steponeplus instrument  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Thermo Fisher steponeplus instrument
    Steponeplus Instrument, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 240 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/steponeplus instrument/product/Thermo Fisher
    Average 99 stars, based on 240 article reviews
    Price from $9.99 to $1999.99
    steponeplus instrument - by Bioz Stars, 2020-02
    99/100 stars

    Images

    Related Articles

    Amplification:

    Article Title: Conditioned media from human palatine tonsil mesenchymal stem cells regulates the interaction between myotubes and fibroblasts by IL‐1Ra activity
    Article Snippet: RT‐PCR analysis was performed on a StepOnePlus™ instrument (Applied Biosystems, Carlsbad, CA, USA) using SYBR® green (Toyobo). .. Fibronectin (124 bp) was amplified using the primers, 5′‐ATGTGGACCCCTCCTGATAGT‐3′ (forward) and 5′‐GCCCAGTGATTTCAGCAAAGG‐3′ (reverse).

    Article Title: Antibiotic treatment of rat dams affects bacterial colonization and causes decreased weight gain in pups
    Article Snippet: .. The cDNA was amplified in duplicate on a StepOnePlus instrument (Applied Biosystems). .. Gene expression was calculated by the comparative cycle threshold (CT) method.

    Article Title: Analytical Performance Determination and Clinical Validation of the Novel Roche RealTime Ready Influenza A/H1N1 Detection Set ▿Analytical Performance Determination and Clinical Validation of the Novel Roche RealTime Ready Influenza A/H1N1 Detection Set ▿ †
    Article Snippet: Cycling was performed with a StepOnePlus instrument (Applied Biosystems). .. PCR standard curves for the absolute quantification of viral RNA were obtained by reverse transcription and amplification of a series of defined amounts of precharacterized, in vitro -transcribed, and assay-specific RNA transcript standards generated as previously described ( ).

    Article Title: Hepatitis A virus infections and outbreaks in asylum seekers arriving to Germany, September 2015 to March 2016
    Article Snippet: .. Thermal cycling was performed on a StepOnePlus instrument (Applied Biosystems) and comprised a 10-min initial enzyme activation step at 95 °C, and 45 cycles of 95 °C for 15 s and 60 °C for 1 min. RT-qPCR-positive samples were further characterized by amplicon sequencing. .. The amplification was performed according to the unified HAV Net protocol ( http://www.rivm.nl/en/Topics/H/HAVNET ) by using specific primers for the HAV VP1/P2A genomic region (HAV 6.1, 5′-TAT GCY ITI TCW GGI GCI YTR GAY GG-3′ HAV 10, 5′-TCY TTC ATY TCW GTC CAY TTY TCA TCA TT-3′, 614 nt).

    Article Title: Brassinosteroid control of sex determination in maize
    Article Snippet: For qRT-PCR analysis, total RNA was pretreated with DNase I (Amplification grade; Invitrogen), and cDNA was synthesized by using reverse transcriptase (Superscript III; Invitrogen). .. All primers showed > 90% efficiency at their indicated concentrations. qRT-PCR was performed as described ( ) by using the StepOnePlus instrument (Applied Biosystems, Invitrogen).

    Synthesized:

    Article Title: Exogenous oxidants activate nuclear factor kappa B through Toll-like receptor 4 stimulation to maintain inflammatory phenotype in macrophage
    Article Snippet: .. Single-stranded cDNA was synthesized from total RNA with the reverse transcription kit using StepOnePlus™ instrument (Life technologies, PA, USA). .. The PCR product was resolved on polyacrylamide gel, stained with ethidium bromide, and visualized under UV light.

    Article Title: Conditioned media from human palatine tonsil mesenchymal stem cells regulates the interaction between myotubes and fibroblasts by IL‐1Ra activity
    Article Snippet: Quantitative reverse transcription PCR (qRT‐PCR) For the analysis of fibronectin expression in L929 cells, complementary DNA was synthesized using the First‐Strand cDNA synthesis kit (Toyobo) according to the manufacturer's instructions. .. RT‐PCR analysis was performed on a StepOnePlus™ instrument (Applied Biosystems, Carlsbad, CA, USA) using SYBR® green (Toyobo).

    Article Title: Therapeutic Potential of Mesenchymal Stromal Cells and MSC Conditioned Medium in Amyotrophic Lateral Sclerosis (ALS) - In Vitro Evidence from Primary Motor Neuron Cultures, NSC-34 Cells, Astrocytes and Microglia
    Article Snippet: The genetic expression of growth factors and cytokines were quantified using the TaqMan method with the following assays synthesized by Lifetech (Life Technologies; Applied Biosystems): GDNF (Mm00599849_m1), BDNF (Mm01334042_m1), CNTF (Mm00446373_m1), FGF-2 (Mm00433287_m1), VEGF (Mm00437304_m1), NGF (Mm00443039_m1), IGF (Mm00439560_m1), TNFα (Mm99999068_m1), IL-6 (Mm00446190_m1), iNOS (Mm00440502_m1), COX2 (Mm03294838_g1) and IL-10 (Mm00439614_m1), CX3CL1 (Mm00436454_m1), CX3CR1 (Mm00438354_m1). .. Corresponding to mRNA, cDNA was used at a concentration of 25 ng/µL. qRT-PCR was performed with cDNA from 50 ng total RNA and TaqMan®Fast Universal Master Mix (Applied Biosystems) on a StepOnePlus instrument (Applied Biosystems) under the following standard conditions: 95°C for 20 s, followed by 40 cycles of 95°C for 1 s and 60°C for 20 s. The relative gene expression was calculated via the comparative Ct method as previously described by K. Livak (Applied Biosystems User Bulletin #2, 2001).

    Article Title: Selection of accurate reference genes in mouse trophoblast stem cells for reverse transcription-quantitative polymerase chain reaction
    Article Snippet: Following extraction, the first strand cDNA was synthesized with a SuperScript III reverse transcriptase reagent set (Thermo Fisher Scientific). .. Gene expression was assessed by qPCR on a StepOnePlus™ instrument (Thermo Fisher Scientific) using Quantitect SYBR Green PCR kits (Qiagen) according to the manufacturer’s instructions.

    Article Title: Temporal retinal transcriptome and systems biology analysis identifies key pathways and hub genes in Staphylococcus aureus endophthalmitis
    Article Snippet: Some RNA was used for the microarray analysis, and the remaining RNA was used for gene validation. cDNA was synthesized using 1.0 μg of total RNA using a Maxima first strand cDNA synthesis kit, as per the manufacturer’s instructions (Thermo scientific, Rockford, IL). .. PCR was performed using a StepOnePlus™ instrument (Applied Bio system, Grand Island, NY).

    Article Title: The host Integrator complex acts in transcription-independent maturation of herpesvirus microRNA 3′ ends
    Article Snippet: For RT-qPCR, the RNA sample was first treated with RQ1 DNase (Promega), and cDNA was synthesized with SSIII RT and random primers (Invitrogen). .. Next, using a StepOnePlus instrument (Applied Biosystems), the cDNA was analyzed by RT-qPCR in technical triplicates using FastStart Universal SYBR Green Master (Rox) master mix (Roche) and primers for pre-GAPDH and pre-U1 ( ) and for pri-miR-HSUR4 (forward, 5′-CCGTGTTGCTACAGCTATAAACTTC-3′; reverse, 5′-ATTACATCCTCTTCCTGTGTAATGTTTGAG-3′).

    Article Title: Global transcriptome response to ionic liquid by a tropical rain forest soil bacterium, Enterobacter lignolyticus
    Article Snippet: cDNA was synthesized using the SuperScript III First-Strand Synthesis System for RT-PCR (Invitrogen) according to the manufacturer’s protocol, using random hexamers and a total input of 100 ng of RNA in each reaction. cDNA samples were used at 1:100 final concentration. .. Reactions in a 20-μL volume were run on the StepOnePlus instrument (Applied Biosystems) using PerfeCta SYBR Green SuperMix mix with ROX (Quanta Biosciences) according to the manufacturer’s instructions.

