stepone real time pcr system  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Thermo Fisher stepone real time pcr system
    Stepone Real Time Pcr System, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 2402 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/stepone real time pcr system/product/Thermo Fisher
    Average 99 stars, based on 2402 article reviews
    Price from $9.99 to $1999.99
    stepone real time pcr system - by Bioz Stars, 2020-04
    99/100 stars

    Images

    Related Articles

    Real-time Polymerase Chain Reaction:

    Article Title: Transcriptomic analysis and novel insights into lens fibre cell differentiation regulated by Gata3
    Article Snippet: .. The cDNA was diluted 15-fold and qPCR was performed using the StepOne Real-Time PCR System (Thermo Fisher Scientific, USA) and the Power SYBR Green Master mix (Thermo Fisher, USA) in 96-well plates. .. The relative gene expression was normalized using B2M, HMBS and SHDA reference genes.

    Article Title: Virucidal Activity of Gold Nanoparticles Synthesized by Green Chemistry Using Garlic Extract
    Article Snippet: .. The real-time PCR was carried out using PowerUp™ SYBR™ Green Master Mix (Applied Biosystems, Beverly, MA, USA) and the Applied Biosystems StepOne Real Time PCR System following procedures: 95 °C for 2 min, followed by 40 cycles of 95 °C for 2 s, 60 °C for 10 s, and 72 °C for 20 s. The number of viral copies was calculated by using a standard curve. ..

    Article Title: Temporally defined neocortical translation and polysome assembly are determined by the RNA-binding protein Hu antigen R
    Article Snippet: .. RNA was isolated from sucrose gradient fractions by using TRIzol-LS (Life Technologies; no. 10296028) following the manufacturer’s protocol. qRT-PCR was performed in 10-μL reactions (equivalent fraction volumes, duplicate technical replicates for each reaction) by using the Applied Biosystems StepOne Real-Time PCR system with Step-one software (Version 2.1; no. 4376373) and the RNA-Ct 1-Step Taqman kit (no. 4392653) with Taqman probes (see for catalog numbers). .. For each probe, n ≥ 4 neocortices were analyzed in n ≥ 2 fractionations, resulting in n ≥ 4 qRT-PCR technical replicates.

    Article Title: Pancreatic stellate cell-potentiated insulin secretion from Min6 cells is independent of interleukin 6-mediated pathway.
    Article Snippet: .. Pancreatic stellate cells (PSCs) secrete various factors, which can influence the β-cell function. .. Pancreatic stellate cells (PSCs) secrete various factors, which can influence the β-cell function.

    Article Title: lncRNA SNHG5 Modulates Endometrial Cancer Progression via the miR-25-3p/BTG2 Axis
    Article Snippet: .. Reverse transcription for miRNA detection was performed using special primers ( ). qRT-PCR was performed using SYBR Green PCR Kit (Takara Bio, Otsu, Japan) with the primers listed in in a StepOne Real-Time PCR System (Thermo Fisher Scientific). .. The expression of specific genes was normalized to that of GAPDH or 18S rRNA, and U6 snRNA was used as an endogenous control to evaluate the expression of miRNAs.

    Article Title: Renalase Attenuates Mouse Fatty Liver Ischemia/Reperfusion Injury through Mitigating Oxidative Stress and Mitochondrial Damage via Activating SIRT1
    Article Snippet: .. Real-time PCR was performed via the Applied Biosystems StepOne Real-Time PCR system using ChamQ™ SYBR® qPCR Master Mix (High ROX Premixed) containing 5 ng cDNA and 10 pM of each primer. .. The cycling conditions consisted of one cycle at 95°C for 30 sec, 40 cycles at 95°C for 10 sec, and 60°C for 30 sec. A melting curve analysis was conducted for each PCR to confirm the specificity of amplification.

    Article Title: Further Evidence for in Utero Transmission of Equine Hepacivirus to Foals
    Article Snippet: .. Quantitative RT-PCR was performed with One Step Prime Script RT-PCR kit (Takara, Ozyme, France) according to the manufacturer’s instructions and adapted from Burbelo et al. [ ] on a StepOne™ Real-Time PCR system (Life Technologies, Saint-Aubin, France) [ ]. .. Quantitative RT-PCR were performed with primers Qanti-5UF1, Qanti-5UR1, and probe 5’-FAM-CCACGAAGGAAGGCGGGGGC-BHQ1-3’ [ ] and with a second pair of primers (Sau5UF 5’-TCGAGGGAGCTGRAATTCGT-3’, Sau5UR 5’-GCCCTCGCAAGCATCCTATC-3’), as previously described [ ].

