Structured Review

Agilent technologies srsf2 mutants
The <t>SRSF2</t> P95H mutation alters SRSF2 in vivo RNA motif specificity (a) Top enriched motifs for WT and P95H SRSF2 binding sites, identified by discriminative analysis of kmer composition. Corresponding p-values are displayed on top of each logo. (b) Relative enrichment of the SSNG (S=C/G, N=C/G/A/U) RNA consensus motifs in RNA regions preferentially bound by WT versus P95H SRSF2. The number of motif occurrences and differential enrichment p-values are displayed for each bar.
Srsf2 Mutants, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/srsf2 mutants/product/Agilent technologies
Average 86 stars, based on 1 article reviews
Price from $9.99 to $1999.99
srsf2 mutants - by Bioz Stars, 2021-06
86/100 stars

Images

1) Product Images from "SRSF2 mutations drive oncogenesis by activating a global program of aberrant alternative splicing in hematopoietic cells"

Article Title: SRSF2 mutations drive oncogenesis by activating a global program of aberrant alternative splicing in hematopoietic cells

Journal: Leukemia

doi: 10.1038/s41375-018-0152-7

The SRSF2 P95H mutation alters SRSF2 in vivo RNA motif specificity (a) Top enriched motifs for WT and P95H SRSF2 binding sites, identified by discriminative analysis of kmer composition. Corresponding p-values are displayed on top of each logo. (b) Relative enrichment of the SSNG (S=C/G, N=C/G/A/U) RNA consensus motifs in RNA regions preferentially bound by WT versus P95H SRSF2. The number of motif occurrences and differential enrichment p-values are displayed for each bar.
Figure Legend Snippet: The SRSF2 P95H mutation alters SRSF2 in vivo RNA motif specificity (a) Top enriched motifs for WT and P95H SRSF2 binding sites, identified by discriminative analysis of kmer composition. Corresponding p-values are displayed on top of each logo. (b) Relative enrichment of the SSNG (S=C/G, N=C/G/A/U) RNA consensus motifs in RNA regions preferentially bound by WT versus P95H SRSF2. The number of motif occurrences and differential enrichment p-values are displayed for each bar.

Techniques Used: Mutagenesis, In Vivo, Binding Assay

SRSF2 mutations results in differential binding and splicing of HNRNP proteins (a–c) Differential binding and splicing in HNRNP proteins is shown for HNRNPA2B1 ( a ), HNRNPH1 ( b ), and HNRNPM ( c ). Left panels: transcript maps showing WT (red) and P95H (cyan) SRSF2 binding profiles. The maps display mean normalized HITS-CLIP signal with nucleotide resolution. Standard errors for each position are shown as ribbons under mean lines. Crosslinking-induced deletions are marked in black. Exon boundaries are represented as vertical dotted lines. Differential interaction sites are highlighted on the transcript. Center panels: RT-PCR capturing differentially bound exons was performed in 3–4 replicates in HEL cells with or without doxycycline induction of SRSF2 WT or P95H expression, and with or without knockdown of endogenous SRSF2, and in human fetal liver CD34+ cells transduced with empty, SRSF2 WT or SRSF2 P95H expressing lentivirus. Right panels: primary patient derived samples - alternative splice events were quantified in normal CD34+ (n=2), WT MDS/AML (n=6), and MUT MDS/AML (n=6) samples. The magnitude of the alternative splice event in % was calculated as ratio of alternative splice event to total expression. Considered bands are marked by an asterisk (*). Predicted band sizes and transcript sizes are indicated to the right of the gel. (d) Direct differential splicing of the HNRNPA2B1 exon 9 by WT vs P95H SRSF2 verified by a minigene splicing assay. RG6-HNRNPA2B1 plasmid was co-transfected with empty vector, SRSF2 WT, SRSF2 P95H/L/R, and control or SRSF2 siRNA. Alternative splicing of exon 9 was determined via semi-quantitative PCR by measuring the ratio of alternative exon exclusion over total (exclusion+inclusion) band intensities (n=3). (e) Colony Forming Unit Assay for control cells (siNTC), cells silenced for HNRNPM or HNRNPH1, cells induced to splice out HNRNPA2B1 exon 9, and cells treated for all three modifications together (siALL). The same number of cells was plated in all experiments. The total number and the composition of colonies is displayed. Total colony numbers and colony type percentages were compared to the control (siNTC). Standard errors (SE) for colony numbers are displayed. In panels ( a–e) , significance values were determined by one way ANOVA with Sidák Post Hoc Test (*P
Figure Legend Snippet: SRSF2 mutations results in differential binding and splicing of HNRNP proteins (a–c) Differential binding and splicing in HNRNP proteins is shown for HNRNPA2B1 ( a ), HNRNPH1 ( b ), and HNRNPM ( c ). Left panels: transcript maps showing WT (red) and P95H (cyan) SRSF2 binding profiles. The maps display mean normalized HITS-CLIP signal with nucleotide resolution. Standard errors for each position are shown as ribbons under mean lines. Crosslinking-induced deletions are marked in black. Exon boundaries are represented as vertical dotted lines. Differential interaction sites are highlighted on the transcript. Center panels: RT-PCR capturing differentially bound exons was performed in 3–4 replicates in HEL cells with or without doxycycline induction of SRSF2 WT or P95H expression, and with or without knockdown of endogenous SRSF2, and in human fetal liver CD34+ cells transduced with empty, SRSF2 WT or SRSF2 P95H expressing lentivirus. Right panels: primary patient derived samples - alternative splice events were quantified in normal CD34+ (n=2), WT MDS/AML (n=6), and MUT MDS/AML (n=6) samples. The magnitude of the alternative splice event in % was calculated as ratio of alternative splice event to total expression. Considered bands are marked by an asterisk (*). Predicted band sizes and transcript sizes are indicated to the right of the gel. (d) Direct differential splicing of the HNRNPA2B1 exon 9 by WT vs P95H SRSF2 verified by a minigene splicing assay. RG6-HNRNPA2B1 plasmid was co-transfected with empty vector, SRSF2 WT, SRSF2 P95H/L/R, and control or SRSF2 siRNA. Alternative splicing of exon 9 was determined via semi-quantitative PCR by measuring the ratio of alternative exon exclusion over total (exclusion+inclusion) band intensities (n=3). (e) Colony Forming Unit Assay for control cells (siNTC), cells silenced for HNRNPM or HNRNPH1, cells induced to splice out HNRNPA2B1 exon 9, and cells treated for all three modifications together (siALL). The same number of cells was plated in all experiments. The total number and the composition of colonies is displayed. Total colony numbers and colony type percentages were compared to the control (siNTC). Standard errors (SE) for colony numbers are displayed. In panels ( a–e) , significance values were determined by one way ANOVA with Sidák Post Hoc Test (*P

