Structured Review

GenePharma Company sirna shrna
PD-L2 knockdown-induced inhibition of autophagy attenuates migration and invasion of osteosarcoma cells. a Representative TEM images depict ultrastructures present during autophagy in KHOS and U2OS cells transfected with PD-L2 <t>shRNA</t> or shNC. Images show autophagic vacuoles (arrows) observed in control cells (the picture in the right is a zoom of the picture in the left). No or few autophagic vacuoles were observed in PD-L2 knockdown cells. b Cells after PD-L2 knockdown exhibited a punctate pattern of LC3-II fluorescence, with reduced LC3-II compared with autophagosomes. KHOS and U2OS cells were incubated with or without CQ. c Expression of LC3, p62, and beclin-1 was evaluated by western blot. KHOS and U2OS cells were incubated in the presence or absence of CQ
Sirna Shrna, supplied by GenePharma Company, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sirna shrna/product/GenePharma Company
Average 93 stars, based on 1 article reviews
Price from $9.99 to $1999.99
sirna shrna - by Bioz Stars, 2020-09
93/100 stars

Images

1) Product Images from "Osteosarcoma cell intrinsic PD-L2 signals promote invasion and metastasis via the RhoA-ROCK-LIMK2 and autophagy pathways"

Article Title: Osteosarcoma cell intrinsic PD-L2 signals promote invasion and metastasis via the RhoA-ROCK-LIMK2 and autophagy pathways

Journal: Cell Death & Disease

doi: 10.1038/s41419-019-1497-1

PD-L2 knockdown-induced inhibition of autophagy attenuates migration and invasion of osteosarcoma cells. a Representative TEM images depict ultrastructures present during autophagy in KHOS and U2OS cells transfected with PD-L2 shRNA or shNC. Images show autophagic vacuoles (arrows) observed in control cells (the picture in the right is a zoom of the picture in the left). No or few autophagic vacuoles were observed in PD-L2 knockdown cells. b Cells after PD-L2 knockdown exhibited a punctate pattern of LC3-II fluorescence, with reduced LC3-II compared with autophagosomes. KHOS and U2OS cells were incubated with or without CQ. c Expression of LC3, p62, and beclin-1 was evaluated by western blot. KHOS and U2OS cells were incubated in the presence or absence of CQ
Figure Legend Snippet: PD-L2 knockdown-induced inhibition of autophagy attenuates migration and invasion of osteosarcoma cells. a Representative TEM images depict ultrastructures present during autophagy in KHOS and U2OS cells transfected with PD-L2 shRNA or shNC. Images show autophagic vacuoles (arrows) observed in control cells (the picture in the right is a zoom of the picture in the left). No or few autophagic vacuoles were observed in PD-L2 knockdown cells. b Cells after PD-L2 knockdown exhibited a punctate pattern of LC3-II fluorescence, with reduced LC3-II compared with autophagosomes. KHOS and U2OS cells were incubated with or without CQ. c Expression of LC3, p62, and beclin-1 was evaluated by western blot. KHOS and U2OS cells were incubated in the presence or absence of CQ

Techniques Used: Inhibition, Migration, Transmission Electron Microscopy, Transfection, shRNA, Fluorescence, Incubation, Expressing, Western Blot

Autophagy promotes migration and invasion of osteosarcoma cells through targeting the RhoA-ROCK-LIMK2 pathway. ( a ) Three beclin-1 siRNA sequences were used to downregulate beclin-1 in KHOS cells (top). The migration and invasion of osteosarcoma cells after beclin-1 knockdown were analyzed by transwell and wound-healing assays (bottom). ( b and c ) Bioinformatics prediction indicated there may be co-expression between beclin-1 and RhoA, and western blot validated the relationship between them. Beclin-1 knockdown decreased p-LIMK and p-cofilin expressions ( b ) as well as RhoA activation ( c ). d The expression levels of autophagy markers (LC3, p62, Beclin1) in the primary and metastatic osteosarcoma tumors were evaluated by IHC (magnification 200X). All experiments were repeated three times. Data are presented as the mean ± S.D. ***P
Figure Legend Snippet: Autophagy promotes migration and invasion of osteosarcoma cells through targeting the RhoA-ROCK-LIMK2 pathway. ( a ) Three beclin-1 siRNA sequences were used to downregulate beclin-1 in KHOS cells (top). The migration and invasion of osteosarcoma cells after beclin-1 knockdown were analyzed by transwell and wound-healing assays (bottom). ( b and c ) Bioinformatics prediction indicated there may be co-expression between beclin-1 and RhoA, and western blot validated the relationship between them. Beclin-1 knockdown decreased p-LIMK and p-cofilin expressions ( b ) as well as RhoA activation ( c ). d The expression levels of autophagy markers (LC3, p62, Beclin1) in the primary and metastatic osteosarcoma tumors were evaluated by IHC (magnification 200X). All experiments were repeated three times. Data are presented as the mean ± S.D. ***P

Techniques Used: Migration, Expressing, Western Blot, Activation Assay, Immunohistochemistry

Related Articles

Clone Assay:

Article Title: Knockdown of mitofilin inhibits autophagy and facilitates starvation-induced apoptosis in HeLa cells
Article Snippet: .. Short hairpin RNA (shRNA) for mitofilin (5’-GCTAAGGTTGTATCTCAGTAT-3’) and its negative control were cloned into pGPU6/Neo (Genepharma, shanghai, China). .. To establish stable cell lines, HeLa cells were transfected and then selected with 1 mg/ml neomycin.

Article Title: LncRNA CSMD1-1 promotes the progression of Hepatocellular Carcinoma by activating MYC signaling
Article Snippet: .. Construction of stable cell linesThe full-length sequence of lncCSMD1 or short hairpin RNA (shRNA) against lncCSMD1 was amplified and cloned into the multiple cloning sites of pcDNA3.1, then subcloned into lentivirus to overexpress or knockdown lncCSMD1 by GenePharma (Shanghai, China), respectively. .. Following a 48-h period of infection with lentivirus plus 5 mg/ml Polybrene, stable cells with expression of lncCSMD1 or shRNA were selected with 4 μg/mL puromycin for 3 days.

Negative Control:

Article Title: Knockdown of mitofilin inhibits autophagy and facilitates starvation-induced apoptosis in HeLa cells
Article Snippet: .. Short hairpin RNA (shRNA) for mitofilin (5’-GCTAAGGTTGTATCTCAGTAT-3’) and its negative control were cloned into pGPU6/Neo (Genepharma, shanghai, China). .. To establish stable cell lines, HeLa cells were transfected and then selected with 1 mg/ml neomycin.

Article Title: Syndecan Binding Protein (SDCBP) Is Overexpressed in Estrogen Receptor Negative Breast Cancers, and Is a Potential Promoter for Tumor Proliferation
Article Snippet: .. Construction of SDCBP-silenced BCa cells Candidate target sequences for short-hairpin RNA (shRNA) of SDCBP and for negative control shRNA were designed by Genepharma Co., Ltd (Shanghai, China), as shown in . .. They were all cloned into pGPU6/GFP/Neo shRNA expression vector.

shRNA:

Article Title: Long non-coding RNA LINC00520 promotes the proliferation and metastasis of malignant melanoma by inducing the miR-125b-5p/EIF5A2 axis
Article Snippet: .. The small interfering RNA (siRNA) and short hairpin RNA (shRNA) of LINC00520 were also chemically synthesized by GenePharma (Shanghai, China). .. The EIF5A2 plasmid was constructed by inserting the full length of EIF5A2 into pcDNA3.1 vector (Invitrogen, USA).

Article Title: Knockdown of mitofilin inhibits autophagy and facilitates starvation-induced apoptosis in HeLa cells
Article Snippet: .. Short hairpin RNA (shRNA) for mitofilin (5’-GCTAAGGTTGTATCTCAGTAT-3’) and its negative control were cloned into pGPU6/Neo (Genepharma, shanghai, China). .. To establish stable cell lines, HeLa cells were transfected and then selected with 1 mg/ml neomycin.

