sphk1 activity assay  (Echelon Biosciences)


Bioz Verified Symbol Echelon Biosciences is a verified supplier
Bioz Manufacturer Symbol Echelon Biosciences manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    Echelon Biosciences sphk1 activity assay
    Specific knockdown of <t>SPHK1</t> in HSCs in BMT SCD chimeras reduced splenomegaly and tissue damage. ( A ) Spleen size and ( B ) H E staining of spleens, livers, and lungs of SCD chimeras with HSC-specific SPHK1 knockdown and controls. ( C ) Representative Evans blue staining and ( D ) quantification of its concentration in the lungs of the control SCD chimeras and SCD chimeras with specific SPHK1 knockdown. ( E ) Albumin concentrations in bronchial alveolar lavage (BAL) fluid collected from the control SCD chimeras and SCD chimeras with specific SPHK1 knockdown. Values shown represent the mean ± SEM ( n = 6–11). * P
    Sphk1 Activity Assay, supplied by Echelon Biosciences, used in various techniques. Bioz Stars score: 93/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sphk1 activity assay/product/Echelon Biosciences
    Average 93 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    sphk1 activity assay - by Bioz Stars, 2022-09
    93/100 stars

    Images

    1) Product Images from "Elevated sphingosine-1-phosphate promotes sickling and sickle cell disease progression"

    Article Title: Elevated sphingosine-1-phosphate promotes sickling and sickle cell disease progression

    Journal: The Journal of Clinical Investigation

    doi: 10.1172/JCI74604

    Specific knockdown of SPHK1 in HSCs in BMT SCD chimeras reduced splenomegaly and tissue damage. ( A ) Spleen size and ( B ) H E staining of spleens, livers, and lungs of SCD chimeras with HSC-specific SPHK1 knockdown and controls. ( C ) Representative Evans blue staining and ( D ) quantification of its concentration in the lungs of the control SCD chimeras and SCD chimeras with specific SPHK1 knockdown. ( E ) Albumin concentrations in bronchial alveolar lavage (BAL) fluid collected from the control SCD chimeras and SCD chimeras with specific SPHK1 knockdown. Values shown represent the mean ± SEM ( n = 6–11). * P
    Figure Legend Snippet: Specific knockdown of SPHK1 in HSCs in BMT SCD chimeras reduced splenomegaly and tissue damage. ( A ) Spleen size and ( B ) H E staining of spleens, livers, and lungs of SCD chimeras with HSC-specific SPHK1 knockdown and controls. ( C ) Representative Evans blue staining and ( D ) quantification of its concentration in the lungs of the control SCD chimeras and SCD chimeras with specific SPHK1 knockdown. ( E ) Albumin concentrations in bronchial alveolar lavage (BAL) fluid collected from the control SCD chimeras and SCD chimeras with specific SPHK1 knockdown. Values shown represent the mean ± SEM ( n = 6–11). * P

    Techniques Used: Staining, Concentration Assay

    SPHK1-mediated elevation of S1P contributes directly to hypoxia-induced sickling in cultured human sickle erythrocytes independent of S1P receptor activation. ( A – C ) Pretreatment of cultured primary erythrocytes isolated from patients with SCD with PF-543 inhibited hypoxia-mediated induction of ( A ) SPHK1 activity, ( B ) S1P production, and ( C ) sickling in a dosage-dependent manner. ( D ) Changes in the percentage of sickled cells in erythrocytes isolated from patients with SCD, following exposure to different hypoxic conditions in the absence or presence of PF-543 treatment. ( E ) S1P contributes to sickling independent of S1P receptor activation. S1P receptor antagonists (VPC, S1P 1 and S1P 3 receptor antagonist; JTE, S1P 2 receptor antagonist) did not reduce hypoxia-induced sickling. ( F ) Exogenous S1P (100 to 500 nM) did not enhance hypoxia-induced sickling in cultured human sickle erythrocytes under different hypoxia conditions. Data are presented as the mean ± SEM. * P
    Figure Legend Snippet: SPHK1-mediated elevation of S1P contributes directly to hypoxia-induced sickling in cultured human sickle erythrocytes independent of S1P receptor activation. ( A – C ) Pretreatment of cultured primary erythrocytes isolated from patients with SCD with PF-543 inhibited hypoxia-mediated induction of ( A ) SPHK1 activity, ( B ) S1P production, and ( C ) sickling in a dosage-dependent manner. ( D ) Changes in the percentage of sickled cells in erythrocytes isolated from patients with SCD, following exposure to different hypoxic conditions in the absence or presence of PF-543 treatment. ( E ) S1P contributes to sickling independent of S1P receptor activation. S1P receptor antagonists (VPC, S1P 1 and S1P 3 receptor antagonist; JTE, S1P 2 receptor antagonist) did not reduce hypoxia-induced sickling. ( F ) Exogenous S1P (100 to 500 nM) did not enhance hypoxia-induced sickling in cultured human sickle erythrocytes under different hypoxia conditions. Data are presented as the mean ± SEM. * P