    Article Title: The Blue-Light Photoreceptor Sfwc-1 Gene Regulates the Phototropic Response and Fruiting-Body Development in the Homothallic Ascomycete Sordaria fimicola
    Article Snippet: .. The quantification of gene expression was conducted by the StepOne real-time PCR system (Thermo Fisher Scientific, USA). .. Real-time PCRs were performed as follows: 12.5 µl of 2× FAST SYBR green PCR master mix, 1 µl of 2.5 µM each primer, and 5 µl of 1 ng/µl cDNA template in total volume of 25 µl.

    Article Title: Adipose-Derived Stem Cells from Systemic Sclerosis Patients Maintain Pro-Angiogenic and Antifibrotic Paracrine Effects In Vitro
    Article Snippet: .. Real-time PCR amplification was performed using Taqman Fast Advanced Master Mix (Applied Biosystems) with pre-designed primers (Applied Biosystems) on a StepOne Real-Time PCR System (Applied Biosystems). .. The cycling conditions were as follows: 2 min at 50 °C (uracil-N-glycosylase (UNG) incubation), 2 min at 95 °C (polymerase activation), 40 cycles of 1 s at 95 °C (denaturation), and 20 s at 60 °C (annealing/elongation).

    Article Title: PiggyBac-modified CD19-expressing 4T1 cell line for the evaluation of CAR construct
    Article Snippet: .. To further investigate the expression level of CD19 and IL-2, qPCR was conducted through a StepOne™ Real-Time PCR system (Applied Biosystems). .. RNA was extracted with RNAsimple Total RNA Kit (TianGen, China) and reverse transcribed with HiScript Q RT SuperMix (Vazyme, China).

    RNA Extraction:

    Article Title: Pancreatic stellate cell-potentiated insulin secretion from Min6 cells is independent of interleukin 6-mediated pathway.
    Article Snippet: Paragraph title: 2.7 | RNA extraction, Reverse‐ transcription PCR and qPCR ... Pancreatic stellate cells (PSCs) secrete various factors, which can influence the β-cell function.

    Article Title: lncRNA SNHG5 Modulates Endometrial Cancer Progression via the miR-25-3p/BTG2 Axis
    Article Snippet: Paragraph title: 2.3. RNA Extraction and Real-Time Quantitative PCR ... Reverse transcription for miRNA detection was performed using special primers ( ). qRT-PCR was performed using SYBR Green PCR Kit (Takara Bio, Otsu, Japan) with the primers listed in in a StepOne Real-Time PCR System (Thermo Fisher Scientific).

    Article Title: The Blue-Light Photoreceptor Sfwc-1 Gene Regulates the Phototropic Response and Fruiting-Body Development in the Homothallic Ascomycete Sordaria fimicola
    Article Snippet: Paragraph title: RNA extraction for gene expression studies. ... The quantification of gene expression was conducted by the StepOne real-time PCR system (Thermo Fisher Scientific, USA).

    Amplification:

    Article Title: Virucidal Activity of Gold Nanoparticles Synthesized by Green Chemistry Using Garlic Extract
    Article Snippet: Reverse transcription was carried out using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Beverly, MA, USA) and the viral genome was amplified with the specific primers: MeVF: 5′ GAGGGTCAAACAGAGTCGAG 3′, MeVR: 5′ CGGTTGGAAGATGGGCAG 3′ that amplified a 95 nt fragment [ ]. .. The real-time PCR was carried out using PowerUp™ SYBR™ Green Master Mix (Applied Biosystems, Beverly, MA, USA) and the Applied Biosystems StepOne Real Time PCR System following procedures: 95 °C for 2 min, followed by 40 cycles of 95 °C for 2 s, 60 °C for 10 s, and 72 °C for 20 s. The number of viral copies was calculated by using a standard curve.

    Article Title: Pancreatic stellate cell-potentiated insulin secretion from Min6 cells is independent of interleukin 6-mediated pathway.
    Article Snippet: Pancreatic stellate cells (PSCs) secrete various factors, which can influence the β-cell function. .. Pancreatic stellate cells (PSCs) secrete various factors, which can influence the β-cell function.

    Article Title: Renalase Attenuates Mouse Fatty Liver Ischemia/Reperfusion Injury through Mitigating Oxidative Stress and Mitochondrial Damage via Activating SIRT1
    Article Snippet: Real-time PCR was performed via the Applied Biosystems StepOne Real-Time PCR system using ChamQ™ SYBR® qPCR Master Mix (High ROX Premixed) containing 5 ng cDNA and 10 pM of each primer. .. The cycling conditions consisted of one cycle at 95°C for 30 sec, 40 cycles at 95°C for 10 sec, and 60°C for 30 sec. A melting curve analysis was conducted for each PCR to confirm the specificity of amplification.

