( n = 5), and I/R-48 ( n = 5) sheep. TIMP-1, −2, and −3 expression levels were higher 24 than 4 h after ischemia. TIMP-1 and −3 expression levels were also higher in the I/R-24 group than in the sham group. TIMP-4 did not differ among groups (KruskalWallis, p = 0.15). Means ± SD. IC, internal control. * p
    Figure Legend Snippet: Representative Western immunoblots and bar graphs of TIMP-1 ( a ), TIMP-2 ( b ), TIMP-3 ( c ), and TIMP-4 ( d ) expression in the fetal cerebral cortex obtained from the sham ( n = 5), I/R-4 ( n = 5), I/R-24 ( n = 5), and I/R-48 ( n = 5) sheep. TIMP-1, −2, and −3 expression levels were higher 24 than 4 h after ischemia. TIMP-1 and −3 expression levels were also higher in the I/R-24 group than in the sham group. TIMP-4 did not differ among groups (KruskalWallis, p = 0.15). Means ± SD. IC, internal control. * p

    Techniques Used: Western Blot, Expressing

    59) Product Images from "Characterization of the Antigenic Heterogeneity of Lipoarabinomannan, the Major Surface Glycolipid of Mycobacterium tuberculosis, and Complexity of Antibody Specificities toward This Antigen"

    Article Title: Characterization of the Antigenic Heterogeneity of Lipoarabinomannan, the Major Surface Glycolipid of Mycobacterium tuberculosis, and Complexity of Antibody Specificities toward This Antigen

    Journal: The Journal of Immunology Author Choice

    doi: 10.4049/jimmunol.1701673

    ( A ) Efficient detection of ManLAM via capture assays. ManLAM in buffer was captured in 96-well microtiter plates coated with CS-35, the FIND Abs, or P30B9 and detected with biotinylated A194-01 IgG using a sensitive ECL detection assay based on an AP-conjugated streptavidin reagent. ( B ) Demonstration of the ability to detect LAM in unprocessed urine from a panel of TB + /HIV-1 − patients, using a sensitive ECL assay based on an HRP-conjugated streptavidin reagent. ( C ) Signals obtained for titered concentrations of ManLAM diluted in buffer tested in this assay for comparison. A linear correlation was seen in this assay for the range of Ag concentrations tested and relative luminescence units (RLUs), with a lower limit
    Figure Legend Snippet: ( A ) Efficient detection of ManLAM via capture assays. ManLAM in buffer was captured in 96-well microtiter plates coated with CS-35, the FIND Abs, or P30B9 and detected with biotinylated A194-01 IgG using a sensitive ECL detection assay based on an AP-conjugated streptavidin reagent. ( B ) Demonstration of the ability to detect LAM in unprocessed urine from a panel of TB + /HIV-1 − patients, using a sensitive ECL assay based on an HRP-conjugated streptavidin reagent. ( C ) Signals obtained for titered concentrations of ManLAM diluted in buffer tested in this assay for comparison. A linear correlation was seen in this assay for the range of Ag concentrations tested and relative luminescence units (RLUs), with a lower limit

    Techniques Used: Detection Assay, Laser Capture Microdissection

    60) Product Images from "Simultaneous detection of nucleotide excision repair events and apoptosis-induced DNA fragmentation in genotoxin-treated cells"

    Article Title: Simultaneous detection of nucleotide excision repair events and apoptosis-induced DNA fragmentation in genotoxin-treated cells

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-20527-6

    Correlation between apoptotic signaling and the generation of large DNAs with decreased generation of excised oligonucleotide repair products. ( A ) Analysis of large DNA fragments and excised oligomers released from genomic DNA following UV irradiation. HeLa cells were exposed to 20 J/m 2 of UVC and incubated for the indicated time points. After extraction of low molecular weight of DNAs from the cells, the DNA molecules were labeled with biotin at 3′-end using terminal deoxynucleotidyl transferase (TdT). The labeled DNA molecules were separated by gel electrophoresis, transferred to a nylon membrane and immobilized by UV cross-linking. The membrane was then incubated with HRP-conjugated streptavidin, and the labeled DNA molecules were detected with a chemiluminescence reagent (upper panel). A small portion of the UV-irradiated cells were lysed and analyzed by SDS-PAGE and immunoblotting with the indicated antibodies. ( B ) Quantification of the excised oligonucleotide repair products and cleaved PARP signals as shown in ( A ). The relative signal intensities were determined by setting the highest signal to 100. The results were quantified and are plotted as mean and standard deviations. ( C ) Quantitative analysis of the excised repair products and the large DNA molecules. ( D ) Wild-type (AA8) and XPG mutant (UV135) CHO cell lines were exposed to UV and processed as described above for the detection of soluble DNAs.
    Figure Legend Snippet: Correlation between apoptotic signaling and the generation of large DNAs with decreased generation of excised oligonucleotide repair products. ( A ) Analysis of large DNA fragments and excised oligomers released from genomic DNA following UV irradiation. HeLa cells were exposed to 20 J/m 2 of UVC and incubated for the indicated time points. After extraction of low molecular weight of DNAs from the cells, the DNA molecules were labeled with biotin at 3′-end using terminal deoxynucleotidyl transferase (TdT). The labeled DNA molecules were separated by gel electrophoresis, transferred to a nylon membrane and immobilized by UV cross-linking. The membrane was then incubated with HRP-conjugated streptavidin, and the labeled DNA molecules were detected with a chemiluminescence reagent (upper panel). A small portion of the UV-irradiated cells were lysed and analyzed by SDS-PAGE and immunoblotting with the indicated antibodies. ( B ) Quantification of the excised oligonucleotide repair products and cleaved PARP signals as shown in ( A ). The relative signal intensities were determined by setting the highest signal to 100. The results were quantified and are plotted as mean and standard deviations. ( C ) Quantitative analysis of the excised repair products and the large DNA molecules. ( D ) Wild-type (AA8) and XPG mutant (UV135) CHO cell lines were exposed to UV and processed as described above for the detection of soluble DNAs.

    Techniques Used: Irradiation, Incubation, Molecular Weight, Labeling, Nucleic Acid Electrophoresis, SDS Page, Mutagenesis

    61) Product Images from "A Surface-Focused Biotinylation Procedure Identifies the Yersinia pestis Catalase KatY as a Membrane-Associated but Non-Surface-Located Protein ▿"

    Article Title: A Surface-Focused Biotinylation Procedure Identifies the Yersinia pestis Catalase KatY as a Membrane-Associated but Non-Surface-Located Protein ▿

    Journal:

    doi: 10.1128/AEM.02968-06

    Mass spectrometric analysis of surface-biotinylated proteins.
    Figure Legend Snippet: Mass spectrometric analysis of surface-biotinylated proteins.

    Techniques Used:

    62) Product Images from "Regulation of Homotypic Cell-Cell Adhesion by Branched N-Glycosylation of N-cadherin Extracellular EC2 and EC3 Domains *"

    Article Title: Regulation of Homotypic Cell-Cell Adhesion by Branched N-Glycosylation of N-cadherin Extracellular EC2 and EC3 Domains *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M109.060806

    Inhibition of N -glycans caused increased cell-cell adhesion in CHO-K1 cells with exogenous expression of N-cadherin. A , exogenous expression of N-cadherin was detected by Western blotting ( WB ) using anti-N-cadherin in CHO-K1 cells. Control , CHO-K1 with
    Figure Legend Snippet: Inhibition of N -glycans caused increased cell-cell adhesion in CHO-K1 cells with exogenous expression of N-cadherin. A , exogenous expression of N-cadherin was detected by Western blotting ( WB ) using anti-N-cadherin in CHO-K1 cells. Control , CHO-K1 with

    Techniques Used: Inhibition, Expressing, Western Blot

    Cis-dimerization of N-cadherin was affected in N -glycosylation mutants. A , cells were collected for co-immunoprecipitation ( IP ) using anti-N-cadherin, followed by SDS-PAGE and blotting ( WB ) with anti-N-cadherin and anti-β-catenin, respectively.
    Figure Legend Snippet: Cis-dimerization of N-cadherin was affected in N -glycosylation mutants. A , cells were collected for co-immunoprecipitation ( IP ) using anti-N-cadherin, followed by SDS-PAGE and blotting ( WB ) with anti-N-cadherin and anti-β-catenin, respectively.

    Techniques Used: Immunoprecipitation, SDS Page, Western Blot

    Analysis of N-glycan types of N-cadherin using glycosidases and L-PHA precipitation. A , CHO-K1 cell lysates expressing native and mutant N-cadherins were digested with PNGase F, followed by SDS-PAGE and Western blotting ( WB ) using anti-N-cadherin antibody.
    Figure Legend Snippet: Analysis of N-glycan types of N-cadherin using glycosidases and L-PHA precipitation. A , CHO-K1 cell lysates expressing native and mutant N-cadherins were digested with PNGase F, followed by SDS-PAGE and Western blotting ( WB ) using anti-N-cadherin antibody.

    Techniques Used: Expressing, Mutagenesis, SDS Page, Western Blot

    63) Product Images from "Covalent Label Transfer between Peroxisomal Importomer Components Reveals Export-driven Import Interactions *"

    Article Title: Covalent Label Transfer between Peroxisomal Importomer Components Reveals Export-driven Import Interactions *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M115.686501

    Labeling of PEX5C with Sulfo-SBED indicates that BED-PEX5C is unable to transfer the biotin label to itself. Label transfer was performed in buffers as described for the import assays in the absence of peroxisomes. The assays were allowed to proceed for the indicated times prior to UV irradiation. a , Coomassie staining of elution fractions 1–6 from PEX5C His tag purification indicates the presence of a low level of residual E. coli proteins. b , labeling of PEX5C with Sulfo-SBED was performed as outlined under “Experimental Procedures” and confirmed by SDS-PAGE and streptavidin-HRP blotting in the absence of reducing agents (loading equivalent to 50% loading from the label transfer assay). c , BED-PEX5C label transfer in the absence of peroxisomes probed with α-His-HRP. d , the blot shown in c stripped and reprobed with streptavidin-HRP. e , the images from c and d merged, indicating the absence of label transfer to PEX5C.
    Figure Legend Snippet: Labeling of PEX5C with Sulfo-SBED indicates that BED-PEX5C is unable to transfer the biotin label to itself. Label transfer was performed in buffers as described for the import assays in the absence of peroxisomes. The assays were allowed to proceed for the indicated times prior to UV irradiation. a , Coomassie staining of elution fractions 1–6 from PEX5C His tag purification indicates the presence of a low level of residual E. coli proteins. b , labeling of PEX5C with Sulfo-SBED was performed as outlined under “Experimental Procedures” and confirmed by SDS-PAGE and streptavidin-HRP blotting in the absence of reducing agents (loading equivalent to 50% loading from the label transfer assay). c , BED-PEX5C label transfer in the absence of peroxisomes probed with α-His-HRP. d , the blot shown in c stripped and reprobed with streptavidin-HRP. e , the images from c and d merged, indicating the absence of label transfer to PEX5C.

    Techniques Used: Labeling, Irradiation, Staining, Purification, SDS Page

    64) Product Images from "Cross-Reactive HIV-1 Neutralizing Monoclonal Antibodies Selected by Screening of an Immune Human Phage Library against an Envelope Glycoprotein (gp140) Isolated from a Patient (R2) with Broadly HIV-1 Neutralizing Antibodies"

    Article Title: Cross-Reactive HIV-1 Neutralizing Monoclonal Antibodies Selected by Screening of an Immune Human Phage Library against an Envelope Glycoprotein (gp140) Isolated from a Patient (R2) with Broadly HIV-1 Neutralizing Antibodies

    Journal: Virology

    doi: 10.1016/j.virol.2007.01.015

    Competition of m46 with anti-gp41 antibodies. 1 μg/ml gp140 89.6 was coated on 96-well plates. Two-fold serially diluted IgG m46, IgG 2F5 and Fab Z13 were added to the wells and biotinylated mouse monoclonal antibody (mAb) T3 and D3 at a constant concentration corresponding to 70% maximum binding was simultaneously added to the wells. Bound biotinylated T3 (A) and D3 (B) were detected using streptavidin-HRP at 450 nm.
    Figure Legend Snippet: Competition of m46 with anti-gp41 antibodies. 1 μg/ml gp140 89.6 was coated on 96-well plates. Two-fold serially diluted IgG m46, IgG 2F5 and Fab Z13 were added to the wells and biotinylated mouse monoclonal antibody (mAb) T3 and D3 at a constant concentration corresponding to 70% maximum binding was simultaneously added to the wells. Bound biotinylated T3 (A) and D3 (B) were detected using streptavidin-HRP at 450 nm.

    Techniques Used: Concentration Assay, Binding Assay

    Competition of m22 and m24 with other CD4bs and CD4i antibodies. Gp140 R2 was captured by the polyclonal sheep anti-gp120 antibody D7324 (5 μg/ml) coated in 96-well plates. Three-fold serially diluted sCD4, Fabs (m14, m16, m18, X5, m22, m24), and IgGs (b12, 17b) followed by addition of biotinylated m22 (A) or m24 (B), at a constant concentration (which leads to 70% of maximum binding) simultaneously to the wells. Bound antibodies were detected by streptavidin-HRP and measured as optical densities at 450 nm.
    Figure Legend Snippet: Competition of m22 and m24 with other CD4bs and CD4i antibodies. Gp140 R2 was captured by the polyclonal sheep anti-gp120 antibody D7324 (5 μg/ml) coated in 96-well plates. Three-fold serially diluted sCD4, Fabs (m14, m16, m18, X5, m22, m24), and IgGs (b12, 17b) followed by addition of biotinylated m22 (A) or m24 (B), at a constant concentration (which leads to 70% of maximum binding) simultaneously to the wells. Bound antibodies were detected by streptavidin-HRP and measured as optical densities at 450 nm.

    Techniques Used: Concentration Assay, Binding Assay

    Competition of m46 with anti-gp41, CD4bs and CD4i antibodies. Gp140 R2 was captured by the polyclonal sheep anti-gp120 antibody D7324 (5 μg/ml) coated on 96-well plates. Serially diluted sCD4, different Fabs (X5, m43, m45) and IgGs (b12, 2F5, 4E10, 2G12) were added, along with biotinylated m46 at a constant concentration that led to 70% of maximum binding, simultaneously to the wells. Bound antibodies were detected by streptavidin-HRP and measured as optical densities at 405 nm.
    Figure Legend Snippet: Competition of m46 with anti-gp41, CD4bs and CD4i antibodies. Gp140 R2 was captured by the polyclonal sheep anti-gp120 antibody D7324 (5 μg/ml) coated on 96-well plates. Serially diluted sCD4, different Fabs (X5, m43, m45) and IgGs (b12, 2F5, 4E10, 2G12) were added, along with biotinylated m46 at a constant concentration that led to 70% of maximum binding, simultaneously to the wells. Bound antibodies were detected by streptavidin-HRP and measured as optical densities at 405 nm.

    Techniques Used: Concentration Assay, Binding Assay

    65) Product Images from "Neointima formation in a restenosis model is suppressed in midkine-deficient mice"

    Article Title: Neointima formation in a restenosis model is suppressed in midkine-deficient mice

    Journal: Journal of Clinical Investigation

    doi:

    Expression of a macrophage monocyte marker and a neutrophil marker in inflammatory cells that accumulated in the intimal lesion 7 days after ligation. ( a and b ) Expression of MOMA-2, a monocyte-macrophage marker; ( c and d ) expression of 7/4, a neutrophil marker. ( a and c ) Mdk +/+ mice; ( b and d ) Mdk –/– mice. Bar, 25 μm.
    Figure Legend Snippet: Expression of a macrophage monocyte marker and a neutrophil marker in inflammatory cells that accumulated in the intimal lesion 7 days after ligation. ( a and b ) Expression of MOMA-2, a monocyte-macrophage marker; ( c and d ) expression of 7/4, a neutrophil marker. ( a and c ) Mdk +/+ mice; ( b and d ) Mdk –/– mice. Bar, 25 μm.

