steponeplus system  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Thermo Fisher steponeplus system
    Correction of exogenous (spiked) gDNA with ValidPrime. The data are presented in linear scale as fold ratio (2 - Cq /2 - Cq ref ), where Cq ref is the Cq NA measured on non-spiked controls and Cq refers to Cq RNA (light bars) or Cq NA (dark bars) depending on whether or not ValidPrime correction was applied (VP − /VP + ). The data are grouped based on the impact of exogenous DNA, expressed as percentage of the total signal (%DNA) in each sample. Data were collected with either 17 GOI assays on a <t>StepOnePlus</t> (Applied Biosystems) using mVPA1 and mVPA5 ( A ), or with 19 assays on a BioMark (Fluidigm) using mVPA1 ( B ). All assays passed the high confidence ValidPrime criteria ( Supplementary Figure S3 ). Data are presented as the mean ± SD, with ( n ) designating the number of samples in each group. cDNAs were from mouse kidney or liver for the StepOnePlus studies and mouse uterus for the BioMark study.
    Steponeplus System, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 562 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/steponeplus system/product/Thermo Fisher
    Average 99 stars, based on 562 article reviews
    Price from $9.99 to $1999.99
    steponeplus system - by Bioz Stars, 2020-02
    99/100 stars

    Images

    1) Product Images from "Correction of RT-qPCR data for genomic DNA-derived signals with ValidPrime"

    Article Title: Correction of RT-qPCR data for genomic DNA-derived signals with ValidPrime

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkr1259

    Correction of exogenous (spiked) gDNA with ValidPrime. The data are presented in linear scale as fold ratio (2 - Cq /2 - Cq ref ), where Cq ref is the Cq NA measured on non-spiked controls and Cq refers to Cq RNA (light bars) or Cq NA (dark bars) depending on whether or not ValidPrime correction was applied (VP − /VP + ). The data are grouped based on the impact of exogenous DNA, expressed as percentage of the total signal (%DNA) in each sample. Data were collected with either 17 GOI assays on a StepOnePlus (Applied Biosystems) using mVPA1 and mVPA5 ( A ), or with 19 assays on a BioMark (Fluidigm) using mVPA1 ( B ). All assays passed the high confidence ValidPrime criteria ( Supplementary Figure S3 ). Data are presented as the mean ± SD, with ( n ) designating the number of samples in each group. cDNAs were from mouse kidney or liver for the StepOnePlus studies and mouse uterus for the BioMark study.
    Figure Legend Snippet: Correction of exogenous (spiked) gDNA with ValidPrime. The data are presented in linear scale as fold ratio (2 - Cq /2 - Cq ref ), where Cq ref is the Cq NA measured on non-spiked controls and Cq refers to Cq RNA (light bars) or Cq NA (dark bars) depending on whether or not ValidPrime correction was applied (VP − /VP + ). The data are grouped based on the impact of exogenous DNA, expressed as percentage of the total signal (%DNA) in each sample. Data were collected with either 17 GOI assays on a StepOnePlus (Applied Biosystems) using mVPA1 and mVPA5 ( A ), or with 19 assays on a BioMark (Fluidigm) using mVPA1 ( B ). All assays passed the high confidence ValidPrime criteria ( Supplementary Figure S3 ). Data are presented as the mean ± SD, with ( n ) designating the number of samples in each group. cDNAs were from mouse kidney or liver for the StepOnePlus studies and mouse uterus for the BioMark study.

    Techniques Used:

    Equivalence between Cq DNA calculated by ValidPrime and RT(−) measurements. Fold ratios in linear scale (2 - Cq (RT+) /2 - Cq (RT−) ) between either the total signal (NA) measured in spiked RT(+) reactions (dark bars) or the gDNA signal (DNA) estimated by ValidPrime (VP) from RT(+) reactions (light bars) compared to the signal in RT(−) reactions. A quantity of 20 ng of cDNA from adipose tissue (hatched bars) or from kidney, were spiked with 0.30 ng gDNA to decrease the variability due to stochastic amplification observed in RT(−) reactions. Independently of the expression level of the three genes studied in RT(+) samples, the estimations by ValidPrime of the gDNA-derived signals in RT(+) were very similar to the signals measured in RT(−) reactions, as the ratio was close to 1 (illustrated by the red dashed line; mean 1.20 ± 0.29). Data are mean ± SD from two experiments in duplicate on the StepOnePlus.
    Figure Legend Snippet: Equivalence between Cq DNA calculated by ValidPrime and RT(−) measurements. Fold ratios in linear scale (2 - Cq (RT+) /2 - Cq (RT−) ) between either the total signal (NA) measured in spiked RT(+) reactions (dark bars) or the gDNA signal (DNA) estimated by ValidPrime (VP) from RT(+) reactions (light bars) compared to the signal in RT(−) reactions. A quantity of 20 ng of cDNA from adipose tissue (hatched bars) or from kidney, were spiked with 0.30 ng gDNA to decrease the variability due to stochastic amplification observed in RT(−) reactions. Independently of the expression level of the three genes studied in RT(+) samples, the estimations by ValidPrime of the gDNA-derived signals in RT(+) were very similar to the signals measured in RT(−) reactions, as the ratio was close to 1 (illustrated by the red dashed line; mean 1.20 ± 0.29). Data are mean ± SD from two experiments in duplicate on the StepOnePlus.

    Techniques Used: Amplification, Expressing, Derivative Assay

    Related Articles

    Amplification:

    Article Title: MicroRNA-155 Mediates Augmented CD40 Expression in Bone Marrow Derived Plasmacytoid Dendritic Cells in Symptomatic Lupus-Prone NZB/W F1 Mice
    Article Snippet: .. Amplification of cDNAs was carried out using the StepOnePlus™ system and StepOne Software v2.3 (Applied Biosystems® , Thermo Fisher Scientific, Waltham, MA, USA) with KAPA SYBR® Fast qPCR kit (Kapa Biosystems, Wilmington, MA, USA) following the thermal conditions at: 95 °C for 3 min and 40 cycles of 95 °C, 60 °C and 72 °C for 20 s each. ..

    Article Title: A Genome-Wide Screen Reveals that the Vibrio cholerae Phosphoenolpyruvate Phosphotransferase System Modulates Virulence Gene Expression
    Article Snippet: .. The amplification and data analysis with ΔΔ CT (where CT is threshold cycle) method were performed using a StepOnePlus system (Life Technologies). gyrB mRNA was measured and used for normalization ( ). ..

    Article Title: A genomic atlas of human adrenal and gonad development
    Article Snippet: .. Amplification was performed in a total volume of 20 µl per reaction using TaqMan® Gene Expression Master Mix on the StepOnePlus™ System (Thermo Fisher Scientific). .. The relative quantification of gene expression was calculated as 2-ΔΔCt using the comparative Ct (ΔΔCt) method and GAPDH as the housekeeping internal control.