    Article Title: Adipose-Derived Stem Cells from Systemic Sclerosis Patients Maintain Pro-Angiogenic and Antifibrotic Paracrine Effects In Vitro
    Article Snippet: .. Real-time PCR amplification was performed using Taqman Fast Advanced Master Mix (Applied Biosystems) with pre-designed primers (Applied Biosystems) on a StepOne Real-Time PCR System (Applied Biosystems). .. The cycling conditions were as follows: 2 min at 50 °C (uracil-N-glycosylase (UNG) incubation), 2 min at 95 °C (polymerase activation), 40 cycles of 1 s at 95 °C (denaturation), and 20 s at 60 °C (annealing/elongation).

    Fluorescence:

    Article Title: Further Evidence for in Utero Transmission of Equine Hepacivirus to Foals
    Article Snippet: Quantitative RT-PCR was performed with One Step Prime Script RT-PCR kit (Takara, Ozyme, France) according to the manufacturer’s instructions and adapted from Burbelo et al. [ ] on a StepOne™ Real-Time PCR system (Life Technologies, Saint-Aubin, France) [ ]. .. Thermal cycling proceeded at 42 °C for 5 min, 95 °C for 10 s, followed by 45 cycles: 95 °C for 5 s and 60 °C for 34 s. Fluorescence was measured at the end of each annealing/elongation step (60 °C).

    Activation Assay:

    Article Title: Adipose-Derived Stem Cells from Systemic Sclerosis Patients Maintain Pro-Angiogenic and Antifibrotic Paracrine Effects In Vitro
    Article Snippet: Real-time PCR amplification was performed using Taqman Fast Advanced Master Mix (Applied Biosystems) with pre-designed primers (Applied Biosystems) on a StepOne Real-Time PCR System (Applied Biosystems). .. The cycling conditions were as follows: 2 min at 50 °C (uracil-N-glycosylase (UNG) incubation), 2 min at 95 °C (polymerase activation), 40 cycles of 1 s at 95 °C (denaturation), and 20 s at 60 °C (annealing/elongation).

    Mutagenesis:

    Article Title: Transcriptomic analysis and novel insights into lens fibre cell differentiation regulated by Gata3
    Article Snippet: Quantitative RT-PCR validation RNA from independent pools of control and mutant lenses was extracted using the RNeasy Micro Kit with on-column DNase digestion (Qiagen). .. The cDNA was diluted 15-fold and qPCR was performed using the StepOne Real-Time PCR System (Thermo Fisher Scientific, USA) and the Power SYBR Green Master mix (Thermo Fisher, USA) in 96-well plates.

    Isolation:

    Article Title: Virucidal Activity of Gold Nanoparticles Synthesized by Green Chemistry Using Garlic Extract
    Article Snippet: RT-qPCR Quantitative Real-Time PCR was performed, total RNA was isolated from treated Vero cells using TRIzol™ Reagent Invitrogen™ (Thermo Fisher Scientific, Bedford, MA, USA). .. The real-time PCR was carried out using PowerUp™ SYBR™ Green Master Mix (Applied Biosystems, Beverly, MA, USA) and the Applied Biosystems StepOne Real Time PCR System following procedures: 95 °C for 2 min, followed by 40 cycles of 95 °C for 2 s, 60 °C for 10 s, and 72 °C for 20 s. The number of viral copies was calculated by using a standard curve.

    Article Title: Temporally defined neocortical translation and polysome assembly are determined by the RNA-binding protein Hu antigen R
    Article Snippet: .. RNA was isolated from sucrose gradient fractions by using TRIzol-LS (Life Technologies; no. 10296028) following the manufacturer’s protocol. qRT-PCR was performed in 10-μL reactions (equivalent fraction volumes, duplicate technical replicates for each reaction) by using the Applied Biosystems StepOne Real-Time PCR system with Step-one software (Version 2.1; no. 4376373) and the RNA-Ct 1-Step Taqman kit (no. 4392653) with Taqman probes (see for catalog numbers). .. For each probe, n ≥ 4 neocortices were analyzed in n ≥ 2 fractionations, resulting in n ≥ 4 qRT-PCR technical replicates.

    Article Title: lncRNA SNHG5 Modulates Endometrial Cancer Progression via the miR-25-3p/BTG2 Axis
    Article Snippet: RNA Extraction and Real-Time Quantitative PCR Total RNA was isolated from cells or tissues using the TRIzol reagent (Thermo Fisher Scientific) and then was reverse transcribed to cDNA using Moloney murine leukemia virus reverse transcriptase (Promega, Madison, WI, USA) following the manufacturer's instructions. .. Reverse transcription for miRNA detection was performed using special primers ( ). qRT-PCR was performed using SYBR Green PCR Kit (Takara Bio, Otsu, Japan) with the primers listed in in a StepOne Real-Time PCR System (Thermo Fisher Scientific).