    Techniques Used: Cell Culture, Activation Assay, Isolation, Activity Assay

    Erythrocyte SPHK1 activity and S1P levels in both erythrocytes and plasma are elevated in individuals with SCD. ( A and B ) Average S1P levels in ( A ) erythrocytes and ( B ) plasma from healthy volunteers (control, n = 14) and patients with SCD ( n = 30). ( C ) Erythrocyte SPHK1 activity for healthy volunteers (control, n = 14) and patients with SCD ( n = 30). Data are presented as the mean ± SEM. * P
    Figure Legend Snippet: Erythrocyte SPHK1 activity and S1P levels in both erythrocytes and plasma are elevated in individuals with SCD. ( A and B ) Average S1P levels in ( A ) erythrocytes and ( B ) plasma from healthy volunteers (control, n = 14) and patients with SCD ( n = 30). ( C ) Erythrocyte SPHK1 activity for healthy volunteers (control, n = 14) and patients with SCD ( n = 30). Data are presented as the mean ± SEM. * P

    Techniques Used: Activity Assay

    PF-543, a potent, specific SPHK1 inhibitor, reduces sickling, hemolysis, and inflammation in SCD Tg mice by reducing erythrocyte SPHK1 activity and S1P levels. ( A – C ) PF-543 treatment significantly reduced ( A ) erythrocyte SPHK1 activity, ( B ) erythrocyte levels, and ( C ) plasma levels of S1P in SCD Tg mice. ( D ) Representative blood smears of SCD Tg mice, as a function PF-543 treatment (original magnification, ×100). ( E ) Percentages of sickle cells and reticulocytes were significantly reduced by PF-543 treatment in SCD Tg mice. ( F – I ) Effects of PF-543 treatment on ( F ) plasma Hb, ( G ) plasma haptoglobin, ( H ) plasma total bilirubin, and ( I ) circulating cytokines in SCD Tg mice. Values shown represent the mean ± SEM ( n = 6–11). * P
    Figure Legend Snippet: PF-543, a potent, specific SPHK1 inhibitor, reduces sickling, hemolysis, and inflammation in SCD Tg mice by reducing erythrocyte SPHK1 activity and S1P levels. ( A – C ) PF-543 treatment significantly reduced ( A ) erythrocyte SPHK1 activity, ( B ) erythrocyte levels, and ( C ) plasma levels of S1P in SCD Tg mice. ( D ) Representative blood smears of SCD Tg mice, as a function PF-543 treatment (original magnification, ×100). ( E ) Percentages of sickle cells and reticulocytes were significantly reduced by PF-543 treatment in SCD Tg mice. ( F – I ) Effects of PF-543 treatment on ( F ) plasma Hb, ( G ) plasma haptoglobin, ( H ) plasma total bilirubin, and ( I ) circulating cytokines in SCD Tg mice. Values shown represent the mean ± SEM ( n = 6–11). * P

    Techniques Used: Mouse Assay, Activity Assay

    Specific knockdown of SPHK1 in HSCs in BMT SCD chimeras reduced erythrocyte SPHK1 protein levels and erythrocyte and plasma S1P levels. ( A ) HPLC and electrophoresis analysis of HbS and mouse normal Hb (HbA) in BMT SCD chimeras to assess the percentage of chimerism. Representative electrophoresis analysis and the average of percentage of chimerism with HbS in SCD chimeras were shown as insets. Data shown represent the mean ± SEM ( n = 6–9). ( B ) Erythrocyte SPHK1 levels, ( C ) activity, ( D ) plasma S1P levels, and ( E ) erythrocyte S1P levels were significantly reduced in the SCD chimeras with specific SPHK1 knockdown compared with those in mice with BMCs infected with a scrambled shRNA. * P
    Figure Legend Snippet: Specific knockdown of SPHK1 in HSCs in BMT SCD chimeras reduced erythrocyte SPHK1 protein levels and erythrocyte and plasma S1P levels. ( A ) HPLC and electrophoresis analysis of HbS and mouse normal Hb (HbA) in BMT SCD chimeras to assess the percentage of chimerism. Representative electrophoresis analysis and the average of percentage of chimerism with HbS in SCD chimeras were shown as insets. Data shown represent the mean ± SEM ( n = 6–9). ( B ) Erythrocyte SPHK1 levels, ( C ) activity, ( D ) plasma S1P levels, and ( E ) erythrocyte S1P levels were significantly reduced in the SCD chimeras with specific SPHK1 knockdown compared with those in mice with BMCs infected with a scrambled shRNA. * P