Techniques Used: Binding Assay, Cross-linking Immunoprecipitation, Reverse Transcription Polymerase Chain Reaction, Expressing, Transduction, Derivative Assay, Splicing Assay, Plasmid Preparation, Transfection, Real-time Polymerase Chain Reaction, Colony-forming Unit Assay

The SRSF2 P95H mutation alters SRSF2 in vivo RNA interactome (a) Overview of the HITS-CLIP procedure. Top: generation of lentiviral vector constructs expressing C-terminally Flag-tagged SRSF2 WT and P95H in a doxycycline inducible manner. Center: HITS-CLIP key experimental steps. Bottom: computational identification of differentially bound regions, preferentially bound by WT (in red) or by P95H (in cyan) SRSF2. (b) Dose dependent inducible expression of Flag-tagged SRSF2 (WT and P95H). (c) Colony Forming Unit Assay for control CD34+ cells (mCherry), and cells with transient induction of SRSF2 WT or P95H. Left panel: total number of colonies. Right panel: composition of colonies (mean values + SEM). Total colony numbers and colony type percentages were compared between WT and P95H by two-tailed t-test (*P
Figure Legend Snippet: The SRSF2 P95H mutation alters SRSF2 in vivo RNA interactome (a) Overview of the HITS-CLIP procedure. Top: generation of lentiviral vector constructs expressing C-terminally Flag-tagged SRSF2 WT and P95H in a doxycycline inducible manner. Center: HITS-CLIP key experimental steps. Bottom: computational identification of differentially bound regions, preferentially bound by WT (in red) or by P95H (in cyan) SRSF2. (b) Dose dependent inducible expression of Flag-tagged SRSF2 (WT and P95H). (c) Colony Forming Unit Assay for control CD34+ cells (mCherry), and cells with transient induction of SRSF2 WT or P95H. Left panel: total number of colonies. Right panel: composition of colonies (mean values + SEM). Total colony numbers and colony type percentages were compared between WT and P95H by two-tailed t-test (*P

Techniques Used: Mutagenesis, In Vivo, Cross-linking Immunoprecipitation, Plasmid Preparation, Construct, Expressing, Colony-forming Unit Assay, Two Tailed Test

Differentially bound SRSF2 targets are enriched in RNA binding and splicing genes (a) Functional annotation enrichment analysis of differentially bound transcripts by WT and P95H SRSF2. The number of genes belonging to each category is displayed. (b) Protein-protein interaction network of SRSF2 RNA interactors associated with splicing. The size of each node is proportional to the number of differential SRSF2 binding sites: WT (in red), P95H (in cyan) or both (in violet).
Figure Legend Snippet: Differentially bound SRSF2 targets are enriched in RNA binding and splicing genes (a) Functional annotation enrichment analysis of differentially bound transcripts by WT and P95H SRSF2. The number of genes belonging to each category is displayed. (b) Protein-protein interaction network of SRSF2 RNA interactors associated with splicing. The size of each node is proportional to the number of differential SRSF2 binding sites: WT (in red), P95H (in cyan) or both (in violet).

Techniques Used: RNA Binding Assay, Functional Assay, Binding Assay

SRSF2 P95H mutations promote alternative splicing with inclusion of CCNG rich exons and enrichment in RNA binding and splicing genes (a) Determination of differential alternative splice events via rMATS analysis in HEL cells engineered to express SRSF2 WT vs P95H. Left panel: five classes of alternative splicing events were considered: cassette exon (CE), alternative 5′ splice site (A5SS), alternative 3′ splice site (A3SS), mutually exclusive exons (MXE) and retained intron (RI). Right panel: the number of significant events with more inclusion in WT or P95H cells is displayed. (b) Relative enrichment of the SSNG (S=C/G, N=C/G/A/T) RNA consensus motifs in cassette exons preferentially spliced in WT vs preferentially spliced in P95H SRSF2 expressing cells. The number of motif occurrences and enrichment p-values are displayed for each bar. (c) Overlap between genes with differential binding and differential splicing in HEL cells expressing either WT or P95H SRSF2. The significance of the overlap is displayed. (d) Functional annotation enrichment analysis of differentially spliced genes in WT vs P95H HEL cells. The number of genes falling into each category is indicated beside each bar.
Figure Legend Snippet: SRSF2 P95H mutations promote alternative splicing with inclusion of CCNG rich exons and enrichment in RNA binding and splicing genes (a) Determination of differential alternative splice events via rMATS analysis in HEL cells engineered to express SRSF2 WT vs P95H. Left panel: five classes of alternative splicing events were considered: cassette exon (CE), alternative 5′ splice site (A5SS), alternative 3′ splice site (A3SS), mutually exclusive exons (MXE) and retained intron (RI). Right panel: the number of significant events with more inclusion in WT or P95H cells is displayed. (b) Relative enrichment of the SSNG (S=C/G, N=C/G/A/T) RNA consensus motifs in cassette exons preferentially spliced in WT vs preferentially spliced in P95H SRSF2 expressing cells. The number of motif occurrences and enrichment p-values are displayed for each bar. (c) Overlap between genes with differential binding and differential splicing in HEL cells expressing either WT or P95H SRSF2. The significance of the overlap is displayed. (d) Functional annotation enrichment analysis of differentially spliced genes in WT vs P95H HEL cells. The number of genes falling into each category is indicated beside each bar.

Techniques Used: RNA Binding Assay, Expressing, Binding Assay, Functional Assay

2) Product Images from "SRSF2 mutations drive oncogenesis by activating a global program of aberrant alternative splicing in hematopoietic cells"

Article Title: SRSF2 mutations drive oncogenesis by activating a global program of aberrant alternative splicing in hematopoietic cells

Journal: Leukemia

doi: 10.1038/s41375-018-0152-7

The SRSF2 P95H mutation alters SRSF2 in vivo RNA motif specificity (a) Top enriched motifs for WT and P95H SRSF2 binding sites, identified by discriminative analysis of kmer composition. Corresponding p-values are displayed on top of each logo. (b) Relative enrichment of the SSNG (S=C/G, N=C/G/A/U) RNA consensus motifs in RNA regions preferentially bound by WT versus P95H SRSF2. The number of motif occurrences and differential enrichment p-values are displayed for each bar.
Figure Legend Snippet: The SRSF2 P95H mutation alters SRSF2 in vivo RNA motif specificity (a) Top enriched motifs for WT and P95H SRSF2 binding sites, identified by discriminative analysis of kmer composition. Corresponding p-values are displayed on top of each logo. (b) Relative enrichment of the SSNG (S=C/G, N=C/G/A/U) RNA consensus motifs in RNA regions preferentially bound by WT versus P95H SRSF2. The number of motif occurrences and differential enrichment p-values are displayed for each bar.