    Article Title: Pancreatic stellate cell-potentiated insulin secretion from Min6 cells is independent of interleukin 6-mediated pathway.
    Article Snippet: Paragraph title: 2.8 | MicroRNA isolation, RT‐PCR, and qPCR ... Pancreatic stellate cells (PSCs) secrete various factors, which can influence the β-cell function.

    Article Title: The Blue-Light Photoreceptor Sfwc-1 Gene Regulates the Phototropic Response and Fruiting-Body Development in the Homothallic Ascomycete Sordaria fimicola
    Article Snippet: For total RNA isolation, frozen mycelial samples were disrupted by grinding in liquid nitrogen for extraction with TRIzol reagent (Invitrogen, USA). .. The quantification of gene expression was conducted by the StepOne real-time PCR system (Thermo Fisher Scientific, USA).

    Article Title: Adipose-Derived Stem Cells from Systemic Sclerosis Patients Maintain Pro-Angiogenic and Antifibrotic Paracrine Effects In Vitro
    Article Snippet: 2.8. qRT-PCR Analysis Total RNA was isolated from HD-ASC and SSc-ASC using RNeasy mini kits (Ambion), including a DNase I digestion step to remove genomic DNA. .. Real-time PCR amplification was performed using Taqman Fast Advanced Master Mix (Applied Biosystems) with pre-designed primers (Applied Biosystems) on a StepOne Real-Time PCR System (Applied Biosystems).

    Polymerase Chain Reaction:

    Article Title: Pancreatic stellate cell-potentiated insulin secretion from Min6 cells is independent of interleukin 6-mediated pathway.
    Article Snippet: Paragraph title: 2.7 | RNA extraction, Reverse‐ transcription PCR and qPCR ... Pancreatic stellate cells (PSCs) secrete various factors, which can influence the β-cell function.

    Article Title: lncRNA SNHG5 Modulates Endometrial Cancer Progression via the miR-25-3p/BTG2 Axis
    Article Snippet: .. Reverse transcription for miRNA detection was performed using special primers ( ). qRT-PCR was performed using SYBR Green PCR Kit (Takara Bio, Otsu, Japan) with the primers listed in in a StepOne Real-Time PCR System (Thermo Fisher Scientific). .. The expression of specific genes was normalized to that of GAPDH or 18S rRNA, and U6 snRNA was used as an endogenous control to evaluate the expression of miRNAs.

    Article Title: Renalase Attenuates Mouse Fatty Liver Ischemia/Reperfusion Injury through Mitigating Oxidative Stress and Mitochondrial Damage via Activating SIRT1
    Article Snippet: Real-time PCR was performed via the Applied Biosystems StepOne Real-Time PCR system using ChamQ™ SYBR® qPCR Master Mix (High ROX Premixed) containing 5 ng cDNA and 10 pM of each primer. .. The cycling conditions consisted of one cycle at 95°C for 30 sec, 40 cycles at 95°C for 10 sec, and 60°C for 30 sec. A melting curve analysis was conducted for each PCR to confirm the specificity of amplification.

    Article Title: The Blue-Light Photoreceptor Sfwc-1 Gene Regulates the Phototropic Response and Fruiting-Body Development in the Homothallic Ascomycete Sordaria fimicola
    Article Snippet: The quantification of gene expression was conducted by the StepOne real-time PCR system (Thermo Fisher Scientific, USA). .. Real-time PCRs were performed as follows: 12.5 µl of 2× FAST SYBR green PCR master mix, 1 µl of 2.5 µM each primer, and 5 µl of 1 ng/µl cDNA template in total volume of 25 µl.

    Size-exclusion Chromatography:

    Article Title: Renalase Attenuates Mouse Fatty Liver Ischemia/Reperfusion Injury through Mitigating Oxidative Stress and Mitochondrial Damage via Activating SIRT1
    Article Snippet: Real-time PCR was performed via the Applied Biosystems StepOne Real-Time PCR system using ChamQ™ SYBR® qPCR Master Mix (High ROX Premixed) containing 5 ng cDNA and 10 pM of each primer. .. The cycling conditions consisted of one cycle at 95°C for 30 sec, 40 cycles at 95°C for 10 sec, and 60°C for 30 sec. A melting curve analysis was conducted for each PCR to confirm the specificity of amplification.

    Quantitative RT-PCR:

    Article Title: Transcriptomic analysis and novel insights into lens fibre cell differentiation regulated by Gata3
    Article Snippet: Paragraph title: Quantitative RT-PCR validation ... The cDNA was diluted 15-fold and qPCR was performed using the StepOne Real-Time PCR System (Thermo Fisher Scientific, USA) and the Power SYBR Green Master mix (Thermo Fisher, USA) in 96-well plates.