    Techniques Used: Expressing, Marker, Ligation, Mouse Assay

    66) Product Images from "B7x/B7-H4 modulates the adaptive immune response and ameliorates renal injury in antibody-mediated nephritis"

    Article Title: B7x/B7-H4 modulates the adaptive immune response and ameliorates renal injury in antibody-mediated nephritis

    Journal: Clinical and Experimental Immunology

    doi: 10.1111/cei.12452

    Exacerbated infiltration of immune cells, immunoglobulin (Ig)G deposition and inflammatory mediator expression in kidneys of B7x −/− mice post-nephrotoxic serum (NTS). (a,b) Immunohistochemical analysis of infiltrating CD3 + T cells and
    Figure Legend Snippet: Exacerbated infiltration of immune cells, immunoglobulin (Ig)G deposition and inflammatory mediator expression in kidneys of B7x −/− mice post-nephrotoxic serum (NTS). (a,b) Immunohistochemical analysis of infiltrating CD3 + T cells and

    Techniques Used: Expressing, Mouse Assay, Immunohistochemistry

    67) Product Images from "Biotinylation is a natural, albeit rare, modification of human histones"

    Article Title: Biotinylation is a natural, albeit rare, modification of human histones

    Journal: Molecular genetics and metabolism

    doi: 10.1016/j.ymgme.2011.08.030

    Comparison of histone extraction protocols, and specificity testing of streptavidin and anti-biotin Panel A: Nuclear histones were extracted from Jurkat cells (lanes 1, 5, and 9) or HeLa cells (lanes 3, 7, and 11) by using HCl; for comparison histones were extracted from Jurkat cells (lanes 2, 6, and 10) or HeLa cells (lanes 4, 8, and 12) by using H 2 SO 4 +TCA+acetone/HCl+acetone. Histones were probed with coomassie blue (lanes 1–4) and antibodies to the C-termini in histone H3 (lanes 5–8) and H4 (lanes 9–12). Panel B: HCl extracts of Jurkat cell histones (lanes 1, 4, 7, 10, and 13), recombinant human histone H4 (lanes 2, 5, 8, 11, and 14), and chemically biotinylated histone H4 (lanes 3, 6, 9, 12, and 15) were probed with streptavidin without biotin competitor (lanes 1–3) and with 5 mM free biotin (lanes 4–6), and with anti-biotin without biotin competitor (lanes 7–9) and with 5 mM free biotin (lanes 10–12), and with coomassie blue (lanes 13–15).
    Figure Legend Snippet: Comparison of histone extraction protocols, and specificity testing of streptavidin and anti-biotin Panel A: Nuclear histones were extracted from Jurkat cells (lanes 1, 5, and 9) or HeLa cells (lanes 3, 7, and 11) by using HCl; for comparison histones were extracted from Jurkat cells (lanes 2, 6, and 10) or HeLa cells (lanes 4, 8, and 12) by using H 2 SO 4 +TCA+acetone/HCl+acetone. Histones were probed with coomassie blue (lanes 1–4) and antibodies to the C-termini in histone H3 (lanes 5–8) and H4 (lanes 9–12). Panel B: HCl extracts of Jurkat cell histones (lanes 1, 4, 7, 10, and 13), recombinant human histone H4 (lanes 2, 5, 8, 11, and 14), and chemically biotinylated histone H4 (lanes 3, 6, 9, 12, and 15) were probed with streptavidin without biotin competitor (lanes 1–3) and with 5 mM free biotin (lanes 4–6), and with anti-biotin without biotin competitor (lanes 7–9) and with 5 mM free biotin (lanes 10–12), and with coomassie blue (lanes 13–15).

    Techniques Used: Recombinant

    Biotinylation marks can be detected in bulk extracts from human cells, using streptavidin and anti-biotin as probes Bulk extracts of histone extracts from various cell lineages were probed with streptavidin (panel A), anti-biotin (panel B), and the loading and transfer controls coomassie blue (panel C), anti-H3 (panel D), and anti-H4 (panel E). Panel F: Histones from HeLa cells were extracted with H 2 SO 4 +TCA+acetone/HCl+acetone. Ten or five microgram of histones were loaded per well. Blots were blocked with PBS containing 5% BSA. After probing with horseradish peroxidase-conjugated anti-biotin or Nutravidin, the blots were washed for 6 hrs, and exposed to autoradiography film for 1 min.
    Figure Legend Snippet: Biotinylation marks can be detected in bulk extracts from human cells, using streptavidin and anti-biotin as probes Bulk extracts of histone extracts from various cell lineages were probed with streptavidin (panel A), anti-biotin (panel B), and the loading and transfer controls coomassie blue (panel C), anti-H3 (panel D), and anti-H4 (panel E). Panel F: Histones from HeLa cells were extracted with H 2 SO 4 +TCA+acetone/HCl+acetone. Ten or five microgram of histones were loaded per well. Blots were blocked with PBS containing 5% BSA. After probing with horseradish peroxidase-conjugated anti-biotin or Nutravidin, the blots were washed for 6 hrs, and exposed to autoradiography film for 1 min.

    Techniques Used: Autoradiography

    Specificity of antibodies to H3K4bio, H3K9bio and H3K18bio Panel A: Confirmation of equal loading of peptides H3K4bio, H3K9bio, and H3K18bio with streptavidin. Panel B: Transblots of peptides N 1–25 (non-biotinylated negative control), H3K4bio, H3K9bio, and H3K18bio were probed with anti-H3K4bio (left), anti-H3K9bio (middle), and anti-H3K18bio (right). Panel C: HCl extracts of histones from Jurkat cells were probed using streptavidin, anti-H3K9bio, and anti-H3K18bio; samples of biotin-free histones (“-”) were generated by using avidin agarose. Panel D: Bulk HCl extracts of histones from Jurkat cells were probed with anti-H3K9bio (top) and anti-H3K18bio (bottom) after pre-incubation of antibodies with increasing amounts of competing peptides H3K4bio, H3K9bio, and H3K18bio; controls (“C”) were prepared without peptide competitors. Note the difference in the order of peptide competitors in the two gels. For some gels, bands from the same analytical runs were electronically re-arranged to facilitate comparisons. Panel E: Peptides H3K9bio, H3K9ac, and H3K9me2 were probed with streptavidin (lanes 1, 2, 9 and 10), anti-H3K9bio (lanes 3, 4, 11 and 12), anti-H3K9ac (lanes 5 and 6), and anti-H3K9me2 (lanes 13 and 14); Ponceau S was used as loading control (lanes 7, 8, 15 and 16). Panel F: Peptides H3K18bio and H3K18ac were probed with streptavidin (lanes 1 and 2), anti-H3K18bio (lanes 3 and 4) and anti-H3K18ac (lanes 5 and 6); Ponceau S was used as loading control (lanes 7 and 8).
    Figure Legend Snippet: Specificity of antibodies to H3K4bio, H3K9bio and H3K18bio Panel A: Confirmation of equal loading of peptides H3K4bio, H3K9bio, and H3K18bio with streptavidin. Panel B: Transblots of peptides N 1–25 (non-biotinylated negative control), H3K4bio, H3K9bio, and H3K18bio were probed with anti-H3K4bio (left), anti-H3K9bio (middle), and anti-H3K18bio (right). Panel C: HCl extracts of histones from Jurkat cells were probed using streptavidin, anti-H3K9bio, and anti-H3K18bio; samples of biotin-free histones (“-”) were generated by using avidin agarose. Panel D: Bulk HCl extracts of histones from Jurkat cells were probed with anti-H3K9bio (top) and anti-H3K18bio (bottom) after pre-incubation of antibodies with increasing amounts of competing peptides H3K4bio, H3K9bio, and H3K18bio; controls (“C”) were prepared without peptide competitors. Note the difference in the order of peptide competitors in the two gels. For some gels, bands from the same analytical runs were electronically re-arranged to facilitate comparisons. Panel E: Peptides H3K9bio, H3K9ac, and H3K9me2 were probed with streptavidin (lanes 1, 2, 9 and 10), anti-H3K9bio (lanes 3, 4, 11 and 12), anti-H3K9ac (lanes 5 and 6), and anti-H3K9me2 (lanes 13 and 14); Ponceau S was used as loading control (lanes 7, 8, 15 and 16). Panel F: Peptides H3K18bio and H3K18ac were probed with streptavidin (lanes 1 and 2), anti-H3K18bio (lanes 3 and 4) and anti-H3K18ac (lanes 5 and 6); Ponceau S was used as loading control (lanes 7 and 8).

    Techniques Used: Negative Control, Generated, Avidin-Biotin Assay, Incubation

    Specificity of antibodies to H4K8bio and H4K12bio Panel A: Transblots of peptides N 1–19 (non-biotinylated negative control), H4K8bio, and H4K12bio were probed with anti-H4K8bio; pre-immune serum was used as negative control. Panel B: HCl extracts of histones from Jurkat cells were probed using streptavidin and anti-H4K8bio; samples of biotin-free histones (“-”) were generated by using avidin agarose. Panel C: HCl extracts of histones from Jurkat cells were probed with anti-H4K8bio after pre-incubation of antibodies with increasing amounts of competing peptides H4K8bio and H4K12bio; controls (“C”) were prepared without peptide competitors. For some gels, bands from the same analytical runs were electronically rearranged to facilitate comparisons. Panel D: Peptides H4K8bio and H4K8ac were probed with streptavidin (lanes 1 and 2), anti-H4K8bio (lanes 3 and 4) and anti-H4K8ac (lanes 5 and 6); Ponceau S was used as loading control (lanes 7 and 8). Panel E: Peptides H4K12bio and H4K12ac were probed with streptavidin (lanes 1 and 2), anti-H4K12bio (lanes 3 and 4) and anti-H4K12ac (lanes 5 and 6); Ponceau S was used as loading control (lanes 7 and 8).
    Figure Legend Snippet: Specificity of antibodies to H4K8bio and H4K12bio Panel A: Transblots of peptides N 1–19 (non-biotinylated negative control), H4K8bio, and H4K12bio were probed with anti-H4K8bio; pre-immune serum was used as negative control. Panel B: HCl extracts of histones from Jurkat cells were probed using streptavidin and anti-H4K8bio; samples of biotin-free histones (“-”) were generated by using avidin agarose. Panel C: HCl extracts of histones from Jurkat cells were probed with anti-H4K8bio after pre-incubation of antibodies with increasing amounts of competing peptides H4K8bio and H4K12bio; controls (“C”) were prepared without peptide competitors. For some gels, bands from the same analytical runs were electronically rearranged to facilitate comparisons. Panel D: Peptides H4K8bio and H4K8ac were probed with streptavidin (lanes 1 and 2), anti-H4K8bio (lanes 3 and 4) and anti-H4K8ac (lanes 5 and 6); Ponceau S was used as loading control (lanes 7 and 8). Panel E: Peptides H4K12bio and H4K12ac were probed with streptavidin (lanes 1 and 2), anti-H4K12bio (lanes 3 and 4) and anti-H4K12ac (lanes 5 and 6); Ponceau S was used as loading control (lanes 7 and 8).

    Techniques Used: Negative Control, Generated, Avidin-Biotin Assay, Incubation

    Validation of the biotin depletion and repletion protocol Panel A: Jurkat cells after a 2-wk depletion in biotin-deficient medium (0.025 nM, lane 1) compared with cells cultured in medium containing a physiological concentration of biotin (0.25 nM) (lane 2), and cells after a 1-wk repletion in medium containing a pharmacological concentration of biotin (10 nM) (lane 3). Biotinylated carboxylases were probed using streptavidin (SA). Equal expression, loading, and transfer of carboxylases was confirmed using anti-PC and anti-PCC. Panel B: As described for panel A, but HeLa cells (lanes 4–6) were substituted for Jurkat cells.
    Figure Legend Snippet: Validation of the biotin depletion and repletion protocol Panel A: Jurkat cells after a 2-wk depletion in biotin-deficient medium (0.025 nM, lane 1) compared with cells cultured in medium containing a physiological concentration of biotin (0.25 nM) (lane 2), and cells after a 1-wk repletion in medium containing a pharmacological concentration of biotin (10 nM) (lane 3). Biotinylated carboxylases were probed using streptavidin (SA). Equal expression, loading, and transfer of carboxylases was confirmed using anti-PC and anti-PCC. Panel B: As described for panel A, but HeLa cells (lanes 4–6) were substituted for Jurkat cells.

    Techniques Used: Cell Culture, Concentration Assay, Expressing, Periodic Counter-current Chromatography

    68) Product Images from "Role of receptor polymorphism and glycosylation in syncytium induction and host range variation of ecotropic mouse gammaretroviruses"

    Article Title: Role of receptor polymorphism and glycosylation in syncytium induction and host range variation of ecotropic mouse gammaretroviruses

    Journal: Retrovirology

    doi: 10.1186/1742-4690-5-2

    Effect of glycosylation inhibitors on expression of HA-tagged mCAT-1 in M. dunni cells. (A) Immunoblot analysis of lysates prepared from cells treated for 3 days with the indicated inhibitors: DMM, CST, Sw, DMN (65 μg/ml); 2DG (10 mM); Tu (0.125 ug/ml). (B) Immunoblot of surface biotinylated proteins from DMM-treated and untreated cells. The upper panel was probed with anti-HA; the lower panel shows the same blot stripped and reprobedwith streptavidin-HRP to show that surface biotinylation and protein loading were approximately equal.
    Figure Legend Snippet: Effect of glycosylation inhibitors on expression of HA-tagged mCAT-1 in M. dunni cells. (A) Immunoblot analysis of lysates prepared from cells treated for 3 days with the indicated inhibitors: DMM, CST, Sw, DMN (65 μg/ml); 2DG (10 mM); Tu (0.125 ug/ml). (B) Immunoblot of surface biotinylated proteins from DMM-treated and untreated cells. The upper panel was probed with anti-HA; the lower panel shows the same blot stripped and reprobedwith streptavidin-HRP to show that surface biotinylation and protein loading were approximately equal.

    Techniques Used: Expressing

    69) Product Images from "Functional test of PCDHB11, the most human-specific neuronal surface protein"

    Article Title: Functional test of PCDHB11, the most human-specific neuronal surface protein

    Journal: BMC Evolutionary Biology

    doi: 10.1186/s12862-016-0652-x

    Expression of protocadherins. GFP was electroporated alone or in combination with protocadherins into K562 cells. a Immunoblotting of cell lysates with anti-GFP shows bands compatible with the expected molecular weights for GFP (27 kDa) and mature PCDHB11-GFP (110 kDa); image representative of three transfections. b Immunoblotting of cell lysates with anti-HA shows bands compatible with the expected molecular weights for mature HA-PCDHB11-GFP (113 kDa) and HA-PCDHGA3 (99 kDa); image representative of two transfections. c Proportion of medium and large clusters was lower in HA-PCDHB11-GFP-transfected than in HA-PCDHGA3-transfected cells, but higher than in control cells ( n = 10-12 images per condition). d Proportion of medium to large cell clusters when normalized by HA-PCDHGA3. For visualization of surface protocadherins, live cells transfected with GFP alone (e) or in combination with HA-PCDHB11-GFP (f) or HA-PCDHGA3 (g) were stained with anti-HA-biotin and streptavidin-Alexa555, then fixed. Blue: DAPI. Green: GFP. Red: surface HA-tagged protocadherins. Scale bar: 10 μm
    Figure Legend Snippet: Expression of protocadherins. GFP was electroporated alone or in combination with protocadherins into K562 cells. a Immunoblotting of cell lysates with anti-GFP shows bands compatible with the expected molecular weights for GFP (27 kDa) and mature PCDHB11-GFP (110 kDa); image representative of three transfections. b Immunoblotting of cell lysates with anti-HA shows bands compatible with the expected molecular weights for mature HA-PCDHB11-GFP (113 kDa) and HA-PCDHGA3 (99 kDa); image representative of two transfections. c Proportion of medium and large clusters was lower in HA-PCDHB11-GFP-transfected than in HA-PCDHGA3-transfected cells, but higher than in control cells ( n = 10-12 images per condition). d Proportion of medium to large cell clusters when normalized by HA-PCDHGA3. For visualization of surface protocadherins, live cells transfected with GFP alone (e) or in combination with HA-PCDHB11-GFP (f) or HA-PCDHGA3 (g) were stained with anti-HA-biotin and streptavidin-Alexa555, then fixed. Blue: DAPI. Green: GFP. Red: surface HA-tagged protocadherins. Scale bar: 10 μm

    Techniques Used: Expressing, Transfection, Staining

    70) Product Images from "The splicing regulator PTBP2 is an AID interacting protein and promotes binding of AID to switch region DNA"

    Article Title: The splicing regulator PTBP2 is an AID interacting protein and promotes binding of AID to switch region DNA

    Journal: Nature immunology

    doi: 10.1038/ni.1977

    AID interacts with PTBP2. (a) Schematic representation of the AID expression construct (biotagDM-AID). The lysine that is biotinylated by BirA is indicated with an asterisk. The H56R,E58Q mutation inactivates the DNA deaminase activity of AID. (b) Protein extracts derived from stimulated CH12 BirA or CH12 BirA/biotagDM-AID cells were analyzed on immunoblots with AID antibodies. (c) Cell extracts from CH12 BirA or CH12 BirA/biotagDM-AID were incubated with streptavidin-agarose beads and bound proteins analyzed by immunoblotting with AID antibodies (upper) or streptavidin-coupled to horseradish-peroxidase (SA-HRP, lower). (d) DM-AID binds to S μ . Cross-linked DNA protein complexes from unstimulated or CIT-stimulated CH12 BirA/biotagDM-AID cells were subjected to modified ChIP in which steptavidin-agarose replaced antibodies used in conventional ChIP. Three-fold dilutions of DNA bound to streptavidin agarose were analyzed by PCR for the presence of S μ or the μ promoter. (e-f) Whole cell extracts derived from anti-CD40+IL-4-stimulated wild-type or AID-deficient mouse splenic B cells were immunoprecipitated with AID ( e ) or PTBP2 ( f ) antibodies and the immunoprecipitates were probed with anti-PTBP2 or anti-AID, respectively on immunoblots. E1 and E2 are two elutions of bound proteins. The data are representative of two independent experiments.
    Figure Legend Snippet: AID interacts with PTBP2. (a) Schematic representation of the AID expression construct (biotagDM-AID). The lysine that is biotinylated by BirA is indicated with an asterisk. The H56R,E58Q mutation inactivates the DNA deaminase activity of AID. (b) Protein extracts derived from stimulated CH12 BirA or CH12 BirA/biotagDM-AID cells were analyzed on immunoblots with AID antibodies. (c) Cell extracts from CH12 BirA or CH12 BirA/biotagDM-AID were incubated with streptavidin-agarose beads and bound proteins analyzed by immunoblotting with AID antibodies (upper) or streptavidin-coupled to horseradish-peroxidase (SA-HRP, lower). (d) DM-AID binds to S μ . Cross-linked DNA protein complexes from unstimulated or CIT-stimulated CH12 BirA/biotagDM-AID cells were subjected to modified ChIP in which steptavidin-agarose replaced antibodies used in conventional ChIP. Three-fold dilutions of DNA bound to streptavidin agarose were analyzed by PCR for the presence of S μ or the μ promoter. (e-f) Whole cell extracts derived from anti-CD40+IL-4-stimulated wild-type or AID-deficient mouse splenic B cells were immunoprecipitated with AID ( e ) or PTBP2 ( f ) antibodies and the immunoprecipitates were probed with anti-PTBP2 or anti-AID, respectively on immunoblots. E1 and E2 are two elutions of bound proteins. The data are representative of two independent experiments.

    Techniques Used: Expressing, Construct, Mutagenesis, Activity Assay, Derivative Assay, Western Blot, Incubation, Modification, Chromatin Immunoprecipitation, Polymerase Chain Reaction, Immunoprecipitation

    71) Product Images from "Protein Complex Interactor Analysis and Differential Activity of KDM3 Subfamily Members Towards H3K9 Methylation"

    Article Title: Protein Complex Interactor Analysis and Differential Activity of KDM3 Subfamily Members Towards H3K9 Methylation

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0060549

    SCAI is a specific interactor candidate of KDM3B. (A) SCAI protein sequence with the peptides identified by MS highlighted in red. The amino acids marked in green indicate trypsin cleavage sites. SCAI sequence coverage by MS was 51%. (B) Reciprocal co-immunoprecipitation of SCAI and KDM3B. V5-SCAI was either co-expressed with Avi-KDM3A or Avi-KDM3B. Reciprocal co-immunoprecipitations using V5- antibodies or streptavidin-coated beads were performed and the immunoprecipitated proteins from each immunoprecipitation were separated on SDS gels. A V5-antibody and streptavidin-HRP were used to detect SCAI and KDM3A or KDM3B, respectively. Only KDM3B but not KDM3A co-precipitated with and was able to precipitate V5-SCAI, respectively. (C) Sub-cellular co-localization of KDM3B and SCAI in HEK293T cells. Avi-KDM3B and V5-SCAI were co-expressed in HEK293T cells and detected by immunoreagents against their respective tags (b and c). The two proteins were found to co-localize in the nucleus (d).
    Figure Legend Snippet: SCAI is a specific interactor candidate of KDM3B. (A) SCAI protein sequence with the peptides identified by MS highlighted in red. The amino acids marked in green indicate trypsin cleavage sites. SCAI sequence coverage by MS was 51%. (B) Reciprocal co-immunoprecipitation of SCAI and KDM3B. V5-SCAI was either co-expressed with Avi-KDM3A or Avi-KDM3B. Reciprocal co-immunoprecipitations using V5- antibodies or streptavidin-coated beads were performed and the immunoprecipitated proteins from each immunoprecipitation were separated on SDS gels. A V5-antibody and streptavidin-HRP were used to detect SCAI and KDM3A or KDM3B, respectively. Only KDM3B but not KDM3A co-precipitated with and was able to precipitate V5-SCAI, respectively. (C) Sub-cellular co-localization of KDM3B and SCAI in HEK293T cells. Avi-KDM3B and V5-SCAI were co-expressed in HEK293T cells and detected by immunoreagents against their respective tags (b and c). The two proteins were found to co-localize in the nucleus (d).

    Techniques Used: Sequencing, Mass Spectrometry, Immunoprecipitation

    72) Product Images from "Novel Molecular Multilevel Targeted Antitumor Agents"

    Article Title: Novel Molecular Multilevel Targeted Antitumor Agents

    Journal: Cancer translational medicine

    doi: 10.4103/ctm.ctm_12_17

    (A,B) Flow cytometry for IL-13RA2 in U-251 GBM cells. Isotype control (A) and (B) receptor detection at various timepoints. Highly purified IL-13.E13K-D2-NLS-cys (C) and IL-13.E13K-D2-LLS-cys (D) . (E) Immunoblot of non-biotinylated (lane 1) and biotinylated (lane 2) IL-13.E13K-D2-LLS-cys probed with streptavidin-HRP. (F,G) Internalization of biotinylated IL-13.E13K-D2-LLS-cys (1 µM) in U-251 MG cells. The cells were analyzed using anti-streptavidin Alexa Fluor 555 (red) by fluorescence microscopy. Two different fields are shown in two column panels. (H) U-251-MG cells were treated with biotin-labeled IL-13.E13K-D2-LLS-cys (1 µM) and cells were stained for the nuclei and the protein. DIC, differential interference contrast. (I) Subcellular localization of IL-13.E13K-D2-LLS-cys was monitored using Z-stack analysis. (J) Internalization and intracellular distribution of IL-13.E13K-D2-LLS-cys. U-251 MG cells were incubated for 8 hrs with 1 µM biotin-conjugated IL-13.E13K-D2-LLS-cys (red) with co-staining of LAMP-1 protein (green).
    Figure Legend Snippet: (A,B) Flow cytometry for IL-13RA2 in U-251 GBM cells. Isotype control (A) and (B) receptor detection at various timepoints. Highly purified IL-13.E13K-D2-NLS-cys (C) and IL-13.E13K-D2-LLS-cys (D) . (E) Immunoblot of non-biotinylated (lane 1) and biotinylated (lane 2) IL-13.E13K-D2-LLS-cys probed with streptavidin-HRP. (F,G) Internalization of biotinylated IL-13.E13K-D2-LLS-cys (1 µM) in U-251 MG cells. The cells were analyzed using anti-streptavidin Alexa Fluor 555 (red) by fluorescence microscopy. Two different fields are shown in two column panels. (H) U-251-MG cells were treated with biotin-labeled IL-13.E13K-D2-LLS-cys (1 µM) and cells were stained for the nuclei and the protein. DIC, differential interference contrast. (I) Subcellular localization of IL-13.E13K-D2-LLS-cys was monitored using Z-stack analysis. (J) Internalization and intracellular distribution of IL-13.E13K-D2-LLS-cys. U-251 MG cells were incubated for 8 hrs with 1 µM biotin-conjugated IL-13.E13K-D2-LLS-cys (red) with co-staining of LAMP-1 protein (green).

    Techniques Used: Flow Cytometry, Cytometry, Purification, Fluorescence, Microscopy, Labeling, Staining, Incubation

    (A) Purified recombinant IL-13-D2-KK2 protein. SDS-PAGE stained with Coommassie blue. (B) Immunoblot of biotinylated IL-13-D2-KK2 probed with Streptavidin-HRP. (C) Cell internalization of biotinylated IL-13-D2-KK2. The protein was analyzed by using anti-streptavidin Alexa Fluor 555 and fluorescent microscopy. (D) U-251 cells were treated with biotinylated IL-13-D2-KK2 for 8 hrs and the co-localization of biotinylated IL-13-D2-KK2 with mitochondrial ATP-synthase enzyme was analyzed by confocal microscopy. (E) IL-13-D2-KK2 effect on GBM cell lines U-251 MG, G48a and T98G analyzed using phase contrast microscopy. (F) GBM cells were treated with IL-13-D2-KK2 for 72 hrs and the cytotoxicity was measured by an MTS assay.
    Figure Legend Snippet: (A) Purified recombinant IL-13-D2-KK2 protein. SDS-PAGE stained with Coommassie blue. (B) Immunoblot of biotinylated IL-13-D2-KK2 probed with Streptavidin-HRP. (C) Cell internalization of biotinylated IL-13-D2-KK2. The protein was analyzed by using anti-streptavidin Alexa Fluor 555 and fluorescent microscopy. (D) U-251 cells were treated with biotinylated IL-13-D2-KK2 for 8 hrs and the co-localization of biotinylated IL-13-D2-KK2 with mitochondrial ATP-synthase enzyme was analyzed by confocal microscopy. (E) IL-13-D2-KK2 effect on GBM cell lines U-251 MG, G48a and T98G analyzed using phase contrast microscopy. (F) GBM cells were treated with IL-13-D2-KK2 for 72 hrs and the cytotoxicity was measured by an MTS assay.

    Techniques Used: Purification, Recombinant, SDS Page, Staining, Microscopy, Confocal Microscopy, MTS Assay

    73) Product Images from "Selenium-Based S-Adenosylmethionine Analog Reveals the Mammalian Seven-Beta-Strand Methyltransferase METTL10 to Be an EF1A1 Lysine Methyltransferase"

    Article Title: Selenium-Based S-Adenosylmethionine Analog Reveals the Mammalian Seven-Beta-Strand Methyltransferase METTL10 to Be an EF1A1 Lysine Methyltransferase

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0105394

    ProSeAM, a synthetic SAM analog, has a wide spectrum of reactivity for histones and non-histone substrates. A, Schematic overview for analyzing lysine methylation. A synthetic cofactor was used to transfer an alkyne moiety to the ε-amino group of lysine by KMTs (1). The modified proteins were tagged with biotin via CuAAC reaction (2). Tagged-proteins in the crude lysates were pulled down with affinity beads (3), and the precipitants were further analyzed with a LC-MS apparatus (4). B, Chemical structure of SAM (1), propargylated SAM (2) and ProSeAM (3). C, H3 peptide (1-21 a.a.) and ProSeAM was incubated with or without GST-G9a at 20°C for 2 h, then the peptide was analyzed by MALDI-TOF MS. D, full-length Histone H3 (1 µg) and ProSeAM (500 µM) were incubated with indicated KMTs (0.5 µg) for 2 h at 20°C. The histones were separated by SDS-PAGE, transferred to a nitrocellulose membrane and probed with streptavidin-HRP (top) or anti-Histone H3 antibody (bottom). E, The non-histone substrates His-HSP90 and His-HSP70 (1 µg) were incubated with His-SMYD2 and His-METTL21A (1 µg), respectively. After the reaction, proteins were separated by SDS-PAGE (right). Their modifications were detected by western blotting with streptavidin-HRP as in Fig. 1D. *and ** showed automodification of SMYD2 and METTL21A, respectively (left). F, His-HSP70 (WT and K561R) were incubated with or without His-METTL21A in the presence of ProSeAM for 2 h at 20°C. Modified proteins were biotinylated and detected with streptavidin-HRP (top) or anti-HSP70 antibody for the loading control (bottom).
    Figure Legend Snippet: ProSeAM, a synthetic SAM analog, has a wide spectrum of reactivity for histones and non-histone substrates. A, Schematic overview for analyzing lysine methylation. A synthetic cofactor was used to transfer an alkyne moiety to the ε-amino group of lysine by KMTs (1). The modified proteins were tagged with biotin via CuAAC reaction (2). Tagged-proteins in the crude lysates were pulled down with affinity beads (3), and the precipitants were further analyzed with a LC-MS apparatus (4). B, Chemical structure of SAM (1), propargylated SAM (2) and ProSeAM (3). C, H3 peptide (1-21 a.a.) and ProSeAM was incubated with or without GST-G9a at 20°C for 2 h, then the peptide was analyzed by MALDI-TOF MS. D, full-length Histone H3 (1 µg) and ProSeAM (500 µM) were incubated with indicated KMTs (0.5 µg) for 2 h at 20°C. The histones were separated by SDS-PAGE, transferred to a nitrocellulose membrane and probed with streptavidin-HRP (top) or anti-Histone H3 antibody (bottom). E, The non-histone substrates His-HSP90 and His-HSP70 (1 µg) were incubated with His-SMYD2 and His-METTL21A (1 µg), respectively. After the reaction, proteins were separated by SDS-PAGE (right). Their modifications were detected by western blotting with streptavidin-HRP as in Fig. 1D. *and ** showed automodification of SMYD2 and METTL21A, respectively (left). F, His-HSP70 (WT and K561R) were incubated with or without His-METTL21A in the presence of ProSeAM for 2 h at 20°C. Modified proteins were biotinylated and detected with streptavidin-HRP (top) or anti-HSP70 antibody for the loading control (bottom).