Article Title: Syndecan Binding Protein (SDCBP) Is Overexpressed in Estrogen Receptor Negative Breast Cancers, and Is a Potential Promoter for Tumor Proliferation
Article Snippet: .. Construction of SDCBP-silenced BCa cells Candidate target sequences for short-hairpin RNA (shRNA) of SDCBP and for negative control shRNA were designed by Genepharma Co., Ltd (Shanghai, China), as shown in . .. They were all cloned into pGPU6/GFP/Neo shRNA expression vector.

Article Title: LncRNA CSMD1-1 promotes the progression of Hepatocellular Carcinoma by activating MYC signaling
Article Snippet: .. Construction of stable cell linesThe full-length sequence of lncCSMD1 or short hairpin RNA (shRNA) against lncCSMD1 was amplified and cloned into the multiple cloning sites of pcDNA3.1, then subcloned into lentivirus to overexpress or knockdown lncCSMD1 by GenePharma (Shanghai, China), respectively. .. Following a 48-h period of infection with lentivirus plus 5 mg/ml Polybrene, stable cells with expression of lncCSMD1 or shRNA were selected with 4 μg/mL puromycin for 3 days.

Article Title: Long noncoding RNA LINC00518 acts as a competing endogenous RNA to promote the metastasis of malignant melanoma via miR-204-5p/AP1S2 axis
Article Snippet: .. LINC00518 small interfering RNA (siRNA) and short hairpin RNA (shRNA) and AP1S2 siRNA were chemically synthesized by GenePharma (Shanghai, China). .. The shRNA and its corresponding control sequences were inserted into the lentivirus vector (GenePharma, Shanghai, China).

Stable Transfection:

Article Title: LncRNA CSMD1-1 promotes the progression of Hepatocellular Carcinoma by activating MYC signaling
Article Snippet: .. Construction of stable cell linesThe full-length sequence of lncCSMD1 or short hairpin RNA (shRNA) against lncCSMD1 was amplified and cloned into the multiple cloning sites of pcDNA3.1, then subcloned into lentivirus to overexpress or knockdown lncCSMD1 by GenePharma (Shanghai, China), respectively. .. Following a 48-h period of infection with lentivirus plus 5 mg/ml Polybrene, stable cells with expression of lncCSMD1 or shRNA were selected with 4 μg/mL puromycin for 3 days.

Synthesized:

Article Title: Long non-coding RNA LINC00520 promotes the proliferation and metastasis of malignant melanoma by inducing the miR-125b-5p/EIF5A2 axis
Article Snippet: .. The small interfering RNA (siRNA) and short hairpin RNA (shRNA) of LINC00520 were also chemically synthesized by GenePharma (Shanghai, China). .. The EIF5A2 plasmid was constructed by inserting the full length of EIF5A2 into pcDNA3.1 vector (Invitrogen, USA).

Article Title: New benzimidazole acridine derivative induces human colon cancer cell apoptosis in vitro via the ROS-JNK signaling pathway
Article Snippet: .. Short-interfering RNA (siRNA) was synthesized by GenePharma (Shanghai, China). .. Phosphor-SAPK/JNK (Thr183/Tyr185), SAPK/JNK, phosphor-p38, p38, phosphor-ERK, ERK, Bcl-2, Bid, cleaved caspase-9, cleaved caspase-8, cleaved caspase-7, cleaved caspase-3, and cleaved PARP were purchased from Cell Signaling Technology (Danvers, MA, USA).

Article Title: Long noncoding RNA LINC00518 acts as a competing endogenous RNA to promote the metastasis of malignant melanoma via miR-204-5p/AP1S2 axis
Article Snippet: .. LINC00518 small interfering RNA (siRNA) and short hairpin RNA (shRNA) and AP1S2 siRNA were chemically synthesized by GenePharma (Shanghai, China). .. The shRNA and its corresponding control sequences were inserted into the lentivirus vector (GenePharma, Shanghai, China).

Small Interfering RNA:

Article Title: Long non-coding RNA LINC00520 promotes the proliferation and metastasis of malignant melanoma by inducing the miR-125b-5p/EIF5A2 axis
Article Snippet: .. The small interfering RNA (siRNA) and short hairpin RNA (shRNA) of LINC00520 were also chemically synthesized by GenePharma (Shanghai, China). .. The EIF5A2 plasmid was constructed by inserting the full length of EIF5A2 into pcDNA3.1 vector (Invitrogen, USA).

Article Title: New benzimidazole acridine derivative induces human colon cancer cell apoptosis in vitro via the ROS-JNK signaling pathway
Article Snippet: .. Short-interfering RNA (siRNA) was synthesized by GenePharma (Shanghai, China). .. Phosphor-SAPK/JNK (Thr183/Tyr185), SAPK/JNK, phosphor-p38, p38, phosphor-ERK, ERK, Bcl-2, Bid, cleaved caspase-9, cleaved caspase-8, cleaved caspase-7, cleaved caspase-3, and cleaved PARP were purchased from Cell Signaling Technology (Danvers, MA, USA).

Article Title: Long noncoding RNA LINC00518 acts as a competing endogenous RNA to promote the metastasis of malignant melanoma via miR-204-5p/AP1S2 axis
Article Snippet: .. LINC00518 small interfering RNA (siRNA) and short hairpin RNA (shRNA) and AP1S2 siRNA were chemically synthesized by GenePharma (Shanghai, China). .. The shRNA and its corresponding control sequences were inserted into the lentivirus vector (GenePharma, Shanghai, China).

Amplification:

Article Title: LncRNA CSMD1-1 promotes the progression of Hepatocellular Carcinoma by activating MYC signaling
Article Snippet: .. Construction of stable cell linesThe full-length sequence of lncCSMD1 or short hairpin RNA (shRNA) against lncCSMD1 was amplified and cloned into the multiple cloning sites of pcDNA3.1, then subcloned into lentivirus to overexpress or knockdown lncCSMD1 by GenePharma (Shanghai, China), respectively. .. Following a 48-h period of infection with lentivirus plus 5 mg/ml Polybrene, stable cells with expression of lncCSMD1 or shRNA were selected with 4 μg/mL puromycin for 3 days.

BIA-KA:

Article Title: Syndecan Binding Protein (SDCBP) Is Overexpressed in Estrogen Receptor Negative Breast Cancers, and Is a Potential Promoter for Tumor Proliferation
Article Snippet: .. Construction of SDCBP-silenced BCa cells Candidate target sequences for short-hairpin RNA (shRNA) of SDCBP and for negative control shRNA were designed by Genepharma Co., Ltd (Shanghai, China), as shown in . .. They were all cloned into pGPU6/GFP/Neo shRNA expression vector.

Sequencing:

Article Title: The DEAD-box RNA helicase DDX5 acts as a positive regulator of Japanese encephalitis virus replication by binding to viral 3′ UTR
Article Snippet: .. Oligonucleotides with the following sequence: CTCTAATGTGGAGTGCGAC was used to clone short hairpin RNA (shRNA)-encoding sequences against DDX5 in the pGPU6/Neo (Genepharma, China) vector, the Oligonucleotides encoding non-targeting shRNA was cloned into pGPU6/Neo vector and the sequence is as follows: GTTCTCCGAACGTGTCACGT which was used as the control shRNA. .. To construct RNAi resistant pcDNA3.1-DDX5r, pcDNA3.1-DDX5r-K144E-HA and pcDNA3.1-DDX5r-S279L-HA mutants, the shRNA target sequence in DDX5 gene was changed into CCTTGATGTGGTCCGCTAC without introducing any residue change using QuikChange site-directed mutagenesis kit (Stratagene) using pcDNA3.1-DDX5-HA as the template by PCR using specific primers ( ).

Article Title: LncRNA CSMD1-1 promotes the progression of Hepatocellular Carcinoma by activating MYC signaling
Article Snippet: .. Construction of stable cell linesThe full-length sequence of lncCSMD1 or short hairpin RNA (shRNA) against lncCSMD1 was amplified and cloned into the multiple cloning sites of pcDNA3.1, then subcloned into lentivirus to overexpress or knockdown lncCSMD1 by GenePharma (Shanghai, China), respectively. .. Following a 48-h period of infection with lentivirus plus 5 mg/ml Polybrene, stable cells with expression of lncCSMD1 or shRNA were selected with 4 μg/mL puromycin for 3 days.