    Positive Control:

    Article Title: Notochordal and nucleus pulposus marker expression is maintained by sub-populations of adult human nucleus pulposus cells through aging and degeneration
    Article Snippet: Intron-spanning qPCR assays (Supplementary Table ) were designed against human gene sequences and qPCR reactions conducted on a StepOnePlus system (Applied Biosystems), using FAM-BHQ1 probes and corresponding primers (Sigma Aldrich). .. Each probe was used at a final concentration of 250 nM. cDNA generated in-house from Total Human RNA or Foetal RNA (Clontech) was used as a positive control.

    Synthesized:

    Article Title: A Genome-Wide Screen Reveals that the Vibrio cholerae Phosphoenolpyruvate Phosphotransferase System Modulates Virulence Gene Expression
    Article Snippet: The synthesized cDNA was subjected to real-time PCR amplification using a Fast SYBR green master mix kit (Life Technologies) with specific primer pairs (see Table S1 in the supplemental material) in a total volume of 20 μl. .. The amplification and data analysis with ΔΔ CT (where CT is threshold cycle) method were performed using a StepOnePlus system (Life Technologies). gyrB mRNA was measured and used for normalization ( ).

    Article Title: Apoplastic and intracellular plant sugars regulate developmental transitions in witches’ broom disease of cacao
    Article Snippet: Fungal and plant RNA samples were assayed using a NanoDrop ND-1000 spectrophotometer (Thermo Fisher Scientific Inc.) followed by 1% formaldehyde–agarose denaturing gel. cDNA was synthesized from 2 μg of total RNA primed with random primers using the Superscript II Reverse Transcriptase kit (Invitrogen). .. All quantitative real-time PCRs (qRT-PCRs) were performed using 0.2 μM of each primer and SYBR Green Master Mix in a StepOnePlus system under recommended conditions and quality controls (Applied Biosystems).

    Article Title: miR-144/451 cluster plays an oncogenic role in esophageal cancer by inhibiting cell invasion
    Article Snippet: Total RNA (~ 2 μg) were extracted using Trizol regent (Invitrogen). cDNA was synthesized using Moloney Murine Leukemia Virus (MMLV) reverse transcriptase (Promega) and ribonuclease inhibitor (Thermo Fisher). .. QPCR reactions were performed using StepOnePlus system (Applied Biosystems).

    Quantitative RT-PCR:

    Article Title: MicroRNA-155 Mediates Augmented CD40 Expression in Bone Marrow Derived Plasmacytoid Dendritic Cells in Symptomatic Lupus-Prone NZB/W F1 Mice
    Article Snippet: Paragraph title: 4.4. Quantitative Real-Time RT-PCR ... Amplification of cDNAs was carried out using the StepOnePlus™ system and StepOne Software v2.3 (Applied Biosystems® , Thermo Fisher Scientific, Waltham, MA, USA) with KAPA SYBR® Fast qPCR kit (Kapa Biosystems, Wilmington, MA, USA) following the thermal conditions at: 95 °C for 3 min and 40 cycles of 95 °C, 60 °C and 72 °C for 20 s each.

    Article Title: Regulation of the neuropathy-associated Pmp22 gene by a distal super-enhancer
    Article Snippet: .. RNA was converted to cDNA using the M-MLV reverse transcriptase (Invitrogen). cDNAs were analyzed by RT-qPCR using Power SYBR Green Master Mix (Thermo Fisher Scientific) on the StepOnePlus system or the ViiA7 system (Applied Biosystems). .. Relative expression was calculated using a relative standard curve or the Comparative Ct method ( ).

    Article Title: A Genome-Wide Screen Reveals that the Vibrio cholerae Phosphoenolpyruvate Phosphotransferase System Modulates Virulence Gene Expression
    Article Snippet: Paragraph title: Quantitative reverse transcriptase PCR (qRT-PCR). ... The amplification and data analysis with ΔΔ CT (where CT is threshold cycle) method were performed using a StepOnePlus system (Life Technologies). gyrB mRNA was measured and used for normalization ( ).

    Article Title: miR-144/451 cluster plays an oncogenic role in esophageal cancer by inhibiting cell invasion
    Article Snippet: Paragraph title: RT-QPCR ... QPCR reactions were performed using StepOnePlus system (Applied Biosystems).

    Article Title: A genomic atlas of human adrenal and gonad development
    Article Snippet: Paragraph title: Quantitative RT-PCR ... Amplification was performed in a total volume of 20 µl per reaction using TaqMan® Gene Expression Master Mix on the StepOnePlus™ System (Thermo Fisher Scientific).

    Real-time Polymerase Chain Reaction:

    Article Title: Persistent histone modifications at the BDNF promoter following extinction of nicotine-seeking in rats
    Article Snippet: .. Quantitative PCR was performed in a StepOnePlus system with the use of SYBR Select Master Mix (Applied Biosystems, VIC, Australia). .. All qPCR primers (Integrated DNA Technologies, IA, USA) were designed using Primer3 software ( ) and verified using the BLAST-like alignment tool (BLAT; ).

    Article Title: In Vitro Effects of Vaspin on Porcine Granulosa Cell Proliferation, Cell Cycle Progression, and Apoptosis by Activation of GRP78 Receptor and Several Kinase Signaling Pathways Including MAP3/1, AKT, and STAT3
    Article Snippet: Paragraph title: 4.8. Real-Time PCR ... Amplifications were performed using the StepOnePlus system (Applied Biosystems, Carlsbad, CA, USA) following the manufacturer’s instructions.

    Article Title: Notochordal and nucleus pulposus marker expression is maintained by sub-populations of adult human nucleus pulposus cells through aging and degeneration
    Article Snippet: .. Intron-spanning qPCR assays (Supplementary Table ) were designed against human gene sequences and qPCR reactions conducted on a StepOnePlus system (Applied Biosystems), using FAM-BHQ1 probes and corresponding primers (Sigma Aldrich). .. A total of 10 ng cDNA was added to each reaction in addition to 5μl LuminoCt qPCR ReadyMix (Sigma Aldrich), 1μl forward primer, 1μl reverse primer, 0.5μl probe and 0.5μl molecular biology grade water.

    Article Title: MicroRNA-155 Mediates Augmented CD40 Expression in Bone Marrow Derived Plasmacytoid Dendritic Cells in Symptomatic Lupus-Prone NZB/W F1 Mice
    Article Snippet: .. Amplification of cDNAs was carried out using the StepOnePlus™ system and StepOne Software v2.3 (Applied Biosystems® , Thermo Fisher Scientific, Waltham, MA, USA) with KAPA SYBR® Fast qPCR kit (Kapa Biosystems, Wilmington, MA, USA) following the thermal conditions at: 95 °C for 3 min and 40 cycles of 95 °C, 60 °C and 72 °C for 20 s each. ..

