steponeplus thermal cycler  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Thermo Fisher steponeplus thermal cycler
    Steponeplus Thermal Cycler, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 58 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/steponeplus thermal cycler/product/Thermo Fisher
    Average 99 stars, based on 58 article reviews
    Price from $9.99 to $1999.99
    steponeplus thermal cycler - by Bioz Stars, 2020-04
    99/100 stars

    Images

    Related Articles

    Immunocytochemistry:

    Article Title: Single-Cell Sequencing of iPSC-Dopamine Neurons Reconstructs Disease Progression and Identifies HDAC4 as a Regulator of Parkinson Cell Phenotypes
    Article Snippet: Paragraph title: qRT-PCR, immunocytochemistry and western blot ... Quality and concentration were quantified using a Nanodrop 1000 (Thermo Scientific). cDNA was synthesized using a superscript III reverse transcriptase kit (Life technologies) as per manufacturer’s instructions. qRT-PCR was carried out using fast SYBR green mastermix and a StepOnePlus thermal cycler (Life technologies).

    Synthesized:

    Article Title: Single-Cell Sequencing of iPSC-Dopamine Neurons Reconstructs Disease Progression and Identifies HDAC4 as a Regulator of Parkinson Cell Phenotypes
    Article Snippet: .. Quality and concentration were quantified using a Nanodrop 1000 (Thermo Scientific). cDNA was synthesized using a superscript III reverse transcriptase kit (Life technologies) as per manufacturer’s instructions. qRT-PCR was carried out using fast SYBR green mastermix and a StepOnePlus thermal cycler (Life technologies). .. For immunocytochemistry cells were fixed in 4% paraformaldehyde in 96 well plates (microClear 96 well plates, Greiner).

    Article Title: Lipopolysaccharide and lipoteichoic acid enhance serum amyloid A3 mRNA expression in murine alveolar epithelial cells
    Article Snippet: Contaminating DNA was eliminated by treatment with DNaseI (18068-015, Invitrogen, Carlsbad, CA, U.S.A.) and cDNA was synthesized using PrimeScript RT Master Mix (RR036A, Takara, Kusatsu, Japan) according to the manufacturer’s instructions. .. Quantitative real-time PCR was carried out in 96-well plates using 300 nmol each of forward and reverse primers, 10 n g of cDNA, and PowerUp SYBR Green Master Mix (A25742, Applied Biosystems, Foster City, CA, U.S.A.) on a StepOnePlus thermal cycler (Applied Biosystems).

    Article Title: Hippo signaling is intrinsically regulated during cell cycle progression by APC/CCdh1
    Article Snippet: Total RNA was prepared using TRIZOL reagent (Life Technologies) or RNAeasy mini kit (Qiagen) according to the manufacturer’s protocol. cDNA was synthesized from total RNA (1–3 μg) using SuperScript II Reverse Transcriptase (Life Technologies) with random hexamer (Roche). .. Quantitative real-time PCR were done with SYBR Select Master Mix on StepOnePlus thermal cycler (Applied Biosystem).

    Article Title: Hippo signaling interactions with Wnt/ β-catenin and Notch signaling repress liver tumorigenesis
    Article Snippet: .. Total RNA from mouse liver tissue or cultured cells was prepared using TRIzol Reagent (Life Technologies, Thermo Fisher Scientific) or an RNeasy Mini Kit (QIAGEN) according to the manufacturer’s protocol. cDNA were synthesized from total RNA (1–3 μg) using SuperScript II Reverse Transcriptase with a random primer (Life Technologies, Thermo Fisher Scientific). qRT-PCR was performed using SYBR Select Master Mix (Thermo Fisher Scientific) on a StepOnePlus thermal cycler from Applied Biosystems. .. Expression levels were always given relative to GAPDH .

    Article Title: Activation of the Immune-Metabolic Receptor GPR84 Enhances Inflammation and Phagocytosis in Macrophages
    Article Snippet: Mouse tissues and cultured cells were extracted with TRIzol reagent (Thermo Fisher Scientific), and total RNA concentration and quality was determined with a ND-1000 spectrophotometer (Nano Drop Technologies, Wilmington, DE, USA). cDNA was synthesized from 700 to 1,000 ng RNA using the QuantiTect Reverse Transcription kit (Qiagen, Manchester, UK) according to the manufacturer’s instructions. .. Real-time quantitative PCR was performed using either Taqman or Sybr Select gene expression master mix (Life Technologies) in the StepOnePlus™ thermal cycler (Applied Biosystems).

    Quantitative RT-PCR:

    Article Title: Single-Cell Sequencing of iPSC-Dopamine Neurons Reconstructs Disease Progression and Identifies HDAC4 as a Regulator of Parkinson Cell Phenotypes
    Article Snippet: .. Quality and concentration were quantified using a Nanodrop 1000 (Thermo Scientific). cDNA was synthesized using a superscript III reverse transcriptase kit (Life technologies) as per manufacturer’s instructions. qRT-PCR was carried out using fast SYBR green mastermix and a StepOnePlus thermal cycler (Life technologies). .. For immunocytochemistry cells were fixed in 4% paraformaldehyde in 96 well plates (microClear 96 well plates, Greiner).

    Article Title: Treatment of Nasopharyngeal Carcinoma Cells with the Histone-Deacetylase Inhibitor Abexinostat: Cooperative Effects with Cis-platin and Radiotherapy on Patient-Derived Xenografts
    Article Snippet: Paragraph title: RNA extraction and transcript assessment by real-time RT-PCR ... Reaction were run in a StepOnePlus thermal cycler (Life Technologies) beginning by one step at 45°C for 30 min (RT reaction) and one step at 95°C for 10 min (release of single strand DNA and activation of the DNA polymerase).

    Article Title: Hippo signaling is intrinsically regulated during cell cycle progression by APC/CCdh1
    Article Snippet: Paragraph title: Quantitative RT-PCR Analysis. ... Quantitative real-time PCR were done with SYBR Select Master Mix on StepOnePlus thermal cycler (Applied Biosystem).

    Article Title: Hippo signaling interactions with Wnt/ β-catenin and Notch signaling repress liver tumorigenesis
    Article Snippet: .. Total RNA from mouse liver tissue or cultured cells was prepared using TRIzol Reagent (Life Technologies, Thermo Fisher Scientific) or an RNeasy Mini Kit (QIAGEN) according to the manufacturer’s protocol. cDNA were synthesized from total RNA (1–3 μg) using SuperScript II Reverse Transcriptase with a random primer (Life Technologies, Thermo Fisher Scientific). qRT-PCR was performed using SYBR Select Master Mix (Thermo Fisher Scientific) on a StepOnePlus thermal cycler from Applied Biosystems. .. Expression levels were always given relative to GAPDH .