    Article Title: Brassinosteroid control of sex determination in maize
    Article Snippet: For qRT-PCR analysis, total RNA was pretreated with DNase I (Amplification grade; Invitrogen), and cDNA was synthesized by using reverse transcriptase (Superscript III; Invitrogen). .. All primers showed > 90% efficiency at their indicated concentrations. qRT-PCR was performed as described ( ) by using the StepOnePlus instrument (Applied Biosystems, Invitrogen).

    Quantitative RT-PCR:

    Article Title: Exogenous oxidants activate nuclear factor kappa B through Toll-like receptor 4 stimulation to maintain inflammatory phenotype in macrophage
    Article Snippet: We confirmed the expression of TLR4 in RAW-Blue cells by real time quantitative PCR (RT-qPCR) and Western blot. .. Single-stranded cDNA was synthesized from total RNA with the reverse transcription kit using StepOnePlus™ instrument (Life technologies, PA, USA).

    Article Title: Conditioned media from human palatine tonsil mesenchymal stem cells regulates the interaction between myotubes and fibroblasts by IL‐1Ra activity
    Article Snippet: Paragraph title: Quantitative reverse transcription PCR (qRT‐PCR) ... RT‐PCR analysis was performed on a StepOnePlus™ instrument (Applied Biosystems, Carlsbad, CA, USA) using SYBR® green (Toyobo).

    Article Title: Therapeutic Potential of Mesenchymal Stromal Cells and MSC Conditioned Medium in Amyotrophic Lateral Sclerosis (ALS) - In Vitro Evidence from Primary Motor Neuron Cultures, NSC-34 Cells, Astrocytes and Microglia
    Article Snippet: .. Corresponding to mRNA, cDNA was used at a concentration of 25 ng/µL. qRT-PCR was performed with cDNA from 50 ng total RNA and TaqMan®Fast Universal Master Mix (Applied Biosystems) on a StepOnePlus instrument (Applied Biosystems) under the following standard conditions: 95°C for 20 s, followed by 40 cycles of 95°C for 1 s and 60°C for 20 s. The relative gene expression was calculated via the comparative Ct method as previously described by K. Livak (Applied Biosystems User Bulletin #2, 2001). .. Ct values were normalized to Hrtp1 and used to calculate the relative gene expression using the 2−ΔΔCt method .

    Article Title: Analytical Performance Determination and Clinical Validation of the Novel Roche RealTime Ready Influenza A/H1N1 Detection Set ▿Analytical Performance Determination and Clinical Validation of the Novel Roche RealTime Ready Influenza A/H1N1 Detection Set ▿ †
    Article Snippet: The concentration of influenza A and H1N1/09 virus-specific RNA was determined by analyzing the eluates with two different RT-qPCR assays ( , ). .. Cycling was performed with a StepOnePlus instrument (Applied Biosystems).

    Article Title: Selection of accurate reference genes in mouse trophoblast stem cells for reverse transcription-quantitative polymerase chain reaction
    Article Snippet: Paragraph title: RT-qPCR ... Gene expression was assessed by qPCR on a StepOnePlus™ instrument (Thermo Fisher Scientific) using Quantitect SYBR Green PCR kits (Qiagen) according to the manufacturer’s instructions.

    Article Title: Hepatitis A virus infections and outbreaks in asylum seekers arriving to Germany, September 2015 to March 2016
    Article Snippet: Primers and probe for the HAV reverse transcription quantitative real-time PCR (RT-qPCR) assay were in the viral polymerase gene region (SH-Poly-A, SH-Poly-1 and SH-Poly-Q ). .. Thermal cycling was performed on a StepOnePlus instrument (Applied Biosystems) and comprised a 10-min initial enzyme activation step at 95 °C, and 45 cycles of 95 °C for 15 s and 60 °C for 1 min. RT-qPCR-positive samples were further characterized by amplicon sequencing.

    Article Title: The host Integrator complex acts in transcription-independent maturation of herpesvirus microRNA 3′ ends
    Article Snippet: .. Next, using a StepOnePlus instrument (Applied Biosystems), the cDNA was analyzed by RT-qPCR in technical triplicates using FastStart Universal SYBR Green Master (Rox) master mix (Roche) and primers for pre-GAPDH and pre-U1 ( ) and for pri-miR-HSUR4 (forward, 5′-CCGTGTTGCTACAGCTATAAACTTC-3′; reverse, 5′-ATTACATCCTCTTCCTGTGTAATGTTTGAG-3′). .. The enrichment value for the RNA selected by anti-Flag antibodies was normalized to the control selection by IgG.

    Article Title: Global transcriptome response to ionic liquid by a tropical rain forest soil bacterium, Enterobacter lignolyticus
    Article Snippet: Paragraph title: RT-qPCR. ... Reactions in a 20-μL volume were run on the StepOnePlus instrument (Applied Biosystems) using PerfeCta SYBR Green SuperMix mix with ROX (Quanta Biosciences) according to the manufacturer’s instructions.

    Article Title: Brassinosteroid control of sex determination in maize
    Article Snippet: .. All primers showed > 90% efficiency at their indicated concentrations. qRT-PCR was performed as described ( ) by using the StepOnePlus instrument (Applied Biosystems, Invitrogen). ..

    SYBR Green Assay:

    Article Title: Mutant p53 prolongs NF-?B activation and promotes chronic inflammation and inflammation-associated colorectal cancer
    Article Snippet: .. Real-time qPCR was performed using SYBR Green Master Mix (Applied Biosystems) in a StepOnePlus instrument (Applied Biosystems). .. The primers used for qPCR are listed in the supplementary section of the Experimental Procedures.

    Article Title: Conditioned media from human palatine tonsil mesenchymal stem cells regulates the interaction between myotubes and fibroblasts by IL‐1Ra activity
    Article Snippet: .. RT‐PCR analysis was performed on a StepOnePlus™ instrument (Applied Biosystems, Carlsbad, CA, USA) using SYBR® green (Toyobo). .. Fibronectin (124 bp) was amplified using the primers, 5′‐ATGTGGACCCCTCCTGATAGT‐3′ (forward) and 5′‐GCCCAGTGATTTCAGCAAAGG‐3′ (reverse).

    Article Title: Selection of accurate reference genes in mouse trophoblast stem cells for reverse transcription-quantitative polymerase chain reaction
    Article Snippet: .. Gene expression was assessed by qPCR on a StepOnePlus™ instrument (Thermo Fisher Scientific) using Quantitect SYBR Green PCR kits (Qiagen) according to the manufacturer’s instructions. ..

    Article Title: The host Integrator complex acts in transcription-independent maturation of herpesvirus microRNA 3′ ends
    Article Snippet: .. Next, using a StepOnePlus instrument (Applied Biosystems), the cDNA was analyzed by RT-qPCR in technical triplicates using FastStart Universal SYBR Green Master (Rox) master mix (Roche) and primers for pre-GAPDH and pre-U1 ( ) and for pri-miR-HSUR4 (forward, 5′-CCGTGTTGCTACAGCTATAAACTTC-3′; reverse, 5′-ATTACATCCTCTTCCTGTGTAATGTTTGAG-3′). .. The enrichment value for the RNA selected by anti-Flag antibodies was normalized to the control selection by IgG.

    Article Title: Global transcriptome response to ionic liquid by a tropical rain forest soil bacterium, Enterobacter lignolyticus
    Article Snippet: .. Reactions in a 20-μL volume were run on the StepOnePlus instrument (Applied Biosystems) using PerfeCta SYBR Green SuperMix mix with ROX (Quanta Biosciences) according to the manufacturer’s instructions. .. UbiD decarboxylase gene (Entcl_4195) was used as a reference based on its expression stability across all conditions in the RNA-Seq dataset.

    Microarray:

    Article Title: Temporal retinal transcriptome and systems biology analysis identifies key pathways and hub genes in Staphylococcus aureus endophthalmitis
    Article Snippet: Some RNA was used for the microarray analysis, and the remaining RNA was used for gene validation. cDNA was synthesized using 1.0 μg of total RNA using a Maxima first strand cDNA synthesis kit, as per the manufacturer’s instructions (Thermo scientific, Rockford, IL). .. PCR was performed using a StepOnePlus™ instrument (Applied Bio system, Grand Island, NY).