    Article Title: Effect on Multipotency and Phenotypic Transition of Unrestricted Somatic Stem Cells from Human Umbilical Cord Blood after Treatment with Epigenetic Agents
    Article Snippet: Paragraph title: 2.4. RNA Preparation, cDNA Synthesis, and Real-Time PCR ... All reactions were run in triplicates on a StepOnePlus System (Applied Biosystems, Foster City, CA).

    Article Title: A Genome-Wide Screen Reveals that the Vibrio cholerae Phosphoenolpyruvate Phosphotransferase System Modulates Virulence Gene Expression
    Article Snippet: The synthesized cDNA was subjected to real-time PCR amplification using a Fast SYBR green master mix kit (Life Technologies) with specific primer pairs (see Table S1 in the supplemental material) in a total volume of 20 μl. .. The amplification and data analysis with ΔΔ CT (where CT is threshold cycle) method were performed using a StepOnePlus system (Life Technologies). gyrB mRNA was measured and used for normalization ( ).

    Article Title: Perilipin-Mediated Lipid Droplet Formation in Adipocytes Promotes Sterol Regulatory Element-Binding Protein-1 Processing and Triacylglyceride Accumulation
    Article Snippet: .. Fluorescence real-time PCR was performed on a StepOnePlus system using TaqMan Gene Expression Assays (Applied Biosystems). ..

    Article Title: miR-144/451 cluster plays an oncogenic role in esophageal cancer by inhibiting cell invasion
    Article Snippet: .. QPCR reactions were performed using StepOnePlus system (Applied Biosystems). ..

    Article Title: Correction of RT-qPCR data for genomic DNA-derived signals with ValidPrime
    Article Snippet: .. Conventional qPCR All reactions (except when indicated) were performed in duplicate 10 µl volumes using 20 ng reverse transcribed total RNA in a StepOnePlus system (Applied Biosystems) with the SsoFast EvaGreen Supermix (BioRad) and an assay concentration of 300 nM using the cycling parameters: 95°C (20 s) followed by 40 cycles at 95°C (3 s) and 60°C (20 s). ..

    Article Title: Adult Brain Serotonin Deficiency Causes Hyperactivity, Circadian Disruption, and Elimination of Siestas
    Article Snippet: Paragraph title: qPCR ... The reactions were run in triplicate using a StepOnePlus system (Applied Biosystems) and relative expression values were calculated by StepOnePlus Software with Tph2 levels normalized to β-actin expression.

    Article Title: Inability to replete white adipose tissue during recovery phase of sepsis is associated with increased autophagy, apoptosis, and proteasome activity
    Article Snippet: .. Real-time quantitative PCR was performed using 25 ng cDNA in a StepOnePlus system using TaqMan gene expression assays (Applied Biosystems, Foster City, CA) using primers as described previously by our laboratory ( ). .. The comparative quantitation method 2-ΔΔCt (where Ct is threshold cycle) was used in presenting gene expression of target genes in reference to the endogenous control.

    Quantitation Assay:

    Article Title: Inability to replete white adipose tissue during recovery phase of sepsis is associated with increased autophagy, apoptosis, and proteasome activity
    Article Snippet: RNA was eluted from the column with RNase-free water, and an aliquot was used for quantitation (NanoDrop 2000, Thermo Fisher Scientific, Waltham, MA). .. Real-time quantitative PCR was performed using 25 ng cDNA in a StepOnePlus system using TaqMan gene expression assays (Applied Biosystems, Foster City, CA) using primers as described previously by our laboratory ( ).

    Expressing:

    Article Title: In Vitro Effects of Vaspin on Porcine Granulosa Cell Proliferation, Cell Cycle Progression, and Apoptosis by Activation of GRP78 Receptor and Several Kinase Signaling Pathways Including MAP3/1, AKT, and STAT3
    Article Snippet: Real-Time PCR RNA isolation and cDNA synthesis were performed following the manufacturer’s protocol using TaqMan™ Gene Expression Cells-to-CT™ Kit. .. Amplifications were performed using the StepOnePlus system (Applied Biosystems, Carlsbad, CA, USA) following the manufacturer’s instructions.

    Article Title: Notochordal and nucleus pulposus marker expression is maintained by sub-populations of adult human nucleus pulposus cells through aging and degeneration
    Article Snippet: Paragraph title: Gene expression analysis ... Intron-spanning qPCR assays (Supplementary Table ) were designed against human gene sequences and qPCR reactions conducted on a StepOnePlus system (Applied Biosystems), using FAM-BHQ1 probes and corresponding primers (Sigma Aldrich).

    Article Title: MicroRNA-155 Mediates Augmented CD40 Expression in Bone Marrow Derived Plasmacytoid Dendritic Cells in Symptomatic Lupus-Prone NZB/W F1 Mice
    Article Snippet: Quantitative Real-Time RT-PCR Quantitative gene expression analyses were performed following the Minimal Information for Publication of Quantitative Real-time PCR Experiments (MIQE) guidelines. .. Amplification of cDNAs was carried out using the StepOnePlus™ system and StepOne Software v2.3 (Applied Biosystems® , Thermo Fisher Scientific, Waltham, MA, USA) with KAPA SYBR® Fast qPCR kit (Kapa Biosystems, Wilmington, MA, USA) following the thermal conditions at: 95 °C for 3 min and 40 cycles of 95 °C, 60 °C and 72 °C for 20 s each.

    Article Title: Regulation of the neuropathy-associated Pmp22 gene by a distal super-enhancer
    Article Snippet: RNA was converted to cDNA using the M-MLV reverse transcriptase (Invitrogen). cDNAs were analyzed by RT-qPCR using Power SYBR Green Master Mix (Thermo Fisher Scientific) on the StepOnePlus system or the ViiA7 system (Applied Biosystems). .. Relative expression was calculated using a relative standard curve or the Comparative Ct method ( ).

    Article Title: Effect on Multipotency and Phenotypic Transition of Unrestricted Somatic Stem Cells from Human Umbilical Cord Blood after Treatment with Epigenetic Agents
    Article Snippet: All reactions were run in triplicates on a StepOnePlus System (Applied Biosystems, Foster City, CA). .. Relative changes in gene expression were calculated following the ΔΔCt-method with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as a standard.

    Article Title: Metformin Exposure at Environmentally Relevant Concentrations Causes Potential Endocrine Disruption in Adult Male Fish
    Article Snippet: Paragraph title: Gene expression ... Reverse transcriptase–polymerase chain reactions were run on the StepOnePlus system (Life Technologies) using the following protocol: 1) 1 cycle at 95 °C for 10 min, and 2) 40 cycles of 95 °C for 15 s and 60 °C for 30 s. The 18 S Universal Primers from Ambion (Life Technologies) were used for normalization across samples.