    Techniques Used: Methylation, Modification, Liquid Chromatography with Mass Spectroscopy, Incubation, Mass Spectrometry, SDS Page, Western Blot

    Proteomic identification of substrates for seven-beta-strand MTases. A, Schematic protocol for proteomic identification. HEK293T cell lysates were added to either propargylic Se-adenosyl- l -selenomethionine (ProSeAM) alone (1) or ProSeAM plus recombinant KMT (lysate:enzyme ratio was 10∶1) (2). After the in vitro reaction, labeled proteins were tagged with biotin and then precipitated with streptavidin beads. The precipitants were then digested with trypsin, and the trypsinized protein fragments were analyzed by LC-MS/MS. B, ProSeAM competes with SAM in the labeling reaction. HEK293T cell lysates were incubated with ProSeAM (250 µM) in the presence or absence of the indicated amount of SAM (0 to 2.5 mM). Modified proteins were biotinylated and detected with streptavidin-HRP (top). Equal protein loading was confirmed by western blotting with anti-α-tubulin antibody (bottom). C, western blot of labeled proteins. A 5% input of precipitated proteins without ProSeAM (1), with ProSeAM alone (2), with ProSeAM plus GST-G9a (3), with ProSeAM plus His-METTL21A (4) or with ProSeAM plus His-METTL10 was separately analyzed with western blotting with streptavidin-HRP (top) prior to the MS analysis, to compare the labeled proteins. Equal protein loading was confirmed by western blotting with anti-α-tubulin antibody (bottom). D, Doughnut chart of the subcellular distribution of proteins labeled with ProSeAM. HEK293T lysates alone (lane 1 in Fig. 2C) and HEK293T lysates with ProSeAM (lane 2 in Fig. 2C) were analyzed as described in A and Experimental procedures (n = 3). In total, 318 proteins were identified as ProSeAM-labeled proteins. E, List of METTL21A substrates. HEK293T cell lysates and ProSeAM were incubated with or without METTL21A (lane 2 and lane 4 in Fig. 2C), and analyzed as above. Molecular weight, peptide area (reflecting the quantity of detected protein), and fold enrichment of the peptide area are listed: ND, not determined because the substrate was detected only in the condition for lane 4 of B. The total numbers of identified proteins, 2-fold increase (compared to control in each experiment), and overlapped identified numbers of 3 independent experiments are listed in Table S2 .
    Figure Legend Snippet: Proteomic identification of substrates for seven-beta-strand MTases. A, Schematic protocol for proteomic identification. HEK293T cell lysates were added to either propargylic Se-adenosyl- l -selenomethionine (ProSeAM) alone (1) or ProSeAM plus recombinant KMT (lysate:enzyme ratio was 10∶1) (2). After the in vitro reaction, labeled proteins were tagged with biotin and then precipitated with streptavidin beads. The precipitants were then digested with trypsin, and the trypsinized protein fragments were analyzed by LC-MS/MS. B, ProSeAM competes with SAM in the labeling reaction. HEK293T cell lysates were incubated with ProSeAM (250 µM) in the presence or absence of the indicated amount of SAM (0 to 2.5 mM). Modified proteins were biotinylated and detected with streptavidin-HRP (top). Equal protein loading was confirmed by western blotting with anti-α-tubulin antibody (bottom). C, western blot of labeled proteins. A 5% input of precipitated proteins without ProSeAM (1), with ProSeAM alone (2), with ProSeAM plus GST-G9a (3), with ProSeAM plus His-METTL21A (4) or with ProSeAM plus His-METTL10 was separately analyzed with western blotting with streptavidin-HRP (top) prior to the MS analysis, to compare the labeled proteins. Equal protein loading was confirmed by western blotting with anti-α-tubulin antibody (bottom). D, Doughnut chart of the subcellular distribution of proteins labeled with ProSeAM. HEK293T lysates alone (lane 1 in Fig. 2C) and HEK293T lysates with ProSeAM (lane 2 in Fig. 2C) were analyzed as described in A and Experimental procedures (n = 3). In total, 318 proteins were identified as ProSeAM-labeled proteins. E, List of METTL21A substrates. HEK293T cell lysates and ProSeAM were incubated with or without METTL21A (lane 2 and lane 4 in Fig. 2C), and analyzed as above. Molecular weight, peptide area (reflecting the quantity of detected protein), and fold enrichment of the peptide area are listed: ND, not determined because the substrate was detected only in the condition for lane 4 of B. The total numbers of identified proteins, 2-fold increase (compared to control in each experiment), and overlapped identified numbers of 3 independent experiments are listed in Table S2 .

    Techniques Used: Recombinant, In Vitro, Labeling, Liquid Chromatography with Mass Spectroscopy, Mass Spectrometry, Incubation, Modification, Western Blot, Molecular Weight

    74) Product Images from "Three assays show differences in binding of wild-type and mutant p53 to unique gene sequences"

    Article Title: Three assays show differences in binding of wild-type and mutant p53 to unique gene sequences

    Journal:

    doi:

    Streptavidin DNA binding assay with mutant p53 binding to unique gene sequences
    Figure Legend Snippet: Streptavidin DNA binding assay with mutant p53 binding to unique gene sequences

    Techniques Used: DNA Binding Assay, Mutagenesis, Binding Assay

    Streptavidin DNA binding assay with wild-type p53 binding to unique gene sequences
    Figure Legend Snippet: Streptavidin DNA binding assay with wild-type p53 binding to unique gene sequences

    Techniques Used: DNA Binding Assay, Binding Assay

    Competition experiment with streptavidin DNA binding assay
    Figure Legend Snippet: Competition experiment with streptavidin DNA binding assay

    Techniques Used: DNA Binding Assay

    75) Product Images from "Characterizing the Role of Cell-Wall ?-1,3-Exoglucanase Xog1p in Candida albicans Adhesion by the Human Antimicrobial Peptide LL-37"

    Article Title: Characterizing the Role of Cell-Wall ?-1,3-Exoglucanase Xog1p in Candida albicans Adhesion by the Human Antimicrobial Peptide LL-37

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0021394

    Binding of LL-37 to C. albicans cell-wall proteins. (A) Flow cytometry showing that BA-LL37 bound to C. albicans . Cells were treated with 1 mg/ml proteinase K (lower panels) or were not treated (upper panels) prior to incubation with 10 µg BA-LL37. The fluorescence intensity (FL1-H) of SA-DTAF that was associated with the cells via binding to BA-LL37 was measured to determine the amount of BA-LL37 bound to cells. The results are representative of two independent experiments that gave similar results. (B) Extracts prepared by fractionation of C. albicans cell-wall proteins using β-ME and β-glucanase. The proteins in the extracts were separated by SDS-PAGE and transferred to a polyvinylidene difluoride membrane. The membranes were probed with BA-LL37 and visualized with HRP–conjugated streptavidin. Arrows indicate the three major cell wall proteins bound by LL-37. The positions and values of molecular mass standards are indicated. Data are representative of three independent experiments that gave similar results.
    Figure Legend Snippet: Binding of LL-37 to C. albicans cell-wall proteins. (A) Flow cytometry showing that BA-LL37 bound to C. albicans . Cells were treated with 1 mg/ml proteinase K (lower panels) or were not treated (upper panels) prior to incubation with 10 µg BA-LL37. The fluorescence intensity (FL1-H) of SA-DTAF that was associated with the cells via binding to BA-LL37 was measured to determine the amount of BA-LL37 bound to cells. The results are representative of two independent experiments that gave similar results. (B) Extracts prepared by fractionation of C. albicans cell-wall proteins using β-ME and β-glucanase. The proteins in the extracts were separated by SDS-PAGE and transferred to a polyvinylidene difluoride membrane. The membranes were probed with BA-LL37 and visualized with HRP–conjugated streptavidin. Arrows indicate the three major cell wall proteins bound by LL-37. The positions and values of molecular mass standards are indicated. Data are representative of three independent experiments that gave similar results.

    Techniques Used: Binding Assay, Flow Cytometry, Cytometry, Incubation, Fluorescence, Fractionation, SDS Page

    Related Articles

    Immunocytochemistry:

    Article Title: Neuronal Expression and Subcellular Localization of Cholesterol 24-Hydroxylase in the Mouse Brain
    Article Snippet: The sections were blocked for at least 1 hour with NGS blocking solution as described above for immunocytochemistry. .. The slides were washed three times for 10 minutes in PBS-T. Streptavidin-horseradish peroxidase conjugate (S911; Invitrogen) was diluted 1:4,000 in 0.5× NGS blocking and incubated for 20 minutes at room temperature.

    Positive Control:

    Article Title: B7 Costimulation Molecules Expressed from the Herpes Simplex Virus 2 Genome Rescue Immune Induction in B7-Deficient Mice ▿
    Article Snippet: BALB/c mice immunized with 5BlacZ were used as a positive control. .. Anti-mouse IgG-biotin (R & D Systems) was used as secondary antibody, and streptavidin-horseradish peroxidase (Pierce) was used as a detection reagent.

    Blocking Assay:

    Article Title: Neuronal Expression and Subcellular Localization of Cholesterol 24-Hydroxylase in the Mouse Brain
    Article Snippet: .. The slides were washed three times for 10 minutes in PBS-T. Streptavidin-horseradish peroxidase conjugate (S911; Invitrogen) was diluted 1:4,000 in 0.5× NGS blocking and incubated for 20 minutes at room temperature. .. The slides were washed three times for 10 minutes in PBS-T. A fresh mixture (1:10) of metal-enhanced diaminobenzidine (DAB) and stable peroxide buffer (34065; Pierce Biotechnology) was prepared and incubated on the slides for 3–5 minutes.

    Article Title: Characterization and Diagnostic Application of Trypanosoma cruzi Trypomastigote Excreted-Secreted Antigens Shed in Extracellular Vesicles Released from Infected Mammalian Cells
    Article Snippet: Western blot analysis of trypomastigote lysates (1 × 105 parasites/lane) or EVs (2 μg/lane) was performed by resolving proteins on a 6% or 8% SDS-PAGE gel, transferring proteins to polyvinylidene difluoride (PVDF) membranes (Bio-Rad, Mississauga, ON, Canada), and blocking with 2% milk powder in PBS containing 0.05% Tween 20 (PBST). .. Bound antibodies were detected using a streptavidin-horseradish peroxidase conjugate (Invitrogen).

    Article Title: Three assays show differences in binding of wild-type and mutant p53 to unique gene sequences
    Article Snippet: .. This membrane was incubated after blocking in a solution containing 1:100,000 dilution of streptavidin horseradish peroxidase (Pierce, Rockford, IL) and visualized using a chemiluminescent substrate (SuperSignal West Pico Chemiluminescent Substrate; Pierce). ..

    Article Title: Enzyme-Linked Aptamer Assay (ELAA) for Detection of Toxoplasma ROP18 Protein in Human Serum
    Article Snippet: Then, three different conditions were included for the blocking step: 1% BSA (AMRESCO) diluted in PBS-T (Luo et al., ), 5% skimmed milk (Rotherham et al., ) in PBS-T and no blocking, as reported in other studies (Martin et al., ; García-Recio et al., ). .. Then, 5 washes were performed and 100 μL of streptavidin-horseradish peroxidase conjugate (Thermo-Fisher) was added, evaluating three previously reported dilutions, 1:10,000 (Murphy et al., ), 1:15,000 (Rotherham et al., ), and 1:20,000 (Balogh et al., ) diluted in PBS and 1% BSA for 1 h at 37°C.

    Article Title: Design, Synthesis, and Biological Evaluation of N-Carboxyphenylpyrrole Derivatives as Potent HIV Fusion Inhibitors Targeting gp41
    Article Snippet: Briefly, wells of polystyrene plates (Immulon 1B, Dynex Technology, Chantilly, VA) were coated with HIV immunoglobulin (HIVIG), which was prepared from plasma of HIV-seropositive donors with high neutralizing titers against HIV-1IIIB , in 0.085 M carbonate-bicarbonate buffer (pH 9.6) at 4 °C overnight, followed by washes with washing buffer (0.01M PBS containing 0.05% Tween-20) and blocking with PBS containing 1% dry fat-free milk (Bio-Rad, Inc., Hercules, CA). .. Virus lysates were added to the wells and incubated at 37 °C for 1 h. After extensive washes, anti-p24 mAb (183-12H-5C), biotin-labeled anti-mouse IgG1 (Santa Cruz Biotech., Santa Cruz, CA), streptavidin-labeled horseradish peroxidase (Zymed, S. San Francisco, CA), and the substrate 3,3′,5,5′-tetramethylbenzidine (Sigma Chemical Co., St. Louis, MO) were added sequentially.

    Enzyme-linked Immunosorbent Assay:

    Article Title: B7 Costimulation Molecules Expressed from the Herpes Simplex Virus 2 Genome Rescue Immune Induction in B7-Deficient Mice ▿
    Article Snippet: Serum was prepared by clot retraction and analyzed by enzyme-linked immunosorbent assay (ELISA) as previously described ( ). .. Anti-mouse IgG-biotin (R & D Systems) was used as secondary antibody, and streptavidin-horseradish peroxidase (Pierce) was used as a detection reagent.

    Article Title: Design, Synthesis, and Biological Evaluation of N-Carboxyphenylpyrrole Derivatives as Potent HIV Fusion Inhibitors Targeting gp41
    Article Snippet: On the fourth day post-infection, 100 μL of culture supernatants were collected from each well, mixed with equal volumes of 5% Triton X-100 and assayed for p24 antigen, which was quantitated by ELISA. .. Virus lysates were added to the wells and incubated at 37 °C for 1 h. After extensive washes, anti-p24 mAb (183-12H-5C), biotin-labeled anti-mouse IgG1 (Santa Cruz Biotech., Santa Cruz, CA), streptavidin-labeled horseradish peroxidase (Zymed, S. San Francisco, CA), and the substrate 3,3′,5,5′-tetramethylbenzidine (Sigma Chemical Co., St. Louis, MO) were added sequentially.

    Quantitation Assay:

    Article Title: B7 Costimulation Molecules Expressed from the Herpes Simplex Virus 2 Genome Rescue Immune Induction in B7-Deficient Mice ▿
    Article Snippet: Paragraph title: Quantitation of serum antibodies. ... Anti-mouse IgG-biotin (R & D Systems) was used as secondary antibody, and streptavidin-horseradish peroxidase (Pierce) was used as a detection reagent.

    Activity Assay:

    Article Title: Enzyme-Linked Aptamer Assay (ELAA) for Detection of Toxoplasma ROP18 Protein in Human Serum
    Article Snippet: Then, 5 washes were performed and 100 μL of streptavidin-horseradish peroxidase conjugate (Thermo-Fisher) was added, evaluating three previously reported dilutions, 1:10,000 (Murphy et al., ), 1:15,000 (Rotherham et al., ), and 1:20,000 (Balogh et al., ) diluted in PBS and 1% BSA for 1 h at 37°C. .. Finally, after five washes, horseradish peroxidase activity was detected by using TMB for 15 min at room temperature and stopped by adding a 5% of sulfuric acid (H2 SO4 ).

    Article Title: Design, Synthesis, and Biological Evaluation of N-Carboxyphenylpyrrole Derivatives as Potent HIV Fusion Inhibitors Targeting gp41
    Article Snippet: Paragraph title: Determination of the inhibitory activity of the compounds on HIV-1 replication ... Virus lysates were added to the wells and incubated at 37 °C for 1 h. After extensive washes, anti-p24 mAb (183-12H-5C), biotin-labeled anti-mouse IgG1 (Santa Cruz Biotech., Santa Cruz, CA), streptavidin-labeled horseradish peroxidase (Zymed, S. San Francisco, CA), and the substrate 3,3′,5,5′-tetramethylbenzidine (Sigma Chemical Co., St. Louis, MO) were added sequentially.

    Expressing:

    Article Title: EphB Receptors Regulate Stem/Progenitor Cell Proliferation, Migration, and Polarity during Hippocampal Neurogenesis
    Article Snippet: To carry out double labeling for calretinin and ephrin-B3 expression, brains from 4% PFA perfused ephrin-B3 lacZ/lacZ animals were vibratome sectioned, washed, and processed overnight in X-gal for detection of the ephrin-B3-β-gal fusion protein. .. After subsequent washing to remove excess X-gal, sections were postfixed in 4% PFA for 15 min, washed, and processed for immunohistochemistry using rabbit anti-calretinin antibodies (Millipore), biotinylated donkey anti-rabbit IgG (Jackson ImmunoResearch, West Grove, PA), and streptavidin-horseradish peroxidase (Pierce, Rockford, IL) with the DAB-Plus kit (Zymed, South San Francisco, CA) to label calretinin-positive mossy cells in the DG.