    Article Title: Virucidal Activity of Gold Nanoparticles Synthesized by Green Chemistry Using Garlic Extract
    Article Snippet: Paragraph title: 2.9. RT-qPCR ... The real-time PCR was carried out using PowerUp™ SYBR™ Green Master Mix (Applied Biosystems, Beverly, MA, USA) and the Applied Biosystems StepOne Real Time PCR System following procedures: 95 °C for 2 min, followed by 40 cycles of 95 °C for 2 s, 60 °C for 10 s, and 72 °C for 20 s. The number of viral copies was calculated by using a standard curve.

    Article Title: Temporally defined neocortical translation and polysome assembly are determined by the RNA-binding protein Hu antigen R
    Article Snippet: .. RNA was isolated from sucrose gradient fractions by using TRIzol-LS (Life Technologies; no. 10296028) following the manufacturer’s protocol. qRT-PCR was performed in 10-μL reactions (equivalent fraction volumes, duplicate technical replicates for each reaction) by using the Applied Biosystems StepOne Real-Time PCR system with Step-one software (Version 2.1; no. 4376373) and the RNA-Ct 1-Step Taqman kit (no. 4392653) with Taqman probes (see for catalog numbers). .. For each probe, n ≥ 4 neocortices were analyzed in n ≥ 2 fractionations, resulting in n ≥ 4 qRT-PCR technical replicates.

    Article Title: lncRNA SNHG5 Modulates Endometrial Cancer Progression via the miR-25-3p/BTG2 Axis
    Article Snippet: .. Reverse transcription for miRNA detection was performed using special primers ( ). qRT-PCR was performed using SYBR Green PCR Kit (Takara Bio, Otsu, Japan) with the primers listed in in a StepOne Real-Time PCR System (Thermo Fisher Scientific). .. The expression of specific genes was normalized to that of GAPDH or 18S rRNA, and U6 snRNA was used as an endogenous control to evaluate the expression of miRNAs.

    Article Title: Further Evidence for in Utero Transmission of Equine Hepacivirus to Foals
    Article Snippet: .. Quantitative RT-PCR was performed with One Step Prime Script RT-PCR kit (Takara, Ozyme, France) according to the manufacturer’s instructions and adapted from Burbelo et al. [ ] on a StepOne™ Real-Time PCR system (Life Technologies, Saint-Aubin, France) [ ]. .. Quantitative RT-PCR were performed with primers Qanti-5UF1, Qanti-5UR1, and probe 5’-FAM-CCACGAAGGAAGGCGGGGGC-BHQ1-3’ [ ] and with a second pair of primers (Sau5UF 5’-TCGAGGGAGCTGRAATTCGT-3’, Sau5UR 5’-GCCCTCGCAAGCATCCTATC-3’), as previously described [ ].

    Article Title: Adipose-Derived Stem Cells from Systemic Sclerosis Patients Maintain Pro-Angiogenic and Antifibrotic Paracrine Effects In Vitro
    Article Snippet: Paragraph title: 2.8. qRT-PCR Analysis ... Real-time PCR amplification was performed using Taqman Fast Advanced Master Mix (Applied Biosystems) with pre-designed primers (Applied Biosystems) on a StepOne Real-Time PCR System (Applied Biosystems).

    SYBR Green Assay:

    Article Title: Transcriptomic analysis and novel insights into lens fibre cell differentiation regulated by Gata3
    Article Snippet: .. The cDNA was diluted 15-fold and qPCR was performed using the StepOne Real-Time PCR System (Thermo Fisher Scientific, USA) and the Power SYBR Green Master mix (Thermo Fisher, USA) in 96-well plates. .. The relative gene expression was normalized using B2M, HMBS and SHDA reference genes.

    Article Title: Virucidal Activity of Gold Nanoparticles Synthesized by Green Chemistry Using Garlic Extract
    Article Snippet: .. The real-time PCR was carried out using PowerUp™ SYBR™ Green Master Mix (Applied Biosystems, Beverly, MA, USA) and the Applied Biosystems StepOne Real Time PCR System following procedures: 95 °C for 2 min, followed by 40 cycles of 95 °C for 2 s, 60 °C for 10 s, and 72 °C for 20 s. The number of viral copies was calculated by using a standard curve. ..

    Article Title: Pancreatic stellate cell-potentiated insulin secretion from Min6 cells is independent of interleukin 6-mediated pathway.
    Article Snippet: .. Pancreatic stellate cells (PSCs) secrete various factors, which can influence the β-cell function. .. Pancreatic stellate cells (PSCs) secrete various factors, which can influence the β-cell function.