    Article Title: Apoplastic and intracellular plant sugars regulate developmental transitions in witches’ broom disease of cacao
    Article Snippet: Paragraph title: Nucleic acid manipulations and gene expression analysis ... All quantitative real-time PCRs (qRT-PCRs) were performed using 0.2 μM of each primer and SYBR Green Master Mix in a StepOnePlus system under recommended conditions and quality controls (Applied Biosystems).

    Article Title: Perilipin-Mediated Lipid Droplet Formation in Adipocytes Promotes Sterol Regulatory Element-Binding Protein-1 Processing and Triacylglyceride Accumulation
    Article Snippet: .. Fluorescence real-time PCR was performed on a StepOnePlus system using TaqMan Gene Expression Assays (Applied Biosystems). ..

    Article Title: A genomic atlas of human adrenal and gonad development
    Article Snippet: .. Amplification was performed in a total volume of 20 µl per reaction using TaqMan® Gene Expression Master Mix on the StepOnePlus™ System (Thermo Fisher Scientific). .. The relative quantification of gene expression was calculated as 2-ΔΔCt using the comparative Ct (ΔΔCt) method and GAPDH as the housekeeping internal control.

    Article Title: Adult Brain Serotonin Deficiency Causes Hyperactivity, Circadian Disruption, and Elimination of Siestas
    Article Snippet: .. The reactions were run in triplicate using a StepOnePlus system (Applied Biosystems) and relative expression values were calculated by StepOnePlus Software with Tph2 levels normalized to β-actin expression. .. Two-weeks after surgery, mice were anesthetized with Avertin (44 m m tribromoethanol, 2.5% tert-amyl alcohol, 0.02 ml/g body weight) and perfused with cold PBS for 2–5 min, followed by cold 4% paraformaldehyde in PBS for 20 min.

    Article Title: Inability to replete white adipose tissue during recovery phase of sepsis is associated with increased autophagy, apoptosis, and proteasome activity
    Article Snippet: .. Real-time quantitative PCR was performed using 25 ng cDNA in a StepOnePlus system using TaqMan gene expression assays (Applied Biosystems, Foster City, CA) using primers as described previously by our laboratory ( ). .. The comparative quantitation method 2-ΔΔCt (where Ct is threshold cycle) was used in presenting gene expression of target genes in reference to the endogenous control.

    Transfection:

    Article Title: Regulation of the neuropathy-associated Pmp22 gene by a distal super-enhancer
    Article Snippet: RNA was harvested from confluent cells or, for siRNA experiments, at 48h after transfection in triplicate using Tri Reagent (Ambion). .. RNA was converted to cDNA using the M-MLV reverse transcriptase (Invitrogen). cDNAs were analyzed by RT-qPCR using Power SYBR Green Master Mix (Thermo Fisher Scientific) on the StepOnePlus system or the ViiA7 system (Applied Biosystems).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: MicroRNA-155 Mediates Augmented CD40 Expression in Bone Marrow Derived Plasmacytoid Dendritic Cells in Symptomatic Lupus-Prone NZB/W F1 Mice
    Article Snippet: Total cellular RNAs were extracted using TRI Reagent® (Sigma-Aldrich, St. Louis, MO, USA) and then reverse transcribed into cDNAs with the ThermoScript™ RT-PCR system (Invitrogen, Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer’s recommendation. .. Amplification of cDNAs was carried out using the StepOnePlus™ system and StepOne Software v2.3 (Applied Biosystems® , Thermo Fisher Scientific, Waltham, MA, USA) with KAPA SYBR® Fast qPCR kit (Kapa Biosystems, Wilmington, MA, USA) following the thermal conditions at: 95 °C for 3 min and 40 cycles of 95 °C, 60 °C and 72 °C for 20 s each.

    Generated:

    Article Title: Notochordal and nucleus pulposus marker expression is maintained by sub-populations of adult human nucleus pulposus cells through aging and degeneration
    Article Snippet: Intron-spanning qPCR assays (Supplementary Table ) were designed against human gene sequences and qPCR reactions conducted on a StepOnePlus system (Applied Biosystems), using FAM-BHQ1 probes and corresponding primers (Sigma Aldrich). .. Each probe was used at a final concentration of 250 nM. cDNA generated in-house from Total Human RNA or Foetal RNA (Clontech) was used as a positive control.

    Article Title: Effect on Multipotency and Phenotypic Transition of Unrestricted Somatic Stem Cells from Human Umbilical Cord Blood after Treatment with Epigenetic Agents
    Article Snippet: All reactions were run in triplicates on a StepOnePlus System (Applied Biosystems, Foster City, CA). .. Standard curves were generated using StepOne software v2.1 (Applied Biosystems).

    Sequencing:

    Article Title: In Vitro Effects of Vaspin on Porcine Granulosa Cell Proliferation, Cell Cycle Progression, and Apoptosis by Activation of GRP78 Receptor and Several Kinase Signaling Pathways Including MAP3/1, AKT, and STAT3
    Article Snippet: Amplifications were performed using the StepOnePlus system (Applied Biosystems, Carlsbad, CA, USA) following the manufacturer’s instructions. .. The relative genes (ThermoFisher Scientific, Waltham, MA, USA) were -caspase 3 (product no. Ss03382792), -caspase 8 (product no. Ss03379427), and -caspase 9 (made to order in Applied Biosystems, based on cDNA sequence described by Matsui et al. [ ]; forward: 5′-GGCTG TCTAC GGCAC AGATG GA-3′, reverse: 5′-CTGGC TCGGG GTTAC TGCCA G-3′); and BAX (product no. Ss03375842), BCL2 (product no. Ss03375167), and p53 (product no. Ss04248637).

    Article Title: Regulation of the neuropathy-associated Pmp22 gene by a distal super-enhancer
    Article Snippet: RNA was converted to cDNA using the M-MLV reverse transcriptase (Invitrogen). cDNAs were analyzed by RT-qPCR using Power SYBR Green Master Mix (Thermo Fisher Scientific) on the StepOnePlus system or the ViiA7 system (Applied Biosystems). .. Note that for the Pmp22 reading frame experiment , an individual reverse primer targeting the 2a sequence was used.

    Article Title: Metformin Exposure at Environmentally Relevant Concentrations Causes Potential Endocrine Disruption in Adult Male Fish
    Article Snippet: The highest scoring expressed sequence tag result was then used for primer design using PrimerQuest software (Integrated DNA Technologies) for intercalating dyes. .. Reverse transcriptase–polymerase chain reactions were run on the StepOnePlus system (Life Technologies) using the following protocol: 1) 1 cycle at 95 °C for 10 min, and 2) 40 cycles of 95 °C for 15 s and 60 °C for 30 s. The 18 S Universal Primers from Ambion (Life Technologies) were used for normalization across samples.