    Random Hexamer Labeling:

    Article Title: Mutant p53 prolongs NF-?B activation and promotes chronic inflammation and inflammation-associated colorectal cancer
    Article Snippet: 1.5 µg aliquots were reverse transcribed using Moloney murine leukemia virus reverse transcriptase (Promega) and random hexamer primers (Amersham). .. Real-time qPCR was performed using SYBR Green Master Mix (Applied Biosystems) in a StepOnePlus instrument (Applied Biosystems).

    Formalin-fixed Paraffin-Embedded:

    Article Title: Detection and localization of viral infection in the pancreas of patients with type 1 diabetes using short fluorescently-labelled oligonucleotide probes
    Article Snippet: Real time PCRs reactions were prepared according to Applied Biosystems guidelines using SybrGreen assay and performed in a StepOnePlus instrument (Applied Biosystems, Carlsbad, CA, USA). .. RNAse treatment CVB3 infected FFPE human islets sections were prepared as described above.

    Expressing:

    Article Title: Exogenous oxidants activate nuclear factor kappa B through Toll-like receptor 4 stimulation to maintain inflammatory phenotype in macrophage
    Article Snippet: Paragraph title: 2.5 Expression of TLR4 in RAW-Blue cells, RNA extraction and real time PCR ... Single-stranded cDNA was synthesized from total RNA with the reverse transcription kit using StepOnePlus™ instrument (Life technologies, PA, USA).

    Article Title: Conditioned media from human palatine tonsil mesenchymal stem cells regulates the interaction between myotubes and fibroblasts by IL‐1Ra activity
    Article Snippet: Quantitative reverse transcription PCR (qRT‐PCR) For the analysis of fibronectin expression in L929 cells, complementary DNA was synthesized using the First‐Strand cDNA synthesis kit (Toyobo) according to the manufacturer's instructions. .. RT‐PCR analysis was performed on a StepOnePlus™ instrument (Applied Biosystems, Carlsbad, CA, USA) using SYBR® green (Toyobo).

    Article Title: Therapeutic Potential of Mesenchymal Stromal Cells and MSC Conditioned Medium in Amyotrophic Lateral Sclerosis (ALS) - In Vitro Evidence from Primary Motor Neuron Cultures, NSC-34 Cells, Astrocytes and Microglia
    Article Snippet: .. Corresponding to mRNA, cDNA was used at a concentration of 25 ng/µL. qRT-PCR was performed with cDNA from 50 ng total RNA and TaqMan®Fast Universal Master Mix (Applied Biosystems) on a StepOnePlus instrument (Applied Biosystems) under the following standard conditions: 95°C for 20 s, followed by 40 cycles of 95°C for 1 s and 60°C for 20 s. The relative gene expression was calculated via the comparative Ct method as previously described by K. Livak (Applied Biosystems User Bulletin #2, 2001). .. Ct values were normalized to Hrtp1 and used to calculate the relative gene expression using the 2−ΔΔCt method .

    Article Title: Antibiotic treatment of rat dams affects bacterial colonization and causes decreased weight gain in pups
    Article Snippet: Paragraph title: Gene expression analysis ... The cDNA was amplified in duplicate on a StepOnePlus instrument (Applied Biosystems).

    Article Title: Selection of accurate reference genes in mouse trophoblast stem cells for reverse transcription-quantitative polymerase chain reaction
    Article Snippet: .. Gene expression was assessed by qPCR on a StepOnePlus™ instrument (Thermo Fisher Scientific) using Quantitect SYBR Green PCR kits (Qiagen) according to the manufacturer’s instructions. ..

    Article Title: Temporal retinal transcriptome and systems biology analysis identifies key pathways and hub genes in Staphylococcus aureus endophthalmitis
    Article Snippet: PCR was performed using a StepOnePlus™ instrument (Applied Bio system, Grand Island, NY). .. The quantification of gene expression was determined via the comparative ΔΔCT method.

    Article Title: The Pseudomonas aeruginosa PrrF Small RNAs Regulate Iron Homeostasis during Acute Murine Lung Infection
    Article Snippet: A total of 50 ng/μl of RNA was used to generate cDNA with an ImProm-II cDNA synthesis kit (Promega) as previously described , and cDNA was analyzed using a StepOnePlus instrument (Applied Biosystems) and TaqMan reagents (Life Technologies). .. Relative RNA levels were then normalized to the levels of the oprF mRNA as previously described ( , , ) for aerobic expression studies or to the omlA level as previously described ( ) for microaerobic expression studies.

    Article Title: Global transcriptome response to ionic liquid by a tropical rain forest soil bacterium, Enterobacter lignolyticus
    Article Snippet: Reactions in a 20-μL volume were run on the StepOnePlus instrument (Applied Biosystems) using PerfeCta SYBR Green SuperMix mix with ROX (Quanta Biosciences) according to the manufacturer’s instructions. .. UbiD decarboxylase gene (Entcl_4195) was used as a reference based on its expression stability across all conditions in the RNA-Seq dataset.

    Modification:

    Article Title: Molecular analysis of Idiopathic Subglottic Stenosis for Mycobacterium species
    Article Snippet: DNA Isolation: Genomic DNA was extracted with the Qiagen DNAeasy extraction kit (Qiagen, Valencia, CA) according to the manufacturer's instructions with slight modification as previously described , . .. Human respiratory pathogen qPCR array (Qiagen, Vallencia, CA) was performed as per manufacture's instructions in a StepOnePlus™ instrument (Applied Biosystems® )

    Western Blot:

    Article Title: Exogenous oxidants activate nuclear factor kappa B through Toll-like receptor 4 stimulation to maintain inflammatory phenotype in macrophage
    Article Snippet: We confirmed the expression of TLR4 in RAW-Blue cells by real time quantitative PCR (RT-qPCR) and Western blot. .. Single-stranded cDNA was synthesized from total RNA with the reverse transcription kit using StepOnePlus™ instrument (Life technologies, PA, USA).

    Transformation Assay:

    Article Title: Global transcriptome response to ionic liquid by a tropical rain forest soil bacterium, Enterobacter lignolyticus
    Article Snippet: Reactions in a 20-μL volume were run on the StepOnePlus instrument (Applied Biosystems) using PerfeCta SYBR Green SuperMix mix with ROX (Quanta Biosciences) according to the manufacturer’s instructions. .. Ratio of expression ( R ) was quantified by the Pfaffl method ( , ) using the equation: R values for each biological replicate were averaged, and the averages were log2 -transformed.

    Countercurrent Chromatography:

    Article Title: Exogenous oxidants activate nuclear factor kappa B through Toll-like receptor 4 stimulation to maintain inflammatory phenotype in macrophage
    Article Snippet: Single-stranded cDNA was synthesized from total RNA with the reverse transcription kit using StepOnePlus™ instrument (Life technologies, PA, USA). .. The primer sequences that were used for TLR4 (NCBI Reference Sequence: ) are: forward primer (FP): 5′-AAC CAG CTG TAT TCC CTC AGC ACT-3′; reverse primer (RP): 5′-ACT GCT TCT GTT CCT TGA CCC ACT-3′.

    Transfection:

    Article Title: The host Integrator complex acts in transcription-independent maturation of herpesvirus microRNA 3′ ends
    Article Snippet: Next, using a StepOnePlus instrument (Applied Biosystems), the cDNA was analyzed by RT-qPCR in technical triplicates using FastStart Universal SYBR Green Master (Rox) master mix (Roche) and primers for pre-GAPDH and pre-U1 ( ) and for pri-miR-HSUR4 (forward, 5′-CCGTGTTGCTACAGCTATAAACTTC-3′; reverse, 5′-ATTACATCCTCTTCCTGTGTAATGTTTGAG-3′). .. Final enrichment values were normalized to the pre-GAPDH enrichment from the pmiR-HSUR4 transfected cell lysate.