    Real-time Polymerase Chain Reaction:

    Article Title: Calcineurin down-regulation in the amygdala is sufficient to induce anxiety-like and depression-like behaviors in C57BL/6J male mice
    Article Snippet: .. 500 ng of RNA from each sample was reverse transcribed into cDNA using the QuantiTect Reverse Transcription Kit (Qiagen). cDNA was then quantified using real time PCR with SYBR Green in a StepOnePlus Thermal Cycler (Applied Biosystems). .. Primer sets for CnB and a reference gene (β-glucuronidase, GusB1) were designed using Primer3 to span introns to prevent genomic DNA amplification.

    Article Title: Predictors of Enteric Pathogens in the Domestic Environment from Human and Animal Sources in Rural Bangladesh
    Article Snippet: Paragraph title: qPCR Assays ... All samples were run in triplicate on a 96-well plate (Applied Biosystems, Foster City, CA) on a StepOnePlus thermal cycler (Applied Biosystems, Foster City, CA).

    Article Title: Lipopolysaccharide and lipoteichoic acid enhance serum amyloid A3 mRNA expression in murine alveolar epithelial cells
    Article Snippet: .. Quantitative real-time PCR was carried out in 96-well plates using 300 nmol each of forward and reverse primers, 10 n g of cDNA, and PowerUp SYBR Green Master Mix (A25742, Applied Biosystems, Foster City, CA, U.S.A.) on a StepOnePlus thermal cycler (Applied Biosystems). .. Thermal cycling was carried out for 2 min at 5°C and 2 min at 95°C, followed by 40 cycles at 95°C for 3 sec and 60°C for 30 sec.

    Article Title: Hippo signaling is intrinsically regulated during cell cycle progression by APC/CCdh1
    Article Snippet: .. Quantitative real-time PCR were done with SYBR Select Master Mix on StepOnePlus thermal cycler (Applied Biosystem). ..

    Article Title: Macrophage subsets exhibit distinct E. coli-LPS tolerisable cytokines associated with the negative regulators, IRAK-M and Tollip
    Article Snippet: Paragraph title: Real-time PCR analysis of gene expression ... RT-PCR was performed using StepOnePlus thermal cycler and Power SYBR Green kit (Applied Biosystems, Foster City, CA, USA) using 10 pmol of the forward and reverse primers for each target.

    Article Title: Expression of the 5-HT1A Serotonin Receptor in the Hippocampus Is Required for Social Stress Resilience and the Antidepressant-Like Effects Induced by the Nicotinic Partial Agonist Cytisine
    Article Snippet: .. Reverse transcription was performed and cDNA was quantified by quantitative PCR with SYBR Green using a StepOnePlus Thermal Cycler (Applied Biosystems). ..

    Article Title: Salivary Gland Gene Expression Atlas Identifies a New Regulator of Branching Morphogenesis
    Article Snippet: .. Independent biological replicates (n = at least 3) were amplified once and analyzed by SYBR-Green qPCR in a StepOnePlus thermal cycler (Applied Biosystems) with ddCT used to calculate fold change. .. E12 SMGs were treated with GSK3β inhibitors 20 mM LiCl , 10 µM S3442 (SB-216763) , or 5 µM BIO (6-bromoindirubin-3′-oxime; Sigma-Aldrich, St. Louis, MO, USA) ( ) with appropriate vehicle controls.

    Article Title: Activation of the Immune-Metabolic Receptor GPR84 Enhances Inflammation and Phagocytosis in Macrophages
    Article Snippet: .. Real-time quantitative PCR was performed using either Taqman or Sybr Select gene expression master mix (Life Technologies) in the StepOnePlus™ thermal cycler (Applied Biosystems). .. Primers were purchased from Qiagen ( tnf α, il-6, il-12b, ccl2, ccl5, cxcl1, fc γ RI, icam-1, βactin ) and Taqman ( gpr84, βactin ).

    Microarray:

    Article Title: Salivary Gland Gene Expression Atlas Identifies a New Regulator of Branching Morphogenesis
    Article Snippet: Paragraph title: Microarray Analysis and qPCR Validation ... Independent biological replicates (n = at least 3) were amplified once and analyzed by SYBR-Green qPCR in a StepOnePlus thermal cycler (Applied Biosystems) with ddCT used to calculate fold change.

    Quantitation Assay:

    Article Title: Calcineurin down-regulation in the amygdala is sufficient to induce anxiety-like and depression-like behaviors in C57BL/6J male mice
    Article Snippet: Paragraph title: Quantitative real-time (q)-PCR and mRNA quantitation of CnB ... 500 ng of RNA from each sample was reverse transcribed into cDNA using the QuantiTect Reverse Transcription Kit (Qiagen). cDNA was then quantified using real time PCR with SYBR Green in a StepOnePlus Thermal Cycler (Applied Biosystems).

    Article Title: Macrophage subsets exhibit distinct E. coli-LPS tolerisable cytokines associated with the negative regulators, IRAK-M and Tollip
    Article Snippet: RT-PCR was performed using StepOnePlus thermal cycler and Power SYBR Green kit (Applied Biosystems, Foster City, CA, USA) using 10 pmol of the forward and reverse primers for each target. .. Thus, the relative quantity of the target transcript is described as fold change (RQ, relative quantitation) relative to the reference sample and GAPDH.

    Article Title: Expression of the 5-HT1A Serotonin Receptor in the Hippocampus Is Required for Social Stress Resilience and the Antidepressant-Like Effects Induced by the Nicotinic Partial Agonist Cytisine
    Article Snippet: Paragraph title: Quantitative Real-Time (q)-PCR and mRNA Quantitation ... Reverse transcription was performed and cDNA was quantified by quantitative PCR with SYBR Green using a StepOnePlus Thermal Cycler (Applied Biosystems).