Over Expression:

Article Title: Osteosarcoma cell intrinsic PD-L2 signals promote invasion and metastasis via the RhoA-ROCK-LIMK2 and autophagy pathways
Article Snippet: .. Gene knockdown with siRNA/shRNA and overexpression with adenovirus Lentiviruses targeting PD-L2 and BMPR2 were obtained from GenePharma (Suzhou, China). .. A non-targeting lentivirus construct was used as a negative control (NC).

Plasmid Preparation:

Article Title: The DEAD-box RNA helicase DDX5 acts as a positive regulator of Japanese encephalitis virus replication by binding to viral 3′ UTR
Article Snippet: .. Oligonucleotides with the following sequence: CTCTAATGTGGAGTGCGAC was used to clone short hairpin RNA (shRNA)-encoding sequences against DDX5 in the pGPU6/Neo (Genepharma, China) vector, the Oligonucleotides encoding non-targeting shRNA was cloned into pGPU6/Neo vector and the sequence is as follows: GTTCTCCGAACGTGTCACGT which was used as the control shRNA. .. To construct RNAi resistant pcDNA3.1-DDX5r, pcDNA3.1-DDX5r-K144E-HA and pcDNA3.1-DDX5r-S279L-HA mutants, the shRNA target sequence in DDX5 gene was changed into CCTTGATGTGGTCCGCTAC without introducing any residue change using QuikChange site-directed mutagenesis kit (Stratagene) using pcDNA3.1-DDX5-HA as the template by PCR using specific primers ( ).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92
    GenePharma Company silencing stathmin shrna
    Suppression of <t>Stathmin</t> in hDPSCs inhibited proliferation and the expression of mineralization‐related genes in hDPSCs. A‐C, Cell cycle distribution for the <t>shRNA‐Ctrl</t> group (A) and the shRNA‐Stathmin group (B) and statistical analysis (C). D, CCK‐8 value of shRNA‐Stathmin hDPSCs and shRNA‐Ctrl hDPSCs at days 1, 3, 5 and 7. Mineralization‐related genes (E, ALP; F, BSP; G, OCN; H, DSPP) were expressed at much lower levels in the Stathmin knockdown group than in the shRNA‐Ctrl group cultured in mineralization medium for 3 weeks. I and J, Alizarin red S staining showed that Stathmin suppression significantly inhibited mineral formation by hDPSCs (scale bar = 100 μm). Each experiment was repeated in triplicate. (* P
    Silencing Stathmin Shrna, supplied by GenePharma Company, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/silencing stathmin shrna/product/GenePharma Company
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    silencing stathmin shrna - by Bioz Stars, 2020-09
    92/100 stars
      Buy from Supplier

    90
    GenePharma Company hoxd3
    <t>HOXD3</t> is required for the HOXD-AS1-mediated progress of CRC in vivo. a – d in vivo tumorigenesis experiment in nude mice. a These graphs show the tumor xenografts 24 days after ectopic-subcutaneous implantation in nude mice with SW620-HOXD-AS1, SW620-HOXD-AS1 + HOXD3 and control cells. b The gross of xenografts. c The effect of HOXD-AS1 or HOXD3 on CRC tumor growth was evaluated based on tumor volume in the three groups. d The statistic results of final tumor weights. e The images of H E staining, ISH for HOXD-AS1 and IHC for HOXD3, H3K27me3 and Ki-67 in xenografts were shown. f – h Intrasplenic injections to establish liver metastasis model in nude mice. f These graphs show SW620-HOXD-AS1, SW620-HOXD-AS1 + HOXD3 and control cells metastasis in vivo . 6 weeks after CRC cells’ Intrasplenic injections. Liver metastases were showed (upper) and the tissues were stained by H E staining (down). g The statistical analysis of number of liver metastatic nodules and h the statistical distribution of metastasis numbers. For c , d , g and h , the date were expressed as mean ± SD in three independent experiments. * P
    Hoxd3, supplied by GenePharma Company, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hoxd3/product/GenePharma Company
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    hoxd3 - by Bioz Stars, 2020-09
    90/100 stars
      Buy from Supplier

    88
    GenePharma Company vector pgpu6 gfp clc 3 shrna
    <t>ClC-3</t> Mediates Recycling of β1 Integrin by Inducing Keratin 18 Phosphorylation (A) Immunofluorescence images (Left) and evaluation of fluorescence intensity of K18 (right) in HeLa cells treated with shK18 <t>(pGPU6/GFP-K18</t> <t>shRNA)</t> or shRNA negative control (shNC). ** P
    Vector Pgpu6 Gfp Clc 3 Shrna, supplied by GenePharma Company, used in various techniques. Bioz Stars score: 88/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/vector pgpu6 gfp clc 3 shrna/product/GenePharma Company
    Average 88 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    vector pgpu6 gfp clc 3 shrna - by Bioz Stars, 2020-09
    88/100 stars
      Buy from Supplier

    84
    GenePharma Company cell transfectionthe shrnas targeting fam83h as1
    <t>FAM83H‐AS1</t> sponges miR‐10a‐5p and miR‐10a‐5p directly targets Girdin in oesophageal cancer cells. A, Relative expression of miR‐10a‐5p in FAM83H‐AS1 knockdown or overexpression cells. B, Relative expression of FAM83H‐AS1 in miR‐10a‐5p mimics or inhibitor transfected cells. C, The MS2‐RIP method identified the direct binding between FAM83H‐AS1 and miR‐10a‐5p. D, The effect of miR‐10a‐5p mimics on luciferase activity of wild‐type and mutant‐type FAM83H‐AS1 vectors observed by dual‐luciferase reporter assay. E, The numbers of miR‐10a‐5p targeting the potential same genes (including Girdin) drawn by Venn diagram. F, Schematic representation of the potential binding sites of miR‐10a‐5p on Girdin 3′ UTR. G, Relative expression of Girdin in 67 pairs of ESCC tissues and corresponding normal tissues confirmed by qRT‐PCR method. H, The correlation between Girdin and miR‐10a‐5p expression. I, Relative expression of Girdin in different subgroups. J, The regulation of miR‐10a‐5p on Girdin expression detected by qRT‐PCR method. K, The effect of miR‐10a‐5p mimics on luciferase activity of wild‐type and mutant‐type Girdin 3′ UTR vectors observed by dual‐luciferase reporter assay. Data are shown as mean ± SD; * P
    Cell Transfectionthe Shrnas Targeting Fam83h As1, supplied by GenePharma Company, used in various techniques. Bioz Stars score: 84/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cell transfectionthe shrnas targeting fam83h as1/product/GenePharma Company
    Average 84 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    cell transfectionthe shrnas targeting fam83h as1 - by Bioz Stars, 2020-09
    84/100 stars
      Buy from Supplier

    Image Search Results


    Suppression of Stathmin in hDPSCs inhibited proliferation and the expression of mineralization‐related genes in hDPSCs. A‐C, Cell cycle distribution for the shRNA‐Ctrl group (A) and the shRNA‐Stathmin group (B) and statistical analysis (C). D, CCK‐8 value of shRNA‐Stathmin hDPSCs and shRNA‐Ctrl hDPSCs at days 1, 3, 5 and 7. Mineralization‐related genes (E, ALP; F, BSP; G, OCN; H, DSPP) were expressed at much lower levels in the Stathmin knockdown group than in the shRNA‐Ctrl group cultured in mineralization medium for 3 weeks. I and J, Alizarin red S staining showed that Stathmin suppression significantly inhibited mineral formation by hDPSCs (scale bar = 100 μm). Each experiment was repeated in triplicate. (* P

    Journal: Journal of Cellular and Molecular Medicine

    Article Title: Stathmin inhibits proliferation and differentiation of dental pulp stem cells via sonic hedgehog/Gli, et al. Stathmin inhibits proliferation and differentiation of dental pulp stem cells via sonic hedgehog/Gli

    doi: 10.1111/jcmm.13621

    Figure Lengend Snippet: Suppression of Stathmin in hDPSCs inhibited proliferation and the expression of mineralization‐related genes in hDPSCs. A‐C, Cell cycle distribution for the shRNA‐Ctrl group (A) and the shRNA‐Stathmin group (B) and statistical analysis (C). D, CCK‐8 value of shRNA‐Stathmin hDPSCs and shRNA‐Ctrl hDPSCs at days 1, 3, 5 and 7. Mineralization‐related genes (E, ALP; F, BSP; G, OCN; H, DSPP) were expressed at much lower levels in the Stathmin knockdown group than in the shRNA‐Ctrl group cultured in mineralization medium for 3 weeks. I and J, Alizarin red S staining showed that Stathmin suppression significantly inhibited mineral formation by hDPSCs (scale bar = 100 μm). Each experiment was repeated in triplicate. (* P

    Article Snippet: 2.3 Lentiviral vector cell transduction A lentivirus containing silencing Stathmin shRNA and the green fluorescent protein (GFP) gene and a negative control consisting of a scrambled sequence and GFP were constructed by the GenePharma Company (GenePharma, Shanghai, China). hDPSCs were infected with shRNA‐Stathmin and shRNA‐Ctrl lentiviruses at a multiplicity of infection of 50.