Techniques Used: Mutagenesis, In Vivo, Binding Assay

SRSF2 mutations results in differential binding and splicing of HNRNP proteins (a–c) Differential binding and splicing in HNRNP proteins is shown for HNRNPA2B1 ( a ), HNRNPH1 ( b ), and HNRNPM ( c ). Left panels: transcript maps showing WT (red) and P95H (cyan) SRSF2 binding profiles. The maps display mean normalized HITS-CLIP signal with nucleotide resolution. Standard errors for each position are shown as ribbons under mean lines. Crosslinking-induced deletions are marked in black. Exon boundaries are represented as vertical dotted lines. Differential interaction sites are highlighted on the transcript. Center panels: RT-PCR capturing differentially bound exons was performed in 3–4 replicates in HEL cells with or without doxycycline induction of SRSF2 WT or P95H expression, and with or without knockdown of endogenous SRSF2, and in human fetal liver CD34+ cells transduced with empty, SRSF2 WT or SRSF2 P95H expressing lentivirus. Right panels: primary patient derived samples - alternative splice events were quantified in normal CD34+ (n=2), WT MDS/AML (n=6), and MUT MDS/AML (n=6) samples. The magnitude of the alternative splice event in % was calculated as ratio of alternative splice event to total expression. Considered bands are marked by an asterisk (*). Predicted band sizes and transcript sizes are indicated to the right of the gel. (d) Direct differential splicing of the HNRNPA2B1 exon 9 by WT vs P95H SRSF2 verified by a minigene splicing assay. RG6-HNRNPA2B1 plasmid was co-transfected with empty vector, SRSF2 WT, SRSF2 P95H/L/R, and control or SRSF2 siRNA. Alternative splicing of exon 9 was determined via semi-quantitative PCR by measuring the ratio of alternative exon exclusion over total (exclusion+inclusion) band intensities (n=3). (e) Colony Forming Unit Assay for control cells (siNTC), cells silenced for HNRNPM or HNRNPH1, cells induced to splice out HNRNPA2B1 exon 9, and cells treated for all three modifications together (siALL). The same number of cells was plated in all experiments. The total number and the composition of colonies is displayed. Total colony numbers and colony type percentages were compared to the control (siNTC). Standard errors (SE) for colony numbers are displayed. In panels ( a–e) , significance values were determined by one way ANOVA with Sidák Post Hoc Test (*P
Figure Legend Snippet: SRSF2 mutations results in differential binding and splicing of HNRNP proteins (a–c) Differential binding and splicing in HNRNP proteins is shown for HNRNPA2B1 ( a ), HNRNPH1 ( b ), and HNRNPM ( c ). Left panels: transcript maps showing WT (red) and P95H (cyan) SRSF2 binding profiles. The maps display mean normalized HITS-CLIP signal with nucleotide resolution. Standard errors for each position are shown as ribbons under mean lines. Crosslinking-induced deletions are marked in black. Exon boundaries are represented as vertical dotted lines. Differential interaction sites are highlighted on the transcript. Center panels: RT-PCR capturing differentially bound exons was performed in 3–4 replicates in HEL cells with or without doxycycline induction of SRSF2 WT or P95H expression, and with or without knockdown of endogenous SRSF2, and in human fetal liver CD34+ cells transduced with empty, SRSF2 WT or SRSF2 P95H expressing lentivirus. Right panels: primary patient derived samples - alternative splice events were quantified in normal CD34+ (n=2), WT MDS/AML (n=6), and MUT MDS/AML (n=6) samples. The magnitude of the alternative splice event in % was calculated as ratio of alternative splice event to total expression. Considered bands are marked by an asterisk (*). Predicted band sizes and transcript sizes are indicated to the right of the gel. (d) Direct differential splicing of the HNRNPA2B1 exon 9 by WT vs P95H SRSF2 verified by a minigene splicing assay. RG6-HNRNPA2B1 plasmid was co-transfected with empty vector, SRSF2 WT, SRSF2 P95H/L/R, and control or SRSF2 siRNA. Alternative splicing of exon 9 was determined via semi-quantitative PCR by measuring the ratio of alternative exon exclusion over total (exclusion+inclusion) band intensities (n=3). (e) Colony Forming Unit Assay for control cells (siNTC), cells silenced for HNRNPM or HNRNPH1, cells induced to splice out HNRNPA2B1 exon 9, and cells treated for all three modifications together (siALL). The same number of cells was plated in all experiments. The total number and the composition of colonies is displayed. Total colony numbers and colony type percentages were compared to the control (siNTC). Standard errors (SE) for colony numbers are displayed. In panels ( a–e) , significance values were determined by one way ANOVA with Sidák Post Hoc Test (*P

Techniques Used: Binding Assay, Cross-linking Immunoprecipitation, Reverse Transcription Polymerase Chain Reaction, Expressing, Transduction, Derivative Assay, Splicing Assay, Plasmid Preparation, Transfection, Real-time Polymerase Chain Reaction, Colony-forming Unit Assay

The SRSF2 P95H mutation alters SRSF2 in vivo RNA interactome (a) Overview of the HITS-CLIP procedure. Top: generation of lentiviral vector constructs expressing C-terminally Flag-tagged SRSF2 WT and P95H in a doxycycline inducible manner. Center: HITS-CLIP key experimental steps. Bottom: computational identification of differentially bound regions, preferentially bound by WT (in red) or by P95H (in cyan) SRSF2. (b) Dose dependent inducible expression of Flag-tagged SRSF2 (WT and P95H). (c) Colony Forming Unit Assay for control CD34+ cells (mCherry), and cells with transient induction of SRSF2 WT or P95H. Left panel: total number of colonies. Right panel: composition of colonies (mean values + SEM). Total colony numbers and colony type percentages were compared between WT and P95H by two-tailed t-test (*P
Figure Legend Snippet: The SRSF2 P95H mutation alters SRSF2 in vivo RNA interactome (a) Overview of the HITS-CLIP procedure. Top: generation of lentiviral vector constructs expressing C-terminally Flag-tagged SRSF2 WT and P95H in a doxycycline inducible manner. Center: HITS-CLIP key experimental steps. Bottom: computational identification of differentially bound regions, preferentially bound by WT (in red) or by P95H (in cyan) SRSF2. (b) Dose dependent inducible expression of Flag-tagged SRSF2 (WT and P95H). (c) Colony Forming Unit Assay for control CD34+ cells (mCherry), and cells with transient induction of SRSF2 WT or P95H. Left panel: total number of colonies. Right panel: composition of colonies (mean values + SEM). Total colony numbers and colony type percentages were compared between WT and P95H by two-tailed t-test (*P

Techniques Used: Mutagenesis, In Vivo, Cross-linking Immunoprecipitation, Plasmid Preparation, Construct, Expressing, Colony-forming Unit Assay, Two Tailed Test

Differentially bound SRSF2 targets are enriched in RNA binding and splicing genes (a) Functional annotation enrichment analysis of differentially bound transcripts by WT and P95H SRSF2. The number of genes belonging to each category is displayed. (b) Protein-protein interaction network of SRSF2 RNA interactors associated with splicing. The size of each node is proportional to the number of differential SRSF2 binding sites: WT (in red), P95H (in cyan) or both (in violet).
Figure Legend Snippet: Differentially bound SRSF2 targets are enriched in RNA binding and splicing genes (a) Functional annotation enrichment analysis of differentially bound transcripts by WT and P95H SRSF2. The number of genes belonging to each category is displayed. (b) Protein-protein interaction network of SRSF2 RNA interactors associated with splicing. The size of each node is proportional to the number of differential SRSF2 binding sites: WT (in red), P95H (in cyan) or both (in violet).