    Western Blot:

    Article Title: Characterization and Diagnostic Application of Trypanosoma cruzi Trypomastigote Excreted-Secreted Antigens Shed in Extracellular Vesicles Released from Infected Mammalian Cells
    Article Snippet: Paragraph title: Western blotting. ... Bound antibodies were detected using a streptavidin-horseradish peroxidase conjugate (Invitrogen).

    Article Title: Rapid labelling and covalent inhibition of intracellular native proteins using ligand-directed N-acyl-N-alkyl sulfonamide
    Article Snippet: .. The samples were analysed by western blotting using Streptavidin-HRP conjugate (SAv-HRP, Thermo, S911, 1:5000) and Coomassie Brilliant Blue (CBB) stain. .. Mouse myoblast C2C12 cells (ATCC) (2.0 × 105 cells) were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% foetal bovine serum (FBS, Gibco), penicillin (100 units/ml), streptomycin (100 mg/ml), and amphotericin B (250 ng/ml), and incubated in a 5% CO2 humidified chamber at 37 °C.

    Immunohistochemistry:

    Article Title: Neuronal Expression and Subcellular Localization of Cholesterol 24-Hydroxylase in the Mouse Brain
    Article Snippet: Paragraph title: Immunohistochemistry ... The slides were washed three times for 10 minutes in PBS-T. Streptavidin-horseradish peroxidase conjugate (S911; Invitrogen) was diluted 1:4,000 in 0.5× NGS blocking and incubated for 20 minutes at room temperature.

    Article Title: EphB Receptors Regulate Stem/Progenitor Cell Proliferation, Migration, and Polarity during Hippocampal Neurogenesis
    Article Snippet: .. After subsequent washing to remove excess X-gal, sections were postfixed in 4% PFA for 15 min, washed, and processed for immunohistochemistry using rabbit anti-calretinin antibodies (Millipore), biotinylated donkey anti-rabbit IgG (Jackson ImmunoResearch, West Grove, PA), and streptavidin-horseradish peroxidase (Pierce, Rockford, IL) with the DAB-Plus kit (Zymed, South San Francisco, CA) to label calretinin-positive mossy cells in the DG. .. Alternatively, perfused, vibratome-sectioned brains were processed for immunofluorescence using anti-β-gal and anti-calretinin antibodies as described above.

    Protease Inhibitor:

    Article Title: Rapid labelling and covalent inhibition of intracellular native proteins using ligand-directed N-acyl-N-alkyl sulfonamide
    Article Snippet: HeLa cells (kindly gifted from Prof. Yoshiki Katayama) (1×107 cells) were suspended in HEPES buffer (50 mM, pH 7.2) containing 1% protease inhibitor cocktail set III (Calbiochem) and lysed by Potter-Elvehjem homogeniser at 4 °C. .. The samples were analysed by western blotting using Streptavidin-HRP conjugate (SAv-HRP, Thermo, S911, 1:5000) and Coomassie Brilliant Blue (CBB) stain.

    Transferring:

    Article Title: Characterization and Diagnostic Application of Trypanosoma cruzi Trypomastigote Excreted-Secreted Antigens Shed in Extracellular Vesicles Released from Infected Mammalian Cells
    Article Snippet: Western blot analysis of trypomastigote lysates (1 × 105 parasites/lane) or EVs (2 μg/lane) was performed by resolving proteins on a 6% or 8% SDS-PAGE gel, transferring proteins to polyvinylidene difluoride (PVDF) membranes (Bio-Rad, Mississauga, ON, Canada), and blocking with 2% milk powder in PBS containing 0.05% Tween 20 (PBST). .. Bound antibodies were detected using a streptavidin-horseradish peroxidase conjugate (Invitrogen).

    Infection:

    Article Title: Design, Synthesis, and Biological Evaluation of N-Carboxyphenylpyrrole Derivatives as Potent HIV Fusion Inhibitors Targeting gp41
    Article Snippet: In brief, 1 × 104 MT-2 cells were infected with an HIV-1 strain (100 TCID50 ) in 200 μL RPMI 1640 medium containing 10% FBS in the presence or absence of a test compound at graded concentrations overnight. .. Virus lysates were added to the wells and incubated at 37 °C for 1 h. After extensive washes, anti-p24 mAb (183-12H-5C), biotin-labeled anti-mouse IgG1 (Santa Cruz Biotech., Santa Cruz, CA), streptavidin-labeled horseradish peroxidase (Zymed, S. San Francisco, CA), and the substrate 3,3′,5,5′-tetramethylbenzidine (Sigma Chemical Co., St. Louis, MO) were added sequentially.

    Light Microscopy:

    Article Title: The RNA-binding Protein Fragile X-related 1 Regulates Somite Formation in Xenopus laevis D⃞
    Article Snippet: Bound immunoglobulin was reacted with biotinylated secondary antibodies followed by a streptavidin-peroxidase conjugate and stained with the AEC chromogen (Histomouse-SP kit; Zymed Laboratories, South San Francisco, CA). .. Light microscopy was performed using a Nikon TE300 microscope connected to a CoolSnap camera (RS Photometrics, Trenton, NJ) by using 4×, 10×, 40×, and 60× objectives.

    Generated:

    Article Title: B7 Costimulation Molecules Expressed from the Herpes Simplex Virus 2 Genome Rescue Immune Induction in B7-Deficient Mice ▿
    Article Snippet: Anti-mouse IgG-biotin (R & D Systems) was used as secondary antibody, and streptavidin-horseradish peroxidase (Pierce) was used as a detection reagent. .. Antibody titers were determined by comparison to standard curves generated with serum containing known concentrations of IgG captured on plates coated with goat-anti-kappa light chain antibody (Caltag).

    other:

    Article Title: Single bead-based electrochemical biosensor
    Article Snippet: Streptavidin-horseradish peroxidase conjugate and streptavidin-Alexa Fluor 488 were purchased from Invitrogen (Carlsbad, CA, USA).

    Imaging:

    Article Title: Role of Translational Attenuation in Inherited Retinal Degeneration
    Article Snippet: .. Biotinylated proteins then were probed with HRP-conjugated streptavidin (S911; Thermo Fisher Scientific), incubated in ECL substrate (RPN2232; GE Healthcare, Chicago, IL, USA) and then imaged using a LI-COR (Lincoln, NE, USA) Fc imaging system. .. After imaging, the membrane was stained with coomassie blue G-250 (161-0786; Bio-Rad Laboratories) for 30 minutes and then destained for 30 minutes (water, ethanol, acetic acid at 50:40:10).

    Sequencing:

    Article Title: Three assays show differences in binding of wild-type and mutant p53 to unique gene sequences
    Article Snippet: Double-stranded biotinylated oligonucleotides for the cyclin G wild type promoter sequence (top strand 5' AGGCCAGACCTGCCCGGGCAAGCCTTGGCA 3') , a cyclin G mutant promoter sequence (top strand 5' AGGCCAGACCTGACCGGGAAATCCTTGGCA3') ( ) the mdm2 promoter sequence (top strand 5' CGGAACGTGTCTGAACTTGACCAGCTC 3') ( ) and the 5'- p21 promoter sequence (top strand 5' CGAGGAACATGTCCCAACATGTTGCTCGAG 3') ( , ) were obtained from Integrated DNA Technologies (Coralville, IA) with the biotin label at the 5' end of one of the strands. .. This membrane was incubated after blocking in a solution containing 1:100,000 dilution of streptavidin horseradish peroxidase (Pierce, Rockford, IL) and visualized using a chemiluminescent substrate (SuperSignal West Pico Chemiluminescent Substrate; Pierce).

    Injection:

    Article Title: Role of Translational Attenuation in Inherited Retinal Degeneration
    Article Snippet: Protein Synthesis Analysis Two hours before retinal collection, mice were intraperitoneally injected with Click-it azidohomoalanine (C10102; Thermo Fisher Scientific) at a dosage of 1.20 mg/kg. .. Biotinylated proteins then were probed with HRP-conjugated streptavidin (S911; Thermo Fisher Scientific), incubated in ECL substrate (RPN2232; GE Healthcare, Chicago, IL, USA) and then imaged using a LI-COR (Lincoln, NE, USA) Fc imaging system.

    Binding Assay:

    Article Title: Three assays show differences in binding of wild-type and mutant p53 to unique gene sequences
    Article Snippet: Paragraph title: Electrophoretic mobility shift assay (EMSA) for p53 DNA binding ... This membrane was incubated after blocking in a solution containing 1:100,000 dilution of streptavidin horseradish peroxidase (Pierce, Rockford, IL) and visualized using a chemiluminescent substrate (SuperSignal West Pico Chemiluminescent Substrate; Pierce).

    Article Title: Enzyme-Linked Aptamer Assay (ELAA) for Detection of Toxoplasma ROP18 Protein in Human Serum
    Article Snippet: After washing three times, biotinylated aptamers (200 nM) against ROP18 were added to each well, these oligonucleotides were diluted in binding buffer (PBS, 0.5% glucose, 0.1% albumin and 1 M MgCl2 ) and incubated for 1 h at 37°C. .. Then, 5 washes were performed and 100 μL of streptavidin-horseradish peroxidase conjugate (Thermo-Fisher) was added, evaluating three previously reported dilutions, 1:10,000 (Murphy et al., ), 1:15,000 (Rotherham et al., ), and 1:20,000 (Balogh et al., ) diluted in PBS and 1% BSA for 1 h at 37°C.

    Immunofluorescence:

    Article Title: EphB Receptors Regulate Stem/Progenitor Cell Proliferation, Migration, and Polarity during Hippocampal Neurogenesis
    Article Snippet: Paragraph title: Immunohistochemistry and immunofluorescence. ... After subsequent washing to remove excess X-gal, sections were postfixed in 4% PFA for 15 min, washed, and processed for immunohistochemistry using rabbit anti-calretinin antibodies (Millipore), biotinylated donkey anti-rabbit IgG (Jackson ImmunoResearch, West Grove, PA), and streptavidin-horseradish peroxidase (Pierce, Rockford, IL) with the DAB-Plus kit (Zymed, South San Francisco, CA) to label calretinin-positive mossy cells in the DG.

    Mutagenesis:

    Article Title: Three assays show differences in binding of wild-type and mutant p53 to unique gene sequences
    Article Snippet: Double-stranded biotinylated oligonucleotides for the cyclin G wild type promoter sequence (top strand 5' AGGCCAGACCTGCCCGGGCAAGCCTTGGCA 3') , a cyclin G mutant promoter sequence (top strand 5' AGGCCAGACCTGACCGGGAAATCCTTGGCA3') ( ) the mdm2 promoter sequence (top strand 5' CGGAACGTGTCTGAACTTGACCAGCTC 3') ( ) and the 5'- p21 promoter sequence (top strand 5' CGAGGAACATGTCCCAACATGTTGCTCGAG 3') ( , ) were obtained from Integrated DNA Technologies (Coralville, IA) with the biotin label at the 5' end of one of the strands. .. This membrane was incubated after blocking in a solution containing 1:100,000 dilution of streptavidin horseradish peroxidase (Pierce, Rockford, IL) and visualized using a chemiluminescent substrate (SuperSignal West Pico Chemiluminescent Substrate; Pierce).

    Isolation:

    Article Title: Characterization and Diagnostic Application of Trypanosoma cruzi Trypomastigote Excreted-Secreted Antigens Shed in Extracellular Vesicles Released from Infected Mammalian Cells
    Article Snippet: Alternatively, Western blots were probed with either IgG antibodies isolated from uninfected control or Chagas patients with severe cardiomyopathy; samples were biotinylated with biotin– N -hydroxysuccinimide ester for 2 h at 20°C as described by the manufacturer (Invitrogen, Burlington, ON, Canada). .. Bound antibodies were detected using a streptavidin-horseradish peroxidase conjugate (Invitrogen).

    Article Title: EphB Receptors Regulate Stem/Progenitor Cell Proliferation, Migration, and Polarity during Hippocampal Neurogenesis
    Article Snippet: Briefly, fresh brains were isolated from CO2 -killed animals and frozen in JUNG Tissue Freezing Medium (Leica Microsystems, Bannockburn, IL) and immediately cryosectioned on a Leica CM3050S cryostat (Leica Microsystems). .. After subsequent washing to remove excess X-gal, sections were postfixed in 4% PFA for 15 min, washed, and processed for immunohistochemistry using rabbit anti-calretinin antibodies (Millipore), biotinylated donkey anti-rabbit IgG (Jackson ImmunoResearch, West Grove, PA), and streptavidin-horseradish peroxidase (Pierce, Rockford, IL) with the DAB-Plus kit (Zymed, South San Francisco, CA) to label calretinin-positive mossy cells in the DG.

    Labeling:

    Article Title: Three assays show differences in binding of wild-type and mutant p53 to unique gene sequences
    Article Snippet: The nuclear extracts containing the p53 protein (100 pg) from the different human cell lines was incubated with 20 pmole of biotin labeled DNA, 1 μg of non-specific DNA (poly-dAdT; Roche, Indianapolis, IN) in the binding buffer (20 mM Hepes (pH 7.5), 1 mM EDTA, 1 mM DTT, 10 mM (NH4 )2 SO4 , 10 mM KCl, 0.2% Tween-20) in a total volume of 20 μl. .. This membrane was incubated after blocking in a solution containing 1:100,000 dilution of streptavidin horseradish peroxidase (Pierce, Rockford, IL) and visualized using a chemiluminescent substrate (SuperSignal West Pico Chemiluminescent Substrate; Pierce).

    Article Title: EphB Receptors Regulate Stem/Progenitor Cell Proliferation, Migration, and Polarity during Hippocampal Neurogenesis
    Article Snippet: To carry out double labeling for calretinin and ephrin-B3 expression, brains from 4% PFA perfused ephrin-B3 lacZ/lacZ animals were vibratome sectioned, washed, and processed overnight in X-gal for detection of the ephrin-B3-β-gal fusion protein. .. After subsequent washing to remove excess X-gal, sections were postfixed in 4% PFA for 15 min, washed, and processed for immunohistochemistry using rabbit anti-calretinin antibodies (Millipore), biotinylated donkey anti-rabbit IgG (Jackson ImmunoResearch, West Grove, PA), and streptavidin-horseradish peroxidase (Pierce, Rockford, IL) with the DAB-Plus kit (Zymed, South San Francisco, CA) to label calretinin-positive mossy cells in the DG.

    Mouse Assay:

    Article Title: B7 Costimulation Molecules Expressed from the Herpes Simplex Virus 2 Genome Rescue Immune Induction in B7-Deficient Mice ▿
    Article Snippet: Blood was collected from the tail vein of mice 24 days postimmunization and 14 days after challenge. .. Anti-mouse IgG-biotin (R & D Systems) was used as secondary antibody, and streptavidin-horseradish peroxidase (Pierce) was used as a detection reagent.

    Article Title: The RNA-binding Protein Fragile X-related 1 Regulates Somite Formation in Xenopus laevis D⃞
    Article Snippet: Xenopus and mice embryos were fixed in a freshly prepared 4% paraformaldehyde solution in PBS for 18 h at 4°C. .. Bound immunoglobulin was reacted with biotinylated secondary antibodies followed by a streptavidin-peroxidase conjugate and stained with the AEC chromogen (Histomouse-SP kit; Zymed Laboratories, South San Francisco, CA).

    Article Title: Role of Translational Attenuation in Inherited Retinal Degeneration
    Article Snippet: Protein Synthesis Analysis Two hours before retinal collection, mice were intraperitoneally injected with Click-it azidohomoalanine (C10102; Thermo Fisher Scientific) at a dosage of 1.20 mg/kg. .. Biotinylated proteins then were probed with HRP-conjugated streptavidin (S911; Thermo Fisher Scientific), incubated in ECL substrate (RPN2232; GE Healthcare, Chicago, IL, USA) and then imaged using a LI-COR (Lincoln, NE, USA) Fc imaging system.