    Techniques: Expressing, shRNA, CCK-8 Assay, ALP Assay, Cell Culture, Staining

    Expression of Stathmin in hDPSCs and lentivirus infections of hDPSCs. A, B, Expression of Stathmin in the cytomembrane and cytoplasm of hDPSCs (scale bar = 20 μm). C, D, At 72 h after gene transduction, both shRNA‐Stathmin‐ and shRNA‐Ctrl‐transfected hDPSCs grew well, and green fluorescent protein (GFP) fluorescence in the hDPSCs confirmed the transfection efficiency (scale bar = 100 μm). E, F, Western blot analysis showing that the Stathmin protein band in the shRNA‐Stathmin group was significantly weaker than that in the shRNA‐Ctrl group. G, Real‐time PCR showed that the expression levels of Stathmin messenger RNA were lower in the shRNA‐Ctrl group than in the shRNA‐Stathmin group ( ***P

    Journal: Journal of Cellular and Molecular Medicine

    Article Title: Stathmin inhibits proliferation and differentiation of dental pulp stem cells via sonic hedgehog/Gli, et al. Stathmin inhibits proliferation and differentiation of dental pulp stem cells via sonic hedgehog/Gli

    doi: 10.1111/jcmm.13621

    Figure Lengend Snippet: Expression of Stathmin in hDPSCs and lentivirus infections of hDPSCs. A, B, Expression of Stathmin in the cytomembrane and cytoplasm of hDPSCs (scale bar = 20 μm). C, D, At 72 h after gene transduction, both shRNA‐Stathmin‐ and shRNA‐Ctrl‐transfected hDPSCs grew well, and green fluorescent protein (GFP) fluorescence in the hDPSCs confirmed the transfection efficiency (scale bar = 100 μm). E, F, Western blot analysis showing that the Stathmin protein band in the shRNA‐Stathmin group was significantly weaker than that in the shRNA‐Ctrl group. G, Real‐time PCR showed that the expression levels of Stathmin messenger RNA were lower in the shRNA‐Ctrl group than in the shRNA‐Stathmin group ( ***P

    Article Snippet: 2.3 Lentiviral vector cell transduction A lentivirus containing silencing Stathmin shRNA and the green fluorescent protein (GFP) gene and a negative control consisting of a scrambled sequence and GFP were constructed by the GenePharma Company (GenePharma, Shanghai, China). hDPSCs were infected with shRNA‐Stathmin and shRNA‐Ctrl lentiviruses at a multiplicity of infection of 50.

    Techniques: Expressing, Transduction, shRNA, Transfection, Fluorescence, Western Blot, Real-time Polymerase Chain Reaction

    Activation of Shh signalling promotes the proliferation and osteogenic/odontoblastic differentiation of hDPSCs. A‐D, Treatment of shRNA‐Stathmin hDPSCs with purmorphamine that specifically binds SMO increased (A, ALP; B, BSP; C, OCN; D, DSPP) mRNA expression, as determined by real‐time PCR. E‐G, Cell cycle distribution for the shRNA‐Stathmin group (E) and the shRNA‐Stathmin + PM group (F) and statistical analysis (G). H, CCK‐8 values of shRNA‐Stathmin + PM hDPSCs and shRNA‐Stathmin hDPSCs at days 1, 3, 5 and 7. Each experiment was repeated in triplicate (* P

    Journal: Journal of Cellular and Molecular Medicine

    Article Title: Stathmin inhibits proliferation and differentiation of dental pulp stem cells via sonic hedgehog/Gli, et al. Stathmin inhibits proliferation and differentiation of dental pulp stem cells via sonic hedgehog/Gli

    doi: 10.1111/jcmm.13621

    Figure Lengend Snippet: Activation of Shh signalling promotes the proliferation and osteogenic/odontoblastic differentiation of hDPSCs. A‐D, Treatment of shRNA‐Stathmin hDPSCs with purmorphamine that specifically binds SMO increased (A, ALP; B, BSP; C, OCN; D, DSPP) mRNA expression, as determined by real‐time PCR. E‐G, Cell cycle distribution for the shRNA‐Stathmin group (E) and the shRNA‐Stathmin + PM group (F) and statistical analysis (G). H, CCK‐8 values of shRNA‐Stathmin + PM hDPSCs and shRNA‐Stathmin hDPSCs at days 1, 3, 5 and 7. Each experiment was repeated in triplicate (* P

    Article Snippet: 2.3 Lentiviral vector cell transduction A lentivirus containing silencing Stathmin shRNA and the green fluorescent protein (GFP) gene and a negative control consisting of a scrambled sequence and GFP were constructed by the GenePharma Company (GenePharma, Shanghai, China). hDPSCs were infected with shRNA‐Stathmin and shRNA‐Ctrl lentiviruses at a multiplicity of infection of 50.

    Techniques: Activation Assay, shRNA, ALP Assay, Expressing, Real-time Polymerase Chain Reaction, CCK-8 Assay

    HOXD3 is required for the HOXD-AS1-mediated progress of CRC in vivo. a – d in vivo tumorigenesis experiment in nude mice. a These graphs show the tumor xenografts 24 days after ectopic-subcutaneous implantation in nude mice with SW620-HOXD-AS1, SW620-HOXD-AS1 + HOXD3 and control cells. b The gross of xenografts. c The effect of HOXD-AS1 or HOXD3 on CRC tumor growth was evaluated based on tumor volume in the three groups. d The statistic results of final tumor weights. e The images of H E staining, ISH for HOXD-AS1 and IHC for HOXD3, H3K27me3 and Ki-67 in xenografts were shown. f – h Intrasplenic injections to establish liver metastasis model in nude mice. f These graphs show SW620-HOXD-AS1, SW620-HOXD-AS1 + HOXD3 and control cells metastasis in vivo . 6 weeks after CRC cells’ Intrasplenic injections. Liver metastases were showed (upper) and the tissues were stained by H E staining (down). g The statistical analysis of number of liver metastatic nodules and h the statistical distribution of metastasis numbers. For c , d , g and h , the date were expressed as mean ± SD in three independent experiments. * P

    Journal: Molecular Cancer

    Article Title: Nuclear lncRNA HOXD-AS1 suppresses colorectal carcinoma growth and metastasis via inhibiting HOXD3-induced integrin β3 transcriptional activating and MAPK/AKT signalling

    doi: 10.1186/s12943-019-0955-9

    Figure Lengend Snippet: HOXD3 is required for the HOXD-AS1-mediated progress of CRC in vivo. a – d in vivo tumorigenesis experiment in nude mice. a These graphs show the tumor xenografts 24 days after ectopic-subcutaneous implantation in nude mice with SW620-HOXD-AS1, SW620-HOXD-AS1 + HOXD3 and control cells. b The gross of xenografts. c The effect of HOXD-AS1 or HOXD3 on CRC tumor growth was evaluated based on tumor volume in the three groups. d The statistic results of final tumor weights. e The images of H E staining, ISH for HOXD-AS1 and IHC for HOXD3, H3K27me3 and Ki-67 in xenografts were shown. f – h Intrasplenic injections to establish liver metastasis model in nude mice. f These graphs show SW620-HOXD-AS1, SW620-HOXD-AS1 + HOXD3 and control cells metastasis in vivo . 6 weeks after CRC cells’ Intrasplenic injections. Liver metastases were showed (upper) and the tissues were stained by H E staining (down). g The statistical analysis of number of liver metastatic nodules and h the statistical distribution of metastasis numbers. For c , d , g and h , the date were expressed as mean ± SD in three independent experiments. * P

    Article Snippet: Construction of cell lines with stably downregulated HOXD-AS1 and HOXD3 There shRNA sequence specially targeting HOXD-AS1 or HOXD3 were designed and synthesized, and clone into a pGU6/GFP/Neo-shRNA vector (GenePharma, China).

