snp cyp2a6 c 27861808 60  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 85

    Structured Review

    Thermo Fisher snp cyp2a6 c 27861808 60
    Allelic discrimination plot of <t>CYP2A6*2</t> rs1801272 genotypes
    Snp Cyp2a6 C 27861808 60, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/snp cyp2a6 c 27861808 60/product/Thermo Fisher
    Average 85 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    snp cyp2a6 c 27861808 60 - by Bioz Stars, 2020-08
    85/100 stars

    Images

    1) Product Images from "Association of genetic polymorphisms CYP2A6*2 rs1801272 and CYP2A6*9 rs28399433 with tobacco-induced lung Cancer: case-control study in an Egyptian population"

    Article Title: Association of genetic polymorphisms CYP2A6*2 rs1801272 and CYP2A6*9 rs28399433 with tobacco-induced lung Cancer: case-control study in an Egyptian population

    Journal: BMC Cancer

    doi: 10.1186/s12885-018-4342-5

    Allelic discrimination plot of CYP2A6*2 rs1801272 genotypes
    Figure Legend Snippet: Allelic discrimination plot of CYP2A6*2 rs1801272 genotypes

    Techniques Used:

    Allelic discrimination plot of CYP2A6*9 rs28399433 genotypes
    Figure Legend Snippet: Allelic discrimination plot of CYP2A6*9 rs28399433 genotypes

    Techniques Used:

    2) Product Images from "Association of genetic polymorphisms CYP2A6*2 rs1801272 and CYP2A6*9 rs28399433 with tobacco-induced lung Cancer: case-control study in an Egyptian population"

    Article Title: Association of genetic polymorphisms CYP2A6*2 rs1801272 and CYP2A6*9 rs28399433 with tobacco-induced lung Cancer: case-control study in an Egyptian population

    Journal: BMC Cancer

    doi: 10.1186/s12885-018-4342-5

    Allelic discrimination plot of CYP2A6*9 rs28399433 genotypes
    Figure Legend Snippet: Allelic discrimination plot of CYP2A6*9 rs28399433 genotypes

    Techniques Used:

    Related Articles

    Sequencing:

    Article Title: Association of genetic polymorphisms CYP2A6*2 rs1801272 and CYP2A6*9 rs28399433 with tobacco-induced lung Cancer: case-control study in an Egyptian population
    Article Snippet: .. For CYP2A6*2 (1799 T > A ) [rs1801272; assay ID: C_27861808_60], the VIC/FAM sequence was as follows: CCCCTGCTCACCGCCAGTGCCCCGG[T/A]GGGCGTCGATGAGGAAGCCCGCCTC. .. For CYP2A6*9 (− 48 T > G) [rs28399433; assay ID: C_30634332_10], the VIC/FAM sequence was as follows: GTGACGGCTGGGGTGGTTTGCCTTT[A/C]TACTGCCTGAAAAAGAGGGATGGAC.

    Article Title: Association of genetic polymorphisms CYP2A6*2 rs1801272 and CYP2A6*9 rs28399433 with tobacco-induced lung Cancer: case-control study in an Egyptian population
    Article Snippet: .. For CYP2A6*2 (1799 T > A ) [rs1801272; assay ID: C_27861808_60], the VIC/FAM sequence was as follows: CCCCTGCTCACCGCCAGTGCCCCGG[T/A]GGGCGTCGATGAGGAAGCCCGCCTC. .. For CYP2A6*9 (− 48 T > G) [rs28399433; assay ID: C_30634332_10], the VIC/FAM sequence was as follows: GTGACGGCTGGGGTGGTTTGCCTTT[A/C]TACTGCCTGAAAAAGAGGGATGGAC.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 85
    Thermo Fisher snp cyp2a6 c 27861808 60
    Allelic discrimination plot of <t>CYP2A6*2</t> rs1801272 genotypes
    Snp Cyp2a6 C 27861808 60, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/snp cyp2a6 c 27861808 60/product/Thermo Fisher
    Average 85 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    snp cyp2a6 c 27861808 60 - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    Image Search Results


    Allelic discrimination plot of CYP2A6*2 rs1801272 genotypes

    Journal: BMC Cancer

    Article Title: Association of genetic polymorphisms CYP2A6*2 rs1801272 and CYP2A6*9 rs28399433 with tobacco-induced lung Cancer: case-control study in an Egyptian population

    doi: 10.1186/s12885-018-4342-5

    Figure Lengend Snippet: Allelic discrimination plot of CYP2A6*2 rs1801272 genotypes

    Article Snippet: For CYP2A6*2 (1799 T > A ) [rs1801272; assay ID: C_27861808_60], the VIC/FAM sequence was as follows: CCCCTGCTCACCGCCAGTGCCCCGG[T/A]GGGCGTCGATGAGGAAGCCCGCCTC.

    Techniques:

    Allelic discrimination plot of CYP2A6*9 rs28399433 genotypes

    Journal: BMC Cancer

    Article Title: Association of genetic polymorphisms CYP2A6*2 rs1801272 and CYP2A6*9 rs28399433 with tobacco-induced lung Cancer: case-control study in an Egyptian population

    doi: 10.1186/s12885-018-4342-5

    Figure Lengend Snippet: Allelic discrimination plot of CYP2A6*9 rs28399433 genotypes

    Article Snippet: For CYP2A6*2 (1799 T > A ) [rs1801272; assay ID: C_27861808_60], the VIC/FAM sequence was as follows: CCCCTGCTCACCGCCAGTGCCCCGG[T/A]GGGCGTCGATGAGGAAGCCCGCCTC.

    Techniques:

    Allelic discrimination plot of CYP2A6*9 rs28399433 genotypes

    Journal: BMC Cancer

    Article Title: Association of genetic polymorphisms CYP2A6*2 rs1801272 and CYP2A6*9 rs28399433 with tobacco-induced lung Cancer: case-control study in an Egyptian population

    doi: 10.1186/s12885-018-4342-5

    Figure Lengend Snippet: Allelic discrimination plot of CYP2A6*9 rs28399433 genotypes

    Article Snippet: For CYP2A6*2 (1799 T > A ) [rs1801272; assay ID: C_27861808_60], the VIC/FAM sequence was as follows: CCCCTGCTCACCGCCAGTGCCCCGG[T/A]GGGCGTCGATGAGGAAGCCCGCCTC.

    Techniques: