Structured Review

Horizon Discovery sirna duplex
FA proteins are involved in S-phase checkpoint activation. ( A ) Replicative DNA synthesis was measured as a function of time after exposure to 10 μM 8-MOP+10 kJ/m 2 UVA in WT, GM3657 (□, lymphoblasts), MRC5 (•, fibroblasts) and FA cells from A, C, G and D2 complementation groups. ( B ) Replicative DNA synthesis was measured 3 h after exposure to 10 μM 8-MOP+10 kJ/m 2 UVA in WT, FA cells from C, G and D2 complementation groups, ectopically corrected FA cells or in FA-D2 cells transfected with <t>CHK1</t> <t>siRNA.</t> ( C ) Inhibition of MRE11 expression by MRE11-siRNA transfection in FA cells. Equal loading of proteins was demonstrated by RAD50 immunoblotting. ( D ) Consequence of MRE11 interference on NBS1 phosphorylation following exposure to photoactivated psoralens. ( E ) Analysis of CHK1 phosphorylation in photoactivated (10 kJ/m 2 UVA) 8-MOP (10 μM) treated FA cells by Western blot with a specific anti-phospho-CHK1 antibody directed against phospho-S345. ( F , G ) Formation and quantitation of ATR foci in response to 10 μM 8-MOP+10 kJ/m 2 UVA treatment as evaluated by immunostaining of cells with an anti-ATR antibody in WT, NBS1 or FANC defective cells.
Sirna Duplex, supplied by Horizon Discovery, used in various techniques. Bioz Stars score: 93/100, based on 36 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sirna duplex/product/Horizon Discovery
Average 93 stars, based on 36 article reviews
Price from $9.99 to $1999.99
sirna duplex - by Bioz Stars, 2020-09
93/100 stars

Images

1) Product Images from "The DNA crosslink-induced S-phase checkpoint depends on ATR-CHK1 and ATR-NBS1-FANCD2 pathways"

Article Title: The DNA crosslink-induced S-phase checkpoint depends on ATR-CHK1 and ATR-NBS1-FANCD2 pathways

Journal: The EMBO Journal

doi: 10.1038/sj.emboj.7600113

FA proteins are involved in S-phase checkpoint activation. ( A ) Replicative DNA synthesis was measured as a function of time after exposure to 10 μM 8-MOP+10 kJ/m 2 UVA in WT, GM3657 (□, lymphoblasts), MRC5 (•, fibroblasts) and FA cells from A, C, G and D2 complementation groups. ( B ) Replicative DNA synthesis was measured 3 h after exposure to 10 μM 8-MOP+10 kJ/m 2 UVA in WT, FA cells from C, G and D2 complementation groups, ectopically corrected FA cells or in FA-D2 cells transfected with CHK1 siRNA. ( C ) Inhibition of MRE11 expression by MRE11-siRNA transfection in FA cells. Equal loading of proteins was demonstrated by RAD50 immunoblotting. ( D ) Consequence of MRE11 interference on NBS1 phosphorylation following exposure to photoactivated psoralens. ( E ) Analysis of CHK1 phosphorylation in photoactivated (10 kJ/m 2 UVA) 8-MOP (10 μM) treated FA cells by Western blot with a specific anti-phospho-CHK1 antibody directed against phospho-S345. ( F , G ) Formation and quantitation of ATR foci in response to 10 μM 8-MOP+10 kJ/m 2 UVA treatment as evaluated by immunostaining of cells with an anti-ATR antibody in WT, NBS1 or FANC defective cells.
Figure Legend Snippet: FA proteins are involved in S-phase checkpoint activation. ( A ) Replicative DNA synthesis was measured as a function of time after exposure to 10 μM 8-MOP+10 kJ/m 2 UVA in WT, GM3657 (□, lymphoblasts), MRC5 (•, fibroblasts) and FA cells from A, C, G and D2 complementation groups. ( B ) Replicative DNA synthesis was measured 3 h after exposure to 10 μM 8-MOP+10 kJ/m 2 UVA in WT, FA cells from C, G and D2 complementation groups, ectopically corrected FA cells or in FA-D2 cells transfected with CHK1 siRNA. ( C ) Inhibition of MRE11 expression by MRE11-siRNA transfection in FA cells. Equal loading of proteins was demonstrated by RAD50 immunoblotting. ( D ) Consequence of MRE11 interference on NBS1 phosphorylation following exposure to photoactivated psoralens. ( E ) Analysis of CHK1 phosphorylation in photoactivated (10 kJ/m 2 UVA) 8-MOP (10 μM) treated FA cells by Western blot with a specific anti-phospho-CHK1 antibody directed against phospho-S345. ( F , G ) Formation and quantitation of ATR foci in response to 10 μM 8-MOP+10 kJ/m 2 UVA treatment as evaluated by immunostaining of cells with an anti-ATR antibody in WT, NBS1 or FANC defective cells.

Techniques Used: Activation Assay, DNA Synthesis, Transfection, Inhibition, Expressing, Western Blot, Quantitation Assay, Immunostaining

CHK1 and NBS1 are independently involved in ICL-dependent S-phase checkpoint downstream of ATR. ( A ) CHK1-siRNA transfection induces inhibition of CHK1 expression in HeLa cells. Protein extracts from mock-transfected (No siRNA), Ctrl siRNA or CHK1-siRNA-transfected cells were analyzed by Western blot with an anti-CHK1 antibody. ( B ) Replicative DNA synthesis in WT, NBS and/or CHK1-siRNA-inhibited cells 3 h after crosslinking treatment (10 μM 8-MOP+10 kJ/m 2 UVA). ( C ) CHK1 phosphorylation in response to ICLs (10 μM 8-MOP+10 kJ/m 2 UVA, 3 h recovery) or HU (2 mM, 6 h of treatment) exposure in WT, NBS, ATRkd-Dox or ATRkd-expressing cells (ATRkd+Dox) was assessed by Western blot with anti-phospho-CHK1 antibody directed against phospho-S345. ( D ) Analysis of NBS1 phosphorylation in response to ICLs (10 μM 8-MOP+10 kJ/m 2 UVA, 3 h recovery) or HU (2 mM, 6 h of treatment) exposure in WT (ATRkd-Dox) and ATRkd-expressing (ATRkd+Dox) cells (first panel), in CHK1-siRNA-treated cells (middle panel) or in response to ICLs or IR (5 Gy) in control and A-T cells (lower panel), as observed by Western blot with an anti-NBS1 antibody. ( E ) Representative images showing ICL-induced NBS1 assembly in nuclear foci in cells expressing or not the inactive form of ATR. Images were taken 3 h after treatment with 8-MOP (10 μM+10 kJ/m 2 UVA). ( F ) Quantification of NBS1 foci in WT, ATRkd-expressing and CHK1-siRNA-transfected cells following exposure to photoactivated 8-MOP.
Figure Legend Snippet: CHK1 and NBS1 are independently involved in ICL-dependent S-phase checkpoint downstream of ATR. ( A ) CHK1-siRNA transfection induces inhibition of CHK1 expression in HeLa cells. Protein extracts from mock-transfected (No siRNA), Ctrl siRNA or CHK1-siRNA-transfected cells were analyzed by Western blot with an anti-CHK1 antibody. ( B ) Replicative DNA synthesis in WT, NBS and/or CHK1-siRNA-inhibited cells 3 h after crosslinking treatment (10 μM 8-MOP+10 kJ/m 2 UVA). ( C ) CHK1 phosphorylation in response to ICLs (10 μM 8-MOP+10 kJ/m 2 UVA, 3 h recovery) or HU (2 mM, 6 h of treatment) exposure in WT, NBS, ATRkd-Dox or ATRkd-expressing cells (ATRkd+Dox) was assessed by Western blot with anti-phospho-CHK1 antibody directed against phospho-S345. ( D ) Analysis of NBS1 phosphorylation in response to ICLs (10 μM 8-MOP+10 kJ/m 2 UVA, 3 h recovery) or HU (2 mM, 6 h of treatment) exposure in WT (ATRkd-Dox) and ATRkd-expressing (ATRkd+Dox) cells (first panel), in CHK1-siRNA-treated cells (middle panel) or in response to ICLs or IR (5 Gy) in control and A-T cells (lower panel), as observed by Western blot with an anti-NBS1 antibody. ( E ) Representative images showing ICL-induced NBS1 assembly in nuclear foci in cells expressing or not the inactive form of ATR. Images were taken 3 h after treatment with 8-MOP (10 μM+10 kJ/m 2 UVA). ( F ) Quantification of NBS1 foci in WT, ATRkd-expressing and CHK1-siRNA-transfected cells following exposure to photoactivated 8-MOP.