    Techniques Used: High Performance Liquid Chromatography, Electrophoresis, Activity Assay, Mouse Assay, Infection, shRNA

    Specific knockdown of SPHK1 in HSCs in BMT SCD chimeras reduced sickling, hemolysis, inflammation, and prolonged life span of erythrocytes. ( A ) Blood smears of SCD chimeras with or without SPHK1 knockdown (original magnification, ×100). ( B ) Percentages of sickle cells and reticulocytes were significantly reduced in the SCD chimeras with HSC-specific SPHK1 knockdown. ( C – E ) SPHK1 knockdown in HSCs ( C ) decreased plasma Hb levels, ( D ) prolonged life span of erythrocytes, and ( E ) reduced circulating cytokines in SCD chimeras. Values shown represent the mean ± SEM ( n = 6–11). * P
    Figure Legend Snippet: Specific knockdown of SPHK1 in HSCs in BMT SCD chimeras reduced sickling, hemolysis, inflammation, and prolonged life span of erythrocytes. ( A ) Blood smears of SCD chimeras with or without SPHK1 knockdown (original magnification, ×100). ( B ) Percentages of sickle cells and reticulocytes were significantly reduced in the SCD chimeras with HSC-specific SPHK1 knockdown. ( C – E ) SPHK1 knockdown in HSCs ( C ) decreased plasma Hb levels, ( D ) prolonged life span of erythrocytes, and ( E ) reduced circulating cytokines in SCD chimeras. Values shown represent the mean ± SEM ( n = 6–11). * P

    Techniques Used:

    Specific knockdown of SPHK1 in HSCs in BMT SCD chimeras increased survival rates and reduced pulmonary congestion and inflammation under hypoxic conditions. ( A ) Knockdown of SPHK1 in HSCs prolonged survival rates of BMT SCD chimeras under hypoxic conditions with 8% O 2 concentration. ( B and C ) Knockdown of SPHK1 in HSCs in SCD chimeras ( B ) reduced hypoxia-induced pulmonary congestion and ( C ) decreased elevation of multiple cytokines in the lung tissue. Values shown represent the mean ± SEM ( n = 6–9). * P
    Figure Legend Snippet: Specific knockdown of SPHK1 in HSCs in BMT SCD chimeras increased survival rates and reduced pulmonary congestion and inflammation under hypoxic conditions. ( A ) Knockdown of SPHK1 in HSCs prolonged survival rates of BMT SCD chimeras under hypoxic conditions with 8% O 2 concentration. ( B and C ) Knockdown of SPHK1 in HSCs in SCD chimeras ( B ) reduced hypoxia-induced pulmonary congestion and ( C ) decreased elevation of multiple cytokines in the lung tissue. Values shown represent the mean ± SEM ( n = 6–9). * P

    Techniques Used: Concentration Assay

    Metabolomic screening reveals that blood S1P levels and erythrocyte SPHK1 activity are elevated in SCD Tg mice. ( A ) Z-score quantification of lipids detected in the blood of both WT and SCD Tg mice. Among all lipids detected, S1P was one of the most substantially elevated in the blood of SCD Tg mice compared with that in WT mice ( n = 6). ( B and C ) LC/MS POS platform measurement indicates that S1P levels in the ( B ) erythrocytes and ( C ) plasma of SCD mice were significantly elevated compared with those in WT mice ( n = 6–8). ( D ) Total erythrocyte SPHK1 activity was significantly elevated in SCD Tg mice compared with that in WT mice ( n = 8). ( E ) SPHK1 activities in purified reticulocytes and mature erythrocytes of SCD Tg mice. Values shown represent the mean ± SEM ( n = 6–8). * P
    Figure Legend Snippet: Metabolomic screening reveals that blood S1P levels and erythrocyte SPHK1 activity are elevated in SCD Tg mice. ( A ) Z-score quantification of lipids detected in the blood of both WT and SCD Tg mice. Among all lipids detected, S1P was one of the most substantially elevated in the blood of SCD Tg mice compared with that in WT mice ( n = 6). ( B and C ) LC/MS POS platform measurement indicates that S1P levels in the ( B ) erythrocytes and ( C ) plasma of SCD mice were significantly elevated compared with those in WT mice ( n = 6–8). ( D ) Total erythrocyte SPHK1 activity was significantly elevated in SCD Tg mice compared with that in WT mice ( n = 8). ( E ) SPHK1 activities in purified reticulocytes and mature erythrocytes of SCD Tg mice. Values shown represent the mean ± SEM ( n = 6–8). * P