    Techniques: In Vivo, Mouse Assay, Staining, In Situ Hybridization, Immunohistochemistry

    HOXD3 mediates Integrin β3 expression by activating Integrin β3 transcription. a A positive correlation between HOXD3 and Integrin β3 expression was found in the TCGA cohort. b – c The expression of both integrin β3 b mRNA and c protein was significantly up-regulated after HOXD3 ectopic overexpression in SW620 cells, while the expression of integrin β3 was reduced when HOXD3 knockdown was mediated by a siRNA. d ChIP assays were performed in HOXD-AS1 overexpressed(SW620-HOXD-AS1)and control cells using anti-HOXD3- antibodies or IgG antibodies, respectively. e The enrichments of HOXD3 of the region upstream of the Integrin β3 gene were examined by real-time PCR. f - g Dual-luciferase report showed that HOXD3 activated Integrin β3 transcription both in f SW620 and g 293 T cells. h Western blot was performed to detect HOXD3, Integrin β3, ERK, p-ERK, AKT and p-AKT expression in SW620-HOXD-AS1, SW620-HOXD-AS1 + HOXD3, SW620-si-Integrin β3 and control cells. i Western blot was performed to detect HOXD3, Integrin β3, ERK, p-ERK, AKT and p-AKT expression in paired CRC tissues and adjacent non-cancerous tissues. j A proposed model for illustrating the function and mechanism of HOXD-AS1 in CRC growth and metastasis . For b, e, f and g, data were expressed as means ± SD in three independent experiments. * P

    Journal: Molecular Cancer

    Article Title: Nuclear lncRNA HOXD-AS1 suppresses colorectal carcinoma growth and metastasis via inhibiting HOXD3-induced integrin β3 transcriptional activating and MAPK/AKT signalling

    doi: 10.1186/s12943-019-0955-9

    Figure Lengend Snippet: HOXD3 mediates Integrin β3 expression by activating Integrin β3 transcription. a A positive correlation between HOXD3 and Integrin β3 expression was found in the TCGA cohort. b – c The expression of both integrin β3 b mRNA and c protein was significantly up-regulated after HOXD3 ectopic overexpression in SW620 cells, while the expression of integrin β3 was reduced when HOXD3 knockdown was mediated by a siRNA. d ChIP assays were performed in HOXD-AS1 overexpressed(SW620-HOXD-AS1)and control cells using anti-HOXD3- antibodies or IgG antibodies, respectively. e The enrichments of HOXD3 of the region upstream of the Integrin β3 gene were examined by real-time PCR. f - g Dual-luciferase report showed that HOXD3 activated Integrin β3 transcription both in f SW620 and g 293 T cells. h Western blot was performed to detect HOXD3, Integrin β3, ERK, p-ERK, AKT and p-AKT expression in SW620-HOXD-AS1, SW620-HOXD-AS1 + HOXD3, SW620-si-Integrin β3 and control cells. i Western blot was performed to detect HOXD3, Integrin β3, ERK, p-ERK, AKT and p-AKT expression in paired CRC tissues and adjacent non-cancerous tissues. j A proposed model for illustrating the function and mechanism of HOXD-AS1 in CRC growth and metastasis . For b, e, f and g, data were expressed as means ± SD in three independent experiments. * P

    Article Snippet: Construction of cell lines with stably downregulated HOXD-AS1 and HOXD3 There shRNA sequence specially targeting HOXD-AS1 or HOXD3 were designed and synthesized, and clone into a pGU6/GFP/Neo-shRNA vector (GenePharma, China).

    Techniques: Expressing, Over Expression, Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction, Luciferase, Western Blot

    The up-regulation of HOXD3 expression predicts poor outcome in CRC patients and promotes CRC progression. a-b Expression analysis of HOXD-AS1 in normal colorectal mucosa and CRC tissues by a IHC and b the statistical analysis for HOXD3 expression. c Graphical illustration of statistical HOXD3 distribution in CRC patients. d-f Kaplan–Meier analysis of overall survival in all patients with CRC according to HOXD3 expression in clinical samples (overall survival, n = 164, log-rank test) and TCGA database (overall survival and disease-free survival, n = 360, log-rank test). g Infecting M5 and SW620 cells with a lentivirus vector harbouring shRNA-HOXD3 to knocked down the endogenous expression of HOXD3 in cells. HOXD3 levels in cells were detected by real-time PCR. h HOXD3 levels in cells were detected by Western blot. i CCK-8 assays were performed to determine the proliferation of HOXD3- depleted CRC cells. j Colony-forming assays were performed to determine the effects of HOXD3 depletion on the growth of CRC cells. The diameter > 50 cells was scored. k Cell cycle progression was analyzed by flow cytometry. l The migration potencies of CRC cells with the indicated treatments were detected by using wound healing assay. m Invasion assays were used to determine the effects of HOXD3 depletion on the invasion ability of CRC cells. For b, g, i, j, k, l and m, data are presented as means ± SD in three independent experiments. * P

    Journal: Molecular Cancer

    Article Title: Nuclear lncRNA HOXD-AS1 suppresses colorectal carcinoma growth and metastasis via inhibiting HOXD3-induced integrin β3 transcriptional activating and MAPK/AKT signalling

    doi: 10.1186/s12943-019-0955-9

    Figure Lengend Snippet: The up-regulation of HOXD3 expression predicts poor outcome in CRC patients and promotes CRC progression. a-b Expression analysis of HOXD-AS1 in normal colorectal mucosa and CRC tissues by a IHC and b the statistical analysis for HOXD3 expression. c Graphical illustration of statistical HOXD3 distribution in CRC patients. d-f Kaplan–Meier analysis of overall survival in all patients with CRC according to HOXD3 expression in clinical samples (overall survival, n = 164, log-rank test) and TCGA database (overall survival and disease-free survival, n = 360, log-rank test). g Infecting M5 and SW620 cells with a lentivirus vector harbouring shRNA-HOXD3 to knocked down the endogenous expression of HOXD3 in cells. HOXD3 levels in cells were detected by real-time PCR. h HOXD3 levels in cells were detected by Western blot. i CCK-8 assays were performed to determine the proliferation of HOXD3- depleted CRC cells. j Colony-forming assays were performed to determine the effects of HOXD3 depletion on the growth of CRC cells. The diameter > 50 cells was scored. k Cell cycle progression was analyzed by flow cytometry. l The migration potencies of CRC cells with the indicated treatments were detected by using wound healing assay. m Invasion assays were used to determine the effects of HOXD3 depletion on the invasion ability of CRC cells. For b, g, i, j, k, l and m, data are presented as means ± SD in three independent experiments. * P

    Article Snippet: Construction of cell lines with stably downregulated HOXD-AS1 and HOXD3 There shRNA sequence specially targeting HOXD-AS1 or HOXD3 were designed and synthesized, and clone into a pGU6/GFP/Neo-shRNA vector (GenePharma, China).