Techniques Used: Transfection, Inhibition, Expressing, Western Blot, DNA Synthesis

ATR is involved in the S-phase checkpoint induced by ICL agents. ( A ) Replicative DNA synthesis was assessed by 3 H–T incorporation at various time points following exposure to 8-MOP (10 μM)+UVA (10 kJ/m 2 ) (left panel) or 3 h post-treatment after various doses of 8-MOP photoactivated by UVA (10 kJ/m 2 ) (right panel) in GM3657 (▾), MRC5 (•), ATM defective cells (□), ATRkd-Dox (○) control cells, ATRkd-expressing cells (▪), i.e. ATRkd+doxycyclin 48 h before crosslinking treatment, or HeLa cells transfected with ATR siRNA (▿) 48 h before the genotoxic treatment. ( B ) Induction by doxycyclin (1 μg/ml) of the Flag-tagged ATRkd protein in ATRkd-transfected cells as analyzed by Western blot with an anti-Flag antibody. ( C ) Inhibition of ATR expression by ATR-siRNA transfection. * Indicates aspecific bands recognized by the α-ATR antibody used.
Figure Legend Snippet: ATR is involved in the S-phase checkpoint induced by ICL agents. ( A ) Replicative DNA synthesis was assessed by 3 H–T incorporation at various time points following exposure to 8-MOP (10 μM)+UVA (10 kJ/m 2 ) (left panel) or 3 h post-treatment after various doses of 8-MOP photoactivated by UVA (10 kJ/m 2 ) (right panel) in GM3657 (▾), MRC5 (•), ATM defective cells (□), ATRkd-Dox (○) control cells, ATRkd-expressing cells (▪), i.e. ATRkd+doxycyclin 48 h before crosslinking treatment, or HeLa cells transfected with ATR siRNA (▿) 48 h before the genotoxic treatment. ( B ) Induction by doxycyclin (1 μg/ml) of the Flag-tagged ATRkd protein in ATRkd-transfected cells as analyzed by Western blot with an anti-Flag antibody. ( C ) Inhibition of ATR expression by ATR-siRNA transfection. * Indicates aspecific bands recognized by the α-ATR antibody used.

Techniques Used: DNA Synthesis, Expressing, Transfection, Western Blot, Inhibition

2) Product Images from "Impairment of Protein Trafficking upon Overexpression and Mutation of Optineurin"

Article Title: Impairment of Protein Trafficking upon Overexpression and Mutation of Optineurin

Journal: PLoS ONE

doi: 10.1371/journal.pone.0011547

Knockdown of the endogenous optineurin inhibits Tf uptake but has little effect on the TfR level or distribution in RPE cells. ( A ) Fluorescence images of RPE cells transfected for 48 h with 50 nM generic scrambled control or optineurin (OPTN) siRNA after a 15-min uptake of TR-Tf (in red). Scale bar, 20 µm. ( B ) Quantification of Tf uptake in scrambled (dark gray filled circles)- and OPTN siRNA-(orange squares) transfected cells. Fluorescence intensity of 7 randomly selected 20× fields at 0-, 2-, 5-, 8-, 10-, and 15-min time points was measured and divided by the number of cells. The internalized TR-Tf at each time point was expressed as percentage relative to that of the 15-min uptake in scrambled siRNA-transfected cells. Data (mean ± SD) presented are representative of three independent experiments. *, P
Figure Legend Snippet: Knockdown of the endogenous optineurin inhibits Tf uptake but has little effect on the TfR level or distribution in RPE cells. ( A ) Fluorescence images of RPE cells transfected for 48 h with 50 nM generic scrambled control or optineurin (OPTN) siRNA after a 15-min uptake of TR-Tf (in red). Scale bar, 20 µm. ( B ) Quantification of Tf uptake in scrambled (dark gray filled circles)- and OPTN siRNA-(orange squares) transfected cells. Fluorescence intensity of 7 randomly selected 20× fields at 0-, 2-, 5-, 8-, 10-, and 15-min time points was measured and divided by the number of cells. The internalized TR-Tf at each time point was expressed as percentage relative to that of the 15-min uptake in scrambled siRNA-transfected cells. Data (mean ± SD) presented are representative of three independent experiments. *, P

Techniques Used: Fluorescence, Transfection

3) Product Images from "Optineurin links myosin VI to the Golgi complex and is involved in Golgi organization and exocytosis"

Article Title: Optineurin links myosin VI to the Golgi complex and is involved in Golgi organization and exocytosis

Journal: The Journal of Cell Biology

doi: 10.1083/jcb.200501162

The transport of VSV-G to the cell surface is dramatically reduced in optineurin-depleted HeLa cells. Mock-treated or siRNA-treated HeLa cells were transfected with ts045-VSV-G-GFP to measure the rate of exocytosis . VSV-G at the cell surface was detected in indirect immunofluorescence using an mAb to the luminal domain of VSV-G and total VSV-G expressed was detected using a pAb to GFP. (A) Representative cells for the 40- and 100-min time points are shown to compare the amount of VSV-G on the cell surface in mock- and optineurin-depleted cells. (B) The ratio of cell surface over total VSV-G fluorescence was measured as described in Materials and methods to determine the rate of transport from the Golgi complex to the cell surface. Error bars: ±SEM. Bars, 10 μm.
Figure Legend Snippet: The transport of VSV-G to the cell surface is dramatically reduced in optineurin-depleted HeLa cells. Mock-treated or siRNA-treated HeLa cells were transfected with ts045-VSV-G-GFP to measure the rate of exocytosis . VSV-G at the cell surface was detected in indirect immunofluorescence using an mAb to the luminal domain of VSV-G and total VSV-G expressed was detected using a pAb to GFP. (A) Representative cells for the 40- and 100-min time points are shown to compare the amount of VSV-G on the cell surface in mock- and optineurin-depleted cells. (B) The ratio of cell surface over total VSV-G fluorescence was measured as described in Materials and methods to determine the rate of transport from the Golgi complex to the cell surface. Error bars: ±SEM. Bars, 10 μm.