    Amplification:

    Article Title: Calcineurin down-regulation in the amygdala is sufficient to induce anxiety-like and depression-like behaviors in C57BL/6J male mice
    Article Snippet: 500 ng of RNA from each sample was reverse transcribed into cDNA using the QuantiTect Reverse Transcription Kit (Qiagen). cDNA was then quantified using real time PCR with SYBR Green in a StepOnePlus Thermal Cycler (Applied Biosystems). .. Primer sets for CnB and a reference gene (β-glucuronidase, GusB1) were designed using Primer3 to span introns to prevent genomic DNA amplification.

    Article Title: Predictors of Enteric Pathogens in the Domestic Environment from Human and Animal Sources in Rural Bangladesh
    Article Snippet: BacCow was sensitive but not specific to ruminant feces, and HumM2 performed the best out of all tested human-associated assays (HumM2, HF183, and BacHum), although it also amplified in the feces of chickens and goats. .. All samples were run in triplicate on a 96-well plate (Applied Biosystems, Foster City, CA) on a StepOnePlus thermal cycler (Applied Biosystems, Foster City, CA).

    Article Title: Macrophage subsets exhibit distinct E. coli-LPS tolerisable cytokines associated with the negative regulators, IRAK-M and Tollip
    Article Snippet: RT-PCR was performed using StepOnePlus thermal cycler and Power SYBR Green kit (Applied Biosystems, Foster City, CA, USA) using 10 pmol of the forward and reverse primers for each target. .. Target amplification was carried out under the following conditions: preheating at 95°C for 10 min, followed by 40 cycles at 95°C for 30 s, 60°C for 1 min and 72°C for 1 min. RT-PCR data were analysed following the 2-ΔΔCt method as described by Livak and Schmittgen [ ], using GAPDH as an endogenous control and resting cells as a reference sample.

    Article Title: Salivary Gland Gene Expression Atlas Identifies a New Regulator of Branching Morphogenesis
    Article Snippet: .. Independent biological replicates (n = at least 3) were amplified once and analyzed by SYBR-Green qPCR in a StepOnePlus thermal cycler (Applied Biosystems) with ddCT used to calculate fold change. .. E12 SMGs were treated with GSK3β inhibitors 20 mM LiCl , 10 µM S3442 (SB-216763) , or 5 µM BIO (6-bromoindirubin-3′-oxime; Sigma-Aldrich, St. Louis, MO, USA) ( ) with appropriate vehicle controls.

    Expressing:

    Article Title: Treatment of Nasopharyngeal Carcinoma Cells with the Histone-Deacetylase Inhibitor Abexinostat: Cooperative Effects with Cis-platin and Radiotherapy on Patient-Derived Xenografts
    Article Snippet: For EBER1 we used custom made oligonucleotides and internal probe (“custom gene expression Taqman assay”; forward primer: 5′-GGACCTACGCTGCCCTAGA-3′ , reverse primer: 5′- GGGACGGGTGGCTACAG-3′ ; internal probe: 5′-CCTCCCTAGCAAAACC-3′ ). .. Reaction were run in a StepOnePlus thermal cycler (Life Technologies) beginning by one step at 45°C for 30 min (RT reaction) and one step at 95°C for 10 min (release of single strand DNA and activation of the DNA polymerase).

    Article Title: Lipopolysaccharide and lipoteichoic acid enhance serum amyloid A3 mRNA expression in murine alveolar epithelial cells
    Article Snippet: Quantitative real-time PCR was carried out in 96-well plates using 300 nmol each of forward and reverse primers, 10 n g of cDNA, and PowerUp SYBR Green Master Mix (A25742, Applied Biosystems, Foster City, CA, U.S.A.) on a StepOnePlus thermal cycler (Applied Biosystems). .. Specific primers ( ) were used to investigate mRNA expression of SAA1/2, SAA3, surfactant protein (SP)-A, B, and C, and mucin 5AC (MUC5AC) and MUC5B, which are antibacterial proteins found in the lungs [ , ].

    Article Title: Hippo signaling is intrinsically regulated during cell cycle progression by APC/CCdh1
    Article Snippet: Quantitative real-time PCR were done with SYBR Select Master Mix on StepOnePlus thermal cycler (Applied Biosystem). .. The relative mRNA expression was calculated using ΔΔCt method.

    Article Title: Macrophage subsets exhibit distinct E. coli-LPS tolerisable cytokines associated with the negative regulators, IRAK-M and Tollip
    Article Snippet: Paragraph title: Real-time PCR analysis of gene expression ... RT-PCR was performed using StepOnePlus thermal cycler and Power SYBR Green kit (Applied Biosystems, Foster City, CA, USA) using 10 pmol of the forward and reverse primers for each target.

    Article Title: Salivary Gland Gene Expression Atlas Identifies a New Regulator of Branching Morphogenesis
    Article Snippet: Raw data were quantile-normalized ( ) and analyzed with GeneSpring 11.5 (Agilent); gene expression was validated by qPCR. .. Independent biological replicates (n = at least 3) were amplified once and analyzed by SYBR-Green qPCR in a StepOnePlus thermal cycler (Applied Biosystems) with ddCT used to calculate fold change.

    Article Title: Hippo signaling interactions with Wnt/ β-catenin and Notch signaling repress liver tumorigenesis
    Article Snippet: Total RNA from mouse liver tissue or cultured cells was prepared using TRIzol Reagent (Life Technologies, Thermo Fisher Scientific) or an RNeasy Mini Kit (QIAGEN) according to the manufacturer’s protocol. cDNA were synthesized from total RNA (1–3 μg) using SuperScript II Reverse Transcriptase with a random primer (Life Technologies, Thermo Fisher Scientific). qRT-PCR was performed using SYBR Select Master Mix (Thermo Fisher Scientific) on a StepOnePlus thermal cycler from Applied Biosystems. .. Expression levels were always given relative to GAPDH .

    Article Title: Activation of the Immune-Metabolic Receptor GPR84 Enhances Inflammation and Phagocytosis in Macrophages
    Article Snippet: .. Real-time quantitative PCR was performed using either Taqman or Sybr Select gene expression master mix (Life Technologies) in the StepOnePlus™ thermal cycler (Applied Biosystems). .. Primers were purchased from Qiagen ( tnf α, il-6, il-12b, ccl2, ccl5, cxcl1, fc γ RI, icam-1, βactin ) and Taqman ( gpr84, βactin ).