    Immunoprecipitation:

    Article Title: The host Integrator complex acts in transcription-independent maturation of herpesvirus microRNA 3′ ends
    Article Snippet: Paragraph title: RNA immunoprecipitation and qRT–PCR ... Next, using a StepOnePlus instrument (Applied Biosystems), the cDNA was analyzed by RT-qPCR in technical triplicates using FastStart Universal SYBR Green Master (Rox) master mix (Roche) and primers for pre-GAPDH and pre-U1 ( ) and for pri-miR-HSUR4 (forward, 5′-CCGTGTTGCTACAGCTATAAACTTC-3′; reverse, 5′-ATTACATCCTCTTCCTGTGTAATGTTTGAG-3′).

    Infection:

    Article Title: Detection and localization of viral infection in the pancreas of patients with type 1 diabetes using short fluorescently-labelled oligonucleotide probes
    Article Snippet: Real time PCRs reactions were prepared according to Applied Biosystems guidelines using SybrGreen assay and performed in a StepOnePlus instrument (Applied Biosystems, Carlsbad, CA, USA). .. RNAse treatment CVB3 infected FFPE human islets sections were prepared as described above.

    Generated:

    Article Title: Analytical Performance Determination and Clinical Validation of the Novel Roche RealTime Ready Influenza A/H1N1 Detection Set ▿Analytical Performance Determination and Clinical Validation of the Novel Roche RealTime Ready Influenza A/H1N1 Detection Set ▿ †
    Article Snippet: Cycling was performed with a StepOnePlus instrument (Applied Biosystems). .. PCR standard curves for the absolute quantification of viral RNA were obtained by reverse transcription and amplification of a series of defined amounts of precharacterized, in vitro -transcribed, and assay-specific RNA transcript standards generated as previously described ( ).

    Article Title: The Pseudomonas aeruginosa PrrF Small RNAs Regulate Iron Homeostasis during Acute Murine Lung Infection
    Article Snippet: A total of 50 ng/μl of RNA was used to generate cDNA with an ImProm-II cDNA synthesis kit (Promega) as previously described , and cDNA was analyzed using a StepOnePlus instrument (Applied Biosystems) and TaqMan reagents (Life Technologies). .. Standard curves were produced for each primer-probe set listed in Table S1 in the supplemental material by analyzing cDNA generated from serial dilutions of RNA and used to determine relative amounts of the RNAs, as described previously ( ).

    Polymerase Chain Reaction:

    Article Title: Detection and localization of viral infection in the pancreas of patients with type 1 diabetes using short fluorescently-labelled oligonucleotide probes
    Article Snippet: Real time PCRs reactions were prepared according to Applied Biosystems guidelines using SybrGreen assay and performed in a StepOnePlus instrument (Applied Biosystems, Carlsbad, CA, USA). .. PCR efficiencies were monitored for each sample according to a previously described approach [ ].

    Article Title: Exogenous oxidants activate nuclear factor kappa B through Toll-like receptor 4 stimulation to maintain inflammatory phenotype in macrophage
    Article Snippet: Single-stranded cDNA was synthesized from total RNA with the reverse transcription kit using StepOnePlus™ instrument (Life technologies, PA, USA). .. The PCR product was resolved on polyacrylamide gel, stained with ethidium bromide, and visualized under UV light.

    Article Title: Conditioned media from human palatine tonsil mesenchymal stem cells regulates the interaction between myotubes and fibroblasts by IL‐1Ra activity
    Article Snippet: Paragraph title: Quantitative reverse transcription PCR (qRT‐PCR) ... RT‐PCR analysis was performed on a StepOnePlus™ instrument (Applied Biosystems, Carlsbad, CA, USA) using SYBR® green (Toyobo).

    Article Title: Analytical Performance Determination and Clinical Validation of the Novel Roche RealTime Ready Influenza A/H1N1 Detection Set ▿Analytical Performance Determination and Clinical Validation of the Novel Roche RealTime Ready Influenza A/H1N1 Detection Set ▿ †
    Article Snippet: Two replicates containing 10 μl of each RT product (corresponding to 5 μl eluate) were analyzed by using the TaqMan universal PCR master mix, No AmpErase UNG (Applied Biosystems), and primers and probes as previously described ( , ). .. Cycling was performed with a StepOnePlus instrument (Applied Biosystems).

    Article Title: Selection of accurate reference genes in mouse trophoblast stem cells for reverse transcription-quantitative polymerase chain reaction
    Article Snippet: .. Gene expression was assessed by qPCR on a StepOnePlus™ instrument (Thermo Fisher Scientific) using Quantitect SYBR Green PCR kits (Qiagen) according to the manufacturer’s instructions. ..

    Article Title: Temporal retinal transcriptome and systems biology analysis identifies key pathways and hub genes in Staphylococcus aureus endophthalmitis
    Article Snippet: .. PCR was performed using a StepOnePlus™ instrument (Applied Bio system, Grand Island, NY). .. The quantification of gene expression was determined via the comparative ΔΔCT method.

    Article Title: Hepatitis A virus infections and outbreaks in asylum seekers arriving to Germany, September 2015 to March 2016
    Article Snippet: Thermal cycling was performed on a StepOnePlus instrument (Applied Biosystems) and comprised a 10-min initial enzyme activation step at 95 °C, and 45 cycles of 95 °C for 15 s and 60 °C for 1 min. RT-qPCR-positive samples were further characterized by amplicon sequencing. .. A 2.5 μL aliquot from the first round of PCR was then used as a template in the second round of PCR with primers HAV 8.2, 5′-GGA TTG GTT TCC ATT CAR ATT GCN AAY TA-3′ and HAV 11, 5′-CTG CCA GTC AGA ACT CCR GCW TCC ATY TC-3′ (518 nt).

    Sequencing:

    Article Title: Exogenous oxidants activate nuclear factor kappa B through Toll-like receptor 4 stimulation to maintain inflammatory phenotype in macrophage
    Article Snippet: Single-stranded cDNA was synthesized from total RNA with the reverse transcription kit using StepOnePlus™ instrument (Life technologies, PA, USA). .. The primer sequences that were used for TLR4 (NCBI Reference Sequence: ) are: forward primer (FP): 5′-AAC CAG CTG TAT TCC CTC AGC ACT-3′; reverse primer (RP): 5′-ACT GCT TCT GTT CCT TGA CCC ACT-3′.

    Article Title: Hepatitis A virus infections and outbreaks in asylum seekers arriving to Germany, September 2015 to March 2016
    Article Snippet: .. Thermal cycling was performed on a StepOnePlus instrument (Applied Biosystems) and comprised a 10-min initial enzyme activation step at 95 °C, and 45 cycles of 95 °C for 15 s and 60 °C for 1 min. RT-qPCR-positive samples were further characterized by amplicon sequencing. .. The amplification was performed according to the unified HAV Net protocol ( http://www.rivm.nl/en/Topics/H/HAVNET ) by using specific primers for the HAV VP1/P2A genomic region (HAV 6.1, 5′-TAT GCY ITI TCW GGI GCI YTR GAY GG-3′ HAV 10, 5′-TCY TTC ATY TCW GTC CAY TTY TCA TCA TT-3′, 614 nt).

    DNA Extraction:

    Article Title: Molecular analysis of Idiopathic Subglottic Stenosis for Mycobacterium species
    Article Snippet: DNA Isolation: Genomic DNA was extracted with the Qiagen DNAeasy extraction kit (Qiagen, Valencia, CA) according to the manufacturer's instructions with slight modification as previously described , . .. Human respiratory pathogen qPCR array (Qiagen, Vallencia, CA) was performed as per manufacture's instructions in a StepOnePlus™ instrument (Applied Biosystems® )

    In Vivo:

    Article Title: The Pseudomonas aeruginosa PrrF Small RNAs Regulate Iron Homeostasis during Acute Murine Lung Infection
    Article Snippet: A total of 50 ng/μl of RNA was used to generate cDNA with an ImProm-II cDNA synthesis kit (Promega) as previously described , and cDNA was analyzed using a StepOnePlus instrument (Applied Biosystems) and TaqMan reagents (Life Technologies). .. As the consistency of expression of each of these genes could not be determined in vivo , expression data from lung homogenates were normalized to both oprF and omlA (Fig. S1).