    Techniques Used: Activity Assay, Mouse Assay, Liquid Chromatography with Mass Spectroscopy, Purification

    2) Product Images from "K27Q/K29Q mutations in sphingosine kinase 1 attenuate high-fat diet induced obesity and altered glucose homeostasis in mice"

    Article Title: K27Q/K29Q mutations in sphingosine kinase 1 attenuate high-fat diet induced obesity and altered glucose homeostasis in mice

    Journal: Scientific Reports

    doi: 10.1038/s41598-020-77096-w

    Generation of QSPHK1 knock-in mice. ( A ) Schematic diagram of Sphk1 K27Q K29Q (QSPHK1) targeting strategy. ( B ) Genotyping of QSPHK1 and WT mice. Genomic DNA was extracted from the tails of the mice and used as templates for PCR amplification of the region flanking the Frt site. Then PCR products were subjected to electrophoresis on a 1.5% agarose gel. Lane M: DNA marker. Lane 1 and 3: homozygous QSPHK1 and WT mice, respectively. Lane 2: heterozygous mice. ( C ) Confirmation of codon substitution of K27Q and K29Q in Sphk1 by sequencing. PCR products of exon 3 of S phk1 were amplified with primers (SPKF: 5′- AGAGCAGCAAGTGCTCTTACCT-3′ and SPKR: 5′- GTCAGCACTCACCGGTGAGTAT -3′) and then sequenced.
    Figure Legend Snippet: Generation of QSPHK1 knock-in mice. ( A ) Schematic diagram of Sphk1 K27Q K29Q (QSPHK1) targeting strategy. ( B ) Genotyping of QSPHK1 and WT mice. Genomic DNA was extracted from the tails of the mice and used as templates for PCR amplification of the region flanking the Frt site. Then PCR products were subjected to electrophoresis on a 1.5% agarose gel. Lane M: DNA marker. Lane 1 and 3: homozygous QSPHK1 and WT mice, respectively. Lane 2: heterozygous mice. ( C ) Confirmation of codon substitution of K27Q and K29Q in Sphk1 by sequencing. PCR products of exon 3 of S phk1 were amplified with primers (SPKF: 5′- AGAGCAGCAAGTGCTCTTACCT-3′ and SPKR: 5′- GTCAGCACTCACCGGTGAGTAT -3′) and then sequenced.

    Techniques Used: Knock-In, Mouse Assay, Polymerase Chain Reaction, Amplification, Electrophoresis, Agarose Gel Electrophoresis, Marker, Sequencing

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    Echelon Biosciences sphk1 activity assay
    Specific knockdown of <t>SPHK1</t> in HSCs in BMT SCD chimeras reduced splenomegaly and tissue damage. ( A ) Spleen size and ( B ) H E staining of spleens, livers, and lungs of SCD chimeras with HSC-specific SPHK1 knockdown and controls. ( C ) Representative Evans blue staining and ( D ) quantification of its concentration in the lungs of the control SCD chimeras and SCD chimeras with specific SPHK1 knockdown. ( E ) Albumin concentrations in bronchial alveolar lavage (BAL) fluid collected from the control SCD chimeras and SCD chimeras with specific SPHK1 knockdown. Values shown represent the mean ± SEM ( n = 6–11). * P
    Sphk1 Activity Assay, supplied by Echelon Biosciences, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sphk1 activity assay/product/Echelon Biosciences
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    sphk1 activity assay - by Bioz Stars, 2022-09
    93/100 stars
      Buy from Supplier

    Image Search Results


    Specific knockdown of SPHK1 in HSCs in BMT SCD chimeras reduced splenomegaly and tissue damage. ( A ) Spleen size and ( B ) H E staining of spleens, livers, and lungs of SCD chimeras with HSC-specific SPHK1 knockdown and controls. ( C ) Representative Evans blue staining and ( D ) quantification of its concentration in the lungs of the control SCD chimeras and SCD chimeras with specific SPHK1 knockdown. ( E ) Albumin concentrations in bronchial alveolar lavage (BAL) fluid collected from the control SCD chimeras and SCD chimeras with specific SPHK1 knockdown. Values shown represent the mean ± SEM ( n = 6–11). * P