    Western Blot:

    Article Title: Single-Cell Sequencing of iPSC-Dopamine Neurons Reconstructs Disease Progression and Identifies HDAC4 as a Regulator of Parkinson Cell Phenotypes
    Article Snippet: Paragraph title: qRT-PCR, immunocytochemistry and western blot ... Quality and concentration were quantified using a Nanodrop 1000 (Thermo Scientific). cDNA was synthesized using a superscript III reverse transcriptase kit (Life technologies) as per manufacturer’s instructions. qRT-PCR was carried out using fast SYBR green mastermix and a StepOnePlus thermal cycler (Life technologies).

    Transfection:

    Article Title: Calcineurin down-regulation in the amygdala is sufficient to induce anxiety-like and depression-like behaviors in C57BL/6J male mice
    Article Snippet: For in vitro testing of shCnB efficacy, N2a cells, mouse neuroblastoma cells that endogenously express calcineurin, were transfected with either pAAV-shCnB or pAAV-Scr using lipofectamine 2000 (Invitrogen) according to the manufacturer’s protocol. .. 500 ng of RNA from each sample was reverse transcribed into cDNA using the QuantiTect Reverse Transcription Kit (Qiagen). cDNA was then quantified using real time PCR with SYBR Green in a StepOnePlus Thermal Cycler (Applied Biosystems).

    Incubation:

    Article Title: Single-Cell Sequencing of iPSC-Dopamine Neurons Reconstructs Disease Progression and Identifies HDAC4 as a Regulator of Parkinson Cell Phenotypes
    Article Snippet: Quality and concentration were quantified using a Nanodrop 1000 (Thermo Scientific). cDNA was synthesized using a superscript III reverse transcriptase kit (Life technologies) as per manufacturer’s instructions. qRT-PCR was carried out using fast SYBR green mastermix and a StepOnePlus thermal cycler (Life technologies). .. They were then blocked with 10% donkey serum (PBS/0.5% triton x) for 1 hour, incubated with the following antibodies; Tyrosine hydroxylase (1:500 Millipore AB1542), Beta-III tubulin (1:500 Covance MMS 435P), HDAC4 (1:500 Abcam ab12171) and DAPI in 1% donkey serum (PBS/0.5% triton x).

    Concentration Assay:

    Article Title: Single-Cell Sequencing of iPSC-Dopamine Neurons Reconstructs Disease Progression and Identifies HDAC4 as a Regulator of Parkinson Cell Phenotypes
    Article Snippet: .. Quality and concentration were quantified using a Nanodrop 1000 (Thermo Scientific). cDNA was synthesized using a superscript III reverse transcriptase kit (Life technologies) as per manufacturer’s instructions. qRT-PCR was carried out using fast SYBR green mastermix and a StepOnePlus thermal cycler (Life technologies). .. For immunocytochemistry cells were fixed in 4% paraformaldehyde in 96 well plates (microClear 96 well plates, Greiner).

    Article Title: Treatment of Nasopharyngeal Carcinoma Cells with the Histone-Deacetylase Inhibitor Abexinostat: Cooperative Effects with Cis-platin and Radiotherapy on Patient-Derived Xenografts
    Article Snippet: For one single reaction, the following reagents were mixed: 0.31 µl RT enzyme mix (containing Arrayscript reverse transcriptase), 6.25 µl PCR mix (containing Ampli Taq Gold DNA polymerase) and 0.63 µl primers/probe mix (final concentration of the primers and FAM-labeled probe: 0.9 and 0.25 µM respectively), 5.31 µl RNA solution (containing 5 or 20 ng of RNA) for a total reaction volume of 12.5 µl. .. Reaction were run in a StepOnePlus thermal cycler (Life Technologies) beginning by one step at 45°C for 30 min (RT reaction) and one step at 95°C for 10 min (release of single strand DNA and activation of the DNA polymerase).

    Article Title: Macrophage subsets exhibit distinct E. coli-LPS tolerisable cytokines associated with the negative regulators, IRAK-M and Tollip
    Article Snippet: The total RNA concentration was determined using NanoVue spectrophotometer (GE Healthcare, Freiberg, Germany). .. RT-PCR was performed using StepOnePlus thermal cycler and Power SYBR Green kit (Applied Biosystems, Foster City, CA, USA) using 10 pmol of the forward and reverse primers for each target.

    Article Title: Activation of the Immune-Metabolic Receptor GPR84 Enhances Inflammation and Phagocytosis in Macrophages
    Article Snippet: Mouse tissues and cultured cells were extracted with TRIzol reagent (Thermo Fisher Scientific), and total RNA concentration and quality was determined with a ND-1000 spectrophotometer (Nano Drop Technologies, Wilmington, DE, USA). cDNA was synthesized from 700 to 1,000 ng RNA using the QuantiTect Reverse Transcription kit (Qiagen, Manchester, UK) according to the manufacturer’s instructions. .. Real-time quantitative PCR was performed using either Taqman or Sybr Select gene expression master mix (Life Technologies) in the StepOnePlus™ thermal cycler (Applied Biosystems).

    Cell Culture:

    Article Title: Hippo signaling interactions with Wnt/ β-catenin and Notch signaling repress liver tumorigenesis
    Article Snippet: .. Total RNA from mouse liver tissue or cultured cells was prepared using TRIzol Reagent (Life Technologies, Thermo Fisher Scientific) or an RNeasy Mini Kit (QIAGEN) according to the manufacturer’s protocol. cDNA were synthesized from total RNA (1–3 μg) using SuperScript II Reverse Transcriptase with a random primer (Life Technologies, Thermo Fisher Scientific). qRT-PCR was performed using SYBR Select Master Mix (Thermo Fisher Scientific) on a StepOnePlus thermal cycler from Applied Biosystems. .. Expression levels were always given relative to GAPDH .

    Article Title: Activation of the Immune-Metabolic Receptor GPR84 Enhances Inflammation and Phagocytosis in Macrophages
    Article Snippet: Mouse tissues and cultured cells were extracted with TRIzol reagent (Thermo Fisher Scientific), and total RNA concentration and quality was determined with a ND-1000 spectrophotometer (Nano Drop Technologies, Wilmington, DE, USA). cDNA was synthesized from 700 to 1,000 ng RNA using the QuantiTect Reverse Transcription kit (Qiagen, Manchester, UK) according to the manufacturer’s instructions. .. Real-time quantitative PCR was performed using either Taqman or Sybr Select gene expression master mix (Life Technologies) in the StepOnePlus™ thermal cycler (Applied Biosystems).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Treatment of Nasopharyngeal Carcinoma Cells with the Histone-Deacetylase Inhibitor Abexinostat: Cooperative Effects with Cis-platin and Radiotherapy on Patient-Derived Xenografts
    Article Snippet: For each RNA target, RT-PCR reactions were done in duplicate or triplicate. .. Reaction were run in a StepOnePlus thermal cycler (Life Technologies) beginning by one step at 45°C for 30 min (RT reaction) and one step at 95°C for 10 min (release of single strand DNA and activation of the DNA polymerase).