    Article Title: lncRNA SNHG5 Modulates Endometrial Cancer Progression via the miR-25-3p/BTG2 Axis
    Article Snippet: .. Reverse transcription for miRNA detection was performed using special primers ( ). qRT-PCR was performed using SYBR Green PCR Kit (Takara Bio, Otsu, Japan) with the primers listed in in a StepOne Real-Time PCR System (Thermo Fisher Scientific). .. The expression of specific genes was normalized to that of GAPDH or 18S rRNA, and U6 snRNA was used as an endogenous control to evaluate the expression of miRNAs.

    Article Title: The Blue-Light Photoreceptor Sfwc-1 Gene Regulates the Phototropic Response and Fruiting-Body Development in the Homothallic Ascomycete Sordaria fimicola
    Article Snippet: The quantification of gene expression was conducted by the StepOne real-time PCR system (Thermo Fisher Scientific, USA). .. Real-time PCRs were performed as follows: 12.5 µl of 2× FAST SYBR green PCR master mix, 1 µl of 2.5 µM each primer, and 5 µl of 1 ng/µl cDNA template in total volume of 25 µl.

    Concentration Assay:

    Article Title: The Blue-Light Photoreceptor Sfwc-1 Gene Regulates the Phototropic Response and Fruiting-Body Development in the Homothallic Ascomycete Sordaria fimicola
    Article Snippet: RNA concentration and quality were evaluated with a NanoDrop spectrophotometer (Thermo Fisher Scientific, USA) and by denaturing gel electrophoresis, respectively. .. The quantification of gene expression was conducted by the StepOne real-time PCR system (Thermo Fisher Scientific, USA).

    Incubation:

    Article Title: Pancreatic stellate cell-potentiated insulin secretion from Min6 cells is independent of interleukin 6-mediated pathway.
    Article Snippet: Pancreatic stellate cells (PSCs) secrete various factors, which can influence the β-cell function. .. Pancreatic stellate cells (PSCs) secrete various factors, which can influence the β-cell function.

    Article Title: Adipose-Derived Stem Cells from Systemic Sclerosis Patients Maintain Pro-Angiogenic and Antifibrotic Paracrine Effects In Vitro
    Article Snippet: Real-time PCR amplification was performed using Taqman Fast Advanced Master Mix (Applied Biosystems) with pre-designed primers (Applied Biosystems) on a StepOne Real-Time PCR System (Applied Biosystems). .. The cycling conditions were as follows: 2 min at 50 °C (uracil-N-glycosylase (UNG) incubation), 2 min at 95 °C (polymerase activation), 40 cycles of 1 s at 95 °C (denaturation), and 20 s at 60 °C (annealing/elongation).

    Stripping Membranes:

    Article Title: The Blue-Light Photoreceptor Sfwc-1 Gene Regulates the Phototropic Response and Fruiting-Body Development in the Homothallic Ascomycete Sordaria fimicola
    Article Snippet: An LED red-light strip of 650 nm (0.5 to 1 µmol/[m2  · s], Taiwan HiPoint) was used for sample handling to mimic darkness conditions. .. The quantification of gene expression was conducted by the StepOne real-time PCR system (Thermo Fisher Scientific, USA).

    Spectrophotometry:

    Article Title: Pancreatic stellate cell-potentiated insulin secretion from Min6 cells is independent of interleukin 6-mediated pathway.
    Article Snippet: Pancreatic stellate cells (PSCs) secrete various factors, which can influence the β-cell function. .. Pancreatic stellate cells (PSCs) secrete various factors, which can influence the β-cell function.

    Article Title: The Blue-Light Photoreceptor Sfwc-1 Gene Regulates the Phototropic Response and Fruiting-Body Development in the Homothallic Ascomycete Sordaria fimicola
    Article Snippet: RNA concentration and quality were evaluated with a NanoDrop spectrophotometer (Thermo Fisher Scientific, USA) and by denaturing gel electrophoresis, respectively. .. The quantification of gene expression was conducted by the StepOne real-time PCR system (Thermo Fisher Scientific, USA).

    Expressing:

    Article Title: Transcriptomic analysis and novel insights into lens fibre cell differentiation regulated by Gata3
    Article Snippet: The cDNA was diluted 15-fold and qPCR was performed using the StepOne Real-Time PCR System (Thermo Fisher Scientific, USA) and the Power SYBR Green Master mix (Thermo Fisher, USA) in 96-well plates. .. The relative gene expression was normalized using B2M, HMBS and SHDA reference genes.

    Article Title: Pancreatic stellate cell-potentiated insulin secretion from Min6 cells is independent of interleukin 6-mediated pathway.
    Article Snippet: .. Pancreatic stellate cells (PSCs) secrete various factors, which can influence the β-cell function. .. Pancreatic stellate cells (PSCs) secrete various factors, which can influence the β-cell function.