    RNA Sequencing Assay:

    Article Title: Global transcriptome response to ionic liquid by a tropical rain forest soil bacterium, Enterobacter lignolyticus
    Article Snippet: Reactions in a 20-μL volume were run on the StepOnePlus instrument (Applied Biosystems) using PerfeCta SYBR Green SuperMix mix with ROX (Quanta Biosciences) according to the manufacturer’s instructions. .. UbiD decarboxylase gene (Entcl_4195) was used as a reference based on its expression stability across all conditions in the RNA-Seq dataset.

    Fluorescence:

    Article Title: Selection of accurate reference genes in mouse trophoblast stem cells for reverse transcription-quantitative polymerase chain reaction
    Article Snippet: Gene expression was assessed by qPCR on a StepOnePlus™ instrument (Thermo Fisher Scientific) using Quantitect SYBR Green PCR kits (Qiagen) according to the manufacturer’s instructions. .. Raw Cq (Ct) values (PCR cycles at which the fluorescence signal crosses threshold) were calculated using StepOne software (v. 2.1; Thermo Fisher Scientific) setting baseline and appropriate threshold values.

    Isolation:

    Article Title: Mutant p53 prolongs NF-?B activation and promotes chronic inflammation and inflammation-associated colorectal cancer
    Article Snippet: RNA was isolated with a NucleoSpin RNA II kit (Macherey-Nagel). .. Real-time qPCR was performed using SYBR Green Master Mix (Applied Biosystems) in a StepOnePlus instrument (Applied Biosystems).

    Article Title: Detection and localization of viral infection in the pancreas of patients with type 1 diabetes using short fluorescently-labelled oligonucleotide probes
    Article Snippet: Paragraph title: RNA isolation, reverse transcription and real time PCR ... Real time PCRs reactions were prepared according to Applied Biosystems guidelines using SybrGreen assay and performed in a StepOnePlus instrument (Applied Biosystems, Carlsbad, CA, USA).

    Article Title: Antibiotic treatment of rat dams affects bacterial colonization and causes decreased weight gain in pups
    Article Snippet: Total RNA from the homogenized samples was extracted by MagMAX Express (Applied Biosystems) by using the MagMAX-96 RNA Isolation Kit (AM 1830, Ambion) for tissues, following the supplier’s recommendations. .. The cDNA was amplified in duplicate on a StepOnePlus instrument (Applied Biosystems).

    Article Title: Analytical Performance Determination and Clinical Validation of the Novel Roche RealTime Ready Influenza A/H1N1 Detection Set ▿Analytical Performance Determination and Clinical Validation of the Novel Roche RealTime Ready Influenza A/H1N1 Detection Set ▿ †
    Article Snippet: Paragraph title: Nucleic acid isolation and determination of virus stock RNA concentrations. ... Cycling was performed with a StepOnePlus instrument (Applied Biosystems).

    Article Title: Hepatitis A virus infections and outbreaks in asylum seekers arriving to Germany, September 2015 to March 2016
    Article Snippet: Nucleic acid isolation was performed using the RNeasy Mini Kit (Qiagen, Hilden, Germany) with 100 μL elution volume (RNase-free water). .. Thermal cycling was performed on a StepOnePlus instrument (Applied Biosystems) and comprised a 10-min initial enzyme activation step at 95 °C, and 45 cycles of 95 °C for 15 s and 60 °C for 1 min. RT-qPCR-positive samples were further characterized by amplicon sequencing.

    Article Title: Brassinosteroid control of sex determination in maize
    Article Snippet: Paragraph title: RNA Isolation and qRT-PCR. ... All primers showed > 90% efficiency at their indicated concentrations. qRT-PCR was performed as described ( ) by using the StepOnePlus instrument (Applied Biosystems, Invitrogen).

    Purification:

    Article Title: Hepatitis A virus infections and outbreaks in asylum seekers arriving to Germany, September 2015 to March 2016
    Article Snippet: Thermal cycling was performed on a StepOnePlus instrument (Applied Biosystems) and comprised a 10-min initial enzyme activation step at 95 °C, and 45 cycles of 95 °C for 15 s and 60 °C for 1 min. RT-qPCR-positive samples were further characterized by amplicon sequencing. .. The PCR products were purified by using QIAquick columns (Qiagen) and sequenced in both directions with the second-round amplification primers.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Conditioned media from human palatine tonsil mesenchymal stem cells regulates the interaction between myotubes and fibroblasts by IL‐1Ra activity
    Article Snippet: .. RT‐PCR analysis was performed on a StepOnePlus™ instrument (Applied Biosystems, Carlsbad, CA, USA) using SYBR® green (Toyobo). .. Fibronectin (124 bp) was amplified using the primers, 5′‐ATGTGGACCCCTCCTGATAGT‐3′ (forward) and 5′‐GCCCAGTGATTTCAGCAAAGG‐3′ (reverse).

    Article Title: Global transcriptome response to ionic liquid by a tropical rain forest soil bacterium, Enterobacter lignolyticus
    Article Snippet: cDNA was synthesized using the SuperScript III First-Strand Synthesis System for RT-PCR (Invitrogen) according to the manufacturer’s protocol, using random hexamers and a total input of 100 ng of RNA in each reaction. cDNA samples were used at 1:100 final concentration. .. Reactions in a 20-μL volume were run on the StepOnePlus instrument (Applied Biosystems) using PerfeCta SYBR Green SuperMix mix with ROX (Quanta Biosciences) according to the manufacturer’s instructions.

    Staining:

    Article Title: Exogenous oxidants activate nuclear factor kappa B through Toll-like receptor 4 stimulation to maintain inflammatory phenotype in macrophage
    Article Snippet: Single-stranded cDNA was synthesized from total RNA with the reverse transcription kit using StepOnePlus™ instrument (Life technologies, PA, USA). .. The PCR product was resolved on polyacrylamide gel, stained with ethidium bromide, and visualized under UV light.

    Concentration Assay:

    Article Title: Molecular analysis of Idiopathic Subglottic Stenosis for Mycobacterium species
    Article Snippet: The gDNA concentration and quality were confirmed using the Bioanalyzer 2100 system (Agilent, CA, USA). .. Human respiratory pathogen qPCR array (Qiagen, Vallencia, CA) was performed as per manufacture's instructions in a StepOnePlus™ instrument (Applied Biosystems® )

    Article Title: Therapeutic Potential of Mesenchymal Stromal Cells and MSC Conditioned Medium in Amyotrophic Lateral Sclerosis (ALS) - In Vitro Evidence from Primary Motor Neuron Cultures, NSC-34 Cells, Astrocytes and Microglia
    Article Snippet: .. Corresponding to mRNA, cDNA was used at a concentration of 25 ng/µL. qRT-PCR was performed with cDNA from 50 ng total RNA and TaqMan®Fast Universal Master Mix (Applied Biosystems) on a StepOnePlus instrument (Applied Biosystems) under the following standard conditions: 95°C for 20 s, followed by 40 cycles of 95°C for 1 s and 60°C for 20 s. The relative gene expression was calculated via the comparative Ct method as previously described by K. Livak (Applied Biosystems User Bulletin #2, 2001). .. Ct values were normalized to Hrtp1 and used to calculate the relative gene expression using the 2−ΔΔCt method .

    Article Title: Analytical Performance Determination and Clinical Validation of the Novel Roche RealTime Ready Influenza A/H1N1 Detection Set ▿Analytical Performance Determination and Clinical Validation of the Novel Roche RealTime Ready Influenza A/H1N1 Detection Set ▿ †
    Article Snippet: The concentration of influenza A and H1N1/09 virus-specific RNA was determined by analyzing the eluates with two different RT-qPCR assays ( , ). .. Cycling was performed with a StepOnePlus instrument (Applied Biosystems).