Techniques Used: Transfection, Immunofluorescence, Fluorescence

The loss of optineurin results in Golgi fragmentation. Mock (a–c) or optineurin siRNA-treated HeLa cells (d–f and d′–f′) were double labeled in immunofluorescence experiments with TGN46 (b, e, and e′) and GM130 (a, d, and d′). White boxes indicate areas enlarged in the pictures below (d′, e′, and f′). The Golgi fragments contain both marker proteins as indicated by the yellow color in the merged images (c, f, and f′). The arrows highlight the overlap between the marker proteins in (d′–f′). Bars, 10 μm. TEM analysis of mock (g) or siRNA-transfected (h) HeLa cells. Arrows indicate the position of Golgi stacks that can be found in both mock-transfected and siRNA-transfected cells. Bars, 200 nm.
Figure Legend Snippet: The loss of optineurin results in Golgi fragmentation. Mock (a–c) or optineurin siRNA-treated HeLa cells (d–f and d′–f′) were double labeled in immunofluorescence experiments with TGN46 (b, e, and e′) and GM130 (a, d, and d′). White boxes indicate areas enlarged in the pictures below (d′, e′, and f′). The Golgi fragments contain both marker proteins as indicated by the yellow color in the merged images (c, f, and f′). The arrows highlight the overlap between the marker proteins in (d′–f′). Bars, 10 μm. TEM analysis of mock (g) or siRNA-transfected (h) HeLa cells. Arrows indicate the position of Golgi stacks that can be found in both mock-transfected and siRNA-transfected cells. Bars, 200 nm.

Techniques Used: Labeling, Immunofluorescence, Marker, Transmission Electron Microscopy, Transfection

Optineurin is depleted from NRK and HeLa cells using siRNA. HeLa (A) or NRK (B) cells were either mock transfected with water or transfected twice at 48-h intervals with siRNA specific to optineurin. After 4 d cells were blotted and probed with antibodies to myosin VI, optineurin, or actin (A, a and B, a). In a parallel experiment mock-transfected, siRNA-transfected NRK, or HeLa cells were used for immunofluorescence and double labeled with antibodies to optineurin (A, b and d; B, b and d) and GM130 (A, c and e; B, c and e). Bars, 10 μm.
Figure Legend Snippet: Optineurin is depleted from NRK and HeLa cells using siRNA. HeLa (A) or NRK (B) cells were either mock transfected with water or transfected twice at 48-h intervals with siRNA specific to optineurin. After 4 d cells were blotted and probed with antibodies to myosin VI, optineurin, or actin (A, a and B, a). In a parallel experiment mock-transfected, siRNA-transfected NRK, or HeLa cells were used for immunofluorescence and double labeled with antibodies to optineurin (A, b and d; B, b and d) and GM130 (A, c and e; B, c and e). Bars, 10 μm.

Techniques Used: Transfection, Immunofluorescence, Labeling

Knockdown of optineurin in NRK cells causes loss of myosin VI from the Golgi complex. Mock-transfected (a, b, e, and f) or siRNA-transfected (c, d, g, and h) NRK cells were used for immunofluorescence and were double labeled with antibodies to the globular tail of myosin VI (a, c, e, and g) and antibodies to TGN38 (b and d) or GM130 (f and h). Asterisks mark the position of the nucleus. Bars, 10 μm.
Figure Legend Snippet: Knockdown of optineurin in NRK cells causes loss of myosin VI from the Golgi complex. Mock-transfected (a, b, e, and f) or siRNA-transfected (c, d, g, and h) NRK cells were used for immunofluorescence and were double labeled with antibodies to the globular tail of myosin VI (a, c, e, and g) and antibodies to TGN38 (b and d) or GM130 (f and h). Asterisks mark the position of the nucleus. Bars, 10 μm.

Techniques Used: Transfection, Immunofluorescence, Labeling

4) Product Images from "La Autoantigen Is Necessary for Optimal Function of the Poliovirus and Hepatitis C Virus Internal Ribosome Entry Site In Vivo and In Vitro †"

Article Title: La Autoantigen Is Necessary for Optimal Function of the Poliovirus and Hepatitis C Virus Internal Ribosome Entry Site In Vivo and In Vitro †

Journal: Molecular and Cellular Biology

doi: 10.1128/MCB.24.15.6861-6870.2004

IRES-driven translation of poliovirus RNA is inhibited by La85-siRNA. A schematic diagram of the bicistronic construct pcDNA3-RLuc-PolioIRES-FLuc is shown at the top of the figure (CMV, cytomegalovirus). The bicistronic construct pcDNA3-RLuc-PolioIRES-FLuc was cotransfected into HeLa cells with either La85-siRNA or control siRNA (Ctlr-siRNA). Twenty hours after transfection, cells were analyzed for FLuc and RLuc activities. The ratios of RLuc/FLuc activity are presented by the bars in the histogram. Absolute levels of RLuc and FLuc activities (in relative light units) are presented below the histogram.
Figure Legend Snippet: IRES-driven translation of poliovirus RNA is inhibited by La85-siRNA. A schematic diagram of the bicistronic construct pcDNA3-RLuc-PolioIRES-FLuc is shown at the top of the figure (CMV, cytomegalovirus). The bicistronic construct pcDNA3-RLuc-PolioIRES-FLuc was cotransfected into HeLa cells with either La85-siRNA or control siRNA (Ctlr-siRNA). Twenty hours after transfection, cells were analyzed for FLuc and RLuc activities. The ratios of RLuc/FLuc activity are presented by the bars in the histogram. Absolute levels of RLuc and FLuc activities (in relative light units) are presented below the histogram.

Techniques Used: Construct, Transfection, Activity Assay

5) Product Images from "Therapeutic Ultrasound Bypasses Canonical Syndecan-4 Signaling to Activate Rac1 *Therapeutic Ultrasound Bypasses Canonical Syndecan-4 Signaling to Activate Rac1 * S⃞"

Article Title: Therapeutic Ultrasound Bypasses Canonical Syndecan-4 Signaling to Activate Rac1 *Therapeutic Ultrasound Bypasses Canonical Syndecan-4 Signaling to Activate Rac1 * S⃞

Journal: The Journal of Biological Chemistry

doi: 10.1074/jbc.M804281200

Ultrasound-induced focal adhesion formation is independent of the syndecan-4-PKC α signaling axis. MEFs transfected with a nontargeting control siRNA ( A ) or an siRNA specific to PKCα ( C ) or treated with 200 n m BIM throughout ( E ) were
Figure Legend Snippet: Ultrasound-induced focal adhesion formation is independent of the syndecan-4-PKC α signaling axis. MEFs transfected with a nontargeting control siRNA ( A ) or an siRNA specific to PKCα ( C ) or treated with 200 n m BIM throughout ( E ) were

Techniques Used: Transfection

6) Product Images from "Caveolin-1 and force regulation in porcine airway smooth muscle"

Article Title: Caveolin-1 and force regulation in porcine airway smooth muscle

Journal: American Journal of Physiology - Lung Cellular and Molecular Physiology

doi: 10.1152/ajplung.00322.2010

Effect of caveolin-1 suppression on ASM contractility. In ASM strips at optimal length, following an initial evaluation of force response to 1 μM ACh (arrowhead), samples were transfected with a small interfering RNA (siRNA) targeting caveolin-1,
Figure Legend Snippet: Effect of caveolin-1 suppression on ASM contractility. In ASM strips at optimal length, following an initial evaluation of force response to 1 μM ACh (arrowhead), samples were transfected with a small interfering RNA (siRNA) targeting caveolin-1,

Techniques Used: Transfection, Small Interfering RNA

7) Product Images from "Germinal Cell Aplasia in Kif18a Mutant Male Mice Due to Impaired Chromosome Congression and Dysregulated BubR1 and CENP-E"

Article Title: Germinal Cell Aplasia in Kif18a Mutant Male Mice Due to Impaired Chromosome Congression and Dysregulated BubR1 and CENP-E