Techniques Used: RNA Binding Assay, Functional Assay, Binding Assay

SRSF2 P95H mutations promote alternative splicing with inclusion of CCNG rich exons and enrichment in RNA binding and splicing genes (a) Determination of differential alternative splice events via rMATS analysis in HEL cells engineered to express SRSF2 WT vs P95H. Left panel: five classes of alternative splicing events were considered: cassette exon (CE), alternative 5′ splice site (A5SS), alternative 3′ splice site (A3SS), mutually exclusive exons (MXE) and retained intron (RI). Right panel: the number of significant events with more inclusion in WT or P95H cells is displayed. (b) Relative enrichment of the SSNG (S=C/G, N=C/G/A/T) RNA consensus motifs in cassette exons preferentially spliced in WT vs preferentially spliced in P95H SRSF2 expressing cells. The number of motif occurrences and enrichment p-values are displayed for each bar. (c) Overlap between genes with differential binding and differential splicing in HEL cells expressing either WT or P95H SRSF2. The significance of the overlap is displayed. (d) Functional annotation enrichment analysis of differentially spliced genes in WT vs P95H HEL cells. The number of genes falling into each category is indicated beside each bar.
Figure Legend Snippet: SRSF2 P95H mutations promote alternative splicing with inclusion of CCNG rich exons and enrichment in RNA binding and splicing genes (a) Determination of differential alternative splice events via rMATS analysis in HEL cells engineered to express SRSF2 WT vs P95H. Left panel: five classes of alternative splicing events were considered: cassette exon (CE), alternative 5′ splice site (A5SS), alternative 3′ splice site (A3SS), mutually exclusive exons (MXE) and retained intron (RI). Right panel: the number of significant events with more inclusion in WT or P95H cells is displayed. (b) Relative enrichment of the SSNG (S=C/G, N=C/G/A/T) RNA consensus motifs in cassette exons preferentially spliced in WT vs preferentially spliced in P95H SRSF2 expressing cells. The number of motif occurrences and enrichment p-values are displayed for each bar. (c) Overlap between genes with differential binding and differential splicing in HEL cells expressing either WT or P95H SRSF2. The significance of the overlap is displayed. (d) Functional annotation enrichment analysis of differentially spliced genes in WT vs P95H HEL cells. The number of genes falling into each category is indicated beside each bar.

Techniques Used: RNA Binding Assay, Expressing, Binding Assay, Functional Assay

Related Articles

Mutagenesis:

Article Title: SRSF2 mutations drive oncogenesis by activating a global program of aberrant alternative splicing in hematopoietic cells
Article Snippet: SRSF2 mutant cell line construction and verification Full length human SRSF2 -Flag was cloned into the CS-TRE-Ubc-tTA-I2G plasmid . .. Site-directed mutagenesis was performed to obtain SRSF2 mutants per standard protocol (Agilent Technologies). .. Lentivirus was produced by co-transfection of 293FT cells with psPAX2 (Addgene plasmid #12260) and pCMV-VSVG (Addgene plasmid #14888).

Article Title: SRSF2 mutations drive oncogenesis by activating a global program of aberrant alternative splicing in hematopoietic cells
Article Snippet: Full length human SRSF2 -Flag was cloned into the CS-TRE-Ubc-tTA-I2G plasmid . .. Site-directed mutagenesis was performed to obtain SRSF2 mutants per standard protocol (Agilent Technologies). .. Lentivirus was produced by co-transfection of 293FT cells with psPAX2 (Addgene plasmid #12260) and pCMV-VSVG (Addgene plasmid #14888).

Article Title: Myelodysplasia-associated mutations in serine/arginine-rich splicing factor SRSF2 lead to alternative splicing of CDC25C
Article Snippet: Plasmid construction The pRevTRE-SC35HA (SRSF2HA) tet-inducible plasmid was a gift from Xiang-Dong Fu’s lab at UCSD [ ]. .. Mutations of P95 were produced using site-directed mutagenesis with the QuikChange Kit (Agilent) with the following primers: SRSF2-P95X sense (5′-CTACGGCCGCCDCCCGGACTCAC-3′) and SRSF2-P95X antisense (5′-GTGAGTCCGGGHGGCGGCCGTAG-3′), where D is A, T, and G and H is A, T, and C [ ]. .. SRSF2 deletion mutants were produced using the InFusion cloning system (Clontech) and primers that overlapped the deletion sites: ΔRRM F1 (ATGTGGAGGGTATGACCTCCATGGCGCGCTACGGC), ΔRRM R1 (GCCGTAGCGCGCCATGGAGGTCATACCCTCCACAT), ΔHNG F1 (CGAGCTGCGGGTGCAAAGCCGCCGGGGACC), ΔHNG R1 (GGTCCCCGGCGGCTTTGCACCCGCAGCTCG), ΔRS F1 (CCCGGACTCACACCACCCTCCCCCAGTGTCCA), ΔRS R1 (TGGACACTGGGGGAGGGTGGTGTGAGTCCGGG), ΔNRS F1 (GGTCTCGGTCCAGGAGTCTCGAGTACCCATACGACG), ΔNRS R1 (CGTCGTATGGGTACTCGAGACTCCTGGACCGAGACC).