    Article Title: lncRNA SNHG5 Modulates Endometrial Cancer Progression via the miR-25-3p/BTG2 Axis
    Article Snippet: Reverse transcription for miRNA detection was performed using special primers ( ). qRT-PCR was performed using SYBR Green PCR Kit (Takara Bio, Otsu, Japan) with the primers listed in in a StepOne Real-Time PCR System (Thermo Fisher Scientific). .. The expression of specific genes was normalized to that of GAPDH or 18S rRNA, and U6 snRNA was used as an endogenous control to evaluate the expression of miRNAs.

    Article Title: Renalase Attenuates Mouse Fatty Liver Ischemia/Reperfusion Injury through Mitigating Oxidative Stress and Mitochondrial Damage via Activating SIRT1
    Article Snippet: Real-time PCR was performed via the Applied Biosystems StepOne Real-Time PCR system using ChamQ™ SYBR® qPCR Master Mix (High ROX Premixed) containing 5 ng cDNA and 10 pM of each primer. .. The expression level of the mtDNA and mitochondrial NADH dehydrogenase 1 (ND1) was normalized to β -actin and calculated as 2−ΔΔ CT .

    Article Title: The Blue-Light Photoreceptor Sfwc-1 Gene Regulates the Phototropic Response and Fruiting-Body Development in the Homothallic Ascomycete Sordaria fimicola
    Article Snippet: .. The quantification of gene expression was conducted by the StepOne real-time PCR system (Thermo Fisher Scientific, USA). .. Real-time PCRs were performed as follows: 12.5 µl of 2× FAST SYBR green PCR master mix, 1 µl of 2.5 µM each primer, and 5 µl of 1 ng/µl cDNA template in total volume of 25 µl.

    Article Title: Adipose-Derived Stem Cells from Systemic Sclerosis Patients Maintain Pro-Angiogenic and Antifibrotic Paracrine Effects In Vitro
    Article Snippet: Real-time PCR amplification was performed using Taqman Fast Advanced Master Mix (Applied Biosystems) with pre-designed primers (Applied Biosystems) on a StepOne Real-Time PCR System (Applied Biosystems). .. Threshold cycle (CT) values of technical duplicates were averaged, and relative quantification of all mRNAs of interest was performed based on the 2−ΔCT method for mRNA GAPDH expression.

    Article Title: PiggyBac-modified CD19-expressing 4T1 cell line for the evaluation of CAR construct
    Article Snippet: .. To further investigate the expression level of CD19 and IL-2, qPCR was conducted through a StepOne™ Real-Time PCR system (Applied Biosystems). .. RNA was extracted with RNAsimple Total RNA Kit (TianGen, China) and reverse transcribed with HiScript Q RT SuperMix (Vazyme, China).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Further Evidence for in Utero Transmission of Equine Hepacivirus to Foals
    Article Snippet: .. Quantitative RT-PCR was performed with One Step Prime Script RT-PCR kit (Takara, Ozyme, France) according to the manufacturer’s instructions and adapted from Burbelo et al. [ ] on a StepOne™ Real-Time PCR system (Life Technologies, Saint-Aubin, France) [ ]. .. Quantitative RT-PCR were performed with primers Qanti-5UF1, Qanti-5UR1, and probe 5’-FAM-CCACGAAGGAAGGCGGGGGC-BHQ1-3’ [ ] and with a second pair of primers (Sau5UF 5’-TCGAGGGAGCTGRAATTCGT-3’, Sau5UR 5’-GCCCTCGCAAGCATCCTATC-3’), as previously described [ ].

    Article Title: Pancreatic stellate cell-potentiated insulin secretion from Min6 cells is independent of interleukin 6-mediated pathway.
    Article Snippet: .. Pancreatic stellate cells (PSCs) secrete various factors, which can influence the β-cell function. .. Pancreatic stellate cells (PSCs) secrete various factors, which can influence the β-cell function.

    Nucleic Acid Electrophoresis:

    Article Title: The Blue-Light Photoreceptor Sfwc-1 Gene Regulates the Phototropic Response and Fruiting-Body Development in the Homothallic Ascomycete Sordaria fimicola
    Article Snippet: RNA concentration and quality were evaluated with a NanoDrop spectrophotometer (Thermo Fisher Scientific, USA) and by denaturing gel electrophoresis, respectively. .. The quantification of gene expression was conducted by the StepOne real-time PCR system (Thermo Fisher Scientific, USA).

    Software:

    Article Title: Temporally defined neocortical translation and polysome assembly are determined by the RNA-binding protein Hu antigen R
    Article Snippet: .. RNA was isolated from sucrose gradient fractions by using TRIzol-LS (Life Technologies; no. 10296028) following the manufacturer’s protocol. qRT-PCR was performed in 10-μL reactions (equivalent fraction volumes, duplicate technical replicates for each reaction) by using the Applied Biosystems StepOne Real-Time PCR system with Step-one software (Version 2.1; no. 4376373) and the RNA-Ct 1-Step Taqman kit (no. 4392653) with Taqman probes (see for catalog numbers). .. For each probe, n ≥ 4 neocortices were analyzed in n ≥ 2 fractionations, resulting in n ≥ 4 qRT-PCR technical replicates.