Journal: Genes & Cancer

doi: 10.1177/1947601909358184

KIF18A physically interacts with BubR1 and CENP-E. ( A ) Control HeLa cells or the cells treated with paclitaxel or transfected with KIF18A siRNA for 24 h were subjected to chromosome spread analysis. Representative mitotic chromosomes from each treatment are shown. ( B ) HeLa cells treated with paclitaxel or transfected with KIF18A siRNA for 24 h were subjected to chromosome spread analysis. The percentages of normal chromosomes and chromosomes with premature sister chromatid separation were summarized from 3 independent experiments. ( C ) Equal amounts of interphase cell or mitotic cell (Taxol-treated) lysates were subjected to immunoprecipitation using the KIF18A antibody or a control IgG. Immunoprecipitates, along with the lysate inputs, were blotted for KIF18A, BubR1, and Eg5. Arrow p-BubR1 denotes the phosphorylated BubR1. ( D ) Equal amounts of interphase cell or mitotic cell (Taxol-treated) lysates were subjected to immunoprecipitation using the KIF18A antibody or a control IgG. Immunoprecipitates and the lysate inputs were blotted for KIF18A and CENP-E. Each experiment was repeated for at least 3 times. Representative data are shown.
Figure Legend Snippet: KIF18A physically interacts with BubR1 and CENP-E. ( A ) Control HeLa cells or the cells treated with paclitaxel or transfected with KIF18A siRNA for 24 h were subjected to chromosome spread analysis. Representative mitotic chromosomes from each treatment are shown. ( B ) HeLa cells treated with paclitaxel or transfected with KIF18A siRNA for 24 h were subjected to chromosome spread analysis. The percentages of normal chromosomes and chromosomes with premature sister chromatid separation were summarized from 3 independent experiments. ( C ) Equal amounts of interphase cell or mitotic cell (Taxol-treated) lysates were subjected to immunoprecipitation using the KIF18A antibody or a control IgG. Immunoprecipitates, along with the lysate inputs, were blotted for KIF18A, BubR1, and Eg5. Arrow p-BubR1 denotes the phosphorylated BubR1. ( D ) Equal amounts of interphase cell or mitotic cell (Taxol-treated) lysates were subjected to immunoprecipitation using the KIF18A antibody or a control IgG. Immunoprecipitates and the lysate inputs were blotted for KIF18A and CENP-E. Each experiment was repeated for at least 3 times. Representative data are shown.

Techniques Used: Transfection, Immunoprecipitation

KIF18A depletion causes spindle pole and chromosome congression defects in vitro . ( A ) Mouse spermatogonial GC-1 cells transfected with Kif18a or luciferase (Luc) siRNA for 24 h were fixed and stained with antibodies to KIF18A (green) and CREST (red). DNA was stained with 4′6′-diamidino-2-phenylindole (DAPI; blue). Representative results are shown. ( B ) Cells at various mitotic stages or with unaligned/misaligned chromosomes were summarized from GC-1 cells transfected with Kif18a or luciferase siRNA. The data were summarized from 3 independent experiments. ( C ) GC-1 cells transfected with Kif18a or luciferase siRNA for 24 h were fixed and stained with antibodies to α-tubulin (green) and γ-tubulin (red). DNA was stained with DAPI (blue). Representative images are shown. ( D ) GC-1 cells transfected with Kif18a or luciferase siRNA for 24 h were fixed and stained with antibodies to α-tubulin (green) and γ-tubulin (red). Mitotic cells with multiple spindle poles were summarized from 3 independent experiments. ( E ) HeLa cells transfected with KIF18A or luciferase siRNA for 24 h were examined under a light microscope. Representative images are shown. ( F ) Equal amounts of proteins from HeLa cells transfected with KIF18A or luciferase siRNA for 24 h were blotted for KIF18A and β-actin. ( G ) Mitotic cells of various stages or with unaligned/misaligned chromosomes were counted from HeLa cells transfected with KIF18A or luciferase siRNA for 24 h. The data were summarized from 3 independent experiments. ( H ) HeLa cells transfected with KIF18A or luciferase siRNA for 24 h were fixed and stained with antibodies to α-tubulin (green) and γ-tubulin (red). Mitotic cells with multiple spindle poles were summarized from 3 independent experiments.
Figure Legend Snippet: KIF18A depletion causes spindle pole and chromosome congression defects in vitro . ( A ) Mouse spermatogonial GC-1 cells transfected with Kif18a or luciferase (Luc) siRNA for 24 h were fixed and stained with antibodies to KIF18A (green) and CREST (red). DNA was stained with 4′6′-diamidino-2-phenylindole (DAPI; blue). Representative results are shown. ( B ) Cells at various mitotic stages or with unaligned/misaligned chromosomes were summarized from GC-1 cells transfected with Kif18a or luciferase siRNA. The data were summarized from 3 independent experiments. ( C ) GC-1 cells transfected with Kif18a or luciferase siRNA for 24 h were fixed and stained with antibodies to α-tubulin (green) and γ-tubulin (red). DNA was stained with DAPI (blue). Representative images are shown. ( D ) GC-1 cells transfected with Kif18a or luciferase siRNA for 24 h were fixed and stained with antibodies to α-tubulin (green) and γ-tubulin (red). Mitotic cells with multiple spindle poles were summarized from 3 independent experiments. ( E ) HeLa cells transfected with KIF18A or luciferase siRNA for 24 h were examined under a light microscope. Representative images are shown. ( F ) Equal amounts of proteins from HeLa cells transfected with KIF18A or luciferase siRNA for 24 h were blotted for KIF18A and β-actin. ( G ) Mitotic cells of various stages or with unaligned/misaligned chromosomes were counted from HeLa cells transfected with KIF18A or luciferase siRNA for 24 h. The data were summarized from 3 independent experiments. ( H ) HeLa cells transfected with KIF18A or luciferase siRNA for 24 h were fixed and stained with antibodies to α-tubulin (green) and γ-tubulin (red). Mitotic cells with multiple spindle poles were summarized from 3 independent experiments.

Techniques Used: In Vitro, Transfection, Luciferase, Staining, Light Microscopy

KIF18A depletion induces prolonged mitotic arrest, leading to mitotic catastrophe. ( A ) HeLa cells constitutively expressing green fluorescent protein (GFP)–tubulin were transfected with KIF18A or luciferase siRNA for 24 h. These cells were then subjected to time lapse confocal microscopy analysis. Representative differential interference contrast (DIC) and α-tubulin images of metaphase cells undergoing mitosis are shown. ( B ) HeLa cells transfected with KIF18A or luciferase siRNA for 0, 24, or 36 h were observed under a light microscope. Representative images are shown. ( C ) HeLa cells constitutively expressing GFP-tubulin were transfected with KIF18A siRNA for 36 h. Mitotic cells were then subjected to time lapse confocal microcopy. DIC and α-tubulin images of a representative cell undergoing mitosis are shown. Arrows indicate the distorted, bundled microtubules. ( D ) HeLa cells transfected with KIF18A, SGO1, or luciferase siRNA for 24 h were collected and lysed. HeLa cells treated with VP16 overnight were also used for lysate preparation. Equal amounts of proteins were blotted for PARP-1 or its degradation product p89. R and A denote rounded-up cells and adherent cells, respectively. ( E ) Sections of wt and Kif18a −/− seminiferous tubules were subjected to terminal deoxynucleotidyl transferase–mediated dUTP-biotin nick end labeling (TUNEL) analysis. Representative images are shown.
Figure Legend Snippet: KIF18A depletion induces prolonged mitotic arrest, leading to mitotic catastrophe. ( A ) HeLa cells constitutively expressing green fluorescent protein (GFP)–tubulin were transfected with KIF18A or luciferase siRNA for 24 h. These cells were then subjected to time lapse confocal microscopy analysis. Representative differential interference contrast (DIC) and α-tubulin images of metaphase cells undergoing mitosis are shown. ( B ) HeLa cells transfected with KIF18A or luciferase siRNA for 0, 24, or 36 h were observed under a light microscope. Representative images are shown. ( C ) HeLa cells constitutively expressing GFP-tubulin were transfected with KIF18A siRNA for 36 h. Mitotic cells were then subjected to time lapse confocal microcopy. DIC and α-tubulin images of a representative cell undergoing mitosis are shown. Arrows indicate the distorted, bundled microtubules. ( D ) HeLa cells transfected with KIF18A, SGO1, or luciferase siRNA for 24 h were collected and lysed. HeLa cells treated with VP16 overnight were also used for lysate preparation. Equal amounts of proteins were blotted for PARP-1 or its degradation product p89. R and A denote rounded-up cells and adherent cells, respectively. ( E ) Sections of wt and Kif18a −/− seminiferous tubules were subjected to terminal deoxynucleotidyl transferase–mediated dUTP-biotin nick end labeling (TUNEL) analysis. Representative images are shown.