    Article Title: Global transcriptome response to ionic liquid by a tropical rain forest soil bacterium, Enterobacter lignolyticus
    Article Snippet: cDNA was synthesized using the SuperScript III First-Strand Synthesis System for RT-PCR (Invitrogen) according to the manufacturer’s protocol, using random hexamers and a total input of 100 ng of RNA in each reaction. cDNA samples were used at 1:100 final concentration. .. Reactions in a 20-μL volume were run on the StepOnePlus instrument (Applied Biosystems) using PerfeCta SYBR Green SuperMix mix with ROX (Quanta Biosciences) according to the manufacturer’s instructions.

    Activated Clotting Time Assay:

    Article Title: Exogenous oxidants activate nuclear factor kappa B through Toll-like receptor 4 stimulation to maintain inflammatory phenotype in macrophage
    Article Snippet: Single-stranded cDNA was synthesized from total RNA with the reverse transcription kit using StepOnePlus™ instrument (Life technologies, PA, USA). .. The primer sequences that were used for TLR4 (NCBI Reference Sequence: ) are: forward primer (FP): 5′-AAC CAG CTG TAT TCC CTC AGC ACT-3′; reverse primer (RP): 5′-ACT GCT TCT GTT CCT TGA CCC ACT-3′.

    Article Title: Hepatitis A virus infections and outbreaks in asylum seekers arriving to Germany, September 2015 to March 2016
    Article Snippet: Thermal cycling was performed on a StepOnePlus instrument (Applied Biosystems) and comprised a 10-min initial enzyme activation step at 95 °C, and 45 cycles of 95 °C for 15 s and 60 °C for 1 min. RT-qPCR-positive samples were further characterized by amplicon sequencing. .. A 2.5 μL aliquot from the first round of PCR was then used as a template in the second round of PCR with primers HAV 8.2, 5′-GGA TTG GTT TCC ATT CAR ATT GCN AAY TA-3′ and HAV 11, 5′-CTG CCA GTC AGA ACT CCR GCW TCC ATY TC-3′ (518 nt).

    Software:

    Article Title: Selection of accurate reference genes in mouse trophoblast stem cells for reverse transcription-quantitative polymerase chain reaction
    Article Snippet: Gene expression was assessed by qPCR on a StepOnePlus™ instrument (Thermo Fisher Scientific) using Quantitect SYBR Green PCR kits (Qiagen) according to the manufacturer’s instructions. .. Raw Cq (Ct) values (PCR cycles at which the fluorescence signal crosses threshold) were calculated using StepOne software (v. 2.1; Thermo Fisher Scientific) setting baseline and appropriate threshold values.

    Article Title: Brassinosteroid control of sex determination in maize
    Article Snippet: MOLYBDENUM COFACTOR BIOSYNTHESIS protein (MOL, GRMZM2G067176) was used as internal control ( ). na1 -specific primers Na1FOR3 5′-AGGCTGAGTTTGCCCATGTT-3′ (300 nM) and Na1REV3 5′-GCAGTCTCGCGCAGCTAATC-3′ (500 nM) and Mol -specific primers MolFOR2 5′-CTGTGTCCTCCGTGCTCCAT-3′ (500 nM) and MolREV2 5′-AGGACTCCCGCATCTCCATA-3′ (500 nM) were designed by using PRIMEREXPRESS software (Applied Biosystems, Invitrogen). .. All primers showed > 90% efficiency at their indicated concentrations. qRT-PCR was performed as described ( ) by using the StepOnePlus instrument (Applied Biosystems, Invitrogen).

    Real-time Polymerase Chain Reaction:

    Article Title: Molecular analysis of Idiopathic Subglottic Stenosis for Mycobacterium species
    Article Snippet: .. Human respiratory pathogen qPCR array (Qiagen, Vallencia, CA) was performed as per manufacture's instructions in a StepOnePlus™ instrument (Applied Biosystems® ) .. Paraffin embedded iSGS and iLTS airway stenosis tissues and healthy controls (US Biomax Inc. product# RS321), were pretreated and probed for Gyrase A (Advanced Cell Diagnostics #436701) following a modified RNAscope® 2.0 Assay's HD Detection Kit (Red) protocol .

    Article Title: Mutant p53 prolongs NF-?B activation and promotes chronic inflammation and inflammation-associated colorectal cancer
    Article Snippet: .. Real-time qPCR was performed using SYBR Green Master Mix (Applied Biosystems) in a StepOnePlus instrument (Applied Biosystems). .. The primers used for qPCR are listed in the supplementary section of the Experimental Procedures.

    Article Title: Detection and localization of viral infection in the pancreas of patients with type 1 diabetes using short fluorescently-labelled oligonucleotide probes
    Article Snippet: Paragraph title: RNA isolation, reverse transcription and real time PCR ... Real time PCRs reactions were prepared according to Applied Biosystems guidelines using SybrGreen assay and performed in a StepOnePlus instrument (Applied Biosystems, Carlsbad, CA, USA).

    Article Title: Exogenous oxidants activate nuclear factor kappa B through Toll-like receptor 4 stimulation to maintain inflammatory phenotype in macrophage
    Article Snippet: Paragraph title: 2.5 Expression of TLR4 in RAW-Blue cells, RNA extraction and real time PCR ... Single-stranded cDNA was synthesized from total RNA with the reverse transcription kit using StepOnePlus™ instrument (Life technologies, PA, USA).

    Article Title: Therapeutic Potential of Mesenchymal Stromal Cells and MSC Conditioned Medium in Amyotrophic Lateral Sclerosis (ALS) - In Vitro Evidence from Primary Motor Neuron Cultures, NSC-34 Cells, Astrocytes and Microglia
    Article Snippet: Paragraph title: Quantitative Real-time Polymerase Chain Reaction (qRT-PCR) ... Corresponding to mRNA, cDNA was used at a concentration of 25 ng/µL. qRT-PCR was performed with cDNA from 50 ng total RNA and TaqMan®Fast Universal Master Mix (Applied Biosystems) on a StepOnePlus instrument (Applied Biosystems) under the following standard conditions: 95°C for 20 s, followed by 40 cycles of 95°C for 1 s and 60°C for 20 s. The relative gene expression was calculated via the comparative Ct method as previously described by K. Livak (Applied Biosystems User Bulletin #2, 2001).

    Article Title: Antibiotic treatment of rat dams affects bacterial colonization and causes decreased weight gain in pups
    Article Snippet: The resulting cDNA was used as template for the qPCR reaction. .. The cDNA was amplified in duplicate on a StepOnePlus instrument (Applied Biosystems).

    Article Title: Selection of accurate reference genes in mouse trophoblast stem cells for reverse transcription-quantitative polymerase chain reaction
    Article Snippet: .. Gene expression was assessed by qPCR on a StepOnePlus™ instrument (Thermo Fisher Scientific) using Quantitect SYBR Green PCR kits (Qiagen) according to the manufacturer’s instructions. ..

    Article Title: Temporal retinal transcriptome and systems biology analysis identifies key pathways and hub genes in Staphylococcus aureus endophthalmitis
    Article Snippet: Paragraph title: RNA extraction and real time PCR analysis ... PCR was performed using a StepOnePlus™ instrument (Applied Bio system, Grand Island, NY).

    Article Title: Hepatitis A virus infections and outbreaks in asylum seekers arriving to Germany, September 2015 to March 2016
    Article Snippet: Primers and probe for the HAV reverse transcription quantitative real-time PCR (RT-qPCR) assay were in the viral polymerase gene region (SH-Poly-A, SH-Poly-1 and SH-Poly-Q ). .. Thermal cycling was performed on a StepOnePlus instrument (Applied Biosystems) and comprised a 10-min initial enzyme activation step at 95 °C, and 45 cycles of 95 °C for 15 s and 60 °C for 1 min. RT-qPCR-positive samples were further characterized by amplicon sequencing.

    Article Title: The Pseudomonas aeruginosa PrrF Small RNAs Regulate Iron Homeostasis during Acute Murine Lung Infection
    Article Snippet: Paragraph title: Real-time PCR. ... A total of 50 ng/μl of RNA was used to generate cDNA with an ImProm-II cDNA synthesis kit (Promega) as previously described , and cDNA was analyzed using a StepOnePlus instrument (Applied Biosystems) and TaqMan reagents (Life Technologies).