    Journal: The Journal of Clinical Investigation

    Article Title: Elevated sphingosine-1-phosphate promotes sickling and sickle cell disease progression

    doi: 10.1172/JCI74604

    Figure Lengend Snippet: Specific knockdown of SPHK1 in HSCs in BMT SCD chimeras reduced splenomegaly and tissue damage. ( A ) Spleen size and ( B ) H E staining of spleens, livers, and lungs of SCD chimeras with HSC-specific SPHK1 knockdown and controls. ( C ) Representative Evans blue staining and ( D ) quantification of its concentration in the lungs of the control SCD chimeras and SCD chimeras with specific SPHK1 knockdown. ( E ) Albumin concentrations in bronchial alveolar lavage (BAL) fluid collected from the control SCD chimeras and SCD chimeras with specific SPHK1 knockdown. Values shown represent the mean ± SEM ( n = 6–11). * P

    Article Snippet: One part of cell lysates was used for SPHK1 activity measurement by SPHK1 activity assay (Echelon Bioscience).

    Techniques: Staining, Concentration Assay

    SPHK1-mediated elevation of S1P contributes directly to hypoxia-induced sickling in cultured human sickle erythrocytes independent of S1P receptor activation. ( A – C ) Pretreatment of cultured primary erythrocytes isolated from patients with SCD with PF-543 inhibited hypoxia-mediated induction of ( A ) SPHK1 activity, ( B ) S1P production, and ( C ) sickling in a dosage-dependent manner. ( D ) Changes in the percentage of sickled cells in erythrocytes isolated from patients with SCD, following exposure to different hypoxic conditions in the absence or presence of PF-543 treatment. ( E ) S1P contributes to sickling independent of S1P receptor activation. S1P receptor antagonists (VPC, S1P 1 and S1P 3 receptor antagonist; JTE, S1P 2 receptor antagonist) did not reduce hypoxia-induced sickling. ( F ) Exogenous S1P (100 to 500 nM) did not enhance hypoxia-induced sickling in cultured human sickle erythrocytes under different hypoxia conditions. Data are presented as the mean ± SEM. * P

    Journal: The Journal of Clinical Investigation

    Article Title: Elevated sphingosine-1-phosphate promotes sickling and sickle cell disease progression

    doi: 10.1172/JCI74604

    Figure Lengend Snippet: SPHK1-mediated elevation of S1P contributes directly to hypoxia-induced sickling in cultured human sickle erythrocytes independent of S1P receptor activation. ( A – C ) Pretreatment of cultured primary erythrocytes isolated from patients with SCD with PF-543 inhibited hypoxia-mediated induction of ( A ) SPHK1 activity, ( B ) S1P production, and ( C ) sickling in a dosage-dependent manner. ( D ) Changes in the percentage of sickled cells in erythrocytes isolated from patients with SCD, following exposure to different hypoxic conditions in the absence or presence of PF-543 treatment. ( E ) S1P contributes to sickling independent of S1P receptor activation. S1P receptor antagonists (VPC, S1P 1 and S1P 3 receptor antagonist; JTE, S1P 2 receptor antagonist) did not reduce hypoxia-induced sickling. ( F ) Exogenous S1P (100 to 500 nM) did not enhance hypoxia-induced sickling in cultured human sickle erythrocytes under different hypoxia conditions. Data are presented as the mean ± SEM. * P

    Article Snippet: One part of cell lysates was used for SPHK1 activity measurement by SPHK1 activity assay (Echelon Bioscience).

    Techniques: Cell Culture, Activation Assay, Isolation, Activity Assay

    Erythrocyte SPHK1 activity and S1P levels in both erythrocytes and plasma are elevated in individuals with SCD. ( A and B ) Average S1P levels in ( A ) erythrocytes and ( B ) plasma from healthy volunteers (control, n = 14) and patients with SCD ( n = 30). ( C ) Erythrocyte SPHK1 activity for healthy volunteers (control, n = 14) and patients with SCD ( n = 30). Data are presented as the mean ± SEM. * P

    Journal: The Journal of Clinical Investigation

    Article Title: Elevated sphingosine-1-phosphate promotes sickling and sickle cell disease progression

    doi: 10.1172/JCI74604

    Figure Lengend Snippet: Erythrocyte SPHK1 activity and S1P levels in both erythrocytes and plasma are elevated in individuals with SCD. ( A and B ) Average S1P levels in ( A ) erythrocytes and ( B ) plasma from healthy volunteers (control, n = 14) and patients with SCD ( n = 30). ( C ) Erythrocyte SPHK1 activity for healthy volunteers (control, n = 14) and patients with SCD ( n = 30). Data are presented as the mean ± SEM. * P

    Article Snippet: One part of cell lysates was used for SPHK1 activity measurement by SPHK1 activity assay (Echelon Bioscience).