Techniques Used: Expressing, Transfection, Luciferase, Confocal Microscopy, Light Microscopy, End Labeling, TUNEL Assay

KIF18A regulates the stability of BubR1 and CENP-E during mitosis. ( A ) HeLa cells transfected with KIF18A or luciferase siRNA for 24 h were fixed and stained with antibodies to α-BubR1 (green) and CREST (red). DNA was stained with 4′6′-diamidino-2-phenylindole (DAPI; blue). Representative images are shown. Arrows indicate BubR1 signals on unaligned chromosomes. ( B ) HeLa cells transfected with KIF18A or luciferase siRNA for 24 h were fixed and stained with antibodies to CENP-E (green) and CREST (red). DNA was stained with DAPI (blue). Representative images are shown. ( C ) HeLa cells transfected with KIF18A , SGO1, or luciferase siRNA for 24 h were collected and lysed. HeLa cells treated with VP16 overnight were also used for lysate preparation. Equal amounts of proteins from various treatments were blotted for KIF18A, CENP-E, BubR1, Aurora B, Eg5, cyclin B, Mad2, PARP-1, and β-actin. R and A denote rounded-up cells and adherent cells, respectively. Arrow p-BubR1 denotes the phosphorylated BubR1. R and A denote rounded-up and adherent cells, respectively.
Figure Legend Snippet: KIF18A regulates the stability of BubR1 and CENP-E during mitosis. ( A ) HeLa cells transfected with KIF18A or luciferase siRNA for 24 h were fixed and stained with antibodies to α-BubR1 (green) and CREST (red). DNA was stained with 4′6′-diamidino-2-phenylindole (DAPI; blue). Representative images are shown. Arrows indicate BubR1 signals on unaligned chromosomes. ( B ) HeLa cells transfected with KIF18A or luciferase siRNA for 24 h were fixed and stained with antibodies to CENP-E (green) and CREST (red). DNA was stained with DAPI (blue). Representative images are shown. ( C ) HeLa cells transfected with KIF18A , SGO1, or luciferase siRNA for 24 h were collected and lysed. HeLa cells treated with VP16 overnight were also used for lysate preparation. Equal amounts of proteins from various treatments were blotted for KIF18A, CENP-E, BubR1, Aurora B, Eg5, cyclin B, Mad2, PARP-1, and β-actin. R and A denote rounded-up cells and adherent cells, respectively. Arrow p-BubR1 denotes the phosphorylated BubR1. R and A denote rounded-up and adherent cells, respectively.

Techniques Used: Transfection, Luciferase, Staining

8) Product Images from "Linking H3K79 trimethylation to Wnt signaling through a novel Dot1-containing complex (DotCom)"

Article Title: Linking H3K79 trimethylation to Wnt signaling through a novel Dot1-containing complex (DotCom)

Journal: Genes & Development

doi: 10.1101/gad.1898410

SiRNA-mediated knockdown of Dot1, AF10, AF9, and ENL affects global H3K79 methylation levels. ( A ) HeLa cells were treated with scrambled, ENL, AF9, AF10, and Dot1 siRNAs as indicated. Total cell lysates were subjected to immunoblot analyses with the indicated
Figure Legend Snippet: SiRNA-mediated knockdown of Dot1, AF10, AF9, and ENL affects global H3K79 methylation levels. ( A ) HeLa cells were treated with scrambled, ENL, AF9, AF10, and Dot1 siRNAs as indicated. Total cell lysates were subjected to immunoblot analyses with the indicated

Techniques Used: Methylation

9) Product Images from "Hypoxia Activates Tumor Suppressor p53 by Inducing ATR-Chk1 Kinase Cascade-mediated Phosphorylation and Consequent 14-3-3? Inactivation of MDMX Protein *"

Article Title: Hypoxia Activates Tumor Suppressor p53 by Inducing ATR-Chk1 Kinase Cascade-mediated Phosphorylation and Consequent 14-3-3? Inactivation of MDMX Protein *

Journal: The Journal of Biological Chemistry

doi: 10.1074/jbc.M111.336875

Depletion of Chk1 or ATR suppresses hypoxia-induced MDMX phosphorylation at Ser-367 and the interaction between MDMX and 14-3-3γ. A , knockdown of Chk1 eliminates hypoxia-induced MDMX phosphorylation and MDMX interaction with 14-3-3γ. U2OS cells were double-transfected with scramble siRNA or siRNA specific to Chk1 ( siR-Chk1 ), and ∼24 h after the second transfection, cells were subjected to hypoxia. After 6 or 18 h hypoxia, cell lysates were prepared for WB (40 μg) or co-IP analyses. 500 μg of cell lysates were incubated with anti-14-3-3 antibodies for co-IP and subjected to SDS-PAGE followed by WB analysis. Proteins of interest were detected by antibodies as listed on the left. B , depletion of ATR inhibits hypoxia-induced MDMX phosphorylation and its interaction with 14-3-3γ. Knockdown of ATR was achieved by the introduction of siRNA or shRNA in U2OS cells ∼24 h after double transfection. Then, cells were subjected to hypoxia for additional 6 or 18 h followed by WB analysis (80 μg) and co-IP (500 μg) as described above. Corresponding antibodies were listed on the left .
Figure Legend Snippet: Depletion of Chk1 or ATR suppresses hypoxia-induced MDMX phosphorylation at Ser-367 and the interaction between MDMX and 14-3-3γ. A , knockdown of Chk1 eliminates hypoxia-induced MDMX phosphorylation and MDMX interaction with 14-3-3γ. U2OS cells were double-transfected with scramble siRNA or siRNA specific to Chk1 ( siR-Chk1 ), and ∼24 h after the second transfection, cells were subjected to hypoxia. After 6 or 18 h hypoxia, cell lysates were prepared for WB (40 μg) or co-IP analyses. 500 μg of cell lysates were incubated with anti-14-3-3 antibodies for co-IP and subjected to SDS-PAGE followed by WB analysis. Proteins of interest were detected by antibodies as listed on the left. B , depletion of ATR inhibits hypoxia-induced MDMX phosphorylation and its interaction with 14-3-3γ. Knockdown of ATR was achieved by the introduction of siRNA or shRNA in U2OS cells ∼24 h after double transfection. Then, cells were subjected to hypoxia for additional 6 or 18 h followed by WB analysis (80 μg) and co-IP (500 μg) as described above. Corresponding antibodies were listed on the left .