    Techniques: Expressing, Immunohistochemistry, Plasmid Preparation, shRNA, Real-time Polymerase Chain Reaction, Western Blot, CCK-8 Assay, Flow Cytometry, Cytometry, Migration, Wound Healing Assay

    HOXD-AS1 inversely regulates the expression of neighbouring gene HOXD3. a Expression of HOXD3 in CRC cells were detected by real-time PCR (upper) and Western blot (down) when HOXD-AS1-overexpression or -depletion, respectively. b Expression levels of HOXD-AS1 in 35 paired CRC and adjacent non-cancerous tissues. c The expression correlation between HOXD-AS1 and HOXD3 was detected by real-time PCR in 35 paired CRC and adjacent non-cancerous tissues. d FISH analysis of the subcellular location of HOXD-AS1 in CRC cells. HOXD-AS1 mainly enriches in nucleus. e To identify the proteins associated with HOXD-AS1 by RNA pull-down assays. Biotinylated HOXD-AS1 and antisense RNA were incubated with cell extracts, and the associated proteins were resolved by SDS-PAGE. The HOXD-AS1-sense-special bands (arrows) in SW620 nuclear lysates group were excised and analyzed by mass spectrometry. f Western blot was used to detect SUZ12 and EZH2 in pull-down products. g RIP assays were performed in SW620 cells using anti-SUZ12, anti-EZH2 or nonspecific IgG antibodies respectively. Real-time PCR was performed to determine amount of RNA associated with SUZ12, EZH2 or IgG compared with the input control. h ChIP assays were performed in HOXD-AS1 overexpressed(SW620-HOXD-AS1)and control cells using anti-EZH2-, anti-SUZ12-, and anti-H3K27me3-antibodies or IgG antibody respectively. To determine the specific binding site of PRC2 complex and the promoter region of HOXD3, we divided HOXD3 promoter region into 7 segments. The enrichments of 7 segments of HOXD3 gene promoter DNA associated with antibodies were examined by real-time PCR. i-j The expression of HOXD3 were detected by i real-time PCR and j Western blot in SUZ12 or EZH2-depleted SW620 and control cells, respectively. k The quantitative data analysis of j to show the expression pattern between EZH2 or SUZ12 and HOXD3, respectively. For a, b, c, g, h, i and k, data were presented as means ± SD in three independent experiments. * P

    Journal: Molecular Cancer

    Article Title: Nuclear lncRNA HOXD-AS1 suppresses colorectal carcinoma growth and metastasis via inhibiting HOXD3-induced integrin β3 transcriptional activating and MAPK/AKT signalling

    doi: 10.1186/s12943-019-0955-9

    Figure Lengend Snippet: HOXD-AS1 inversely regulates the expression of neighbouring gene HOXD3. a Expression of HOXD3 in CRC cells were detected by real-time PCR (upper) and Western blot (down) when HOXD-AS1-overexpression or -depletion, respectively. b Expression levels of HOXD-AS1 in 35 paired CRC and adjacent non-cancerous tissues. c The expression correlation between HOXD-AS1 and HOXD3 was detected by real-time PCR in 35 paired CRC and adjacent non-cancerous tissues. d FISH analysis of the subcellular location of HOXD-AS1 in CRC cells. HOXD-AS1 mainly enriches in nucleus. e To identify the proteins associated with HOXD-AS1 by RNA pull-down assays. Biotinylated HOXD-AS1 and antisense RNA were incubated with cell extracts, and the associated proteins were resolved by SDS-PAGE. The HOXD-AS1-sense-special bands (arrows) in SW620 nuclear lysates group were excised and analyzed by mass spectrometry. f Western blot was used to detect SUZ12 and EZH2 in pull-down products. g RIP assays were performed in SW620 cells using anti-SUZ12, anti-EZH2 or nonspecific IgG antibodies respectively. Real-time PCR was performed to determine amount of RNA associated with SUZ12, EZH2 or IgG compared with the input control. h ChIP assays were performed in HOXD-AS1 overexpressed(SW620-HOXD-AS1)and control cells using anti-EZH2-, anti-SUZ12-, and anti-H3K27me3-antibodies or IgG antibody respectively. To determine the specific binding site of PRC2 complex and the promoter region of HOXD3, we divided HOXD3 promoter region into 7 segments. The enrichments of 7 segments of HOXD3 gene promoter DNA associated with antibodies were examined by real-time PCR. i-j The expression of HOXD3 were detected by i real-time PCR and j Western blot in SUZ12 or EZH2-depleted SW620 and control cells, respectively. k The quantitative data analysis of j to show the expression pattern between EZH2 or SUZ12 and HOXD3, respectively. For a, b, c, g, h, i and k, data were presented as means ± SD in three independent experiments. * P

    Article Snippet: Construction of cell lines with stably downregulated HOXD-AS1 and HOXD3 There shRNA sequence specially targeting HOXD-AS1 or HOXD3 were designed and synthesized, and clone into a pGU6/GFP/Neo-shRNA vector (GenePharma, China).

    Techniques: Expressing, Real-time Polymerase Chain Reaction, Western Blot, Over Expression, Fluorescence In Situ Hybridization, Incubation, SDS Page, Mass Spectrometry, Chromatin Immunoprecipitation, Binding Assay

    ClC-3 Mediates Recycling of β1 Integrin by Inducing Keratin 18 Phosphorylation (A) Immunofluorescence images (Left) and evaluation of fluorescence intensity of K18 (right) in HeLa cells treated with shK18 (pGPU6/GFP-K18 shRNA) or shRNA negative control (shNC). ** P

    Journal: Oncotarget

    Article Title: Chloride channel-3 promotes tumor metastasis by regulating membrane ruffling and is associated with poor survival

    doi:

    Figure Lengend Snippet: ClC-3 Mediates Recycling of β1 Integrin by Inducing Keratin 18 Phosphorylation (A) Immunofluorescence images (Left) and evaluation of fluorescence intensity of K18 (right) in HeLa cells treated with shK18 (pGPU6/GFP-K18 shRNA) or shRNA negative control (shNC). ** P

    Article Snippet: RNAi To identify and to follow up the cells with knockdown of ClC-3 or CK18 expression, the vector pGPU6/GFP-ClC-3 shRNA (sh-ClC-3) that encodes shRNA and targets the specific sequence (ClC-3: 5′- GAGUAAAGUAGGAUGGCUUUCAACCCA-3′[ ]; CK18: 5′- TATCACACGACTGCAGCTG-3′) was constructed and identified at GenePharma (GenePharma.

    Techniques: Immunofluorescence, Fluorescence, shRNA, Negative Control

    FAM83H‐AS1 sponges miR‐10a‐5p and miR‐10a‐5p directly targets Girdin in oesophageal cancer cells. A, Relative expression of miR‐10a‐5p in FAM83H‐AS1 knockdown or overexpression cells. B, Relative expression of FAM83H‐AS1 in miR‐10a‐5p mimics or inhibitor transfected cells. C, The MS2‐RIP method identified the direct binding between FAM83H‐AS1 and miR‐10a‐5p. D, The effect of miR‐10a‐5p mimics on luciferase activity of wild‐type and mutant‐type FAM83H‐AS1 vectors observed by dual‐luciferase reporter assay. E, The numbers of miR‐10a‐5p targeting the potential same genes (including Girdin) drawn by Venn diagram. F, Schematic representation of the potential binding sites of miR‐10a‐5p on Girdin 3′ UTR. G, Relative expression of Girdin in 67 pairs of ESCC tissues and corresponding normal tissues confirmed by qRT‐PCR method. H, The correlation between Girdin and miR‐10a‐5p expression. I, Relative expression of Girdin in different subgroups. J, The regulation of miR‐10a‐5p on Girdin expression detected by qRT‐PCR method. K, The effect of miR‐10a‐5p mimics on luciferase activity of wild‐type and mutant‐type Girdin 3′ UTR vectors observed by dual‐luciferase reporter assay. Data are shown as mean ± SD; * P