    Article Title: Macrophage subsets exhibit distinct E. coli-LPS tolerisable cytokines associated with the negative regulators, IRAK-M and Tollip
    Article Snippet: .. RT-PCR was performed using StepOnePlus thermal cycler and Power SYBR Green kit (Applied Biosystems, Foster City, CA, USA) using 10 pmol of the forward and reverse primers for each target. .. Target amplification was carried out under the following conditions: preheating at 95°C for 10 min, followed by 40 cycles at 95°C for 30 s, 60°C for 1 min and 72°C for 1 min. RT-PCR data were analysed following the 2-ΔΔCt method as described by Livak and Schmittgen [ ], using GAPDH as an endogenous control and resting cells as a reference sample.

    Inhibition:

    Article Title: Predictors of Enteric Pathogens in the Domestic Environment from Human and Animal Sources in Rural Bangladesh
    Article Snippet: All samples were run in triplicate on a 96-well plate (Applied Biosystems, Foster City, CA) on a StepOnePlus thermal cycler (Applied Biosystems, Foster City, CA). .. A subset of samples were tested for inhibition using the spike-and-dilute method.

    Polymerase Chain Reaction:

    Article Title: Treatment of Nasopharyngeal Carcinoma Cells with the Histone-Deacetylase Inhibitor Abexinostat: Cooperative Effects with Cis-platin and Radiotherapy on Patient-Derived Xenografts
    Article Snippet: For one single reaction, the following reagents were mixed: 0.31 µl RT enzyme mix (containing Arrayscript reverse transcriptase), 6.25 µl PCR mix (containing Ampli Taq Gold DNA polymerase) and 0.63 µl primers/probe mix (final concentration of the primers and FAM-labeled probe: 0.9 and 0.25 µM respectively), 5.31 µl RNA solution (containing 5 or 20 ng of RNA) for a total reaction volume of 12.5 µl. .. Reaction were run in a StepOnePlus thermal cycler (Life Technologies) beginning by one step at 45°C for 30 min (RT reaction) and one step at 95°C for 10 min (release of single strand DNA and activation of the DNA polymerase).

    Article Title: Hippo signaling is intrinsically regulated during cell cycle progression by APC/CCdh1
    Article Snippet: Quantitative real-time PCR were done with SYBR Select Master Mix on StepOnePlus thermal cycler (Applied Biosystem). .. PCR primers for human samples were: CTGF , forward: AGGAGTGGGTGTGTGACGA; reverse: CCAGGCAGTTGGCTCTAATC.

    Article Title: Hippo signaling interactions with Wnt/ β-catenin and Notch signaling repress liver tumorigenesis
    Article Snippet: Total RNA from mouse liver tissue or cultured cells was prepared using TRIzol Reagent (Life Technologies, Thermo Fisher Scientific) or an RNeasy Mini Kit (QIAGEN) according to the manufacturer’s protocol. cDNA were synthesized from total RNA (1–3 μg) using SuperScript II Reverse Transcriptase with a random primer (Life Technologies, Thermo Fisher Scientific). qRT-PCR was performed using SYBR Select Master Mix (Thermo Fisher Scientific) on a StepOnePlus thermal cycler from Applied Biosystems. .. The following PCR primers for mouse samples were used: Ctgf , forward, CTGCCTACCGACTGGAAGAC; reverse, CATTGGTAACTCGGGTGGAG; Cyr61 , forward, GCTCAGTCAGAAGGCAGACC, reverse, GTTCTTGGGGACACAGAGGA; Axin2 , forward, GCTGGAGAAACTGAAACTGGA, reverse, CAAAGTGTTGGGTGGGGTAAG; Wif1 , forward, GCCACGAACCCAACAAGT, reverse, TCCCTTCTATCCTCAGCCTTT; Apcdd1 , forward, ATGAACACCACCCTCCCATAC, reverse, GTAGTAATGCCCTTCCCAGGT; Nrarp , forward, GCGTGGTTATGGGAGAAAGAT, reverse, GGGAGAGGAAAAGAGGAATGA; Hes1 , forward, GTGGGTCCTAACGCAGTGTC, reverse, TCAGAAGAGAGAGGTGGGCTA; Jag1 , forward, AGAAGTCAGAGTTCAGAGGCGTCC, reverse, AGTAGAAGGCTGTCACCAAGCAAC; Jag2 , forward, AGCCACGGAGCAGTCATTTG, reverse, TCGGATTCCAGAGCAGATAGCG; Il6 , forward, TCCATCCAGTTGCCTTCTTG, reverse, TTCCACGATTTCCCAGAGAA; Il11 , forward, AGGCGAGACATCAAGAGCTG, reverse, GCAGGTGGTCCTTCCCTAA; Lif , forward, ATTGTGCCCTTACTGCTGCTG, reverse, GCCAGTTGATTCTTGATCTGGT; Osm , forward, CCCTATATCCGCCTCCAAAACC, reverse, GACTCTGTCCAGTGTGGTGTAC; Il1b , forward, CAACCAACACGTGATATTCTCCATG, reverse, GATCCACACTCTCCAGCTGCA; Il33 , forward, TCCTTGCTTGGCAGTATCCA, reverse, TGCTCAATGTGTCAACAGACG; Ccl4 , forward, GCCCTCTCTCTCCTCTTGCT, reverse, CTGGTCTCATAGTAATCCATC; Cxcl10 , forward, GTCACATCAGCTGCTACTC, reverse, GTGGTTAAGTTCGTGCTTAC; Cxcl16 , forward, GGGAAGAGTTTTCACCACCA, reverse, GGTTGGGTGTGCTCTTTGTT; Bcl-2 , forward, GGACTTGAAGTGCCATTGGT, reverse, AGCCCCTCTGTGACAGCTTA; Socs3 , forward, AGCTTACTACATCTATTCT, reverse, TTAAAGTGGAGCATCATACT; EpCam , forward, CCTGAGAGTGAACGGAGAGC, reverse, GACACCACCACAATGACAGC; Sox9 , forward, CGACTACGCTGACCATCAGA, reverse, AGACTGGTTGTTCCCAGTGC; Gapdh , forward, ATCCTGCACCACCAACTGCT, reverse, GGGCCATCCACAGTCTTCTG.