Techniques Used: Transfection, Western Blot, Co-Immunoprecipitation Assay, Incubation, SDS Page, shRNA

10) Product Images from "Molecular Characterization of Myosin Phosphatase in Endothelium"

Article Title: Molecular Characterization of Myosin Phosphatase in Endothelium

Journal: Journal of cellular physiology

doi: 10.1002/jcp.22894

Role of the each subunit of protein phosphatase 1 (PPase 1) in the endothelial permeability. HPAEC plated on gold microelectrodes were transfected with small interfering RNA (siRNA) specific to the catalytic subunit of PPase 1 (CS1β in A, C or
Figure Legend Snippet: Role of the each subunit of protein phosphatase 1 (PPase 1) in the endothelial permeability. HPAEC plated on gold microelectrodes were transfected with small interfering RNA (siRNA) specific to the catalytic subunit of PPase 1 (CS1β in A, C or

Techniques Used: Permeability, Transfection, Small Interfering RNA

11) Product Images from "Hook Adaptors Induce Unidirectional Processive Motility by Enhancing the Dynein-Dynactin Interaction *"

Article Title: Hook Adaptors Induce Unidirectional Processive Motility by Enhancing the Dynein-Dynactin Interaction *

Journal: The Journal of Biological Chemistry

doi: 10.1074/jbc.M116.738211

Hook proteins display high velocities and long run lengths. A , example time series of particles moving to the minus end of microtubules (polarity is marked for Hk1 and Hk3; plus end shown in green ). Scale bars = 2 μm. FL , full-length. B , maximum projections of Halo-Hook1 (full-length) expressed in cells under mock or dynein heavy chain ( DHC ) siRNA conditions and imaged in the TIRF assay. Scale bars = 5 μm. C , Western blot of mock and dynein heavy chain siRNA knockdown lysates used for TIRF assays. D ) and plotted as probability density functions with 95% confidence interval bootstrapping. (BICD2, n = 242; Hk1, n = 90; Hk3, n = 84). E , table of motility parameters based on fits from data in D. F , percent of events with a mean velocity of more than 1 μm/s. G , per-track standard deviation of instantaneous velocity. Data are plotted as a box plot with Tukey whiskers.
Figure Legend Snippet: Hook proteins display high velocities and long run lengths. A , example time series of particles moving to the minus end of microtubules (polarity is marked for Hk1 and Hk3; plus end shown in green ). Scale bars = 2 μm. FL , full-length. B , maximum projections of Halo-Hook1 (full-length) expressed in cells under mock or dynein heavy chain ( DHC ) siRNA conditions and imaged in the TIRF assay. Scale bars = 5 μm. C , Western blot of mock and dynein heavy chain siRNA knockdown lysates used for TIRF assays. D ) and plotted as probability density functions with 95% confidence interval bootstrapping. (BICD2, n = 242; Hk1, n = 90; Hk3, n = 84). E , table of motility parameters based on fits from data in D. F , percent of events with a mean velocity of more than 1 μm/s. G , per-track standard deviation of instantaneous velocity. Data are plotted as a box plot with Tukey whiskers.

Techniques Used: Western Blot, Standard Deviation

12) Product Images from "Epigenetic Regulation of miR-212 Expression in Lung Cancer"

Article Title: Epigenetic Regulation of miR-212 Expression in Lung Cancer

Journal: PLoS ONE

doi: 10.1371/journal.pone.0027722

Role of EZH2 and G9a enzymes in histone methylation pattern and in miR-212 expression levels in NSCLC. ( A ) Expression analysis of EZH2, ( B ) G9a and ( C ) HDAC enzymes by Real-Time PCR in Calu-1 and MRC5 cells. ( D ) Expression analysis of mature miR-212 in Calu-1 cells untreated (−) or treated (+) with siEZH2 and TSA inhibitor or ( E ) with TSA and BIX01294 (BIX) inhibitors. ( D ) Calu-1 cells were transfected with specific EZH2-siRNA for 24 hours. Then, the cells were incubated with 100 ng/ml of TSA for 24 hours and miR-212 expression was evaluated by qRT-PCR. Down-regulation of EZH2 expression after siEZH2 transfection was evaluated by western blotting using anti-EZH2 antibody. To confirm equal loading the membrane was immunoblotted with anti-β-actin antibody. ( E ) Calu-1 cells were treated with 100 ng/ml of TSA for 16 or 24 hours in presence or in absence of 10 µM of BIX for 16 hours and miR-212 expression was evaluated by Real-Time PCR. These results suggest that in Calu-1 cells the upregulation of EZH2 and G9a enzymes contributes to increase histone methylation and thus to decrease miR-212 expression levels. Means ± SD of four independent experiments in triplicate are given.
Figure Legend Snippet: Role of EZH2 and G9a enzymes in histone methylation pattern and in miR-212 expression levels in NSCLC. ( A ) Expression analysis of EZH2, ( B ) G9a and ( C ) HDAC enzymes by Real-Time PCR in Calu-1 and MRC5 cells. ( D ) Expression analysis of mature miR-212 in Calu-1 cells untreated (−) or treated (+) with siEZH2 and TSA inhibitor or ( E ) with TSA and BIX01294 (BIX) inhibitors. ( D ) Calu-1 cells were transfected with specific EZH2-siRNA for 24 hours. Then, the cells were incubated with 100 ng/ml of TSA for 24 hours and miR-212 expression was evaluated by qRT-PCR. Down-regulation of EZH2 expression after siEZH2 transfection was evaluated by western blotting using anti-EZH2 antibody. To confirm equal loading the membrane was immunoblotted with anti-β-actin antibody. ( E ) Calu-1 cells were treated with 100 ng/ml of TSA for 16 or 24 hours in presence or in absence of 10 µM of BIX for 16 hours and miR-212 expression was evaluated by Real-Time PCR. These results suggest that in Calu-1 cells the upregulation of EZH2 and G9a enzymes contributes to increase histone methylation and thus to decrease miR-212 expression levels. Means ± SD of four independent experiments in triplicate are given.

Techniques Used: Methylation, Expressing, Real-time Polymerase Chain Reaction, Transfection, Incubation, Quantitative RT-PCR, Western Blot

13) Product Images from "A role for Chk1 in blocking transcriptional elongation of p21 RNA during the S-phase checkpoint"

Article Title: A role for Chk1 in blocking transcriptional elongation of p21 RNA during the S-phase checkpoint

Journal: Genes & Development

doi: 10.1101/gad.1795709

Unlike Chk1, Chk2 exerts a positive effect on p21 transcription. ( A ) HCT116 cells were transfected with control or Chk2 siRNA duplexes for 36 h, and then left untreated (N), treated with HU (HU, 1.7 mM, 24 h) or dauno (D, 0.22 μM, 8 h), lysed,
Figure Legend Snippet: Unlike Chk1, Chk2 exerts a positive effect on p21 transcription. ( A ) HCT116 cells were transfected with control or Chk2 siRNA duplexes for 36 h, and then left untreated (N), treated with HU (HU, 1.7 mM, 24 h) or dauno (D, 0.22 μM, 8 h), lysed,

Techniques Used: Transfection

14) Product Images from "Glutaminase dysregulation in HIV-1-infected human microglia mediates neurotoxicity: relevant to HIV-1 associated neurocognitive disorders"

Article Title: Glutaminase dysregulation in HIV-1-infected human microglia mediates neurotoxicity: relevant to HIV-1 associated neurocognitive disorders

Journal: The Journal of neuroscience : the official journal of the Society for Neuroscience

doi: 10.1523/JNEUROSCI.2051-11.2011

Reduced neurotoxicity by glutaminase C siRNA. Control or HIV-1-infected microglia were transfected with glutaminase C or control siRNA, and supernatants, RNA were collected. GAC expression (A), GLS1 expression (B), and KGA expression (C) were determined
Figure Legend Snippet: Reduced neurotoxicity by glutaminase C siRNA. Control or HIV-1-infected microglia were transfected with glutaminase C or control siRNA, and supernatants, RNA were collected. GAC expression (A), GLS1 expression (B), and KGA expression (C) were determined

Techniques Used: Infection, Transfection, Expressing

Reduced neurotoxicity by glutaminase 1 siRNA. Control or HIV-1-infected microglia were transfected with glutaminase 1 or control siRNA, and supernatants, RNA were collected. GAC expression (A), GLS1 expression (B), and KGA expression (C) were determined
Figure Legend Snippet: Reduced neurotoxicity by glutaminase 1 siRNA. Control or HIV-1-infected microglia were transfected with glutaminase 1 or control siRNA, and supernatants, RNA were collected. GAC expression (A), GLS1 expression (B), and KGA expression (C) were determined