    Techniques: Activity Assay

    PF-543, a potent, specific SPHK1 inhibitor, reduces sickling, hemolysis, and inflammation in SCD Tg mice by reducing erythrocyte SPHK1 activity and S1P levels. ( A – C ) PF-543 treatment significantly reduced ( A ) erythrocyte SPHK1 activity, ( B ) erythrocyte levels, and ( C ) plasma levels of S1P in SCD Tg mice. ( D ) Representative blood smears of SCD Tg mice, as a function PF-543 treatment (original magnification, ×100). ( E ) Percentages of sickle cells and reticulocytes were significantly reduced by PF-543 treatment in SCD Tg mice. ( F – I ) Effects of PF-543 treatment on ( F ) plasma Hb, ( G ) plasma haptoglobin, ( H ) plasma total bilirubin, and ( I ) circulating cytokines in SCD Tg mice. Values shown represent the mean ± SEM ( n = 6–11). * P

    Journal: The Journal of Clinical Investigation

    Article Title: Elevated sphingosine-1-phosphate promotes sickling and sickle cell disease progression

    doi: 10.1172/JCI74604

    Figure Lengend Snippet: PF-543, a potent, specific SPHK1 inhibitor, reduces sickling, hemolysis, and inflammation in SCD Tg mice by reducing erythrocyte SPHK1 activity and S1P levels. ( A – C ) PF-543 treatment significantly reduced ( A ) erythrocyte SPHK1 activity, ( B ) erythrocyte levels, and ( C ) plasma levels of S1P in SCD Tg mice. ( D ) Representative blood smears of SCD Tg mice, as a function PF-543 treatment (original magnification, ×100). ( E ) Percentages of sickle cells and reticulocytes were significantly reduced by PF-543 treatment in SCD Tg mice. ( F – I ) Effects of PF-543 treatment on ( F ) plasma Hb, ( G ) plasma haptoglobin, ( H ) plasma total bilirubin, and ( I ) circulating cytokines in SCD Tg mice. Values shown represent the mean ± SEM ( n = 6–11). * P

    Article Snippet: One part of cell lysates was used for SPHK1 activity measurement by SPHK1 activity assay (Echelon Bioscience).

    Techniques: Mouse Assay, Activity Assay

    Specific knockdown of SPHK1 in HSCs in BMT SCD chimeras reduced erythrocyte SPHK1 protein levels and erythrocyte and plasma S1P levels. ( A ) HPLC and electrophoresis analysis of HbS and mouse normal Hb (HbA) in BMT SCD chimeras to assess the percentage of chimerism. Representative electrophoresis analysis and the average of percentage of chimerism with HbS in SCD chimeras were shown as insets. Data shown represent the mean ± SEM ( n = 6–9). ( B ) Erythrocyte SPHK1 levels, ( C ) activity, ( D ) plasma S1P levels, and ( E ) erythrocyte S1P levels were significantly reduced in the SCD chimeras with specific SPHK1 knockdown compared with those in mice with BMCs infected with a scrambled shRNA. * P

    Journal: The Journal of Clinical Investigation

    Article Title: Elevated sphingosine-1-phosphate promotes sickling and sickle cell disease progression

    doi: 10.1172/JCI74604

    Figure Lengend Snippet: Specific knockdown of SPHK1 in HSCs in BMT SCD chimeras reduced erythrocyte SPHK1 protein levels and erythrocyte and plasma S1P levels. ( A ) HPLC and electrophoresis analysis of HbS and mouse normal Hb (HbA) in BMT SCD chimeras to assess the percentage of chimerism. Representative electrophoresis analysis and the average of percentage of chimerism with HbS in SCD chimeras were shown as insets. Data shown represent the mean ± SEM ( n = 6–9). ( B ) Erythrocyte SPHK1 levels, ( C ) activity, ( D ) plasma S1P levels, and ( E ) erythrocyte S1P levels were significantly reduced in the SCD chimeras with specific SPHK1 knockdown compared with those in mice with BMCs infected with a scrambled shRNA. * P

    Article Snippet: One part of cell lysates was used for SPHK1 activity measurement by SPHK1 activity assay (Echelon Bioscience).