    Article Title: miR-144/451 cluster plays an oncogenic role in esophageal cancer by inhibiting cell invasion
    Article Snippet: The Sequence for forward primer of pri-miRNA was ACAGTGCTTTTCAAGCCATGC, for reverse primer, the sequence was GGGTGCCCGGACTAGTACAT. β-actin was selected as internal reference for detecting pri-miRNA, sequence for forward primer was: ATCCGCAAAGACCTGT, and for reverse primer the sequence was: GGGTGTAACGCAACTAAG. .. QPCR reactions were performed using StepOnePlus system (Applied Biosystems).

    Fluorescence:

    Article Title: Perilipin-Mediated Lipid Droplet Formation in Adipocytes Promotes Sterol Regulatory Element-Binding Protein-1 Processing and Triacylglyceride Accumulation
    Article Snippet: .. Fluorescence real-time PCR was performed on a StepOnePlus system using TaqMan Gene Expression Assays (Applied Biosystems). ..

    Isolation:

    Article Title: Persistent histone modifications at the BDNF promoter following extinction of nicotine-seeking in rats
    Article Snippet: RNA was isolated using the Trizol extraction method according to manufacturer’s instructions (Invitrogen, CA, USA). .. Quantitative PCR was performed in a StepOnePlus system with the use of SYBR Select Master Mix (Applied Biosystems, VIC, Australia).

    Article Title: In Vitro Effects of Vaspin on Porcine Granulosa Cell Proliferation, Cell Cycle Progression, and Apoptosis by Activation of GRP78 Receptor and Several Kinase Signaling Pathways Including MAP3/1, AKT, and STAT3
    Article Snippet: Real-Time PCR RNA isolation and cDNA synthesis were performed following the manufacturer’s protocol using TaqMan™ Gene Expression Cells-to-CT™ Kit. .. Amplifications were performed using the StepOnePlus system (Applied Biosystems, Carlsbad, CA, USA) following the manufacturer’s instructions.

    Article Title: A Genome-Wide Screen Reveals that the Vibrio cholerae Phosphoenolpyruvate Phosphotransferase System Modulates Virulence Gene Expression
    Article Snippet: Total RNA was isolated from AKI-induced V. cholerae cultures using TRIzol regent (Life Technologies) and treated with DNase I for 1 h with a Turbo DNA-free kit (Life Technologies). .. The amplification and data analysis with ΔΔ CT (where CT is threshold cycle) method were performed using a StepOnePlus system (Life Technologies). gyrB mRNA was measured and used for normalization ( ).

    Article Title: Adult Brain Serotonin Deficiency Causes Hyperactivity, Circadian Disruption, and Elimination of Siestas
    Article Snippet: Tissue punches were lysed and homogenized using a 1 ml dounce homogenizer, from which RNA was isolated using a PureLink RNA Mini Kit (Ambion-Life Technologies). .. The reactions were run in triplicate using a StepOnePlus system (Applied Biosystems) and relative expression values were calculated by StepOnePlus Software with Tph2 levels normalized to β-actin expression.

    Purification:

    Article Title: A genomic atlas of human adrenal and gonad development
    Article Snippet: Quantitative RT-PCR Purified RNA from adrenal glands and control tissue (heart) was quantified using the NanoDrop 1000 spectrophotometer (Thermo Fisher Scientific). .. Amplification was performed in a total volume of 20 µl per reaction using TaqMan® Gene Expression Master Mix on the StepOnePlus™ System (Thermo Fisher Scientific).

    Polymerase Chain Reaction:

    Article Title: Persistent histone modifications at the BDNF promoter following extinction of nicotine-seeking in rats
    Article Snippet: Quantitative PCR was performed in a StepOnePlus system with the use of SYBR Select Master Mix (Applied Biosystems, VIC, Australia). .. Annealing temperatures for each primer were optimized using temperature-graded PCR, before specificity for target sequences confirmed with 1.5% agarose gels.

    Article Title: In Vitro Effects of Vaspin on Porcine Granulosa Cell Proliferation, Cell Cycle Progression, and Apoptosis by Activation of GRP78 Receptor and Several Kinase Signaling Pathways Including MAP3/1, AKT, and STAT3
    Article Snippet: Amplifications were performed using the StepOnePlus system (Applied Biosystems, Carlsbad, CA, USA) following the manufacturer’s instructions. .. PCR was performed using a final volume of 20 μL, including 50 ng/reaction cDNA.

    Article Title: Effect on Multipotency and Phenotypic Transition of Unrestricted Somatic Stem Cells from Human Umbilical Cord Blood after Treatment with Epigenetic Agents
    Article Snippet: First-strand cDNA synthesis was performed from 1.5 μ g RNA by reverse transcription using oligo(dT) (Promega) and Moloney murine leukemia virus reverse transcriptase (Promega) in a volume of 50 μ L at 42°C for 1 h. Real-time PCR was carried out with SYBR Green PCR Mastermix (Applied Biosystems) using 25 ng template cDNA. .. All reactions were run in triplicates on a StepOnePlus System (Applied Biosystems, Foster City, CA).

    Article Title: A Genome-Wide Screen Reveals that the Vibrio cholerae Phosphoenolpyruvate Phosphotransferase System Modulates Virulence Gene Expression
    Article Snippet: Paragraph title: Quantitative reverse transcriptase PCR (qRT-PCR). ... The amplification and data analysis with ΔΔ CT (where CT is threshold cycle) method were performed using a StepOnePlus system (Life Technologies). gyrB mRNA was measured and used for normalization ( ).

    IA:

    Article Title: Persistent histone modifications at the BDNF promoter following extinction of nicotine-seeking in rats
    Article Snippet: Quantitative PCR was performed in a StepOnePlus system with the use of SYBR Select Master Mix (Applied Biosystems, VIC, Australia). .. All qPCR primers (Integrated DNA Technologies, IA, USA) were designed using Primer3 software ( ) and verified using the BLAST-like alignment tool (BLAT; ).

    Mouse Assay:

    Article Title: Inability to replete white adipose tissue during recovery phase of sepsis is associated with increased autophagy, apoptosis, and proteasome activity
    Article Snippet: Real-time quantitative PCR was performed using 25 ng cDNA in a StepOnePlus system using TaqMan gene expression assays (Applied Biosystems, Foster City, CA) using primers as described previously by our laboratory ( ). .. Samples for the determination of adipose tissue mRNA content in mice from both acute and recovery sepsis were run simultaneously.

    Software:

    Article Title: Persistent histone modifications at the BDNF promoter following extinction of nicotine-seeking in rats
    Article Snippet: Quantitative PCR was performed in a StepOnePlus system with the use of SYBR Select Master Mix (Applied Biosystems, VIC, Australia). .. All qPCR primers (Integrated DNA Technologies, IA, USA) were designed using Primer3 software ( ) and verified using the BLAST-like alignment tool (BLAT; ).