Produced:

Article Title: Myelodysplasia-associated mutations in serine/arginine-rich splicing factor SRSF2 lead to alternative splicing of CDC25C
Article Snippet: Plasmid construction The pRevTRE-SC35HA (SRSF2HA) tet-inducible plasmid was a gift from Xiang-Dong Fu’s lab at UCSD [ ]. .. Mutations of P95 were produced using site-directed mutagenesis with the QuikChange Kit (Agilent) with the following primers: SRSF2-P95X sense (5′-CTACGGCCGCCDCCCGGACTCAC-3′) and SRSF2-P95X antisense (5′-GTGAGTCCGGGHGGCGGCCGTAG-3′), where D is A, T, and G and H is A, T, and C [ ]. .. SRSF2 deletion mutants were produced using the InFusion cloning system (Clontech) and primers that overlapped the deletion sites: ΔRRM F1 (ATGTGGAGGGTATGACCTCCATGGCGCGCTACGGC), ΔRRM R1 (GCCGTAGCGCGCCATGGAGGTCATACCCTCCACAT), ΔHNG F1 (CGAGCTGCGGGTGCAAAGCCGCCGGGGACC), ΔHNG R1 (GGTCCCCGGCGGCTTTGCACCCGCAGCTCG), ΔRS F1 (CCCGGACTCACACCACCCTCCCCCAGTGTCCA), ΔRS R1 (TGGACACTGGGGGAGGGTGGTGTGAGTCCGGG), ΔNRS F1 (GGTCTCGGTCCAGGAGTCTCGAGTACCCATACGACG), ΔNRS R1 (CGTCGTATGGGTACTCGAGACTCCTGGACCGAGACC).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86
    Agilent technologies srsf2 mutants
    The <t>SRSF2</t> P95H mutation alters SRSF2 in vivo RNA motif specificity (a) Top enriched motifs for WT and P95H SRSF2 binding sites, identified by discriminative analysis of kmer composition. Corresponding p-values are displayed on top of each logo. (b) Relative enrichment of the SSNG (S=C/G, N=C/G/A/U) RNA consensus motifs in RNA regions preferentially bound by WT versus P95H SRSF2. The number of motif occurrences and differential enrichment p-values are displayed for each bar.
    Srsf2 Mutants, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/srsf2 mutants/product/Agilent technologies
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    srsf2 mutants - by Bioz Stars, 2021-06
    86/100 stars
      Buy from Supplier

    Image Search Results


    The SRSF2 P95H mutation alters SRSF2 in vivo RNA motif specificity (a) Top enriched motifs for WT and P95H SRSF2 binding sites, identified by discriminative analysis of kmer composition. Corresponding p-values are displayed on top of each logo. (b) Relative enrichment of the SSNG (S=C/G, N=C/G/A/U) RNA consensus motifs in RNA regions preferentially bound by WT versus P95H SRSF2. The number of motif occurrences and differential enrichment p-values are displayed for each bar.

    Journal: Leukemia

    Article Title: SRSF2 mutations drive oncogenesis by activating a global program of aberrant alternative splicing in hematopoietic cells

    doi: 10.1038/s41375-018-0152-7

    Figure Lengend Snippet: The SRSF2 P95H mutation alters SRSF2 in vivo RNA motif specificity (a) Top enriched motifs for WT and P95H SRSF2 binding sites, identified by discriminative analysis of kmer composition. Corresponding p-values are displayed on top of each logo. (b) Relative enrichment of the SSNG (S=C/G, N=C/G/A/U) RNA consensus motifs in RNA regions preferentially bound by WT versus P95H SRSF2. The number of motif occurrences and differential enrichment p-values are displayed for each bar.

    Article Snippet: Site-directed mutagenesis was performed to obtain SRSF2 mutants per standard protocol (Agilent Technologies).

    Techniques: Mutagenesis, In Vivo, Binding Assay

    SRSF2 mutations results in differential binding and splicing of HNRNP proteins (a–c) Differential binding and splicing in HNRNP proteins is shown for HNRNPA2B1 ( a ), HNRNPH1 ( b ), and HNRNPM ( c ). Left panels: transcript maps showing WT (red) and P95H (cyan) SRSF2 binding profiles. The maps display mean normalized HITS-CLIP signal with nucleotide resolution. Standard errors for each position are shown as ribbons under mean lines. Crosslinking-induced deletions are marked in black. Exon boundaries are represented as vertical dotted lines. Differential interaction sites are highlighted on the transcript. Center panels: RT-PCR capturing differentially bound exons was performed in 3–4 replicates in HEL cells with or without doxycycline induction of SRSF2 WT or P95H expression, and with or without knockdown of endogenous SRSF2, and in human fetal liver CD34+ cells transduced with empty, SRSF2 WT or SRSF2 P95H expressing lentivirus. Right panels: primary patient derived samples - alternative splice events were quantified in normal CD34+ (n=2), WT MDS/AML (n=6), and MUT MDS/AML (n=6) samples. The magnitude of the alternative splice event in % was calculated as ratio of alternative splice event to total expression. Considered bands are marked by an asterisk (*). Predicted band sizes and transcript sizes are indicated to the right of the gel. (d) Direct differential splicing of the HNRNPA2B1 exon 9 by WT vs P95H SRSF2 verified by a minigene splicing assay. RG6-HNRNPA2B1 plasmid was co-transfected with empty vector, SRSF2 WT, SRSF2 P95H/L/R, and control or SRSF2 siRNA. Alternative splicing of exon 9 was determined via semi-quantitative PCR by measuring the ratio of alternative exon exclusion over total (exclusion+inclusion) band intensities (n=3). (e) Colony Forming Unit Assay for control cells (siNTC), cells silenced for HNRNPM or HNRNPH1, cells induced to splice out HNRNPA2B1 exon 9, and cells treated for all three modifications together (siALL). The same number of cells was plated in all experiments. The total number and the composition of colonies is displayed. Total colony numbers and colony type percentages were compared to the control (siNTC). Standard errors (SE) for colony numbers are displayed. In panels ( a–e) , significance values were determined by one way ANOVA with Sidák Post Hoc Test (*P

    Journal: Leukemia

    Article Title: SRSF2 mutations drive oncogenesis by activating a global program of aberrant alternative splicing in hematopoietic cells

    doi: 10.1038/s41375-018-0152-7

    Figure Lengend Snippet: SRSF2 mutations results in differential binding and splicing of HNRNP proteins (a–c) Differential binding and splicing in HNRNP proteins is shown for HNRNPA2B1 ( a ), HNRNPH1 ( b ), and HNRNPM ( c ). Left panels: transcript maps showing WT (red) and P95H (cyan) SRSF2 binding profiles. The maps display mean normalized HITS-CLIP signal with nucleotide resolution. Standard errors for each position are shown as ribbons under mean lines. Crosslinking-induced deletions are marked in black. Exon boundaries are represented as vertical dotted lines. Differential interaction sites are highlighted on the transcript. Center panels: RT-PCR capturing differentially bound exons was performed in 3–4 replicates in HEL cells with or without doxycycline induction of SRSF2 WT or P95H expression, and with or without knockdown of endogenous SRSF2, and in human fetal liver CD34+ cells transduced with empty, SRSF2 WT or SRSF2 P95H expressing lentivirus. Right panels: primary patient derived samples - alternative splice events were quantified in normal CD34+ (n=2), WT MDS/AML (n=6), and MUT MDS/AML (n=6) samples. The magnitude of the alternative splice event in % was calculated as ratio of alternative splice event to total expression. Considered bands are marked by an asterisk (*). Predicted band sizes and transcript sizes are indicated to the right of the gel. (d) Direct differential splicing of the HNRNPA2B1 exon 9 by WT vs P95H SRSF2 verified by a minigene splicing assay. RG6-HNRNPA2B1 plasmid was co-transfected with empty vector, SRSF2 WT, SRSF2 P95H/L/R, and control or SRSF2 siRNA. Alternative splicing of exon 9 was determined via semi-quantitative PCR by measuring the ratio of alternative exon exclusion over total (exclusion+inclusion) band intensities (n=3). (e) Colony Forming Unit Assay for control cells (siNTC), cells silenced for HNRNPM or HNRNPH1, cells induced to splice out HNRNPA2B1 exon 9, and cells treated for all three modifications together (siALL). The same number of cells was plated in all experiments. The total number and the composition of colonies is displayed. Total colony numbers and colony type percentages were compared to the control (siNTC). Standard errors (SE) for colony numbers are displayed. In panels ( a–e) , significance values were determined by one way ANOVA with Sidák Post Hoc Test (*P

    Article Snippet: Site-directed mutagenesis was performed to obtain SRSF2 mutants per standard protocol (Agilent Technologies).

    Techniques: Binding Assay, Cross-linking Immunoprecipitation, Reverse Transcription Polymerase Chain Reaction, Expressing, Transduction, Derivative Assay, Splicing Assay, Plasmid Preparation, Transfection, Real-time Polymerase Chain Reaction, Colony-forming Unit Assay

    The SRSF2 P95H mutation alters SRSF2 in vivo RNA interactome (a) Overview of the HITS-CLIP procedure. Top: generation of lentiviral vector constructs expressing C-terminally Flag-tagged SRSF2 WT and P95H in a doxycycline inducible manner. Center: HITS-CLIP key experimental steps. Bottom: computational identification of differentially bound regions, preferentially bound by WT (in red) or by P95H (in cyan) SRSF2. (b) Dose dependent inducible expression of Flag-tagged SRSF2 (WT and P95H). (c) Colony Forming Unit Assay for control CD34+ cells (mCherry), and cells with transient induction of SRSF2 WT or P95H. Left panel: total number of colonies. Right panel: composition of colonies (mean values + SEM). Total colony numbers and colony type percentages were compared between WT and P95H by two-tailed t-test (*P

    Journal: Leukemia

    Article Title: SRSF2 mutations drive oncogenesis by activating a global program of aberrant alternative splicing in hematopoietic cells

    doi: 10.1038/s41375-018-0152-7

    Figure Lengend Snippet: The SRSF2 P95H mutation alters SRSF2 in vivo RNA interactome (a) Overview of the HITS-CLIP procedure. Top: generation of lentiviral vector constructs expressing C-terminally Flag-tagged SRSF2 WT and P95H in a doxycycline inducible manner. Center: HITS-CLIP key experimental steps. Bottom: computational identification of differentially bound regions, preferentially bound by WT (in red) or by P95H (in cyan) SRSF2. (b) Dose dependent inducible expression of Flag-tagged SRSF2 (WT and P95H). (c) Colony Forming Unit Assay for control CD34+ cells (mCherry), and cells with transient induction of SRSF2 WT or P95H. Left panel: total number of colonies. Right panel: composition of colonies (mean values + SEM). Total colony numbers and colony type percentages were compared between WT and P95H by two-tailed t-test (*P

    Article Snippet: Site-directed mutagenesis was performed to obtain SRSF2 mutants per standard protocol (Agilent Technologies).

    Techniques: Mutagenesis, In Vivo, Cross-linking Immunoprecipitation, Plasmid Preparation, Construct, Expressing, Colony-forming Unit Assay, Two Tailed Test

    Differentially bound SRSF2 targets are enriched in RNA binding and splicing genes (a) Functional annotation enrichment analysis of differentially bound transcripts by WT and P95H SRSF2. The number of genes belonging to each category is displayed. (b) Protein-protein interaction network of SRSF2 RNA interactors associated with splicing. The size of each node is proportional to the number of differential SRSF2 binding sites: WT (in red), P95H (in cyan) or both (in violet).

    Journal: Leukemia

    Article Title: SRSF2 mutations drive oncogenesis by activating a global program of aberrant alternative splicing in hematopoietic cells

    doi: 10.1038/s41375-018-0152-7

    Figure Lengend Snippet: Differentially bound SRSF2 targets are enriched in RNA binding and splicing genes (a) Functional annotation enrichment analysis of differentially bound transcripts by WT and P95H SRSF2. The number of genes belonging to each category is displayed. (b) Protein-protein interaction network of SRSF2 RNA interactors associated with splicing. The size of each node is proportional to the number of differential SRSF2 binding sites: WT (in red), P95H (in cyan) or both (in violet).

    Article Snippet: Site-directed mutagenesis was performed to obtain SRSF2 mutants per standard protocol (Agilent Technologies).

    Techniques: RNA Binding Assay, Functional Assay, Binding Assay

    SRSF2 P95H mutations promote alternative splicing with inclusion of CCNG rich exons and enrichment in RNA binding and splicing genes (a) Determination of differential alternative splice events via rMATS analysis in HEL cells engineered to express SRSF2 WT vs P95H. Left panel: five classes of alternative splicing events were considered: cassette exon (CE), alternative 5′ splice site (A5SS), alternative 3′ splice site (A3SS), mutually exclusive exons (MXE) and retained intron (RI). Right panel: the number of significant events with more inclusion in WT or P95H cells is displayed. (b) Relative enrichment of the SSNG (S=C/G, N=C/G/A/T) RNA consensus motifs in cassette exons preferentially spliced in WT vs preferentially spliced in P95H SRSF2 expressing cells. The number of motif occurrences and enrichment p-values are displayed for each bar. (c) Overlap between genes with differential binding and differential splicing in HEL cells expressing either WT or P95H SRSF2. The significance of the overlap is displayed. (d) Functional annotation enrichment analysis of differentially spliced genes in WT vs P95H HEL cells. The number of genes falling into each category is indicated beside each bar.

    Journal: Leukemia

    Article Title: SRSF2 mutations drive oncogenesis by activating a global program of aberrant alternative splicing in hematopoietic cells

    doi: 10.1038/s41375-018-0152-7

    Figure Lengend Snippet: SRSF2 P95H mutations promote alternative splicing with inclusion of CCNG rich exons and enrichment in RNA binding and splicing genes (a) Determination of differential alternative splice events via rMATS analysis in HEL cells engineered to express SRSF2 WT vs P95H. Left panel: five classes of alternative splicing events were considered: cassette exon (CE), alternative 5′ splice site (A5SS), alternative 3′ splice site (A3SS), mutually exclusive exons (MXE) and retained intron (RI). Right panel: the number of significant events with more inclusion in WT or P95H cells is displayed. (b) Relative enrichment of the SSNG (S=C/G, N=C/G/A/T) RNA consensus motifs in cassette exons preferentially spliced in WT vs preferentially spliced in P95H SRSF2 expressing cells. The number of motif occurrences and enrichment p-values are displayed for each bar. (c) Overlap between genes with differential binding and differential splicing in HEL cells expressing either WT or P95H SRSF2. The significance of the overlap is displayed. (d) Functional annotation enrichment analysis of differentially spliced genes in WT vs P95H HEL cells. The number of genes falling into each category is indicated beside each bar.