    Techniques: High Performance Liquid Chromatography, Electrophoresis, Activity Assay, Mouse Assay, Infection, shRNA

    Specific knockdown of SPHK1 in HSCs in BMT SCD chimeras reduced sickling, hemolysis, inflammation, and prolonged life span of erythrocytes. ( A ) Blood smears of SCD chimeras with or without SPHK1 knockdown (original magnification, ×100). ( B ) Percentages of sickle cells and reticulocytes were significantly reduced in the SCD chimeras with HSC-specific SPHK1 knockdown. ( C – E ) SPHK1 knockdown in HSCs ( C ) decreased plasma Hb levels, ( D ) prolonged life span of erythrocytes, and ( E ) reduced circulating cytokines in SCD chimeras. Values shown represent the mean ± SEM ( n = 6–11). * P

    Journal: The Journal of Clinical Investigation

    Article Title: Elevated sphingosine-1-phosphate promotes sickling and sickle cell disease progression

    doi: 10.1172/JCI74604

    Figure Lengend Snippet: Specific knockdown of SPHK1 in HSCs in BMT SCD chimeras reduced sickling, hemolysis, inflammation, and prolonged life span of erythrocytes. ( A ) Blood smears of SCD chimeras with or without SPHK1 knockdown (original magnification, ×100). ( B ) Percentages of sickle cells and reticulocytes were significantly reduced in the SCD chimeras with HSC-specific SPHK1 knockdown. ( C – E ) SPHK1 knockdown in HSCs ( C ) decreased plasma Hb levels, ( D ) prolonged life span of erythrocytes, and ( E ) reduced circulating cytokines in SCD chimeras. Values shown represent the mean ± SEM ( n = 6–11). * P

    Article Snippet: One part of cell lysates was used for SPHK1 activity measurement by SPHK1 activity assay (Echelon Bioscience).

    Techniques:

    Specific knockdown of SPHK1 in HSCs in BMT SCD chimeras increased survival rates and reduced pulmonary congestion and inflammation under hypoxic conditions. ( A ) Knockdown of SPHK1 in HSCs prolonged survival rates of BMT SCD chimeras under hypoxic conditions with 8% O 2 concentration. ( B and C ) Knockdown of SPHK1 in HSCs in SCD chimeras ( B ) reduced hypoxia-induced pulmonary congestion and ( C ) decreased elevation of multiple cytokines in the lung tissue. Values shown represent the mean ± SEM ( n = 6–9). * P

    Journal: The Journal of Clinical Investigation

    Article Title: Elevated sphingosine-1-phosphate promotes sickling and sickle cell disease progression

    doi: 10.1172/JCI74604

    Figure Lengend Snippet: Specific knockdown of SPHK1 in HSCs in BMT SCD chimeras increased survival rates and reduced pulmonary congestion and inflammation under hypoxic conditions. ( A ) Knockdown of SPHK1 in HSCs prolonged survival rates of BMT SCD chimeras under hypoxic conditions with 8% O 2 concentration. ( B and C ) Knockdown of SPHK1 in HSCs in SCD chimeras ( B ) reduced hypoxia-induced pulmonary congestion and ( C ) decreased elevation of multiple cytokines in the lung tissue. Values shown represent the mean ± SEM ( n = 6–9). * P

    Article Snippet: One part of cell lysates was used for SPHK1 activity measurement by SPHK1 activity assay (Echelon Bioscience).

    Techniques: Concentration Assay

    Metabolomic screening reveals that blood S1P levels and erythrocyte SPHK1 activity are elevated in SCD Tg mice. ( A ) Z-score quantification of lipids detected in the blood of both WT and SCD Tg mice. Among all lipids detected, S1P was one of the most substantially elevated in the blood of SCD Tg mice compared with that in WT mice ( n = 6). ( B and C ) LC/MS POS platform measurement indicates that S1P levels in the ( B ) erythrocytes and ( C ) plasma of SCD mice were significantly elevated compared with those in WT mice ( n = 6–8). ( D ) Total erythrocyte SPHK1 activity was significantly elevated in SCD Tg mice compared with that in WT mice ( n = 8). ( E ) SPHK1 activities in purified reticulocytes and mature erythrocytes of SCD Tg mice. Values shown represent the mean ± SEM ( n = 6–8). * P