    Article Title: MicroRNA-155 Mediates Augmented CD40 Expression in Bone Marrow Derived Plasmacytoid Dendritic Cells in Symptomatic Lupus-Prone NZB/W F1 Mice
    Article Snippet: .. Amplification of cDNAs was carried out using the StepOnePlus™ system and StepOne Software v2.3 (Applied Biosystems® , Thermo Fisher Scientific, Waltham, MA, USA) with KAPA SYBR® Fast qPCR kit (Kapa Biosystems, Wilmington, MA, USA) following the thermal conditions at: 95 °C for 3 min and 40 cycles of 95 °C, 60 °C and 72 °C for 20 s each. ..

    Article Title: Effect on Multipotency and Phenotypic Transition of Unrestricted Somatic Stem Cells from Human Umbilical Cord Blood after Treatment with Epigenetic Agents
    Article Snippet: All reactions were run in triplicates on a StepOnePlus System (Applied Biosystems, Foster City, CA). .. Standard curves were generated using StepOne software v2.1 (Applied Biosystems).

    Article Title: Metformin Exposure at Environmentally Relevant Concentrations Causes Potential Endocrine Disruption in Adult Male Fish
    Article Snippet: The highest scoring expressed sequence tag result was then used for primer design using PrimerQuest software (Integrated DNA Technologies) for intercalating dyes. .. Reverse transcriptase–polymerase chain reactions were run on the StepOnePlus system (Life Technologies) using the following protocol: 1) 1 cycle at 95 °C for 10 min, and 2) 40 cycles of 95 °C for 15 s and 60 °C for 30 s. The 18 S Universal Primers from Ambion (Life Technologies) were used for normalization across samples.

    Article Title: A genomic atlas of human adrenal and gonad development
    Article Snippet: Amplification was performed in a total volume of 20 µl per reaction using TaqMan® Gene Expression Master Mix on the StepOnePlus™ System (Thermo Fisher Scientific). .. Data were analysed with StepOne software (v 2.1) and results expressed as fold change above control.

    Article Title: Correction of RT-qPCR data for genomic DNA-derived signals with ValidPrime
    Article Snippet: Conventional qPCR All reactions (except when indicated) were performed in duplicate 10 µl volumes using 20 ng reverse transcribed total RNA in a StepOnePlus system (Applied Biosystems) with the SsoFast EvaGreen Supermix (BioRad) and an assay concentration of 300 nM using the cycling parameters: 95°C (20 s) followed by 40 cycles at 95°C (3 s) and 60°C (20 s). .. Analysis of the data was performed with the StepOne software v.2.2.

    Article Title: Adult Brain Serotonin Deficiency Causes Hyperactivity, Circadian Disruption, and Elimination of Siestas
    Article Snippet: .. The reactions were run in triplicate using a StepOnePlus system (Applied Biosystems) and relative expression values were calculated by StepOnePlus Software with Tph2 levels normalized to β-actin expression. .. Two-weeks after surgery, mice were anesthetized with Avertin (44 m m tribromoethanol, 2.5% tert-amyl alcohol, 0.02 ml/g body weight) and perfused with cold PBS for 2–5 min, followed by cold 4% paraformaldehyde in PBS for 20 min.

    SYBR Green Assay:

    Article Title: Regulation of the neuropathy-associated Pmp22 gene by a distal super-enhancer
    Article Snippet: .. RNA was converted to cDNA using the M-MLV reverse transcriptase (Invitrogen). cDNAs were analyzed by RT-qPCR using Power SYBR Green Master Mix (Thermo Fisher Scientific) on the StepOnePlus system or the ViiA7 system (Applied Biosystems). .. Relative expression was calculated using a relative standard curve or the Comparative Ct method ( ).

    Article Title: Effect on Multipotency and Phenotypic Transition of Unrestricted Somatic Stem Cells from Human Umbilical Cord Blood after Treatment with Epigenetic Agents
    Article Snippet: First-strand cDNA synthesis was performed from 1.5 μ g RNA by reverse transcription using oligo(dT) (Promega) and Moloney murine leukemia virus reverse transcriptase (Promega) in a volume of 50 μ L at 42°C for 1 h. Real-time PCR was carried out with SYBR Green PCR Mastermix (Applied Biosystems) using 25 ng template cDNA. .. All reactions were run in triplicates on a StepOnePlus System (Applied Biosystems, Foster City, CA).

    Article Title: Metformin Exposure at Environmentally Relevant Concentrations Causes Potential Endocrine Disruption in Adult Male Fish
    Article Snippet: Gene expression was quantified using the iTaq Universal SYBR Green Supermix 20 µL protocol (Bio-Rad). .. Reverse transcriptase–polymerase chain reactions were run on the StepOnePlus system (Life Technologies) using the following protocol: 1) 1 cycle at 95 °C for 10 min, and 2) 40 cycles of 95 °C for 15 s and 60 °C for 30 s. The 18 S Universal Primers from Ambion (Life Technologies) were used for normalization across samples.

    Article Title: A Genome-Wide Screen Reveals that the Vibrio cholerae Phosphoenolpyruvate Phosphotransferase System Modulates Virulence Gene Expression
    Article Snippet: The synthesized cDNA was subjected to real-time PCR amplification using a Fast SYBR green master mix kit (Life Technologies) with specific primer pairs (see Table S1 in the supplemental material) in a total volume of 20 μl. .. The amplification and data analysis with ΔΔ CT (where CT is threshold cycle) method were performed using a StepOnePlus system (Life Technologies). gyrB mRNA was measured and used for normalization ( ).

    Article Title: Apoplastic and intracellular plant sugars regulate developmental transitions in witches’ broom disease of cacao
    Article Snippet: .. All quantitative real-time PCRs (qRT-PCRs) were performed using 0.2 μM of each primer and SYBR Green Master Mix in a StepOnePlus system under recommended conditions and quality controls (Applied Biosystems). .. Expression levels for each treatment were calculated using the formula [2–(Ct target–Ct internal reference) ]×1000 and either conveyed as normalized absolute levels as is, or as the fold increase obtained by dividing by the values obtained in appropriate controls when applicable.

    Article Title: miR-144/451 cluster plays an oncogenic role in esophageal cancer by inhibiting cell invasion
    Article Snippet: SYBR Green mastermix were purchased from Toyobo Technologies. .. QPCR reactions were performed using StepOnePlus system (Applied Biosystems).

    RNA Extraction:

    Article Title: Persistent histone modifications at the BDNF promoter following extinction of nicotine-seeking in rats
    Article Snippet: Paragraph title: RNA extraction and quantitative real-time PCR ... Quantitative PCR was performed in a StepOnePlus system with the use of SYBR Select Master Mix (Applied Biosystems, VIC, Australia).

    Article Title: Notochordal and nucleus pulposus marker expression is maintained by sub-populations of adult human nucleus pulposus cells through aging and degeneration
    Article Snippet: Gene expression analysis RNA extraction and cDNA synthesis was performed according to previously published methodology , . .. Intron-spanning qPCR assays (Supplementary Table ) were designed against human gene sequences and qPCR reactions conducted on a StepOnePlus system (Applied Biosystems), using FAM-BHQ1 probes and corresponding primers (Sigma Aldrich).