    Electrophoretic Mobility Shift Assay:

    Article Title: Three assays show differences in binding of wild-type and mutant p53 to unique gene sequences
    Article Snippet: Paragraph title: Electrophoretic mobility shift assay (EMSA) for p53 DNA binding ... This membrane was incubated after blocking in a solution containing 1:100,000 dilution of streptavidin horseradish peroxidase (Pierce, Rockford, IL) and visualized using a chemiluminescent substrate (SuperSignal West Pico Chemiluminescent Substrate; Pierce).

    IA:

    Article Title: Three assays show differences in binding of wild-type and mutant p53 to unique gene sequences
    Article Snippet: Double-stranded biotinylated oligonucleotides for the cyclin G wild type promoter sequence (top strand 5' AGGCCAGACCTGCCCGGGCAAGCCTTGGCA 3') , a cyclin G mutant promoter sequence (top strand 5' AGGCCAGACCTGACCGGGAAATCCTTGGCA3') ( ) the mdm2 promoter sequence (top strand 5' CGGAACGTGTCTGAACTTGACCAGCTC 3') ( ) and the 5'- p21 promoter sequence (top strand 5' CGAGGAACATGTCCCAACATGTTGCTCGAG 3') ( , ) were obtained from Integrated DNA Technologies (Coralville, IA) with the biotin label at the 5' end of one of the strands. .. This membrane was incubated after blocking in a solution containing 1:100,000 dilution of streptavidin horseradish peroxidase (Pierce, Rockford, IL) and visualized using a chemiluminescent substrate (SuperSignal West Pico Chemiluminescent Substrate; Pierce).

    SDS Page:

    Article Title: Characterization and Diagnostic Application of Trypanosoma cruzi Trypomastigote Excreted-Secreted Antigens Shed in Extracellular Vesicles Released from Infected Mammalian Cells
    Article Snippet: Western blot analysis of trypomastigote lysates (1 × 105 parasites/lane) or EVs (2 μg/lane) was performed by resolving proteins on a 6% or 8% SDS-PAGE gel, transferring proteins to polyvinylidene difluoride (PVDF) membranes (Bio-Rad, Mississauga, ON, Canada), and blocking with 2% milk powder in PBS containing 0.05% Tween 20 (PBST). .. Bound antibodies were detected using a streptavidin-horseradish peroxidase conjugate (Invitrogen).

    Article Title: Role of Translational Attenuation in Inherited Retinal Degeneration
    Article Snippet: After the tagged proteins were precipitated to remove reaction components, they were resolubilized in 1 × SDS-loading buffer (2% SDS, 10% glycerol, 0.005% bromophenol blue, and 5% 2-mercaptoethanol) and heated at 95°C for 10 minutes before half of the reaction (∼50 μg) was separated by SDS-PAGE (4568093, 4568096; Bio-Rad Laboratories). .. Biotinylated proteins then were probed with HRP-conjugated streptavidin (S911; Thermo Fisher Scientific), incubated in ECL substrate (RPN2232; GE Healthcare, Chicago, IL, USA) and then imaged using a LI-COR (Lincoln, NE, USA) Fc imaging system.

    Software:

    Article Title: Role of Translational Attenuation in Inherited Retinal Degeneration
    Article Snippet: Biotinylated proteins then were probed with HRP-conjugated streptavidin (S911; Thermo Fisher Scientific), incubated in ECL substrate (RPN2232; GE Healthcare, Chicago, IL, USA) and then imaged using a LI-COR (Lincoln, NE, USA) Fc imaging system. .. Densitometry analyses were performed on entire lanes using ImageJ software.

    Microscopy:

    Article Title: EphB Receptors Regulate Stem/Progenitor Cell Proliferation, Migration, and Polarity during Hippocampal Neurogenesis
    Article Snippet: Slides were counterstained in Nuclear Fast Red solution (Polysciences, Warrington, PA) and color images obtained with a Nikon (Tokyo, Japan) DMX-1200 color digital camera on an Olympus (Tokyo, Japan) BX-50 microscope. .. After subsequent washing to remove excess X-gal, sections were postfixed in 4% PFA for 15 min, washed, and processed for immunohistochemistry using rabbit anti-calretinin antibodies (Millipore), biotinylated donkey anti-rabbit IgG (Jackson ImmunoResearch, West Grove, PA), and streptavidin-horseradish peroxidase (Pierce, Rockford, IL) with the DAB-Plus kit (Zymed, South San Francisco, CA) to label calretinin-positive mossy cells in the DG.

    Article Title: The RNA-binding Protein Fragile X-related 1 Regulates Somite Formation in Xenopus laevis D⃞
    Article Snippet: Bound immunoglobulin was reacted with biotinylated secondary antibodies followed by a streptavidin-peroxidase conjugate and stained with the AEC chromogen (Histomouse-SP kit; Zymed Laboratories, South San Francisco, CA). .. Light microscopy was performed using a Nikon TE300 microscope connected to a CoolSnap camera (RS Photometrics, Trenton, NJ) by using 4×, 10×, 40×, and 60× objectives.

    Recombinant:

    Article Title: Characterization and Diagnostic Application of Trypanosoma cruzi Trypomastigote Excreted-Secreted Antigens Shed in Extracellular Vesicles Released from Infected Mammalian Cells
    Article Snippet: Bound antibodies were detected using a streptavidin-horseradish peroxidase conjugate (Invitrogen). .. For Western blot analysis using recombinant protein, ∼1.0 μg of PFR1 or RHS, or 10 μg of TESA EVs, was resolved on an 8% SDS-PAGE gel and transferred to a PVDF membrane, and membranes were blocked with 2% skimmed milk powder prior to probing with antisera (1:2,000 dilution) from uninfected controls or Chagas patients with asymptomatic clinical signs, ECG abnormalities, or ventricular arrhythmia.

    Article Title: Rapid labelling and covalent inhibition of intracellular native proteins using ligand-directed N-acyl-N-alkyl sulfonamide
    Article Snippet: This solution was incubated with recombinant FKBP12 (final concentration 1 µM) and 1 (1 µM) or 8 (1–20 µM) in the absence or presence of Rapamycin (10 or 20 µM) for 1 h at 37 °C. .. The samples were analysed by western blotting using Streptavidin-HRP conjugate (SAv-HRP, Thermo, S911, 1:5000) and Coomassie Brilliant Blue (CBB) stain.

    Article Title: Design, Synthesis, and Biological Evaluation of N-Carboxyphenylpyrrole Derivatives as Potent HIV Fusion Inhibitors Targeting gp41
    Article Snippet: Virus lysates were added to the wells and incubated at 37 °C for 1 h. After extensive washes, anti-p24 mAb (183-12H-5C), biotin-labeled anti-mouse IgG1 (Santa Cruz Biotech., Santa Cruz, CA), streptavidin-labeled horseradish peroxidase (Zymed, S. San Francisco, CA), and the substrate 3,3′,5,5′-tetramethylbenzidine (Sigma Chemical Co., St. Louis, MO) were added sequentially. .. Recombinant protein p24 purchased from US Biological Swampscott, MA) was included for establishing standard dose response curves.

    Next-Generation Sequencing:

    Article Title: Neuronal Expression and Subcellular Localization of Cholesterol 24-Hydroxylase in the Mouse Brain
    Article Snippet: .. The slides were washed three times for 10 minutes in PBS-T. Streptavidin-horseradish peroxidase conjugate (S911; Invitrogen) was diluted 1:4,000 in 0.5× NGS blocking and incubated for 20 minutes at room temperature. .. The slides were washed three times for 10 minutes in PBS-T. A fresh mixture (1:10) of metal-enhanced diaminobenzidine (DAB) and stable peroxide buffer (34065; Pierce Biotechnology) was prepared and incubated on the slides for 3–5 minutes.

    Incubation:

    Article Title: Neuronal Expression and Subcellular Localization of Cholesterol 24-Hydroxylase in the Mouse Brain
    Article Snippet: .. The slides were washed three times for 10 minutes in PBS-T. Streptavidin-horseradish peroxidase conjugate (S911; Invitrogen) was diluted 1:4,000 in 0.5× NGS blocking and incubated for 20 minutes at room temperature. .. The slides were washed three times for 10 minutes in PBS-T. A fresh mixture (1:10) of metal-enhanced diaminobenzidine (DAB) and stable peroxide buffer (34065; Pierce Biotechnology) was prepared and incubated on the slides for 3–5 minutes.

    Article Title: Rapid labelling and covalent inhibition of intracellular native proteins using ligand-directed N-acyl-N-alkyl sulfonamide
    Article Snippet: The reaction mixture was mixed with 1/4 volume of 5 × sample buffer (pH 6.8, 312.5 mM Tris–HCl, 25% sucrose, 10% SDS, 0.025% bromophenol blue) containing 250 mM DTT and incubated for 1 h at 25 °C. .. The samples were analysed by western blotting using Streptavidin-HRP conjugate (SAv-HRP, Thermo, S911, 1:5000) and Coomassie Brilliant Blue (CBB) stain.

    Article Title: Three assays show differences in binding of wild-type and mutant p53 to unique gene sequences
    Article Snippet: .. This membrane was incubated after blocking in a solution containing 1:100,000 dilution of streptavidin horseradish peroxidase (Pierce, Rockford, IL) and visualized using a chemiluminescent substrate (SuperSignal West Pico Chemiluminescent Substrate; Pierce). ..

    Article Title: EphB Receptors Regulate Stem/Progenitor Cell Proliferation, Migration, and Polarity during Hippocampal Neurogenesis
    Article Snippet: Sections were postfixed on slides in 4% PFA and incubated overnight at 37°C in X-gal solution. .. After subsequent washing to remove excess X-gal, sections were postfixed in 4% PFA for 15 min, washed, and processed for immunohistochemistry using rabbit anti-calretinin antibodies (Millipore), biotinylated donkey anti-rabbit IgG (Jackson ImmunoResearch, West Grove, PA), and streptavidin-horseradish peroxidase (Pierce, Rockford, IL) with the DAB-Plus kit (Zymed, South San Francisco, CA) to label calretinin-positive mossy cells in the DG.

    Article Title: The RNA-binding Protein Fragile X-related 1 Regulates Somite Formation in Xenopus laevis D⃞
    Article Snippet: Endogenous peroxidase was inhibited by a 15-min treatment with 0.5% H2 O2 solution in PBS, and the sections were next incubated for 18 h at 4°C with antiserum #27-17 (dilution 1:500) or mAb3FX (dilution 1:500). .. Bound immunoglobulin was reacted with biotinylated secondary antibodies followed by a streptavidin-peroxidase conjugate and stained with the AEC chromogen (Histomouse-SP kit; Zymed Laboratories, South San Francisco, CA).

    Article Title: Enzyme-Linked Aptamer Assay (ELAA) for Detection of Toxoplasma ROP18 Protein in Human Serum
    Article Snippet: After washing three times, biotinylated aptamers (200 nM) against ROP18 were added to each well, these oligonucleotides were diluted in binding buffer (PBS, 0.5% glucose, 0.1% albumin and 1 M MgCl2 ) and incubated for 1 h at 37°C. .. Then, 5 washes were performed and 100 μL of streptavidin-horseradish peroxidase conjugate (Thermo-Fisher) was added, evaluating three previously reported dilutions, 1:10,000 (Murphy et al., ), 1:15,000 (Rotherham et al., ), and 1:20,000 (Balogh et al., ) diluted in PBS and 1% BSA for 1 h at 37°C.

    Article Title: Role of Translational Attenuation in Inherited Retinal Degeneration
    Article Snippet: .. Biotinylated proteins then were probed with HRP-conjugated streptavidin (S911; Thermo Fisher Scientific), incubated in ECL substrate (RPN2232; GE Healthcare, Chicago, IL, USA) and then imaged using a LI-COR (Lincoln, NE, USA) Fc imaging system. .. After imaging, the membrane was stained with coomassie blue G-250 (161-0786; Bio-Rad Laboratories) for 30 minutes and then destained for 30 minutes (water, ethanol, acetic acid at 50:40:10).

    Article Title: Design, Synthesis, and Biological Evaluation of N-Carboxyphenylpyrrole Derivatives as Potent HIV Fusion Inhibitors Targeting gp41
    Article Snippet: .. Virus lysates were added to the wells and incubated at 37 °C for 1 h. After extensive washes, anti-p24 mAb (183-12H-5C), biotin-labeled anti-mouse IgG1 (Santa Cruz Biotech., Santa Cruz, CA), streptavidin-labeled horseradish peroxidase (Zymed, S. San Francisco, CA), and the substrate 3,3′,5,5′-tetramethylbenzidine (Sigma Chemical Co., St. Louis, MO) were added sequentially. ..

    Spectrophotometry:

    Article Title: Enzyme-Linked Aptamer Assay (ELAA) for Detection of Toxoplasma ROP18 Protein in Human Serum
    Article Snippet: Then, 5 washes were performed and 100 μL of streptavidin-horseradish peroxidase conjugate (Thermo-Fisher) was added, evaluating three previously reported dilutions, 1:10,000 (Murphy et al., ), 1:15,000 (Rotherham et al., ), and 1:20,000 (Balogh et al., ) diluted in PBS and 1% BSA for 1 h at 37°C. .. The absorbance at 450 nm was read in an Epoch 2 spectrophotometer (BioTek Instruments, Winooski, VT, USA).

    Concentration Assay:

    Article Title: Rapid labelling and covalent inhibition of intracellular native proteins using ligand-directed N-acyl-N-alkyl sulfonamide
    Article Snippet: This solution was incubated with recombinant FKBP12 (final concentration 1 µM) and 1 (1 µM) or 8 (1–20 µM) in the absence or presence of Rapamycin (10 or 20 µM) for 1 h at 37 °C. .. The samples were analysed by western blotting using Streptavidin-HRP conjugate (SAv-HRP, Thermo, S911, 1:5000) and Coomassie Brilliant Blue (CBB) stain.

    Staining:

    Article Title: Rapid labelling and covalent inhibition of intracellular native proteins using ligand-directed N-acyl-N-alkyl sulfonamide
    Article Snippet: .. The samples were analysed by western blotting using Streptavidin-HRP conjugate (SAv-HRP, Thermo, S911, 1:5000) and Coomassie Brilliant Blue (CBB) stain. .. Mouse myoblast C2C12 cells (ATCC) (2.0 × 105 cells) were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% foetal bovine serum (FBS, Gibco), penicillin (100 units/ml), streptomycin (100 mg/ml), and amphotericin B (250 ng/ml), and incubated in a 5% CO2 humidified chamber at 37 °C.

    Article Title: EphB Receptors Regulate Stem/Progenitor Cell Proliferation, Migration, and Polarity during Hippocampal Neurogenesis
    Article Snippet: 5-Bromo-4-chloro-3-indolyl-β- d -galactopyranoside (X-gal) staining procedures have been previously described ( ). .. After subsequent washing to remove excess X-gal, sections were postfixed in 4% PFA for 15 min, washed, and processed for immunohistochemistry using rabbit anti-calretinin antibodies (Millipore), biotinylated donkey anti-rabbit IgG (Jackson ImmunoResearch, West Grove, PA), and streptavidin-horseradish peroxidase (Pierce, Rockford, IL) with the DAB-Plus kit (Zymed, South San Francisco, CA) to label calretinin-positive mossy cells in the DG.

    Article Title: The RNA-binding Protein Fragile X-related 1 Regulates Somite Formation in Xenopus laevis D⃞
    Article Snippet: .. Bound immunoglobulin was reacted with biotinylated secondary antibodies followed by a streptavidin-peroxidase conjugate and stained with the AEC chromogen (Histomouse-SP kit; Zymed Laboratories, South San Francisco, CA). .. The slides were then mounted in GVA Mount (Zymed Laboratories).