    Software:

    Article Title: Treatment of Nasopharyngeal Carcinoma Cells with the Histone-Deacetylase Inhibitor Abexinostat: Cooperative Effects with Cis-platin and Radiotherapy on Patient-Derived Xenografts
    Article Snippet: Reaction were run in a StepOnePlus thermal cycler (Life Technologies) beginning by one step at 45°C for 30 min (RT reaction) and one step at 95°C for 10 min (release of single strand DNA and activation of the DNA polymerase). .. Results were analyzed using the StepOne software.

    Article Title: Macrophage subsets exhibit distinct E. coli-LPS tolerisable cytokines associated with the negative regulators, IRAK-M and Tollip
    Article Snippet: Sequence specific primers for the target mRNAs ( ) were designed using Primer Express Software (Applied Biosystems, Paisley, UK) and synthesised by Eurofins MWG Operon (Ebersberg, Germany). .. RT-PCR was performed using StepOnePlus thermal cycler and Power SYBR Green kit (Applied Biosystems, Foster City, CA, USA) using 10 pmol of the forward and reverse primers for each target.

    Article Title: Activation of the Immune-Metabolic Receptor GPR84 Enhances Inflammation and Phagocytosis in Macrophages
    Article Snippet: Real-time quantitative PCR was performed using either Taqman or Sybr Select gene expression master mix (Life Technologies) in the StepOnePlus™ thermal cycler (Applied Biosystems). .. Cycle threshold values were determined by the StepOne software and target gene expression was normalized to housekeeping gene ( βactin ).

    RNA Sequencing Assay:

    Article Title: Single-Cell Sequencing of iPSC-Dopamine Neurons Reconstructs Disease Progression and Identifies HDAC4 as a Regulator of Parkinson Cell Phenotypes
    Article Snippet: qRT-PCR, immunocytochemistry and western blot For qRT-PCR experiments to validate RNA-Seq findings RNA was extracted from 12 well plates using Trizol (life technologies) and purified using the RNeasy Micro kit (QIAGEN) as per manufacturer’s instructions. .. Quality and concentration were quantified using a Nanodrop 1000 (Thermo Scientific). cDNA was synthesized using a superscript III reverse transcriptase kit (Life technologies) as per manufacturer’s instructions. qRT-PCR was carried out using fast SYBR green mastermix and a StepOnePlus thermal cycler (Life technologies).

    Isolation:

    Article Title: Calcineurin down-regulation in the amygdala is sufficient to induce anxiety-like and depression-like behaviors in C57BL/6J male mice
    Article Snippet: Twenty four hours later, cells were lysed and RNA was isolated using the Qiagen RNeasy Mini kit, according to the manufacturer’s protocol. .. 500 ng of RNA from each sample was reverse transcribed into cDNA using the QuantiTect Reverse Transcription Kit (Qiagen). cDNA was then quantified using real time PCR with SYBR Green in a StepOnePlus Thermal Cycler (Applied Biosystems).

    Article Title: Macrophage subsets exhibit distinct E. coli-LPS tolerisable cytokines associated with the negative regulators, IRAK-M and Tollip
    Article Snippet: Following each treatment, cells were washed with ice-cold PBS and total RNA was isolated using GenElute RNA extraction kit (Sigma-Aldrich, Poole, UK) according to manufacturer’s instructions. .. RT-PCR was performed using StepOnePlus thermal cycler and Power SYBR Green kit (Applied Biosystems, Foster City, CA, USA) using 10 pmol of the forward and reverse primers for each target.

    Article Title: Salivary Gland Gene Expression Atlas Identifies a New Regulator of Branching Morphogenesis
    Article Snippet: RNA isolated from LCM samples was amplified twice with MessageAMP 2 AA (Ambion, Austin, TX, USA) and analyzed with Mouse Whole Genome Arrays (4x44k, Agilent, Santa Clara, CA, USA). .. Independent biological replicates (n = at least 3) were amplified once and analyzed by SYBR-Green qPCR in a StepOnePlus thermal cycler (Applied Biosystems) with ddCT used to calculate fold change.

    Size-exclusion Chromatography:

    Article Title: Lipopolysaccharide and lipoteichoic acid enhance serum amyloid A3 mRNA expression in murine alveolar epithelial cells
    Article Snippet: Quantitative real-time PCR was carried out in 96-well plates using 300 nmol each of forward and reverse primers, 10 n g of cDNA, and PowerUp SYBR Green Master Mix (A25742, Applied Biosystems, Foster City, CA, U.S.A.) on a StepOnePlus thermal cycler (Applied Biosystems). .. Thermal cycling was carried out for 2 min at 5°C and 2 min at 95°C, followed by 40 cycles at 95°C for 3 sec and 60°C for 30 sec.

    Purification:

    Article Title: Single-Cell Sequencing of iPSC-Dopamine Neurons Reconstructs Disease Progression and Identifies HDAC4 as a Regulator of Parkinson Cell Phenotypes
    Article Snippet: qRT-PCR, immunocytochemistry and western blot For qRT-PCR experiments to validate RNA-Seq findings RNA was extracted from 12 well plates using Trizol (life technologies) and purified using the RNeasy Micro kit (QIAGEN) as per manufacturer’s instructions. .. Quality and concentration were quantified using a Nanodrop 1000 (Thermo Scientific). cDNA was synthesized using a superscript III reverse transcriptase kit (Life technologies) as per manufacturer’s instructions. qRT-PCR was carried out using fast SYBR green mastermix and a StepOnePlus thermal cycler (Life technologies).

    Article Title: Structural Determinants of the Interaction between the TpsA and TpsB Proteins in the Haemophilus influenzae HMW1 Two-Partner Secretion System
    Article Snippet: To determine the Tm for the HMW1 propiece, duplicate 1.5-μg samples of purified native and heat-denatured protein were suspended in 50 μl of 100 mM Tris–150 mM NaCl–1 mM EDTA–1× SYPRO Orange and were seeded into 96-well plates. .. Plates were heated in a StepOnePlus thermal cycler at intervals of 1°C from 29°C to 95°C, with a ramping rate of 1°C per min (Applied Biosystems).