Techniques Used: Infection, Transfection, Expressing

15) Product Images from "8p22 MTUS1 Gene Product ATIP3 Is a Novel Anti-Mitotic Protein Underexpressed in Invasive Breast Carcinoma of Poor Prognosis"

Article Title: 8p22 MTUS1 Gene Product ATIP3 Is a Novel Anti-Mitotic Protein Underexpressed in Invasive Breast Carcinoma of Poor Prognosis

Journal: PLoS ONE

doi: 10.1371/journal.pone.0007239

ATIP3 inhibits cancer cell proliferation. A. ATIP3 silencing in MDA-MB-468 cells transfected with control siRNA or specific ATIP3 siRNA#1 or siRNA#2 for 72 hours. Left panel : real-time RT-PCR using ATIP3-specific primers relative to EEF1G, normalized to non transfected cells (NT). Middle panel : immunoblotting with anti-MTUS1 antibodies showing ATIP3 at 170 kDa, and reprobing with anti-alpha-tubulin antibodies for internal control. Right panel : MTT assay. Results are expressed as percent of MTT incorporation in control siRNA-transfected cells at time 96 hours. Shown are the results of two representative experiments out of four performed in quadruplicate. **p
Figure Legend Snippet: ATIP3 inhibits cancer cell proliferation. A. ATIP3 silencing in MDA-MB-468 cells transfected with control siRNA or specific ATIP3 siRNA#1 or siRNA#2 for 72 hours. Left panel : real-time RT-PCR using ATIP3-specific primers relative to EEF1G, normalized to non transfected cells (NT). Middle panel : immunoblotting with anti-MTUS1 antibodies showing ATIP3 at 170 kDa, and reprobing with anti-alpha-tubulin antibodies for internal control. Right panel : MTT assay. Results are expressed as percent of MTT incorporation in control siRNA-transfected cells at time 96 hours. Shown are the results of two representative experiments out of four performed in quadruplicate. **p

Techniques Used: Multiple Displacement Amplification, Transfection, Quantitative RT-PCR, MTT Assay

16) Product Images from "Cog3p depletion blocks vesicle-mediated Golgi retrograde trafficking in HeLa cells"

Article Title: Cog3p depletion blocks vesicle-mediated Golgi retrograde trafficking in HeLa cells

Journal: The Journal of Cell Biology

doi: 10.1083/jcb.200412003

Cog3p depletion induces Golgi fragmentation. GalT-GFP HeLa cells were transfected with COG3 siRNA (right column) or mock transfected (left column). 72 h after transfection, cells were fixed and processed for IF with anti-Cog3p (COG3p row), and anti-GM130 (GM130 row) antibodies. The bottom row represent merged three-color images. Bars, 10 μm.
Figure Legend Snippet: Cog3p depletion induces Golgi fragmentation. GalT-GFP HeLa cells were transfected with COG3 siRNA (right column) or mock transfected (left column). 72 h after transfection, cells were fixed and processed for IF with anti-Cog3p (COG3p row), and anti-GM130 (GM130 row) antibodies. The bottom row represent merged three-color images. Bars, 10 μm.

Techniques Used: Transfection

Accumulation of CCD vesicles precedes COG3 KD-induced Golgi fragmentation. Control or COG3 KD cells that stably express GalT-GFP were fixed 48 h after siRNA transfection and stained with anti-GS15 and secondary antibodies conjugated with Alexa 594. Images were acquired with 63× objective and deconvolved. Note that the Golgi (arrows) has not yet been fragmented in a subpopulation of the COG3 KD cells, whereas the majority of GS15 was associated with multiple CCD vesicles. Bar, 10 μm.
Figure Legend Snippet: Accumulation of CCD vesicles precedes COG3 KD-induced Golgi fragmentation. Control or COG3 KD cells that stably express GalT-GFP were fixed 48 h after siRNA transfection and stained with anti-GS15 and secondary antibodies conjugated with Alexa 594. Images were acquired with 63× objective and deconvolved. Note that the Golgi (arrows) has not yet been fragmented in a subpopulation of the COG3 KD cells, whereas the majority of GS15 was associated with multiple CCD vesicles. Bar, 10 μm.

Techniques Used: Stable Transfection, Transfection, Staining

Mouse COG3p expression partially suppresses hCOG3 KD-induced Golgi fragmentation. (A) DNA alignment of a portion of the hCOG3 and mCOG3 sequences. siRNA target region is highlighted in the box. (B) GalT-GFP HeLa cells were either mock transfected (control), transfected with COG3 siRNA (COG3 KD), or simultaneously transfected with COG3p siRNA and mCOG3-encoding plasmid (COG3 KD +mCOG3) and imaged 72 h after transfection. Bar, 10 μm.
Figure Legend Snippet: Mouse COG3p expression partially suppresses hCOG3 KD-induced Golgi fragmentation. (A) DNA alignment of a portion of the hCOG3 and mCOG3 sequences. siRNA target region is highlighted in the box. (B) GalT-GFP HeLa cells were either mock transfected (control), transfected with COG3 siRNA (COG3 KD), or simultaneously transfected with COG3p siRNA and mCOG3-encoding plasmid (COG3 KD +mCOG3) and imaged 72 h after transfection. Bar, 10 μm.

Techniques Used: Expressing, Transfection, Plasmid Preparation

SiRNA-induced COG3 KD is destabilizing Lobe A COG complex subunits. (A) Expression of COG subunits after COG3 KD. WB of cell lysates from control and COG3 KD cells. Average levels of the COG subunits (±SD, n = 4) after 72 h of COG3 KD were determined by quantitative WB, and normalized to mock-transfected cells. (B) Membrane localization of COG complex subunits. WB of membrane (P100) and cytosol (S100) fractions. (C) Cog6p localization. Control and COG3 KD cells that stably express GalT-GFP were fixed and analyzed by three-color IF microscopy after immunostaining with anti-Cog6p. DNA was stained with DAPI. Arrows indicate Golgi or Golgi fragments. Bars, 10 μm.
Figure Legend Snippet: SiRNA-induced COG3 KD is destabilizing Lobe A COG complex subunits. (A) Expression of COG subunits after COG3 KD. WB of cell lysates from control and COG3 KD cells. Average levels of the COG subunits (±SD, n = 4) after 72 h of COG3 KD were determined by quantitative WB, and normalized to mock-transfected cells. (B) Membrane localization of COG complex subunits. WB of membrane (P100) and cytosol (S100) fractions. (C) Cog6p localization. Control and COG3 KD cells that stably express GalT-GFP were fixed and analyzed by three-color IF microscopy after immunostaining with anti-Cog6p. DNA was stained with DAPI. Arrows indicate Golgi or Golgi fragments. Bars, 10 μm.