    Journal: The Journal of Clinical Investigation

    Article Title: Elevated sphingosine-1-phosphate promotes sickling and sickle cell disease progression

    doi: 10.1172/JCI74604

    Figure Lengend Snippet: Metabolomic screening reveals that blood S1P levels and erythrocyte SPHK1 activity are elevated in SCD Tg mice. ( A ) Z-score quantification of lipids detected in the blood of both WT and SCD Tg mice. Among all lipids detected, S1P was one of the most substantially elevated in the blood of SCD Tg mice compared with that in WT mice ( n = 6). ( B and C ) LC/MS POS platform measurement indicates that S1P levels in the ( B ) erythrocytes and ( C ) plasma of SCD mice were significantly elevated compared with those in WT mice ( n = 6–8). ( D ) Total erythrocyte SPHK1 activity was significantly elevated in SCD Tg mice compared with that in WT mice ( n = 8). ( E ) SPHK1 activities in purified reticulocytes and mature erythrocytes of SCD Tg mice. Values shown represent the mean ± SEM ( n = 6–8). * P

    Article Snippet: One part of cell lysates was used for SPHK1 activity measurement by SPHK1 activity assay (Echelon Bioscience).

    Techniques: Activity Assay, Mouse Assay, Liquid Chromatography with Mass Spectroscopy, Purification

    Generation of QSPHK1 knock-in mice. ( A ) Schematic diagram of Sphk1 K27Q K29Q (QSPHK1) targeting strategy. ( B ) Genotyping of QSPHK1 and WT mice. Genomic DNA was extracted from the tails of the mice and used as templates for PCR amplification of the region flanking the Frt site. Then PCR products were subjected to electrophoresis on a 1.5% agarose gel. Lane M: DNA marker. Lane 1 and 3: homozygous QSPHK1 and WT mice, respectively. Lane 2: heterozygous mice. ( C ) Confirmation of codon substitution of K27Q and K29Q in Sphk1 by sequencing. PCR products of exon 3 of S phk1 were amplified with primers (SPKF: 5′- AGAGCAGCAAGTGCTCTTACCT-3′ and SPKR: 5′- GTCAGCACTCACCGGTGAGTAT -3′) and then sequenced.

    Journal: Scientific Reports

    Article Title: K27Q/K29Q mutations in sphingosine kinase 1 attenuate high-fat diet induced obesity and altered glucose homeostasis in mice

    doi: 10.1038/s41598-020-77096-w

    Figure Lengend Snippet: Generation of QSPHK1 knock-in mice. ( A ) Schematic diagram of Sphk1 K27Q K29Q (QSPHK1) targeting strategy. ( B ) Genotyping of QSPHK1 and WT mice. Genomic DNA was extracted from the tails of the mice and used as templates for PCR amplification of the region flanking the Frt site. Then PCR products were subjected to electrophoresis on a 1.5% agarose gel. Lane M: DNA marker. Lane 1 and 3: homozygous QSPHK1 and WT mice, respectively. Lane 2: heterozygous mice. ( C ) Confirmation of codon substitution of K27Q and K29Q in Sphk1 by sequencing. PCR products of exon 3 of S phk1 were amplified with primers (SPKF: 5′- AGAGCAGCAAGTGCTCTTACCT-3′ and SPKR: 5′- GTCAGCACTCACCGGTGAGTAT -3′) and then sequenced.

    Article Snippet: Measurement of Sphk1 activity0.1 g tissue extracts from liver were used for Sphk1 activity assay with a commercial kit according to the manufacturer’s instructions (Sphingosine Kinase Activity Assay Kit, Echelon Biosciences Inc.).

    Techniques: Knock-In, Mouse Assay, Polymerase Chain Reaction, Amplification, Electrophoresis, Agarose Gel Electrophoresis, Marker, Sequencing

    Impact of tamoxifen and LCL204 on AC and Sphk1 expression and Sphk1 activity in AML cell lines. (A) Tamoxifen dose-response in KG-1 cells. KG-1 cells were seeded in 6-well plates, 5 × 10 6 /well, in media containing 5% FBS. After 60 min, cells were

    Journal: Biochimica et biophysica acta

    Article Title: Modification of sphingolipid metabolism by tamoxifen and N-desmethyltamoxifen in acute myelogenous leukemia – Impact on enzyme activity and response to cytotoxics

    doi: 10.1016/j.bbalip.2015.03.001

    Figure Lengend Snippet: Impact of tamoxifen and LCL204 on AC and Sphk1 expression and Sphk1 activity in AML cell lines. (A) Tamoxifen dose-response in KG-1 cells. KG-1 cells were seeded in 6-well plates, 5 × 10 6 /well, in media containing 5% FBS. After 60 min, cells were

    Article Snippet: Sphk1 activity was quantified by using a commercial Sphingosine Kinase Activity Assay Kit (Echelon Biosciences, Salt Lake City, UT) as the manufacturer instructed.

    Techniques: Expressing, Activity Assay