    RNA Expression:

    Article Title: miR-144/451 cluster plays an oncogenic role in esophageal cancer by inhibiting cell invasion
    Article Snippet: QPCR reactions were performed using StepOnePlus system (Applied Biosystems). .. Expression of miRNA and mRNA were presented as relative RNA expression using ΔΔCT formula (the fold change in target gene expression was equal to 2−ΔΔCT ).

    Agarose Gel Electrophoresis:

    Article Title: Inability to replete white adipose tissue during recovery phase of sepsis is associated with increased autophagy, apoptosis, and proteasome activity
    Article Snippet: RNA quality was analyzed on a 1% agarose gel. .. Real-time quantitative PCR was performed using 25 ng cDNA in a StepOnePlus system using TaqMan gene expression assays (Applied Biosystems, Foster City, CA) using primers as described previously by our laboratory ( ).

    Spectrophotometry:

    Article Title: In Vitro Effects of Vaspin on Porcine Granulosa Cell Proliferation, Cell Cycle Progression, and Apoptosis by Activation of GRP78 Receptor and Several Kinase Signaling Pathways Including MAP3/1, AKT, and STAT3
    Article Snippet: RNA and cDNA quantity were evaluated by measuring absorbances at 260 nm and 280 nm using spectrophotometry. .. Amplifications were performed using the StepOnePlus system (Applied Biosystems, Carlsbad, CA, USA) following the manufacturer’s instructions.

    Article Title: Apoplastic and intracellular plant sugars regulate developmental transitions in witches’ broom disease of cacao
    Article Snippet: Fungal and plant RNA samples were assayed using a NanoDrop ND-1000 spectrophotometer (Thermo Fisher Scientific Inc.) followed by 1% formaldehyde–agarose denaturing gel. cDNA was synthesized from 2 μg of total RNA primed with random primers using the Superscript II Reverse Transcriptase kit (Invitrogen). .. All quantitative real-time PCRs (qRT-PCRs) were performed using 0.2 μM of each primer and SYBR Green Master Mix in a StepOnePlus system under recommended conditions and quality controls (Applied Biosystems).

    Article Title: A genomic atlas of human adrenal and gonad development
    Article Snippet: Quantitative RT-PCR Purified RNA from adrenal glands and control tissue (heart) was quantified using the NanoDrop 1000 spectrophotometer (Thermo Fisher Scientific). .. Amplification was performed in a total volume of 20 µl per reaction using TaqMan® Gene Expression Master Mix on the StepOnePlus™ System (Thermo Fisher Scientific).

    Concentration Assay:

    Article Title: Notochordal and nucleus pulposus marker expression is maintained by sub-populations of adult human nucleus pulposus cells through aging and degeneration
    Article Snippet: Intron-spanning qPCR assays (Supplementary Table ) were designed against human gene sequences and qPCR reactions conducted on a StepOnePlus system (Applied Biosystems), using FAM-BHQ1 probes and corresponding primers (Sigma Aldrich). .. All primer concentrations were optimised empirically, and all primers were used at 900 nM, except EIF2B1 and T, which were used at a 300 nM final concentration.

    Article Title: Correction of RT-qPCR data for genomic DNA-derived signals with ValidPrime
    Article Snippet: .. Conventional qPCR All reactions (except when indicated) were performed in duplicate 10 µl volumes using 20 ng reverse transcribed total RNA in a StepOnePlus system (Applied Biosystems) with the SsoFast EvaGreen Supermix (BioRad) and an assay concentration of 300 nM using the cycling parameters: 95°C (20 s) followed by 40 cycles at 95°C (3 s) and 60°C (20 s). ..

    Fluorescence In Situ Hybridization:

    Article Title: Metformin Exposure at Environmentally Relevant Concentrations Causes Potential Endocrine Disruption in Adult Male Fish
    Article Snippet: Because of low RNA yields for livers from some fish, only 8 samples per group were used to measure expression of GK, FBPase, FASN, and PXR. .. Reverse transcriptase–polymerase chain reactions were run on the StepOnePlus system (Life Technologies) using the following protocol: 1) 1 cycle at 95 °C for 10 min, and 2) 40 cycles of 95 °C for 15 s and 60 °C for 30 s. The 18 S Universal Primers from Ambion (Life Technologies) were used for normalization across samples.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Thermo Fisher steponeplus real time system
    p21-/- attenuates the antiproliferative effects of AzaC (a) p21 mRNA is significantly upregulated in CD4+ and CD8+ Teff following treatment with AzaC. Teffs were isolated from the spleens of B6. Foxp3 GFP × B6.CAG DSRED and nTregs were isolated from B6. Foxp3 GFP . Cells were co-cultured at a 1:10 ratio of nTregs to Teffs for 2 days in the presence of anti-CD3/CD28 beads (bead:cell 1:1; Invitrogen) and Xcyte medium supplemented with L-glutamine (4 mM), penicillin (100 U/mL), streptomycin (100 μg/mL), and human recombinant IL-2 (hIL-2; 500 U/mL). The activated T cells were cultured with AzaC (1 μM) or PBS for an additional 2 days. Cells were sorted using FACS Aria II (BD) to isolate nTregs (CD4+DSRED-FOXP3GFP+), CD4+ Teffs (CD4+DSRed+FOXP3GFP-), and CD8+ Teffs (CD8+DSRed+FOXP3GFP-) prior to RNA extraction. QPCR was performed on the Applied Biosystems <t>StepOnePlus</t> Real-Time System using pre-designed TaqMan® Gene Expression Assays (18S RNA Mm03928990 and p21 Mm04205640). Relative fold changes in expression were determined using the ΔΔCT method. AzaC treatment resulted in a 3.4 fold increase of p21 expression in CD4+ Teffs (FACS sorted to remove AzaC converted Tregs) (AzaC vs. PBS p
    Steponeplus Real Time System, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 25 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/steponeplus real time system/product/Thermo Fisher
    Average 90 stars, based on 25 article reviews
    Price from $9.99 to $1999.99
    steponeplus real time system - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    79
    Thermo Fisher applied biosystemstm thermo fisher scientific steponeplustm real time pcr system
    p21-/- attenuates the antiproliferative effects of AzaC (a) p21 mRNA is significantly upregulated in CD4+ and CD8+ Teff following treatment with AzaC. Teffs were isolated from the spleens of B6. Foxp3 GFP × B6.CAG DSRED and nTregs were isolated from B6. Foxp3 GFP . Cells were co-cultured at a 1:10 ratio of nTregs to Teffs for 2 days in the presence of anti-CD3/CD28 beads (bead:cell 1:1; Invitrogen) and Xcyte medium supplemented with L-glutamine (4 mM), penicillin (100 U/mL), streptomycin (100 μg/mL), and human recombinant IL-2 (hIL-2; 500 U/mL). The activated T cells were cultured with AzaC (1 μM) or PBS for an additional 2 days. Cells were sorted using FACS Aria II (BD) to isolate nTregs (CD4+DSRED-FOXP3GFP+), CD4+ Teffs (CD4+DSRed+FOXP3GFP-), and CD8+ Teffs (CD8+DSRed+FOXP3GFP-) prior to RNA extraction. QPCR was performed on the Applied Biosystems <t>StepOnePlus</t> Real-Time System using pre-designed TaqMan® Gene Expression Assays (18S RNA Mm03928990 and p21 Mm04205640). Relative fold changes in expression were determined using the ΔΔCT method. AzaC treatment resulted in a 3.4 fold increase of p21 expression in CD4+ Teffs (FACS sorted to remove AzaC converted Tregs) (AzaC vs. PBS p
    Applied Biosystemstm Thermo Fisher Scientific Steponeplustm Real Time Pcr System, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 79/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/applied biosystemstm thermo fisher scientific steponeplustm real time pcr system/product/Thermo Fisher
    Average 79 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    applied biosystemstm thermo fisher scientific steponeplustm real time pcr system - by Bioz Stars, 2020-02
    79/100 stars
      Buy from Supplier