    Article Title: Role of Translational Attenuation in Inherited Retinal Degeneration
    Article Snippet: Biotinylated proteins then were probed with HRP-conjugated streptavidin (S911; Thermo Fisher Scientific), incubated in ECL substrate (RPN2232; GE Healthcare, Chicago, IL, USA) and then imaged using a LI-COR (Lincoln, NE, USA) Fc imaging system. .. After imaging, the membrane was stained with coomassie blue G-250 (161-0786; Bio-Rad Laboratories) for 30 minutes and then destained for 30 minutes (water, ethanol, acetic acid at 50:40:10).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Thermo Fisher horseradish peroxidase conjugated streptavidin
    Depletion of glypican-1 stimulates the endocytosis of PrP C . SH-SY5Y cells expressing wild type PrP C were treated with either control or glypican-1 siRNA and then incubated for 60 h. Cells were surface biotinylated and incubated in OptiMEM for 1 h at 37°C. Where indicated, cells were treated with trypsin to remove remaining cell surface PrP C . Cells were then lysed and total PrP C immunoprecipitated from the sample using antibody 3F4. ( A ) Samples were subjected to western blot analysis and the biotin-labelled PrP C fraction was detected with peroxidase-conjugated <t>streptavidin.</t> ( B ) Densitometric analysis (mean ± s.e.m.) of multiple blots from three separate experiments in (A) is shown. ( C ) Expression of glypican-1 (in lysate samples treated with heparinase I and heparinase III) and PrP C in the cell lysates from (A). β-actin was used as a loading control. ( D ) SH-SY5Y cells expressing PrP C were treated with either control siRNA or glypican-1 siRNA and then allowed to reach confluence for 48 h. Cells were subsequently surface biotinylated and incubated in OptiMEM for 1 h at 37°C. Cells were homogenised in the presence of 1% (v/v) Triton X-100 and subjected to buoyant sucrose density gradient centrifugation. ( E ) Densitometric analysis of the proportion of total PrP C present in the detergent soluble fractions of the plasma membrane after siRNA treatment from three independent experiments. ( F ) SH-SY5Y cells expressing PrP C were seeded onto glass coverslips and grown to 50% confluency. Cells were fixed, and then incubated with anti-PrP antibody 3F4 and a glypican-1 polyclonal antibody. Finally, cells were incubated with Alexa488-conjugated rabbit anti-mouse and Alexa594-conjugated goat anti-rabbit antibodies and viewed using a DeltaVision Optical Restoration Microscopy System. Images are representative of three individual experiments. Scale bars equal 10 µm. * P
    Horseradish Peroxidase Conjugated Streptavidin, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 90 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/horseradish peroxidase conjugated streptavidin/product/Thermo Fisher
    Average 94 stars, based on 90 article reviews
    Price from $9.99 to $1999.99
    horseradish peroxidase conjugated streptavidin - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    99
    Thermo Fisher streptavidin hrp
    Schematic diagram showed non-radioactive metabolic incorporation followed by azide-biotin or azide-Alex555 labeling, and biotin signals of proteins were detected by <t>streptavidin-HRP</t> by western blot. HPG is incorporated into newly synthesized proteins by metabolism and protein synthesis and the triazole conjugation between newly alkyne proteins labeled HPG and azide labeled either biotin or Alex555 via CuSO4 catalysis (A) . (B-a) The detection of biotin signals from extracted total proteins labeled by labeling reaction. Normal culture medium was changed to replace DMEM free of L-methionine supplemented with HPG after pulse 4 hr, and proteins were extracted in each of group at various time points including 0, 4, 24 and 72 hr. (B-b) Biotin signals of total proteins were detected. 1: Normal culture condition group; 2: HPG plus anisomycin group; 3: HPG group. (B-c,d,e) Biotin signals of Bcl-2, MMP-9 and IgG were individually detected in the immunoprecipitate pulled down by primary antibodies via siRNA post-transfection followed by non-radioactive metabolic labeling. (B-f) Radioactive isotope 35 S-methonine incorporated into synthesized IgG purified by immunoprecipitation was detected by autoradiography. 1: 35 S-methonine treated human choriocarcinoma cell line BeWo group and then antibody against human IgG immunoprecipitated human IgG in extracted total proteins; 2: cycloheximide plus 35 S-methonine treated BeWo group then antibody against human IgG immunoprecipitated human IgG in extracted total proteins; 3: 35 S-methonine treated skin fibroblast and then antibody against human IgG immunoprecipitated human IgG in extracted total proteins.
    Streptavidin Hrp, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 162 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/streptavidin hrp/product/Thermo Fisher
    Average 99 stars, based on 162 article reviews
    Price from $9.99 to $1999.99
    streptavidin hrp - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results


    Depletion of glypican-1 stimulates the endocytosis of PrP C . SH-SY5Y cells expressing wild type PrP C were treated with either control or glypican-1 siRNA and then incubated for 60 h. Cells were surface biotinylated and incubated in OptiMEM for 1 h at 37°C. Where indicated, cells were treated with trypsin to remove remaining cell surface PrP C . Cells were then lysed and total PrP C immunoprecipitated from the sample using antibody 3F4. ( A ) Samples were subjected to western blot analysis and the biotin-labelled PrP C fraction was detected with peroxidase-conjugated streptavidin. ( B ) Densitometric analysis (mean ± s.e.m.) of multiple blots from three separate experiments in (A) is shown. ( C ) Expression of glypican-1 (in lysate samples treated with heparinase I and heparinase III) and PrP C in the cell lysates from (A). β-actin was used as a loading control. ( D ) SH-SY5Y cells expressing PrP C were treated with either control siRNA or glypican-1 siRNA and then allowed to reach confluence for 48 h. Cells were subsequently surface biotinylated and incubated in OptiMEM for 1 h at 37°C. Cells were homogenised in the presence of 1% (v/v) Triton X-100 and subjected to buoyant sucrose density gradient centrifugation. ( E ) Densitometric analysis of the proportion of total PrP C present in the detergent soluble fractions of the plasma membrane after siRNA treatment from three independent experiments. ( F ) SH-SY5Y cells expressing PrP C were seeded onto glass coverslips and grown to 50% confluency. Cells were fixed, and then incubated with anti-PrP antibody 3F4 and a glypican-1 polyclonal antibody. Finally, cells were incubated with Alexa488-conjugated rabbit anti-mouse and Alexa594-conjugated goat anti-rabbit antibodies and viewed using a DeltaVision Optical Restoration Microscopy System. Images are representative of three individual experiments. Scale bars equal 10 µm. * P

    Journal: PLoS Pathogens

    Article Title: Glypican-1 Mediates Both Prion Protein Lipid Raft Association and Disease Isoform Formation

    doi: 10.1371/journal.ppat.1000666

    Figure Lengend Snippet: Depletion of glypican-1 stimulates the endocytosis of PrP C . SH-SY5Y cells expressing wild type PrP C were treated with either control or glypican-1 siRNA and then incubated for 60 h. Cells were surface biotinylated and incubated in OptiMEM for 1 h at 37°C. Where indicated, cells were treated with trypsin to remove remaining cell surface PrP C . Cells were then lysed and total PrP C immunoprecipitated from the sample using antibody 3F4. ( A ) Samples were subjected to western blot analysis and the biotin-labelled PrP C fraction was detected with peroxidase-conjugated streptavidin. ( B ) Densitometric analysis (mean ± s.e.m.) of multiple blots from three separate experiments in (A) is shown. ( C ) Expression of glypican-1 (in lysate samples treated with heparinase I and heparinase III) and PrP C in the cell lysates from (A). β-actin was used as a loading control. ( D ) SH-SY5Y cells expressing PrP C were treated with either control siRNA or glypican-1 siRNA and then allowed to reach confluence for 48 h. Cells were subsequently surface biotinylated and incubated in OptiMEM for 1 h at 37°C. Cells were homogenised in the presence of 1% (v/v) Triton X-100 and subjected to buoyant sucrose density gradient centrifugation. ( E ) Densitometric analysis of the proportion of total PrP C present in the detergent soluble fractions of the plasma membrane after siRNA treatment from three independent experiments. ( F ) SH-SY5Y cells expressing PrP C were seeded onto glass coverslips and grown to 50% confluency. Cells were fixed, and then incubated with anti-PrP antibody 3F4 and a glypican-1 polyclonal antibody. Finally, cells were incubated with Alexa488-conjugated rabbit anti-mouse and Alexa594-conjugated goat anti-rabbit antibodies and viewed using a DeltaVision Optical Restoration Microscopy System. Images are representative of three individual experiments. Scale bars equal 10 µm. * P

    Article Snippet: Where indicated, biotin-labelled PrP was detected by subsequent immunoprecipitation of epitope-tagged PrP from the individual fractions using antibody 3F4 (Eurogentec Ltd., Southampton, U.K.) and subsequent immunoblotting using horseradish peroxidase-conjugated streptavidin (Thermo Fisher Scientific, Cramlington, U.K.).

    Techniques: Expressing, Incubation, Immunoprecipitation, Western Blot, Gradient Centrifugation, Microscopy

    Depletion of glypican-1 does not affect cell division or surface levels of PrP C . ( A ) ScN2a cells were seeded into 96 well plates and treated with transfection reagent only or incubated with either control siRNA or one of the four siRNAs targeted to glypican-1. Those experiments exceeding 48 h were dosed with a second treatment of the indicated siRNAs. Cells were then rinsed with PBS and fixed with 70% (v/v) ethanol. Plates were allowed to dry, stained with Hoescht 33342 and the fluorescence measured. ( B ) ScN2a cells were treated with control or glypican-1 siRNA. After 96 h, cell monolayers were labelled with a membrane impermeable biotin reagent. Biotin-labelled cell surface PrP was detected by immunoprecipitation using 6D11 and subsequent immunoblotting using HRP-conjugated streptavidin. Total PrP and PK-resistant PrP (PrP Sc ) were detected by immunoblotting using antibody 6D11. ( C ) Densitometric analysis of the proportion of the relative amount of biotinylated cell surface PrP in the absence or presence of glypican-1 siRNA from three independent experiments.

    Journal: PLoS Pathogens

    Article Title: Glypican-1 Mediates Both Prion Protein Lipid Raft Association and Disease Isoform Formation

    doi: 10.1371/journal.ppat.1000666

    Figure Lengend Snippet: Depletion of glypican-1 does not affect cell division or surface levels of PrP C . ( A ) ScN2a cells were seeded into 96 well plates and treated with transfection reagent only or incubated with either control siRNA or one of the four siRNAs targeted to glypican-1. Those experiments exceeding 48 h were dosed with a second treatment of the indicated siRNAs. Cells were then rinsed with PBS and fixed with 70% (v/v) ethanol. Plates were allowed to dry, stained with Hoescht 33342 and the fluorescence measured. ( B ) ScN2a cells were treated with control or glypican-1 siRNA. After 96 h, cell monolayers were labelled with a membrane impermeable biotin reagent. Biotin-labelled cell surface PrP was detected by immunoprecipitation using 6D11 and subsequent immunoblotting using HRP-conjugated streptavidin. Total PrP and PK-resistant PrP (PrP Sc ) were detected by immunoblotting using antibody 6D11. ( C ) Densitometric analysis of the proportion of the relative amount of biotinylated cell surface PrP in the absence or presence of glypican-1 siRNA from three independent experiments.

    Article Snippet: Where indicated, biotin-labelled PrP was detected by subsequent immunoprecipitation of epitope-tagged PrP from the individual fractions using antibody 3F4 (Eurogentec Ltd., Southampton, U.K.) and subsequent immunoblotting using horseradish peroxidase-conjugated streptavidin (Thermo Fisher Scientific, Cramlington, U.K.).

    Techniques: Transfection, Incubation, Staining, Fluorescence, Immunoprecipitation

    Heparin stimulates the endocytosis of PrP C in a dose-dependent manner and displaces it from detergent-resistant lipid rafts. ( A ) SH-SY5Y cells expressing PrP C were surface biotinylated and then incubated for 1 h at 37°C in the absence or presence of various concentrations of heparin diluted in OptiMEM. Prior to lysis cells were, where indicated, incubated with trypsin to digest cell surface PrP C . Cells were then lysed and PrP C immunoprecipitated from the sample using antibody 3F4. Samples were subjected to SDS PAGE and western blot analysis and the biotin-labelled PrP C detected with peroxidase-conjugated streptavidin. ( B ) Densitometric analysis of multiple blots from four separate experiments as described in (A) is shown. ( C ) SH-SY5Y cells expressing PrP C were surface biotinylated and then incubated in the absence or presence of 50 µM heparin prepared in OptiMEM for 1 h at 37°C. Cells were homogenised in the presence of 1% (v/v) Triton X-100 and subjected to buoyant sucrose density gradient centrifugation. PrP C was immunoprecipitated from equal volumes of each gradient fraction using 3F4 and subjected to SDS-PAGE and western blotting. The gradient fractions from both the untreated and heparin treated cells were analysed on the same SDS gel and immunoblotted under identical conditions. The biotin-labelled PrP C was detected with peroxidase-conjugated streptavidin. Flotillin-1 and transferrin receptor (TfR) were detected by immunoblotting as markers for DRM and detergent-soluble fractions, respectively. ( D ) Densitometric analysis of the proportion of total PrP C in the detergent soluble fractions of the plasma membrane. ( E ) Untransfected SH-SY5Y cells and SH-SY5Y cells expressing either PrP C or PrP-TM were grown to confluence and then incubated for 1 h in the presence or absence of 50 µM heparin prepared in OptiMEM. Media samples were collected and concentrated and cells harvested and lysed. Cell lysate samples were immunoblotted for PrP C using antibody 3F4, with β-actin used as a loading control. ( F ) Quantification of PrP C and PrP-TM levels after treatment of cells with heparin as in (E). Experiments were performed in triplicate and repeated on three occasions. * P

    Journal: PLoS Pathogens

    Article Title: Glypican-1 Mediates Both Prion Protein Lipid Raft Association and Disease Isoform Formation

    doi: 10.1371/journal.ppat.1000666

    Figure Lengend Snippet: Heparin stimulates the endocytosis of PrP C in a dose-dependent manner and displaces it from detergent-resistant lipid rafts. ( A ) SH-SY5Y cells expressing PrP C were surface biotinylated and then incubated for 1 h at 37°C in the absence or presence of various concentrations of heparin diluted in OptiMEM. Prior to lysis cells were, where indicated, incubated with trypsin to digest cell surface PrP C . Cells were then lysed and PrP C immunoprecipitated from the sample using antibody 3F4. Samples were subjected to SDS PAGE and western blot analysis and the biotin-labelled PrP C detected with peroxidase-conjugated streptavidin. ( B ) Densitometric analysis of multiple blots from four separate experiments as described in (A) is shown. ( C ) SH-SY5Y cells expressing PrP C were surface biotinylated and then incubated in the absence or presence of 50 µM heparin prepared in OptiMEM for 1 h at 37°C. Cells were homogenised in the presence of 1% (v/v) Triton X-100 and subjected to buoyant sucrose density gradient centrifugation. PrP C was immunoprecipitated from equal volumes of each gradient fraction using 3F4 and subjected to SDS-PAGE and western blotting. The gradient fractions from both the untreated and heparin treated cells were analysed on the same SDS gel and immunoblotted under identical conditions. The biotin-labelled PrP C was detected with peroxidase-conjugated streptavidin. Flotillin-1 and transferrin receptor (TfR) were detected by immunoblotting as markers for DRM and detergent-soluble fractions, respectively. ( D ) Densitometric analysis of the proportion of total PrP C in the detergent soluble fractions of the plasma membrane. ( E ) Untransfected SH-SY5Y cells and SH-SY5Y cells expressing either PrP C or PrP-TM were grown to confluence and then incubated for 1 h in the presence or absence of 50 µM heparin prepared in OptiMEM. Media samples were collected and concentrated and cells harvested and lysed. Cell lysate samples were immunoblotted for PrP C using antibody 3F4, with β-actin used as a loading control. ( F ) Quantification of PrP C and PrP-TM levels after treatment of cells with heparin as in (E). Experiments were performed in triplicate and repeated on three occasions. * P

    Article Snippet: Where indicated, biotin-labelled PrP was detected by subsequent immunoprecipitation of epitope-tagged PrP from the individual fractions using antibody 3F4 (Eurogentec Ltd., Southampton, U.K.) and subsequent immunoblotting using horseradish peroxidase-conjugated streptavidin (Thermo Fisher Scientific, Cramlington, U.K.).