    Article Snippet: Site-directed mutagenesis was performed to obtain SRSF2 mutants per standard protocol (Agilent Technologies).

    Techniques: RNA Binding Assay, Expressing, Binding Assay, Functional Assay

    The SRSF2 P95H mutation alters SRSF2 in vivo RNA motif specificity (a) Top enriched motifs for WT and P95H SRSF2 binding sites, identified by discriminative analysis of kmer composition. Corresponding p-values are displayed on top of each logo. (b) Relative enrichment of the SSNG (S=C/G, N=C/G/A/U) RNA consensus motifs in RNA regions preferentially bound by WT versus P95H SRSF2. The number of motif occurrences and differential enrichment p-values are displayed for each bar.

    Journal: Leukemia

    Article Title: SRSF2 mutations drive oncogenesis by activating a global program of aberrant alternative splicing in hematopoietic cells

    doi: 10.1038/s41375-018-0152-7

    Figure Lengend Snippet: The SRSF2 P95H mutation alters SRSF2 in vivo RNA motif specificity (a) Top enriched motifs for WT and P95H SRSF2 binding sites, identified by discriminative analysis of kmer composition. Corresponding p-values are displayed on top of each logo. (b) Relative enrichment of the SSNG (S=C/G, N=C/G/A/U) RNA consensus motifs in RNA regions preferentially bound by WT versus P95H SRSF2. The number of motif occurrences and differential enrichment p-values are displayed for each bar.

    Article Snippet: Site-directed mutagenesis was performed to obtain SRSF2 mutants per standard protocol (Agilent Technologies).

    Techniques: Mutagenesis, In Vivo, Binding Assay

    SRSF2 mutations results in differential binding and splicing of HNRNP proteins (a–c) Differential binding and splicing in HNRNP proteins is shown for HNRNPA2B1 ( a ), HNRNPH1 ( b ), and HNRNPM ( c ). Left panels: transcript maps showing WT (red) and P95H (cyan) SRSF2 binding profiles. The maps display mean normalized HITS-CLIP signal with nucleotide resolution. Standard errors for each position are shown as ribbons under mean lines. Crosslinking-induced deletions are marked in black. Exon boundaries are represented as vertical dotted lines. Differential interaction sites are highlighted on the transcript. Center panels: RT-PCR capturing differentially bound exons was performed in 3–4 replicates in HEL cells with or without doxycycline induction of SRSF2 WT or P95H expression, and with or without knockdown of endogenous SRSF2, and in human fetal liver CD34+ cells transduced with empty, SRSF2 WT or SRSF2 P95H expressing lentivirus. Right panels: primary patient derived samples - alternative splice events were quantified in normal CD34+ (n=2), WT MDS/AML (n=6), and MUT MDS/AML (n=6) samples. The magnitude of the alternative splice event in % was calculated as ratio of alternative splice event to total expression. Considered bands are marked by an asterisk (*). Predicted band sizes and transcript sizes are indicated to the right of the gel. (d) Direct differential splicing of the HNRNPA2B1 exon 9 by WT vs P95H SRSF2 verified by a minigene splicing assay. RG6-HNRNPA2B1 plasmid was co-transfected with empty vector, SRSF2 WT, SRSF2 P95H/L/R, and control or SRSF2 siRNA. Alternative splicing of exon 9 was determined via semi-quantitative PCR by measuring the ratio of alternative exon exclusion over total (exclusion+inclusion) band intensities (n=3). (e) Colony Forming Unit Assay for control cells (siNTC), cells silenced for HNRNPM or HNRNPH1, cells induced to splice out HNRNPA2B1 exon 9, and cells treated for all three modifications together (siALL). The same number of cells was plated in all experiments. The total number and the composition of colonies is displayed. Total colony numbers and colony type percentages were compared to the control (siNTC). Standard errors (SE) for colony numbers are displayed. In panels ( a–e) , significance values were determined by one way ANOVA with Sidák Post Hoc Test (*P

    Journal: Leukemia

    Article Title: SRSF2 mutations drive oncogenesis by activating a global program of aberrant alternative splicing in hematopoietic cells

    doi: 10.1038/s41375-018-0152-7

    Figure Lengend Snippet: SRSF2 mutations results in differential binding and splicing of HNRNP proteins (a–c) Differential binding and splicing in HNRNP proteins is shown for HNRNPA2B1 ( a ), HNRNPH1 ( b ), and HNRNPM ( c ). Left panels: transcript maps showing WT (red) and P95H (cyan) SRSF2 binding profiles. The maps display mean normalized HITS-CLIP signal with nucleotide resolution. Standard errors for each position are shown as ribbons under mean lines. Crosslinking-induced deletions are marked in black. Exon boundaries are represented as vertical dotted lines. Differential interaction sites are highlighted on the transcript. Center panels: RT-PCR capturing differentially bound exons was performed in 3–4 replicates in HEL cells with or without doxycycline induction of SRSF2 WT or P95H expression, and with or without knockdown of endogenous SRSF2, and in human fetal liver CD34+ cells transduced with empty, SRSF2 WT or SRSF2 P95H expressing lentivirus. Right panels: primary patient derived samples - alternative splice events were quantified in normal CD34+ (n=2), WT MDS/AML (n=6), and MUT MDS/AML (n=6) samples. The magnitude of the alternative splice event in % was calculated as ratio of alternative splice event to total expression. Considered bands are marked by an asterisk (*). Predicted band sizes and transcript sizes are indicated to the right of the gel. (d) Direct differential splicing of the HNRNPA2B1 exon 9 by WT vs P95H SRSF2 verified by a minigene splicing assay. RG6-HNRNPA2B1 plasmid was co-transfected with empty vector, SRSF2 WT, SRSF2 P95H/L/R, and control or SRSF2 siRNA. Alternative splicing of exon 9 was determined via semi-quantitative PCR by measuring the ratio of alternative exon exclusion over total (exclusion+inclusion) band intensities (n=3). (e) Colony Forming Unit Assay for control cells (siNTC), cells silenced for HNRNPM or HNRNPH1, cells induced to splice out HNRNPA2B1 exon 9, and cells treated for all three modifications together (siALL). The same number of cells was plated in all experiments. The total number and the composition of colonies is displayed. Total colony numbers and colony type percentages were compared to the control (siNTC). Standard errors (SE) for colony numbers are displayed. In panels ( a–e) , significance values were determined by one way ANOVA with Sidák Post Hoc Test (*P

    Article Snippet: Site-directed mutagenesis was performed to obtain SRSF2 mutants per standard protocol (Agilent Technologies).