    99
    Thermo Fisher applied biosystems steponeplus
    p21-/- attenuates the antiproliferative effects of AzaC (a) p21 mRNA is significantly upregulated in CD4+ and CD8+ Teff following treatment with AzaC. Teffs were isolated from the spleens of B6. Foxp3 GFP × B6.CAG DSRED and nTregs were isolated from B6. Foxp3 GFP . Cells were co-cultured at a 1:10 ratio of nTregs to Teffs for 2 days in the presence of anti-CD3/CD28 beads (bead:cell 1:1; Invitrogen) and Xcyte medium supplemented with L-glutamine (4 mM), penicillin (100 U/mL), streptomycin (100 μg/mL), and human recombinant IL-2 (hIL-2; 500 U/mL). The activated T cells were cultured with AzaC (1 μM) or PBS for an additional 2 days. Cells were sorted using FACS Aria II (BD) to isolate nTregs (CD4+DSRED-FOXP3GFP+), CD4+ Teffs (CD4+DSRed+FOXP3GFP-), and CD8+ Teffs (CD8+DSRed+FOXP3GFP-) prior to RNA extraction. QPCR was performed on the Applied Biosystems <t>StepOnePlus</t> Real-Time System using pre-designed TaqMan® Gene Expression Assays (18S RNA Mm03928990 and p21 Mm04205640). Relative fold changes in expression were determined using the ΔΔCT method. AzaC treatment resulted in a 3.4 fold increase of p21 expression in CD4+ Teffs (FACS sorted to remove AzaC converted Tregs) (AzaC vs. PBS p
    Applied Biosystems Steponeplus, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 17 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/applied biosystems steponeplus/product/Thermo Fisher
    Average 99 stars, based on 17 article reviews
    Price from $9.99 to $1999.99
    applied biosystems steponeplus - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    Image Search Results


    p21-/- attenuates the antiproliferative effects of AzaC (a) p21 mRNA is significantly upregulated in CD4+ and CD8+ Teff following treatment with AzaC. Teffs were isolated from the spleens of B6. Foxp3 GFP × B6.CAG DSRED and nTregs were isolated from B6. Foxp3 GFP . Cells were co-cultured at a 1:10 ratio of nTregs to Teffs for 2 days in the presence of anti-CD3/CD28 beads (bead:cell 1:1; Invitrogen) and Xcyte medium supplemented with L-glutamine (4 mM), penicillin (100 U/mL), streptomycin (100 μg/mL), and human recombinant IL-2 (hIL-2; 500 U/mL). The activated T cells were cultured with AzaC (1 μM) or PBS for an additional 2 days. Cells were sorted using FACS Aria II (BD) to isolate nTregs (CD4+DSRED-FOXP3GFP+), CD4+ Teffs (CD4+DSRed+FOXP3GFP-), and CD8+ Teffs (CD8+DSRed+FOXP3GFP-) prior to RNA extraction. QPCR was performed on the Applied Biosystems StepOnePlus Real-Time System using pre-designed TaqMan® Gene Expression Assays (18S RNA Mm03928990 and p21 Mm04205640). Relative fold changes in expression were determined using the ΔΔCT method. AzaC treatment resulted in a 3.4 fold increase of p21 expression in CD4+ Teffs (FACS sorted to remove AzaC converted Tregs) (AzaC vs. PBS p

    Journal: Journal of immunology (Baltimore, Md. : 1950)

    Article Title: Azacitidine mitigates GvHD via differential effects on the proliferation of T effectors and nTregs in vivo

    doi: 10.4049/jimmunol.1502399

    Figure Lengend Snippet: p21-/- attenuates the antiproliferative effects of AzaC (a) p21 mRNA is significantly upregulated in CD4+ and CD8+ Teff following treatment with AzaC. Teffs were isolated from the spleens of B6. Foxp3 GFP × B6.CAG DSRED and nTregs were isolated from B6. Foxp3 GFP . Cells were co-cultured at a 1:10 ratio of nTregs to Teffs for 2 days in the presence of anti-CD3/CD28 beads (bead:cell 1:1; Invitrogen) and Xcyte medium supplemented with L-glutamine (4 mM), penicillin (100 U/mL), streptomycin (100 μg/mL), and human recombinant IL-2 (hIL-2; 500 U/mL). The activated T cells were cultured with AzaC (1 μM) or PBS for an additional 2 days. Cells were sorted using FACS Aria II (BD) to isolate nTregs (CD4+DSRED-FOXP3GFP+), CD4+ Teffs (CD4+DSRed+FOXP3GFP-), and CD8+ Teffs (CD8+DSRed+FOXP3GFP-) prior to RNA extraction. QPCR was performed on the Applied Biosystems StepOnePlus Real-Time System using pre-designed TaqMan® Gene Expression Assays (18S RNA Mm03928990 and p21 Mm04205640). Relative fold changes in expression were determined using the ΔΔCT method. AzaC treatment resulted in a 3.4 fold increase of p21 expression in CD4+ Teffs (FACS sorted to remove AzaC converted Tregs) (AzaC vs. PBS p

    Article Snippet: QPCR was performed on the Applied Biosystems StepOnePlus Real-Time System (Thermo fisher) using pre-designed TaqMan® Gene Expression Assays (Life Technologies) (18S RNA Mm03928990 and p21 Mm04205640) according to manufacturer's instructions.

    Techniques: Isolation, Cell Culture, Recombinant, FACS, RNA Extraction, Real-time Polymerase Chain Reaction, Expressing