    RNA Extraction:

    Article Title: Exogenous oxidants activate nuclear factor kappa B through Toll-like receptor 4 stimulation to maintain inflammatory phenotype in macrophage
    Article Snippet: Paragraph title: 2.5 Expression of TLR4 in RAW-Blue cells, RNA extraction and real time PCR ... Single-stranded cDNA was synthesized from total RNA with the reverse transcription kit using StepOnePlus™ instrument (Life technologies, PA, USA).

    Article Title: Temporal retinal transcriptome and systems biology analysis identifies key pathways and hub genes in Staphylococcus aureus endophthalmitis
    Article Snippet: Paragraph title: RNA extraction and real time PCR analysis ... PCR was performed using a StepOnePlus™ instrument (Applied Bio system, Grand Island, NY).

    Article Title: The Pseudomonas aeruginosa PrrF Small RNAs Regulate Iron Homeostasis during Acute Murine Lung Infection
    Article Snippet: Microaerobic cultures were treated with RNAlater (Sigma) prior to RNA extraction. .. A total of 50 ng/μl of RNA was used to generate cDNA with an ImProm-II cDNA synthesis kit (Promega) as previously described , and cDNA was analyzed using a StepOnePlus instrument (Applied Biosystems) and TaqMan reagents (Life Technologies).

    Selection:

    Article Title: The host Integrator complex acts in transcription-independent maturation of herpesvirus microRNA 3′ ends
    Article Snippet: Next, using a StepOnePlus instrument (Applied Biosystems), the cDNA was analyzed by RT-qPCR in technical triplicates using FastStart Universal SYBR Green Master (Rox) master mix (Roche) and primers for pre-GAPDH and pre-U1 ( ) and for pri-miR-HSUR4 (forward, 5′-CCGTGTTGCTACAGCTATAAACTTC-3′; reverse, 5′-ATTACATCCTCTTCCTGTGTAATGTTTGAG-3′). .. The enrichment value for the RNA selected by anti-Flag antibodies was normalized to the control selection by IgG.

    In Vitro:

    Article Title: Analytical Performance Determination and Clinical Validation of the Novel Roche RealTime Ready Influenza A/H1N1 Detection Set ▿Analytical Performance Determination and Clinical Validation of the Novel Roche RealTime Ready Influenza A/H1N1 Detection Set ▿ †
    Article Snippet: Cycling was performed with a StepOnePlus instrument (Applied Biosystems). .. PCR standard curves for the absolute quantification of viral RNA were obtained by reverse transcription and amplification of a series of defined amounts of precharacterized, in vitro -transcribed, and assay-specific RNA transcript standards generated as previously described ( ).

    Incubation:

    Article Title: The host Integrator complex acts in transcription-independent maturation of herpesvirus microRNA 3′ ends
    Article Snippet: Cross-links were reversed by incubation for 45 min at 70°C. .. Next, using a StepOnePlus instrument (Applied Biosystems), the cDNA was analyzed by RT-qPCR in technical triplicates using FastStart Universal SYBR Green Master (Rox) master mix (Roche) and primers for pre-GAPDH and pre-U1 ( ) and for pri-miR-HSUR4 (forward, 5′-CCGTGTTGCTACAGCTATAAACTTC-3′; reverse, 5′-ATTACATCCTCTTCCTGTGTAATGTTTGAG-3′).

    Produced:

    Article Title: Antibiotic treatment of rat dams affects bacterial colonization and causes decreased weight gain in pups
    Article Snippet: Next, cDNA was produced from ∼500 ng of total RNA by using the High-Capacity cDNA Reverse Transcriptase Kit (Applied Biosystems, Foster City, CA, USA) according to the manufacturer's recommendations. .. The cDNA was amplified in duplicate on a StepOnePlus instrument (Applied Biosystems).

    Article Title: The Pseudomonas aeruginosa PrrF Small RNAs Regulate Iron Homeostasis during Acute Murine Lung Infection
    Article Snippet: A total of 50 ng/μl of RNA was used to generate cDNA with an ImProm-II cDNA synthesis kit (Promega) as previously described , and cDNA was analyzed using a StepOnePlus instrument (Applied Biosystems) and TaqMan reagents (Life Technologies). .. Standard curves were produced for each primer-probe set listed in Table S1 in the supplemental material by analyzing cDNA generated from serial dilutions of RNA and used to determine relative amounts of the RNAs, as described previously ( ).

    Activation Assay:

    Article Title: Hepatitis A virus infections and outbreaks in asylum seekers arriving to Germany, September 2015 to March 2016
    Article Snippet: .. Thermal cycling was performed on a StepOnePlus instrument (Applied Biosystems) and comprised a 10-min initial enzyme activation step at 95 °C, and 45 cycles of 95 °C for 15 s and 60 °C for 1 min. RT-qPCR-positive samples were further characterized by amplicon sequencing. .. The amplification was performed according to the unified HAV Net protocol ( http://www.rivm.nl/en/Topics/H/HAVNET ) by using specific primers for the HAV VP1/P2A genomic region (HAV 6.1, 5′-TAT GCY ITI TCW GGI GCI YTR GAY GG-3′ HAV 10, 5′-TCY TTC ATY TCW GTC CAY TTY TCA TCA TT-3′, 614 nt).

    CTG Assay:

    Article Title: Exogenous oxidants activate nuclear factor kappa B through Toll-like receptor 4 stimulation to maintain inflammatory phenotype in macrophage
    Article Snippet: Single-stranded cDNA was synthesized from total RNA with the reverse transcription kit using StepOnePlus™ instrument (Life technologies, PA, USA). .. The primer sequences that were used for TLR4 (NCBI Reference Sequence: ) are: forward primer (FP): 5′-AAC CAG CTG TAT TCC CTC AGC ACT-3′; reverse primer (RP): 5′-ACT GCT TCT GTT CCT TGA CCC ACT-3′.

    Lysis:

    Article Title: Antibiotic treatment of rat dams affects bacterial colonization and causes decreased weight gain in pups
    Article Snippet: Gene expression analysis Approximately 1 cm of colon tissue from dissected animals (D4W, P2W, P4W and P14W), stored in RNAlater® (Life Technologies) at −80 °C, was homogenized in lysis buffer (MagMAX-96 RNA Isolation Kit; Ambion, Austin, TX) with glass beads using a FastPrep instrument (FP120, Bio 101, Thermo Savant; Qbiogene). .. The cDNA was amplified in duplicate on a StepOnePlus instrument (Applied Biosystems).