    Techniques: Binding Assay, Cross-linking Immunoprecipitation, Reverse Transcription Polymerase Chain Reaction, Expressing, Transduction, Derivative Assay, Splicing Assay, Plasmid Preparation, Transfection, Real-time Polymerase Chain Reaction, Colony-forming Unit Assay

    The SRSF2 P95H mutation alters SRSF2 in vivo RNA interactome (a) Overview of the HITS-CLIP procedure. Top: generation of lentiviral vector constructs expressing C-terminally Flag-tagged SRSF2 WT and P95H in a doxycycline inducible manner. Center: HITS-CLIP key experimental steps. Bottom: computational identification of differentially bound regions, preferentially bound by WT (in red) or by P95H (in cyan) SRSF2. (b) Dose dependent inducible expression of Flag-tagged SRSF2 (WT and P95H). (c) Colony Forming Unit Assay for control CD34+ cells (mCherry), and cells with transient induction of SRSF2 WT or P95H. Left panel: total number of colonies. Right panel: composition of colonies (mean values + SEM). Total colony numbers and colony type percentages were compared between WT and P95H by two-tailed t-test (*P

    Journal: Leukemia

    Article Title: SRSF2 mutations drive oncogenesis by activating a global program of aberrant alternative splicing in hematopoietic cells

    doi: 10.1038/s41375-018-0152-7

    Figure Lengend Snippet: The SRSF2 P95H mutation alters SRSF2 in vivo RNA interactome (a) Overview of the HITS-CLIP procedure. Top: generation of lentiviral vector constructs expressing C-terminally Flag-tagged SRSF2 WT and P95H in a doxycycline inducible manner. Center: HITS-CLIP key experimental steps. Bottom: computational identification of differentially bound regions, preferentially bound by WT (in red) or by P95H (in cyan) SRSF2. (b) Dose dependent inducible expression of Flag-tagged SRSF2 (WT and P95H). (c) Colony Forming Unit Assay for control CD34+ cells (mCherry), and cells with transient induction of SRSF2 WT or P95H. Left panel: total number of colonies. Right panel: composition of colonies (mean values + SEM). Total colony numbers and colony type percentages were compared between WT and P95H by two-tailed t-test (*P

    Article Snippet: Site-directed mutagenesis was performed to obtain SRSF2 mutants per standard protocol (Agilent Technologies).

    Techniques: Mutagenesis, In Vivo, Cross-linking Immunoprecipitation, Plasmid Preparation, Construct, Expressing, Colony-forming Unit Assay, Two Tailed Test

    Differentially bound SRSF2 targets are enriched in RNA binding and splicing genes (a) Functional annotation enrichment analysis of differentially bound transcripts by WT and P95H SRSF2. The number of genes belonging to each category is displayed. (b) Protein-protein interaction network of SRSF2 RNA interactors associated with splicing. The size of each node is proportional to the number of differential SRSF2 binding sites: WT (in red), P95H (in cyan) or both (in violet).

    Journal: Leukemia

    Article Title: SRSF2 mutations drive oncogenesis by activating a global program of aberrant alternative splicing in hematopoietic cells

    doi: 10.1038/s41375-018-0152-7

    Figure Lengend Snippet: Differentially bound SRSF2 targets are enriched in RNA binding and splicing genes (a) Functional annotation enrichment analysis of differentially bound transcripts by WT and P95H SRSF2. The number of genes belonging to each category is displayed. (b) Protein-protein interaction network of SRSF2 RNA interactors associated with splicing. The size of each node is proportional to the number of differential SRSF2 binding sites: WT (in red), P95H (in cyan) or both (in violet).

    Article Snippet: Site-directed mutagenesis was performed to obtain SRSF2 mutants per standard protocol (Agilent Technologies).

    Techniques: RNA Binding Assay, Functional Assay, Binding Assay

    SRSF2 P95H mutations promote alternative splicing with inclusion of CCNG rich exons and enrichment in RNA binding and splicing genes (a) Determination of differential alternative splice events via rMATS analysis in HEL cells engineered to express SRSF2 WT vs P95H. Left panel: five classes of alternative splicing events were considered: cassette exon (CE), alternative 5′ splice site (A5SS), alternative 3′ splice site (A3SS), mutually exclusive exons (MXE) and retained intron (RI). Right panel: the number of significant events with more inclusion in WT or P95H cells is displayed. (b) Relative enrichment of the SSNG (S=C/G, N=C/G/A/T) RNA consensus motifs in cassette exons preferentially spliced in WT vs preferentially spliced in P95H SRSF2 expressing cells. The number of motif occurrences and enrichment p-values are displayed for each bar. (c) Overlap between genes with differential binding and differential splicing in HEL cells expressing either WT or P95H SRSF2. The significance of the overlap is displayed. (d) Functional annotation enrichment analysis of differentially spliced genes in WT vs P95H HEL cells. The number of genes falling into each category is indicated beside each bar.

    Journal: Leukemia

    Article Title: SRSF2 mutations drive oncogenesis by activating a global program of aberrant alternative splicing in hematopoietic cells

    doi: 10.1038/s41375-018-0152-7

    Figure Lengend Snippet: SRSF2 P95H mutations promote alternative splicing with inclusion of CCNG rich exons and enrichment in RNA binding and splicing genes (a) Determination of differential alternative splice events via rMATS analysis in HEL cells engineered to express SRSF2 WT vs P95H. Left panel: five classes of alternative splicing events were considered: cassette exon (CE), alternative 5′ splice site (A5SS), alternative 3′ splice site (A3SS), mutually exclusive exons (MXE) and retained intron (RI). Right panel: the number of significant events with more inclusion in WT or P95H cells is displayed. (b) Relative enrichment of the SSNG (S=C/G, N=C/G/A/T) RNA consensus motifs in cassette exons preferentially spliced in WT vs preferentially spliced in P95H SRSF2 expressing cells. The number of motif occurrences and enrichment p-values are displayed for each bar. (c) Overlap between genes with differential binding and differential splicing in HEL cells expressing either WT or P95H SRSF2. The significance of the overlap is displayed. (d) Functional annotation enrichment analysis of differentially spliced genes in WT vs P95H HEL cells. The number of genes falling into each category is indicated beside each bar.

    Article Snippet: Site-directed mutagenesis was performed to obtain SRSF2 mutants per standard protocol (Agilent Technologies).

    Techniques: RNA Binding Assay, Expressing, Binding Assay, Functional Assay