    Journal: Journal of Cellular and Molecular Medicine

    Article Title: LncRNA FAM83H‐AS1 promotes oesophageal squamous cell carcinoma progression via miR‐10a‐5p/Girdin axis, et al. LncRNA FAM83H‐AS1 promotes oesophageal squamous cell carcinoma progression via miR‐10a‐5p/Girdin axis

    doi: 10.1111/jcmm.15530

    Figure Lengend Snippet: FAM83H‐AS1 sponges miR‐10a‐5p and miR‐10a‐5p directly targets Girdin in oesophageal cancer cells. A, Relative expression of miR‐10a‐5p in FAM83H‐AS1 knockdown or overexpression cells. B, Relative expression of FAM83H‐AS1 in miR‐10a‐5p mimics or inhibitor transfected cells. C, The MS2‐RIP method identified the direct binding between FAM83H‐AS1 and miR‐10a‐5p. D, The effect of miR‐10a‐5p mimics on luciferase activity of wild‐type and mutant‐type FAM83H‐AS1 vectors observed by dual‐luciferase reporter assay. E, The numbers of miR‐10a‐5p targeting the potential same genes (including Girdin) drawn by Venn diagram. F, Schematic representation of the potential binding sites of miR‐10a‐5p on Girdin 3′ UTR. G, Relative expression of Girdin in 67 pairs of ESCC tissues and corresponding normal tissues confirmed by qRT‐PCR method. H, The correlation between Girdin and miR‐10a‐5p expression. I, Relative expression of Girdin in different subgroups. J, The regulation of miR‐10a‐5p on Girdin expression detected by qRT‐PCR method. K, The effect of miR‐10a‐5p mimics on luciferase activity of wild‐type and mutant‐type Girdin 3′ UTR vectors observed by dual‐luciferase reporter assay. Data are shown as mean ± SD; * P

    Article Snippet: 2.5 Cell transfectionThe shRNAs targeting FAM83H‐AS1 and the pcDNA3.1‐FAM83H‐AS1 were designed and synthesized by GenePharma and Sangon Biotech, respectively.

    Techniques: Expressing, Over Expression, Transfection, Binding Assay, Luciferase, Activity Assay, Mutagenesis, Reporter Assay, Quantitative RT-PCR

    MiR‐10a‐5p contains binding sites to FAM83H‐AS1 and functions as tumour suppressor role. A, The sequence of predicted (wild‐type) and mutated (mutant type) binding sites for miR‐10a‐5p on FAM83H‐AS1. The red nucleotides are the seed sequences of miR‐10a‐5p. B, Relative expression of miR‐10a‐5p in 67 pairs of ESCC tissues and corresponding normal tissues confirmed by qRT‐PCR method. C, Relative expression of miR‐10a‐5p in four human oesophageal cancer cell lines detected by qRT‐PCR method. Pools: average expression in 10 normal tissues was used as normal control. * Compared with the pools. D, Relative expression of miR‐10a‐5p in different subgroups. E, The correlation between FAM83H‐AS1 and miR‐10a‐5p expression. F, Relative expression of miR‐10a‐5p detected by transfection with miR‐10a‐5p mimics or inhibitor. G, MTS assay and H, clone formation assay were conducted by transfection with miR‐10a‐5p mimics or inhibitor. I, Transwell migration and J, invasion assays were performed by transfection with miR‐10a‐5p mimics or inhibitor (magnification, ×200). Data are shown as mean ± SD; * P

    Journal: Journal of Cellular and Molecular Medicine

    Article Title: LncRNA FAM83H‐AS1 promotes oesophageal squamous cell carcinoma progression via miR‐10a‐5p/Girdin axis, et al. LncRNA FAM83H‐AS1 promotes oesophageal squamous cell carcinoma progression via miR‐10a‐5p/Girdin axis

    doi: 10.1111/jcmm.15530

    Figure Lengend Snippet: MiR‐10a‐5p contains binding sites to FAM83H‐AS1 and functions as tumour suppressor role. A, The sequence of predicted (wild‐type) and mutated (mutant type) binding sites for miR‐10a‐5p on FAM83H‐AS1. The red nucleotides are the seed sequences of miR‐10a‐5p. B, Relative expression of miR‐10a‐5p in 67 pairs of ESCC tissues and corresponding normal tissues confirmed by qRT‐PCR method. C, Relative expression of miR‐10a‐5p in four human oesophageal cancer cell lines detected by qRT‐PCR method. Pools: average expression in 10 normal tissues was used as normal control. * Compared with the pools. D, Relative expression of miR‐10a‐5p in different subgroups. E, The correlation between FAM83H‐AS1 and miR‐10a‐5p expression. F, Relative expression of miR‐10a‐5p detected by transfection with miR‐10a‐5p mimics or inhibitor. G, MTS assay and H, clone formation assay were conducted by transfection with miR‐10a‐5p mimics or inhibitor. I, Transwell migration and J, invasion assays were performed by transfection with miR‐10a‐5p mimics or inhibitor (magnification, ×200). Data are shown as mean ± SD; * P

    Article Snippet: 2.5 Cell transfectionThe shRNAs targeting FAM83H‐AS1 and the pcDNA3.1‐FAM83H‐AS1 were designed and synthesized by GenePharma and Sangon Biotech, respectively.

    Techniques: Binding Assay, Sequencing, Mutagenesis, Expressing, Quantitative RT-PCR, Transfection, MTS Assay, Tube Formation Assay, Migration

    FAM83H‐AS1 positively regulates Girdin in a miR‐10a‐5p‐dependent manner. A, Relative expression of Girdin following cotransfection with miR‐10a‐5p inhibitor or mimics in FAM83H‐AS1 knockdown or overexpression cells. B, The correlation between FAM83H‐AS1 and Girdin expression. C, MTS assay and D, clone formation assay were rescued by cotransfection with miR‐10a‐5p inhibitor or mimics in FAM83H‐AS1 knockdown or overexpression cells. E, Transwell migration and F, invasion assays were confirmed following cotransfection with miR‐10a‐5p inhibitor or mimics in FAM83H‐AS1 knockdown or overexpression cells (magnification, ×200). Data are shown as mean ± SD; * P

    Journal: Journal of Cellular and Molecular Medicine

    Article Title: LncRNA FAM83H‐AS1 promotes oesophageal squamous cell carcinoma progression via miR‐10a‐5p/Girdin axis, et al. LncRNA FAM83H‐AS1 promotes oesophageal squamous cell carcinoma progression via miR‐10a‐5p/Girdin axis

    doi: 10.1111/jcmm.15530

    Figure Lengend Snippet: FAM83H‐AS1 positively regulates Girdin in a miR‐10a‐5p‐dependent manner. A, Relative expression of Girdin following cotransfection with miR‐10a‐5p inhibitor or mimics in FAM83H‐AS1 knockdown or overexpression cells. B, The correlation between FAM83H‐AS1 and Girdin expression. C, MTS assay and D, clone formation assay were rescued by cotransfection with miR‐10a‐5p inhibitor or mimics in FAM83H‐AS1 knockdown or overexpression cells. E, Transwell migration and F, invasion assays were confirmed following cotransfection with miR‐10a‐5p inhibitor or mimics in FAM83H‐AS1 knockdown or overexpression cells (magnification, ×200). Data are shown as mean ± SD; * P

    Article Snippet: 2.5 Cell transfectionThe shRNAs targeting FAM83H‐AS1 and the pcDNA3.1‐FAM83H‐AS1 were designed and synthesized by GenePharma and Sangon Biotech, respectively.

    Techniques: Expressing, Cotransfection, Over Expression, MTS Assay, Tube Formation Assay, Migration

    FAM83H implicates in ESCC progression and is regulated by FAM83H‐AS1 at mRNA and protein level. A, The interfering efficiency against FAM83H analysed by qRT‐PCR method. B, Cell proliferation was assessed using MTS assay with silenced FAM83H in Kyse150 and TE1 cells. C, Transwell migration and D, invasion assays were carried out with silenced FAM83H in Kyse150 and TE1 cells (magnification, ×200). E, and F, The influence of FAM83H‐AS1 on FAM83H mRNA and protein level detected by qRT‐PCR and Western blot assays. G, The influence of FAM83H on FAM83H‐AS1 expression analysed by qRT‐PCR method. Data are shown as mean ± SD; * P

    Journal: Journal of Cellular and Molecular Medicine

    Article Title: LncRNA FAM83H‐AS1 promotes oesophageal squamous cell carcinoma progression via miR‐10a‐5p/Girdin axis, et al. LncRNA FAM83H‐AS1 promotes oesophageal squamous cell carcinoma progression via miR‐10a‐5p/Girdin axis

    doi: 10.1111/jcmm.15530

    Figure Lengend Snippet: FAM83H implicates in ESCC progression and is regulated by FAM83H‐AS1 at mRNA and protein level. A, The interfering efficiency against FAM83H analysed by qRT‐PCR method. B, Cell proliferation was assessed using MTS assay with silenced FAM83H in Kyse150 and TE1 cells. C, Transwell migration and D, invasion assays were carried out with silenced FAM83H in Kyse150 and TE1 cells (magnification, ×200). E, and F, The influence of FAM83H‐AS1 on FAM83H mRNA and protein level detected by qRT‐PCR and Western blot assays. G, The influence of FAM83H on FAM83H‐AS1 expression analysed by qRT‐PCR method. Data are shown as mean ± SD; * P

    Article Snippet: 2.5 Cell transfectionThe shRNAs targeting FAM83H‐AS1 and the pcDNA3.1‐FAM83H‐AS1 were designed and synthesized by GenePharma and Sangon Biotech, respectively.

    Techniques: Quantitative RT-PCR, MTS Assay, Migration, Western Blot, Expressing

    Knockdown of FAM83H‐AS1 suppresses cell proliferation, migration and invasion in oesophageal cancer cells. A, The knockdown efficiency against FAM83H‐AS1 detected by qRT‐PCR method. B, Cell proliferation was assessed using MTS assay following FAM83H‐AS1 knockdown in Kyse150 and TE1 cells. C, Clone formation assay was conducted following FAM83H‐AS1 knockdown in Kyse150 and TE1 cells. D, Transwell migration and E, invasion assays were performed in Kyse150 and TE1 cells with FAM83H‐AS1 knockdown, respectively (magnification, ×200). Data are shown as mean ± SD; * P

    Journal: Journal of Cellular and Molecular Medicine

    Article Title: LncRNA FAM83H‐AS1 promotes oesophageal squamous cell carcinoma progression via miR‐10a‐5p/Girdin axis, et al. LncRNA FAM83H‐AS1 promotes oesophageal squamous cell carcinoma progression via miR‐10a‐5p/Girdin axis

    doi: 10.1111/jcmm.15530

    Figure Lengend Snippet: Knockdown of FAM83H‐AS1 suppresses cell proliferation, migration and invasion in oesophageal cancer cells. A, The knockdown efficiency against FAM83H‐AS1 detected by qRT‐PCR method. B, Cell proliferation was assessed using MTS assay following FAM83H‐AS1 knockdown in Kyse150 and TE1 cells. C, Clone formation assay was conducted following FAM83H‐AS1 knockdown in Kyse150 and TE1 cells. D, Transwell migration and E, invasion assays were performed in Kyse150 and TE1 cells with FAM83H‐AS1 knockdown, respectively (magnification, ×200). Data are shown as mean ± SD; * P

    Article Snippet: 2.5 Cell transfectionThe shRNAs targeting FAM83H‐AS1 and the pcDNA3.1‐FAM83H‐AS1 were designed and synthesized by GenePharma and Sangon Biotech, respectively.

    Techniques: Migration, Quantitative RT-PCR, MTS Assay, Tube Formation Assay

    FAM83H‐AS1 and FAM83H are significantly up‐regulated and are associated with clinicopathological characteristics. A, Relative expression of FAM83H‐AS1 in 67 pairs of ESCC tissues and corresponding normal tissues confirmed by qRT‐PCR method. B, Relative expression of FAM83H‐AS1 in four human oesophageal cancer cell lines detected by qRT‐PCR method. Pools: average expression in 10 normal tissues was used as normal control. * Compared with the pools. C, Relative expression of FAM83H‐AS1 in different subgroups. D, The subcellular localization of FAM83H‐AS1 in oesophageal cancer cells. E, Schematic representation of the genomic organization of FAM83H‐AS1 and FAM83H cited from NCBI. F, Relative expression of FAM83H in 67 pairs of ESCC tissues and corresponding normal tissues detected by qRT‐PCR method. G, The correlation between FAM83H‐AS1 and FAM83H expression determined by qRT‐PCR method. H, Relative expression of FAM83H in four human oesophageal cancer cell lines detected by qRT‐PCR method. Pools: average expression in 10 normal tissues was used as normal control. * Compared with the pools. I, Relative expression of FAM83H in different subgroups. Data are shown as mean ± SD; * P

    Journal: Journal of Cellular and Molecular Medicine

    Article Title: LncRNA FAM83H‐AS1 promotes oesophageal squamous cell carcinoma progression via miR‐10a‐5p/Girdin axis, et al. LncRNA FAM83H‐AS1 promotes oesophageal squamous cell carcinoma progression via miR‐10a‐5p/Girdin axis

    doi: 10.1111/jcmm.15530

    Figure Lengend Snippet: FAM83H‐AS1 and FAM83H are significantly up‐regulated and are associated with clinicopathological characteristics. A, Relative expression of FAM83H‐AS1 in 67 pairs of ESCC tissues and corresponding normal tissues confirmed by qRT‐PCR method. B, Relative expression of FAM83H‐AS1 in four human oesophageal cancer cell lines detected by qRT‐PCR method. Pools: average expression in 10 normal tissues was used as normal control. * Compared with the pools. C, Relative expression of FAM83H‐AS1 in different subgroups. D, The subcellular localization of FAM83H‐AS1 in oesophageal cancer cells. E, Schematic representation of the genomic organization of FAM83H‐AS1 and FAM83H cited from NCBI. F, Relative expression of FAM83H in 67 pairs of ESCC tissues and corresponding normal tissues detected by qRT‐PCR method. G, The correlation between FAM83H‐AS1 and FAM83H expression determined by qRT‐PCR method. H, Relative expression of FAM83H in four human oesophageal cancer cell lines detected by qRT‐PCR method. Pools: average expression in 10 normal tissues was used as normal control. * Compared with the pools. I, Relative expression of FAM83H in different subgroups. Data are shown as mean ± SD; * P

    Article Snippet: 2.5 Cell transfectionThe shRNAs targeting FAM83H‐AS1 and the pcDNA3.1‐FAM83H‐AS1 were designed and synthesized by GenePharma and Sangon Biotech, respectively.

    Techniques: Expressing, Quantitative RT-PCR

    FAM83H‐AS1 is up‐regulated in TGF‐β‐treated Eca109 cells and contributes to EMT process. A, Cell morphology in TGF‐β‐treated or untreated Eca109 cells. B, Relative expression of EMT‐related markers was detected in TGF‐β‐treated Eca109 cells. C, Relative expression of FAM83H‐AS1 was assessed in TGF‐β‐treated Eca109 cells. D, and E, The regulation of FAM83H‐AS1 on EMT‐related markers detected by qRT‐PCR method. F, The effect of FAM83H‐AS1 on EMT‐related markers observed by Western blot assay. Data are shown as mean ± SD; * P

    Journal: Journal of Cellular and Molecular Medicine

    Article Title: LncRNA FAM83H‐AS1 promotes oesophageal squamous cell carcinoma progression via miR‐10a‐5p/Girdin axis, et al. LncRNA FAM83H‐AS1 promotes oesophageal squamous cell carcinoma progression via miR‐10a‐5p/Girdin axis

    doi: 10.1111/jcmm.15530

    Figure Lengend Snippet: FAM83H‐AS1 is up‐regulated in TGF‐β‐treated Eca109 cells and contributes to EMT process. A, Cell morphology in TGF‐β‐treated or untreated Eca109 cells. B, Relative expression of EMT‐related markers was detected in TGF‐β‐treated Eca109 cells. C, Relative expression of FAM83H‐AS1 was assessed in TGF‐β‐treated Eca109 cells. D, and E, The regulation of FAM83H‐AS1 on EMT‐related markers detected by qRT‐PCR method. F, The effect of FAM83H‐AS1 on EMT‐related markers observed by Western blot assay. Data are shown as mean ± SD; * P

    Article Snippet: 2.5 Cell transfectionThe shRNAs targeting FAM83H‐AS1 and the pcDNA3.1‐FAM83H‐AS1 were designed and synthesized by GenePharma and Sangon Biotech, respectively.

    Techniques: Expressing, Quantitative RT-PCR, Western Blot