    Sequencing:

    Article Title: Macrophage subsets exhibit distinct E. coli-LPS tolerisable cytokines associated with the negative regulators, IRAK-M and Tollip
    Article Snippet: Sequence specific primers for the target mRNAs ( ) were designed using Primer Express Software (Applied Biosystems, Paisley, UK) and synthesised by Eurofins MWG Operon (Ebersberg, Germany). .. RT-PCR was performed using StepOnePlus thermal cycler and Power SYBR Green kit (Applied Biosystems, Foster City, CA, USA) using 10 pmol of the forward and reverse primers for each target.

    Mouse Assay:

    Article Title: Expression of the 5-HT1A Serotonin Receptor in the Hippocampus Is Required for Social Stress Resilience and the Antidepressant-Like Effects Induced by the Nicotinic Partial Agonist Cytisine
    Article Snippet: Mice infused with AAV-sh5-HT1A or AAV-Scr in the hippocampus were killed 3 weeks after viral infusion. .. Reverse transcription was performed and cDNA was quantified by quantitative PCR with SYBR Green using a StepOnePlus Thermal Cycler (Applied Biosystems).

    TaqMan Assay:

    Article Title: Treatment of Nasopharyngeal Carcinoma Cells with the Histone-Deacetylase Inhibitor Abexinostat: Cooperative Effects with Cis-platin and Radiotherapy on Patient-Derived Xenografts
    Article Snippet: For EBER1 we used custom made oligonucleotides and internal probe (“custom gene expression Taqman assay”; forward primer: 5′-GGACCTACGCTGCCCTAGA-3′ , reverse primer: 5′- GGGACGGGTGGCTACAG-3′ ; internal probe: 5′-CCTCCCTAGCAAAACC-3′ ). .. Reaction were run in a StepOnePlus thermal cycler (Life Technologies) beginning by one step at 45°C for 30 min (RT reaction) and one step at 95°C for 10 min (release of single strand DNA and activation of the DNA polymerase).

    SYBR Green Assay:

    Article Title: Single-Cell Sequencing of iPSC-Dopamine Neurons Reconstructs Disease Progression and Identifies HDAC4 as a Regulator of Parkinson Cell Phenotypes
    Article Snippet: .. Quality and concentration were quantified using a Nanodrop 1000 (Thermo Scientific). cDNA was synthesized using a superscript III reverse transcriptase kit (Life technologies) as per manufacturer’s instructions. qRT-PCR was carried out using fast SYBR green mastermix and a StepOnePlus thermal cycler (Life technologies). .. For immunocytochemistry cells were fixed in 4% paraformaldehyde in 96 well plates (microClear 96 well plates, Greiner).

    Article Title: Calcineurin down-regulation in the amygdala is sufficient to induce anxiety-like and depression-like behaviors in C57BL/6J male mice
    Article Snippet: .. 500 ng of RNA from each sample was reverse transcribed into cDNA using the QuantiTect Reverse Transcription Kit (Qiagen). cDNA was then quantified using real time PCR with SYBR Green in a StepOnePlus Thermal Cycler (Applied Biosystems). .. Primer sets for CnB and a reference gene (β-glucuronidase, GusB1) were designed using Primer3 to span introns to prevent genomic DNA amplification.

    Article Title: Lipopolysaccharide and lipoteichoic acid enhance serum amyloid A3 mRNA expression in murine alveolar epithelial cells
    Article Snippet: .. Quantitative real-time PCR was carried out in 96-well plates using 300 nmol each of forward and reverse primers, 10 n g of cDNA, and PowerUp SYBR Green Master Mix (A25742, Applied Biosystems, Foster City, CA, U.S.A.) on a StepOnePlus thermal cycler (Applied Biosystems). .. Thermal cycling was carried out for 2 min at 5°C and 2 min at 95°C, followed by 40 cycles at 95°C for 3 sec and 60°C for 30 sec.

    Article Title: Macrophage subsets exhibit distinct E. coli-LPS tolerisable cytokines associated with the negative regulators, IRAK-M and Tollip
    Article Snippet: .. RT-PCR was performed using StepOnePlus thermal cycler and Power SYBR Green kit (Applied Biosystems, Foster City, CA, USA) using 10 pmol of the forward and reverse primers for each target. .. Target amplification was carried out under the following conditions: preheating at 95°C for 10 min, followed by 40 cycles at 95°C for 30 s, 60°C for 1 min and 72°C for 1 min. RT-PCR data were analysed following the 2-ΔΔCt method as described by Livak and Schmittgen [ ], using GAPDH as an endogenous control and resting cells as a reference sample.

    Article Title: Expression of the 5-HT1A Serotonin Receptor in the Hippocampus Is Required for Social Stress Resilience and the Antidepressant-Like Effects Induced by the Nicotinic Partial Agonist Cytisine
    Article Snippet: .. Reverse transcription was performed and cDNA was quantified by quantitative PCR with SYBR Green using a StepOnePlus Thermal Cycler (Applied Biosystems). ..

    Article Title: Salivary Gland Gene Expression Atlas Identifies a New Regulator of Branching Morphogenesis
    Article Snippet: .. Independent biological replicates (n = at least 3) were amplified once and analyzed by SYBR-Green qPCR in a StepOnePlus thermal cycler (Applied Biosystems) with ddCT used to calculate fold change. .. E12 SMGs were treated with GSK3β inhibitors 20 mM LiCl , 10 µM S3442 (SB-216763) , or 5 µM BIO (6-bromoindirubin-3′-oxime; Sigma-Aldrich, St. Louis, MO, USA) ( ) with appropriate vehicle controls.

    RNA Extraction:

    Article Title: Treatment of Nasopharyngeal Carcinoma Cells with the Histone-Deacetylase Inhibitor Abexinostat: Cooperative Effects with Cis-platin and Radiotherapy on Patient-Derived Xenografts
    Article Snippet: Paragraph title: RNA extraction and transcript assessment by real-time RT-PCR ... Reaction were run in a StepOnePlus thermal cycler (Life Technologies) beginning by one step at 45°C for 30 min (RT reaction) and one step at 95°C for 10 min (release of single strand DNA and activation of the DNA polymerase).

    Article Title: Macrophage subsets exhibit distinct E. coli-LPS tolerisable cytokines associated with the negative regulators, IRAK-M and Tollip
    Article Snippet: Following each treatment, cells were washed with ice-cold PBS and total RNA was isolated using GenElute RNA extraction kit (Sigma-Aldrich, Poole, UK) according to manufacturer’s instructions. .. RT-PCR was performed using StepOnePlus thermal cycler and Power SYBR Green kit (Applied Biosystems, Foster City, CA, USA) using 10 pmol of the forward and reverse primers for each target.

    Binding Assay:

    Article Title: Structural Determinants of the Interaction between the TpsA and TpsB Proteins in the Haemophilus influenzae HMW1 Two-Partner Secretion System
    Article Snippet: Protein structures were assessed by measuring melting temperature ( Tm ) based on binding of SYPRO Orange dye (Molecular Probes) and differential scanning fluorimetry. .. Plates were heated in a StepOnePlus thermal cycler at intervals of 1°C from 29°C to 95°C, with a ramping rate of 1°C per min (Applied Biosystems).

    In Vitro:

    Article Title: Calcineurin down-regulation in the amygdala is sufficient to induce anxiety-like and depression-like behaviors in C57BL/6J male mice
    Article Snippet: For in vitro testing of shCnB efficacy, N2a cells, mouse neuroblastoma cells that endogenously express calcineurin, were transfected with either pAAV-shCnB or pAAV-Scr using lipofectamine 2000 (Invitrogen) according to the manufacturer’s protocol. .. 500 ng of RNA from each sample was reverse transcribed into cDNA using the QuantiTect Reverse Transcription Kit (Qiagen). cDNA was then quantified using real time PCR with SYBR Green in a StepOnePlus Thermal Cycler (Applied Biosystems).

    Laser Capture Microdissection:

    Article Title: Salivary Gland Gene Expression Atlas Identifies a New Regulator of Branching Morphogenesis
    Article Snippet: RNA isolated from LCM samples was amplified twice with MessageAMP 2 AA (Ambion, Austin, TX, USA) and analyzed with Mouse Whole Genome Arrays (4x44k, Agilent, Santa Clara, CA, USA). .. Independent biological replicates (n = at least 3) were amplified once and analyzed by SYBR-Green qPCR in a StepOnePlus thermal cycler (Applied Biosystems) with ddCT used to calculate fold change.

    Random Hexamer Labeling:

    Article Title: Hippo signaling is intrinsically regulated during cell cycle progression by APC/CCdh1
    Article Snippet: Total RNA was prepared using TRIZOL reagent (Life Technologies) or RNAeasy mini kit (Qiagen) according to the manufacturer’s protocol. cDNA was synthesized from total RNA (1–3 μg) using SuperScript II Reverse Transcriptase (Life Technologies) with random hexamer (Roche). .. Quantitative real-time PCR were done with SYBR Select Master Mix on StepOnePlus thermal cycler (Applied Biosystem).

    Spectrophotometry:

    Article Title: Lipopolysaccharide and lipoteichoic acid enhance serum amyloid A3 mRNA expression in murine alveolar epithelial cells
    Article Snippet: The RNA was quantified using a NanoDropLite spectrophotometer (Thermo Fisher Scientific, Wilmington, DE, U.S.A.) and stored at −80°C until use. .. Quantitative real-time PCR was carried out in 96-well plates using 300 nmol each of forward and reverse primers, 10 n g of cDNA, and PowerUp SYBR Green Master Mix (A25742, Applied Biosystems, Foster City, CA, U.S.A.) on a StepOnePlus thermal cycler (Applied Biosystems).

    Article Title: Macrophage subsets exhibit distinct E. coli-LPS tolerisable cytokines associated with the negative regulators, IRAK-M and Tollip
    Article Snippet: The total RNA concentration was determined using NanoVue spectrophotometer (GE Healthcare, Freiberg, Germany). .. RT-PCR was performed using StepOnePlus thermal cycler and Power SYBR Green kit (Applied Biosystems, Foster City, CA, USA) using 10 pmol of the forward and reverse primers for each target.

    Article Title: Activation of the Immune-Metabolic Receptor GPR84 Enhances Inflammation and Phagocytosis in Macrophages
    Article Snippet: Mouse tissues and cultured cells were extracted with TRIzol reagent (Thermo Fisher Scientific), and total RNA concentration and quality was determined with a ND-1000 spectrophotometer (Nano Drop Technologies, Wilmington, DE, USA). cDNA was synthesized from 700 to 1,000 ng RNA using the QuantiTect Reverse Transcription kit (Qiagen, Manchester, UK) according to the manufacturer’s instructions. .. Real-time quantitative PCR was performed using either Taqman or Sybr Select gene expression master mix (Life Technologies) in the StepOnePlus™ thermal cycler (Applied Biosystems).

    Activation Assay:

    Article Title: Treatment of Nasopharyngeal Carcinoma Cells with the Histone-Deacetylase Inhibitor Abexinostat: Cooperative Effects with Cis-platin and Radiotherapy on Patient-Derived Xenografts
    Article Snippet: .. Reaction were run in a StepOnePlus thermal cycler (Life Technologies) beginning by one step at 45°C for 30 min (RT reaction) and one step at 95°C for 10 min (release of single strand DNA and activation of the DNA polymerase). .. Results were analyzed using the StepOne software.

    Environmental Sampling:

    Article Title: Predictors of Enteric Pathogens in the Domestic Environment from Human and Animal Sources in Rural Bangladesh
    Article Snippet: Less than 1% of all environmental sample types were positive for the Cryptosporidium gene; consequently, we did not continue to analyze for the Cryptosporidium gene in any sample type. .. All samples were run in triplicate on a 96-well plate (Applied Biosystems, Foster City, CA) on a StepOnePlus thermal cycler (Applied Biosystems, Foster City, CA).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Thermo Fisher steponeplus real time thermal cycler
    Steponeplus Real Time Thermal Cycler, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/steponeplus real time thermal cycler/product/Thermo Fisher
    Average 90 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    steponeplus real time thermal cycler - by Bioz Stars, 2020-04
    90/100 stars
      Buy from Supplier

    94
    Thermo Fisher spectrofluorometric thermal cycler steponeplus
    Spectrofluorometric Thermal Cycler Steponeplus, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 60 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/spectrofluorometric thermal cycler steponeplus/product/Thermo Fisher
    Average 94 stars, based on 60 article reviews
    Price from $9.99 to $1999.99
    spectrofluorometric thermal cycler steponeplus - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    99
    Thermo Fisher automatic thermal cycler
    Automatic Thermal Cycler, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/automatic thermal cycler/product/Thermo Fisher
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    automatic thermal cycler - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results