    Article Title: Analytical Performance Determination and Clinical Validation of the Novel Roche RealTime Ready Influenza A/H1N1 Detection Set ▿Analytical Performance Determination and Clinical Validation of the Novel Roche RealTime Ready Influenza A/H1N1 Detection Set ▿ †
    Article Snippet: To determine the concentration of the specific viral RNA contained in the spiked solutions, 200 μl of the solutions Sw1-1, -2, and -3 and InfA1-1, -2, and -3 was added to 300 μl lysis buffer and mixed well under safety cabinets before starting automated nucleic acid isolation. .. Cycling was performed with a StepOnePlus instrument (Applied Biosystems).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Thermo Fisher steponeplus real time system
    p21-/- attenuates the antiproliferative effects of AzaC (a) p21 mRNA is significantly upregulated in CD4+ and CD8+ Teff following treatment with AzaC. Teffs were isolated from the spleens of B6. Foxp3 GFP × B6.CAG DSRED and nTregs were isolated from B6. Foxp3 GFP . Cells were co-cultured at a 1:10 ratio of nTregs to Teffs for 2 days in the presence of anti-CD3/CD28 beads (bead:cell 1:1; Invitrogen) and Xcyte medium supplemented with L-glutamine (4 mM), penicillin (100 U/mL), streptomycin (100 μg/mL), and human recombinant IL-2 (hIL-2; 500 U/mL). The activated T cells were cultured with AzaC (1 μM) or PBS for an additional 2 days. Cells were sorted using FACS Aria II (BD) to isolate nTregs (CD4+DSRED-FOXP3GFP+), CD4+ Teffs (CD4+DSRed+FOXP3GFP-), and CD8+ Teffs (CD8+DSRed+FOXP3GFP-) prior to RNA extraction. QPCR was performed on the Applied Biosystems <t>StepOnePlus</t> Real-Time System using pre-designed TaqMan® Gene Expression Assays (18S RNA Mm03928990 and p21 Mm04205640). Relative fold changes in expression were determined using the ΔΔCT method. AzaC treatment resulted in a 3.4 fold increase of p21 expression in CD4+ Teffs (FACS sorted to remove AzaC converted Tregs) (AzaC vs. PBS p
    Steponeplus Real Time System, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 3228 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/steponeplus real time system/product/Thermo Fisher
    Average 90 stars, based on 3228 article reviews
    Price from $9.99 to $1999.99
    steponeplus real time system - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    99
    Thermo Fisher steponeplus device
    p21-/- attenuates the antiproliferative effects of AzaC (a) p21 mRNA is significantly upregulated in CD4+ and CD8+ Teff following treatment with AzaC. Teffs were isolated from the spleens of B6. Foxp3 GFP × B6.CAG DSRED and nTregs were isolated from B6. Foxp3 GFP . Cells were co-cultured at a 1:10 ratio of nTregs to Teffs for 2 days in the presence of anti-CD3/CD28 beads (bead:cell 1:1; Invitrogen) and Xcyte medium supplemented with L-glutamine (4 mM), penicillin (100 U/mL), streptomycin (100 μg/mL), and human recombinant IL-2 (hIL-2; 500 U/mL). The activated T cells were cultured with AzaC (1 μM) or PBS for an additional 2 days. Cells were sorted using FACS Aria II (BD) to isolate nTregs (CD4+DSRED-FOXP3GFP+), CD4+ Teffs (CD4+DSRed+FOXP3GFP-), and CD8+ Teffs (CD8+DSRed+FOXP3GFP-) prior to RNA extraction. QPCR was performed on the Applied Biosystems <t>StepOnePlus</t> Real-Time System using pre-designed TaqMan® Gene Expression Assays (18S RNA Mm03928990 and p21 Mm04205640). Relative fold changes in expression were determined using the ΔΔCT method. AzaC treatment resulted in a 3.4 fold increase of p21 expression in CD4+ Teffs (FACS sorted to remove AzaC converted Tregs) (AzaC vs. PBS p
    Steponeplus Device, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 22 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/steponeplus device/product/Thermo Fisher
    Average 99 stars, based on 22 article reviews
    Price from $9.99 to $1999.99
    steponeplus device - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher steponeplus instrument
    p21-/- attenuates the antiproliferative effects of AzaC (a) p21 mRNA is significantly upregulated in CD4+ and CD8+ Teff following treatment with AzaC. Teffs were isolated from the spleens of B6. Foxp3 GFP × B6.CAG DSRED and nTregs were isolated from B6. Foxp3 GFP . Cells were co-cultured at a 1:10 ratio of nTregs to Teffs for 2 days in the presence of anti-CD3/CD28 beads (bead:cell 1:1; Invitrogen) and Xcyte medium supplemented with L-glutamine (4 mM), penicillin (100 U/mL), streptomycin (100 μg/mL), and human recombinant IL-2 (hIL-2; 500 U/mL). The activated T cells were cultured with AzaC (1 μM) or PBS for an additional 2 days. Cells were sorted using FACS Aria II (BD) to isolate nTregs (CD4+DSRED-FOXP3GFP+), CD4+ Teffs (CD4+DSRed+FOXP3GFP-), and CD8+ Teffs (CD8+DSRed+FOXP3GFP-) prior to RNA extraction. QPCR was performed on the Applied Biosystems <t>StepOnePlus</t> Real-Time System using pre-designed TaqMan® Gene Expression Assays (18S RNA Mm03928990 and p21 Mm04205640). Relative fold changes in expression were determined using the ΔΔCT method. AzaC treatment resulted in a 3.4 fold increase of p21 expression in CD4+ Teffs (FACS sorted to remove AzaC converted Tregs) (AzaC vs. PBS p
    Steponeplus Instrument, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 240 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/steponeplus instrument/product/Thermo Fisher
    Average 99 stars, based on 240 article reviews
    Price from $9.99 to $1999.99
    steponeplus instrument - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    Image Search Results


    p21-/- attenuates the antiproliferative effects of AzaC (a) p21 mRNA is significantly upregulated in CD4+ and CD8+ Teff following treatment with AzaC. Teffs were isolated from the spleens of B6. Foxp3 GFP × B6.CAG DSRED and nTregs were isolated from B6. Foxp3 GFP . Cells were co-cultured at a 1:10 ratio of nTregs to Teffs for 2 days in the presence of anti-CD3/CD28 beads (bead:cell 1:1; Invitrogen) and Xcyte medium supplemented with L-glutamine (4 mM), penicillin (100 U/mL), streptomycin (100 μg/mL), and human recombinant IL-2 (hIL-2; 500 U/mL). The activated T cells were cultured with AzaC (1 μM) or PBS for an additional 2 days. Cells were sorted using FACS Aria II (BD) to isolate nTregs (CD4+DSRED-FOXP3GFP+), CD4+ Teffs (CD4+DSRed+FOXP3GFP-), and CD8+ Teffs (CD8+DSRed+FOXP3GFP-) prior to RNA extraction. QPCR was performed on the Applied Biosystems StepOnePlus Real-Time System using pre-designed TaqMan® Gene Expression Assays (18S RNA Mm03928990 and p21 Mm04205640). Relative fold changes in expression were determined using the ΔΔCT method. AzaC treatment resulted in a 3.4 fold increase of p21 expression in CD4+ Teffs (FACS sorted to remove AzaC converted Tregs) (AzaC vs. PBS p

    Journal: Journal of immunology (Baltimore, Md. : 1950)

    Article Title: Azacitidine mitigates GvHD via differential effects on the proliferation of T effectors and nTregs in vivo

    doi: 10.4049/jimmunol.1502399

    Figure Lengend Snippet: p21-/- attenuates the antiproliferative effects of AzaC (a) p21 mRNA is significantly upregulated in CD4+ and CD8+ Teff following treatment with AzaC. Teffs were isolated from the spleens of B6. Foxp3 GFP × B6.CAG DSRED and nTregs were isolated from B6. Foxp3 GFP . Cells were co-cultured at a 1:10 ratio of nTregs to Teffs for 2 days in the presence of anti-CD3/CD28 beads (bead:cell 1:1; Invitrogen) and Xcyte medium supplemented with L-glutamine (4 mM), penicillin (100 U/mL), streptomycin (100 μg/mL), and human recombinant IL-2 (hIL-2; 500 U/mL). The activated T cells were cultured with AzaC (1 μM) or PBS for an additional 2 days. Cells were sorted using FACS Aria II (BD) to isolate nTregs (CD4+DSRED-FOXP3GFP+), CD4+ Teffs (CD4+DSRed+FOXP3GFP-), and CD8+ Teffs (CD8+DSRed+FOXP3GFP-) prior to RNA extraction. QPCR was performed on the Applied Biosystems StepOnePlus Real-Time System using pre-designed TaqMan® Gene Expression Assays (18S RNA Mm03928990 and p21 Mm04205640). Relative fold changes in expression were determined using the ΔΔCT method. AzaC treatment resulted in a 3.4 fold increase of p21 expression in CD4+ Teffs (FACS sorted to remove AzaC converted Tregs) (AzaC vs. PBS p

    Article Snippet: QPCR was performed on the Applied Biosystems StepOnePlus Real-Time System (Thermo fisher) using pre-designed TaqMan® Gene Expression Assays (Life Technologies) (18S RNA Mm03928990 and p21 Mm04205640) according to manufacturer's instructions.

    Techniques: Isolation, Cell Culture, Recombinant, FACS, RNA Extraction, Real-time Polymerase Chain Reaction, Expressing