    Article Title: Further Evidence for in Utero Transmission of Equine Hepacivirus to Foals
    Article Snippet: Quantitative RT-PCR was performed with One Step Prime Script RT-PCR kit (Takara, Ozyme, France) according to the manufacturer’s instructions and adapted from Burbelo et al. [ ] on a StepOne™ Real-Time PCR system (Life Technologies, Saint-Aubin, France) [ ]. .. Data were analyzed using the StepOne™ software, version 2.2.2 (Life Technologies, Saint-Aubin, France).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Thermo Fisher transcription quantitative polymerase chain reaction rt qpcr system
    Comparison of exosomal <t>miR-223-3p</t> levels between DCIS patients, upstage IDC patients and IDC patients. Exosomal miR-223-3p levels of DCIS patients (Stage 0), upstaged IDC patients (Stage I) and IDC patients (Stage I) were measured by reverse transcription-quantitative polymerase chain reaction. DCIS patients who were initially diagnosed by a needle biopsy prior to surgery were re-diagnosed following the operation using the completely excised specimen. Patients upstaged to IDC from DCIS on the final pathological report were described as upstage IDC patients. DCIS, ductal carcinoma in situ ; IDC, invasive ductal carcinoma; miR, microRNA.
    Transcription Quantitative Polymerase Chain Reaction Rt Qpcr System, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/transcription quantitative polymerase chain reaction rt qpcr system/product/Thermo Fisher
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    transcription quantitative polymerase chain reaction rt qpcr system - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    99
    Thermo Fisher stepone real time pcr system
    Comparison of exosomal <t>miR-223-3p</t> levels between DCIS patients, upstage IDC patients and IDC patients. Exosomal miR-223-3p levels of DCIS patients (Stage 0), upstaged IDC patients (Stage I) and IDC patients (Stage I) were measured by reverse transcription-quantitative polymerase chain reaction. DCIS patients who were initially diagnosed by a needle biopsy prior to surgery were re-diagnosed following the operation using the completely excised specimen. Patients upstaged to IDC from DCIS on the final pathological report were described as upstage IDC patients. DCIS, ductal carcinoma in situ ; IDC, invasive ductal carcinoma; miR, microRNA.
    Stepone Real Time Pcr System, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 2458 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/stepone real time pcr system/product/Thermo Fisher
    Average 99 stars, based on 2458 article reviews
    Price from $9.99 to $1999.99
    stepone real time pcr system - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results


    Comparison of exosomal miR-223-3p levels between DCIS patients, upstage IDC patients and IDC patients. Exosomal miR-223-3p levels of DCIS patients (Stage 0), upstaged IDC patients (Stage I) and IDC patients (Stage I) were measured by reverse transcription-quantitative polymerase chain reaction. DCIS patients who were initially diagnosed by a needle biopsy prior to surgery were re-diagnosed following the operation using the completely excised specimen. Patients upstaged to IDC from DCIS on the final pathological report were described as upstage IDC patients. DCIS, ductal carcinoma in situ ; IDC, invasive ductal carcinoma; miR, microRNA.

    Journal: Oncology Letters

    Article Title: Exosome-encapsulated microRNA-223-3p as a minimally invasive biomarker for the early detection of invasive breast cancer

    doi: 10.3892/ol.2018.8457

    Figure Lengend Snippet: Comparison of exosomal miR-223-3p levels between DCIS patients, upstage IDC patients and IDC patients. Exosomal miR-223-3p levels of DCIS patients (Stage 0), upstaged IDC patients (Stage I) and IDC patients (Stage I) were measured by reverse transcription-quantitative polymerase chain reaction. DCIS patients who were initially diagnosed by a needle biopsy prior to surgery were re-diagnosed following the operation using the completely excised specimen. Patients upstaged to IDC from DCIS on the final pathological report were described as upstage IDC patients. DCIS, ductal carcinoma in situ ; IDC, invasive ductal carcinoma; miR, microRNA.

    Article Snippet: Expressions of miR-223-3p of pCMV-pre-miR-223-3p or wpCMV-miR-neg-transfected MCF7 cells were measured by reverse transcription-quantitative polymerase chain reaction (RT-qPCR) system (StepOne; Thermo Fisher Scientific, Inc.) and Digital PCR system (Quant Studio 3D Digital PCR System; Thermo Fisher Scientific, Inc.).

    Techniques: Real-time Polymerase Chain Reaction, In Situ