    Techniques: Expressing, Incubation, Lysis, Immunoprecipitation, SDS Page, Western Blot, Gradient Centrifugation, SDS-Gel

    Depletion of glypican-1 inhibits the association of PrP-TM with DRMs. SH-SY5Y cells expressing PrP-TM were treated with either control siRNA or siRNA targeted to glypican-1 and then allowed to reach confluence for 48 h. Cells were subsequently surface biotinylated and incubated in OptiMEM for 1 h at 37°C in the presence of Tyrphostin A23 to block endocytosis. The media was removed and the cells washed in phosphate-buffered saline prior to homogenisation in the presence of 1% (v/v) Triton X-100 and subjected to buoyant sucrose density gradient centrifugation. ( A ) Quantification of glypican-1 and PrP-TM expression in cell lysates. To detect glypican-1, cell lysate samples were treated with heparinase I and heparinase III prior to electrophoresis as described in the materials and methods section. ( B ) PrP-TM was immunoprecipitated from equal volumes of each gradient fraction using 3F4 and then subjected to western blotting with peroxidase-conjugated streptavidin. Flotillin-1 and transferrin receptor (TfR) were detected by immunoblotting as markers for DRM and detergent-soluble fractions, respectively. ( C ) Densitometric analysis of the proportion of total PrP-TM present in the detergent soluble fractions of the plasma membrane after siRNA treatment from multiple blots from three independent experiments. * P

    Journal: PLoS Pathogens

    Article Title: Glypican-1 Mediates Both Prion Protein Lipid Raft Association and Disease Isoform Formation

    doi: 10.1371/journal.ppat.1000666

    Figure Lengend Snippet: Depletion of glypican-1 inhibits the association of PrP-TM with DRMs. SH-SY5Y cells expressing PrP-TM were treated with either control siRNA or siRNA targeted to glypican-1 and then allowed to reach confluence for 48 h. Cells were subsequently surface biotinylated and incubated in OptiMEM for 1 h at 37°C in the presence of Tyrphostin A23 to block endocytosis. The media was removed and the cells washed in phosphate-buffered saline prior to homogenisation in the presence of 1% (v/v) Triton X-100 and subjected to buoyant sucrose density gradient centrifugation. ( A ) Quantification of glypican-1 and PrP-TM expression in cell lysates. To detect glypican-1, cell lysate samples were treated with heparinase I and heparinase III prior to electrophoresis as described in the materials and methods section. ( B ) PrP-TM was immunoprecipitated from equal volumes of each gradient fraction using 3F4 and then subjected to western blotting with peroxidase-conjugated streptavidin. Flotillin-1 and transferrin receptor (TfR) were detected by immunoblotting as markers for DRM and detergent-soluble fractions, respectively. ( C ) Densitometric analysis of the proportion of total PrP-TM present in the detergent soluble fractions of the plasma membrane after siRNA treatment from multiple blots from three independent experiments. * P

    Article Snippet: Where indicated, biotin-labelled PrP was detected by subsequent immunoprecipitation of epitope-tagged PrP from the individual fractions using antibody 3F4 (Eurogentec Ltd., Southampton, U.K.) and subsequent immunoblotting using horseradish peroxidase-conjugated streptavidin (Thermo Fisher Scientific, Cramlington, U.K.).

    Techniques: Expressing, Incubation, Blocking Assay, Homogenization, Gradient Centrifugation, Electrophoresis, Immunoprecipitation, Western Blot

    The association of PrP-TM with DRMs is disrupted by treatment of cells with either heparin or bacterial PI-PLC. SH-SY5Y cells expressing PrP-TM were surface biotinylated and then ( A ) incubated in the absence or presence of 50 µM heparin prepared in OptiMEM for 1 h at 37°C or ( B ) incubated in the absence or presence of 1 U/ml bacterial PI-PLC for 1 h at 4°C. Cells were homogenised in the presence of 1% (v/v) Triton X-100 and subjected to buoyant sucrose density gradient centrifugation. PrP-TM was immunoprecipitated from equal volumes of each gradient fraction using 3F4 and subjected to western blotting. The biotin-labelled PrP-TM fraction was detected with peroxidase-conjugated streptavidin. Flotillin-1 and transferrin receptor (TfR) were detected by immunoblotting as markers for DRM and detergent-soluble fractions respectively. ( C ) Densitometric analysis of the proportion of total PrP-TM present in the detergent soluble fractions of the plasma membrane after heparin and PI-PLC treatment. Experiments were performed in triplicate and repeated on three occasions. * P

    Journal: PLoS Pathogens

    Article Title: Glypican-1 Mediates Both Prion Protein Lipid Raft Association and Disease Isoform Formation

    doi: 10.1371/journal.ppat.1000666

    Figure Lengend Snippet: The association of PrP-TM with DRMs is disrupted by treatment of cells with either heparin or bacterial PI-PLC. SH-SY5Y cells expressing PrP-TM were surface biotinylated and then ( A ) incubated in the absence or presence of 50 µM heparin prepared in OptiMEM for 1 h at 37°C or ( B ) incubated in the absence or presence of 1 U/ml bacterial PI-PLC for 1 h at 4°C. Cells were homogenised in the presence of 1% (v/v) Triton X-100 and subjected to buoyant sucrose density gradient centrifugation. PrP-TM was immunoprecipitated from equal volumes of each gradient fraction using 3F4 and subjected to western blotting. The biotin-labelled PrP-TM fraction was detected with peroxidase-conjugated streptavidin. Flotillin-1 and transferrin receptor (TfR) were detected by immunoblotting as markers for DRM and detergent-soluble fractions respectively. ( C ) Densitometric analysis of the proportion of total PrP-TM present in the detergent soluble fractions of the plasma membrane after heparin and PI-PLC treatment. Experiments were performed in triplicate and repeated on three occasions. * P

    Article Snippet: Where indicated, biotin-labelled PrP was detected by subsequent immunoprecipitation of epitope-tagged PrP from the individual fractions using antibody 3F4 (Eurogentec Ltd., Southampton, U.K.) and subsequent immunoblotting using horseradish peroxidase-conjugated streptavidin (Thermo Fisher Scientific, Cramlington, U.K.).

    Techniques: Planar Chromatography, Expressing, Incubation, Gradient Centrifugation, Immunoprecipitation, Western Blot

    Schematic diagram showed non-radioactive metabolic incorporation followed by azide-biotin or azide-Alex555 labeling, and biotin signals of proteins were detected by streptavidin-HRP by western blot. HPG is incorporated into newly synthesized proteins by metabolism and protein synthesis and the triazole conjugation between newly alkyne proteins labeled HPG and azide labeled either biotin or Alex555 via CuSO4 catalysis (A) . (B-a) The detection of biotin signals from extracted total proteins labeled by labeling reaction. Normal culture medium was changed to replace DMEM free of L-methionine supplemented with HPG after pulse 4 hr, and proteins were extracted in each of group at various time points including 0, 4, 24 and 72 hr. (B-b) Biotin signals of total proteins were detected. 1: Normal culture condition group; 2: HPG plus anisomycin group; 3: HPG group. (B-c,d,e) Biotin signals of Bcl-2, MMP-9 and IgG were individually detected in the immunoprecipitate pulled down by primary antibodies via siRNA post-transfection followed by non-radioactive metabolic labeling. (B-f) Radioactive isotope 35 S-methonine incorporated into synthesized IgG purified by immunoprecipitation was detected by autoradiography. 1: 35 S-methonine treated human choriocarcinoma cell line BeWo group and then antibody against human IgG immunoprecipitated human IgG in extracted total proteins; 2: cycloheximide plus 35 S-methonine treated BeWo group then antibody against human IgG immunoprecipitated human IgG in extracted total proteins; 3: 35 S-methonine treated skin fibroblast and then antibody against human IgG immunoprecipitated human IgG in extracted total proteins.

    Journal: BMC Cell Biology

    Article Title: A morphologic and semi-quantitative technique to analyze synthesis and release of specific proteins in cells

    doi: 10.1186/s12860-014-0045-1

    Figure Lengend Snippet: Schematic diagram showed non-radioactive metabolic incorporation followed by azide-biotin or azide-Alex555 labeling, and biotin signals of proteins were detected by streptavidin-HRP by western blot. HPG is incorporated into newly synthesized proteins by metabolism and protein synthesis and the triazole conjugation between newly alkyne proteins labeled HPG and azide labeled either biotin or Alex555 via CuSO4 catalysis (A) . (B-a) The detection of biotin signals from extracted total proteins labeled by labeling reaction. Normal culture medium was changed to replace DMEM free of L-methionine supplemented with HPG after pulse 4 hr, and proteins were extracted in each of group at various time points including 0, 4, 24 and 72 hr. (B-b) Biotin signals of total proteins were detected. 1: Normal culture condition group; 2: HPG plus anisomycin group; 3: HPG group. (B-c,d,e) Biotin signals of Bcl-2, MMP-9 and IgG were individually detected in the immunoprecipitate pulled down by primary antibodies via siRNA post-transfection followed by non-radioactive metabolic labeling. (B-f) Radioactive isotope 35 S-methonine incorporated into synthesized IgG purified by immunoprecipitation was detected by autoradiography. 1: 35 S-methonine treated human choriocarcinoma cell line BeWo group and then antibody against human IgG immunoprecipitated human IgG in extracted total proteins; 2: cycloheximide plus 35 S-methonine treated BeWo group then antibody against human IgG immunoprecipitated human IgG in extracted total proteins; 3: 35 S-methonine treated skin fibroblast and then antibody against human IgG immunoprecipitated human IgG in extracted total proteins.

    Article Snippet: Each diluted standard was incubated with primary antibody coated on the well and streptavidin-HRP and OD value for each sample was detected by ELISA.

    Techniques: Labeling, Western Blot, Synthesized, Conjugation Assay, Transfection, Purification, Immunoprecipitation, Autoradiography

    Electron microscopy of PA1b-bound V-ATPase. A , representative classes of PA1b-streptavidin-HRP-bound V-ATPase in the absence of ATP. B , as A but in the presence of 2 m m Mg·ATP. The PA1b-streptavidin-HRP density is indicated by an arrow in the far left panel 1 of A. Scale bars in both A and B represent 15 nm. C–E , three-dimensional reconstructions of the V-ATPase viewed perpendicular to the long axis of the complex ( upper image ) and from the extracellular end ( lower image ) bound to PA1b ( C ), bound to PA1b after the addition of Mg·ATP ( D ) and a control with no PA1b ( E ). All models were generated using EMAN, and the picture was produced using Chimera rendered at the same sigma level. In C ( lower ), the decameric c ring (Protein Data Bank ID code 2DB4 ( 53 ) r ainbow colors ) and a subunit model ( red ) have been fitted to the PA1b-streptavidin-HRP V-ATPase reconstruction in the absence of ATP using Chimera. If catalytically active, the c ring would rotate counterclockwise with respect to subunit a when observed from this perspective.

    Journal: The Journal of Biological Chemistry

    Article Title: PA1b Inhibitor Binding to Subunits c and e of the Vacuolar ATPase Reveals Its Insecticidal Mechanism *

    doi: 10.1074/jbc.M113.541250

    Figure Lengend Snippet: Electron microscopy of PA1b-bound V-ATPase. A , representative classes of PA1b-streptavidin-HRP-bound V-ATPase in the absence of ATP. B , as A but in the presence of 2 m m Mg·ATP. The PA1b-streptavidin-HRP density is indicated by an arrow in the far left panel 1 of A. Scale bars in both A and B represent 15 nm. C–E , three-dimensional reconstructions of the V-ATPase viewed perpendicular to the long axis of the complex ( upper image ) and from the extracellular end ( lower image ) bound to PA1b ( C ), bound to PA1b after the addition of Mg·ATP ( D ) and a control with no PA1b ( E ). All models were generated using EMAN, and the picture was produced using Chimera rendered at the same sigma level. In C ( lower ), the decameric c ring (Protein Data Bank ID code 2DB4 ( 53 ) r ainbow colors ) and a subunit model ( red ) have been fitted to the PA1b-streptavidin-HRP V-ATPase reconstruction in the absence of ATP using Chimera. If catalytically active, the c ring would rotate counterclockwise with respect to subunit a when observed from this perspective.

    Article Snippet: For the second experiment, 4 μl of V-ATPase (4 μg) was mixed with 3 μl of biotin-PA1b (3 μg) and 3 μl of streptavidin-HRP (15 μg), made up to 60 μl using V-ATPase buffer and incubated for 30 min. Mg·ATP was from a stock solution of 100 mm at pH 7.5 to a final concentration of 5 mm , and the mixture was incubated at room temperature for 5 min to allow for complete turnover.

    Techniques: Electron Microscopy, Generated, Produced

    Expression of recombinant porcine CCL2. (A) CHO cell line stably expressing the porcine CCL2 fused to GFP. The expression of GFP fusion protein was directly analysed by flow cytometry. Non transfected CHO cells were used as negative control (grey histogram). 5 000 cells were acquired. (B) Western blot of CCL2-GFP produced by transfected CHO cells. Different dilutions of supernatant were resolved by 15% SDS-PAGE under reducing conditions and revealed with biotinylated anti-GFP and streptavidin-HRP. Numbers on the left indicate the position of MW markers. (C) Chemotactic activity of CCL2-GFP on porcine blood monocytes. Chemotaxis was assessed with the Transwell cell migration system and subsequent flow cytometry counting of migrated cells by a 45 s acquisition. (1) FSC versus SSC dot plot of migrated cells in response to supernatants from CHO cells expressing CCL2-GFP or the inverted sequence of pCCL2 fused to GFP (InvCCL2-GFP, negative control). (2) Results expressed as migration index, calculated as the ratio of the number of cells migrating to the chemokine and the number of cells in the negative control. Results from one representative experiment out of three performed are shown. (A color version of this figure is available at www.vetres.org. )

    Journal: Veterinary Research

    Article Title: Porcine monocyte subsets differ in the expression of CCR2 and in their responsiveness to CCL2

    doi: 10.1051/vetres/2010048

    Figure Lengend Snippet: Expression of recombinant porcine CCL2. (A) CHO cell line stably expressing the porcine CCL2 fused to GFP. The expression of GFP fusion protein was directly analysed by flow cytometry. Non transfected CHO cells were used as negative control (grey histogram). 5 000 cells were acquired. (B) Western blot of CCL2-GFP produced by transfected CHO cells. Different dilutions of supernatant were resolved by 15% SDS-PAGE under reducing conditions and revealed with biotinylated anti-GFP and streptavidin-HRP. Numbers on the left indicate the position of MW markers. (C) Chemotactic activity of CCL2-GFP on porcine blood monocytes. Chemotaxis was assessed with the Transwell cell migration system and subsequent flow cytometry counting of migrated cells by a 45 s acquisition. (1) FSC versus SSC dot plot of migrated cells in response to supernatants from CHO cells expressing CCL2-GFP or the inverted sequence of pCCL2 fused to GFP (InvCCL2-GFP, negative control). (2) Results expressed as migration index, calculated as the ratio of the number of cells migrating to the chemokine and the number of cells in the negative control. Results from one representative experiment out of three performed are shown. (A color version of this figure is available at www.vetres.org. )

    Article Snippet: The expression of GFP-fused proteins in these clones was confirmed by Western blot using a biotin-conjugated goat anti-GFP polyclonal antibody and streptavidin-HRP.

    Techniques: Expressing, Recombinant, Stable Transfection, Flow Cytometry, Cytometry, Transfection, Negative Control, Western Blot, Produced, SDS Page, Activity Assay, Chemotaxis Assay, Migration, Sequencing