Techniques Used: Expressing, Western Blot, Transfection, Stable Transfection, Microscopy, Immunostaining, Staining

17) Product Images from "sSgo1, a major splice variant of Sgo1, functions in centriole cohesion where it is regulated by Plk1"

Article Title: sSgo1, a major splice variant of Sgo1, functions in centriole cohesion where it is regulated by Plk1

Journal: Developmental cell

doi: 10.1016/j.devcel.2007.12.007

Ectopic expression of sSgo1 suppresses centriole splitting induced by Sgo1 depletion. (A) HeLa cells co-transfected with the Myc-sSgo1 expression construct and Sgo1 3′UTR siRNA for 48 h were collected and an equal amount of cell lysate was blotted
Figure Legend Snippet: Ectopic expression of sSgo1 suppresses centriole splitting induced by Sgo1 depletion. (A) HeLa cells co-transfected with the Myc-sSgo1 expression construct and Sgo1 3′UTR siRNA for 48 h were collected and an equal amount of cell lysate was blotted

Techniques Used: Expressing, Transfection, Construct

Plk1 is physically associated with sSgo1. (A) HeLa cells co-transfected with Myc-sSgo1 plasmid and Plk1 or Luc siRNA for 24 h were stained with antibodies to the Myc tag (green) and γ-tubulin (red). (B) HeLa cells were cotransfected with Myc-sSgo1
Figure Legend Snippet: Plk1 is physically associated with sSgo1. (A) HeLa cells co-transfected with Myc-sSgo1 plasmid and Plk1 or Luc siRNA for 24 h were stained with antibodies to the Myc tag (green) and γ-tubulin (red). (B) HeLa cells were cotransfected with Myc-sSgo1

Techniques Used: Transfection, Plasmid Preparation, Staining

siRNA depletion of Sgo1 causes formation of extra γ-tubulin foci. (A) HeLa cells were transfected with Sgo1 or luciferase (Luc) siRNA for 24 h. Rounded-up (R) and adherent (A) cells in Sgo1 siRNA transfected dishes were collected separately. An
Figure Legend Snippet: siRNA depletion of Sgo1 causes formation of extra γ-tubulin foci. (A) HeLa cells were transfected with Sgo1 or luciferase (Luc) siRNA for 24 h. Rounded-up (R) and adherent (A) cells in Sgo1 siRNA transfected dishes were collected separately. An

Techniques Used: Transfection, Luciferase

18) Product Images from "Repression of E-cadherin by the Polycomb Group Protein EZH2 in Cancer"

Article Title: Repression of E-cadherin by the Polycomb Group Protein EZH2 in Cancer

Journal: Oncogene

doi: 10.1038/onc.2008.333

E-cadherin over-expression attenuates EZH2-mediated cell invasion ( a ) H16N2 cells were transfected with E-cadherin or vector alone. Transfected cells were infected with EZH2, EZH2ΔSET, and control adenovirus. Cell invasion was assessed by Boyden chamber assay, and p values were calculated between EZH2 and EZH2+E-cadherin samples. ( b ) E-cadherin knockdown in H16N2 cells was carried out using siRNA duplex. siRNA targeting luciferase served as a control. The p values were calculated between Luciferease RNAi and EZH2 RNAi samples. The inset demonstrates knockdown of E-cadherin protein by RNA interference.
Figure Legend Snippet: E-cadherin over-expression attenuates EZH2-mediated cell invasion ( a ) H16N2 cells were transfected with E-cadherin or vector alone. Transfected cells were infected with EZH2, EZH2ΔSET, and control adenovirus. Cell invasion was assessed by Boyden chamber assay, and p values were calculated between EZH2 and EZH2+E-cadherin samples. ( b ) E-cadherin knockdown in H16N2 cells was carried out using siRNA duplex. siRNA targeting luciferase served as a control. The p values were calculated between Luciferease RNAi and EZH2 RNAi samples. The inset demonstrates knockdown of E-cadherin protein by RNA interference.

Techniques Used: Over Expression, Transfection, Plasmid Preparation, Infection, Boyden Chamber Assay, Luciferase

19) Product Images from "Modulation of p53 function by SET8-mediated methylation at lysine 382"

Article Title: Modulation of p53 function by SET8-mediated methylation at lysine 382

Journal: Molecular cell

doi: 10.1016/j.molcel.2007.07.012

p53 is monomethylated at K382 in vivo by SET8 (A) Ectopic SET8 specifically methylates p53 at K382 in vivo ) (D) p53K382me1 levels decrease upon DNA damage. Western analyses with the indicated antibodies of αp53K382me1 and p53 (DO1) IPs from U2OS cells transfected with control or SET8 siRNA and treated with NCS for 2 hrs. Tubulin and total p53 levels present in WCE are shown to control for loading. (E) SET8 mRNA expression decreases in response to DNA damage. Real-time PCR analysis of SET8 and Smyd2 mRNA levels present in U2OS cells ± NCS treatment (0.5 μg/ml, 4 hrs). (F) SET8 protein levels decrease in response to DNA damage. Western analysis of SET8 in U2OS cells as in (E).
Figure Legend Snippet: p53 is monomethylated at K382 in vivo by SET8 (A) Ectopic SET8 specifically methylates p53 at K382 in vivo ) (D) p53K382me1 levels decrease upon DNA damage. Western analyses with the indicated antibodies of αp53K382me1 and p53 (DO1) IPs from U2OS cells transfected with control or SET8 siRNA and treated with NCS for 2 hrs. Tubulin and total p53 levels present in WCE are shown to control for loading. (E) SET8 mRNA expression decreases in response to DNA damage. Real-time PCR analysis of SET8 and Smyd2 mRNA levels present in U2OS cells ± NCS treatment (0.5 μg/ml, 4 hrs). (F) SET8 protein levels decrease in response to DNA damage. Western analysis of SET8 in U2OS cells as in (E).

Techniques Used: In Vivo, Western Blot, Transfection, Expressing, Real-time Polymerase Chain Reaction

Monomethylation of p53 at K382 attenuates p53 biological function (A) SET8 knock-down renders cells more sensitive to cell death and cell-cycle arrest following DNA damage. Sub-G1 and cell-cycle distribution of U2OS cells ± SET8 siRNA and ± 24 hrs treatment with 1 μg/ml doxorubicin was determined by flow cytometry. (B) The increased sensitivity of SET8 knock-down cells to DNA damage is p53 dependent. Cell cycle distribution of SET8 knock-down cells as in (A) ± p53 knockdown. (C) Increased sensitivity of SET8 knock-down cells to DNA damage-induced cell death is p53-dependent. Cell death was determined in U2OS cells ± SET8 siRNA and ± p53 siRNA, in response to 2 μg/ml doxorubicin for 20 hrs. Error bars indicate ± s.e.m. from at least three experiments.
Figure Legend Snippet: Monomethylation of p53 at K382 attenuates p53 biological function (A) SET8 knock-down renders cells more sensitive to cell death and cell-cycle arrest following DNA damage. Sub-G1 and cell-cycle distribution of U2OS cells ± SET8 siRNA and ± 24 hrs treatment with 1 μg/ml doxorubicin was determined by flow cytometry. (B) The increased sensitivity of SET8 knock-down cells to DNA damage is p53 dependent. Cell cycle distribution of SET8 knock-down cells as in (A) ± p53 knockdown. (C) Increased sensitivity of SET8 knock-down cells to DNA damage-induced cell death is p53-dependent. Cell death was determined in U2OS cells ± SET8 siRNA and ± p53 siRNA, in response to 2 μg/ml doxorubicin for 20 hrs. Error bars indicate ± s.e.m. from at least three experiments.

Techniques Used: Flow Cytometry, Cytometry

20) Product Images from "Involvement of post-transcriptional regulation of FOXO1 by HuR in 5-FU-induced apoptosis in breast cancer cells"

Article Title: Involvement of post-transcriptional regulation of FOXO1 by HuR in 5-FU-induced apoptosis in breast cancer cells

Journal: Oncology Letters

doi: 10.3892/ol.2013.1352

HuR positively regulates FOXO1 expression. MDA-MB-231 cells were seeded into 6-well plates and transfected with pcDNA-flag or pcDNA-flag-HuR plasmids and siRNA-Con or siRNA-HuR plasmids. (A and B) mRNA and (C) protein levels were determined by RT-PCR and western blot analysis, respectively. Tubulin was used as an internal control, and values are expressed as means ± SEM of at least three independent experiments. * P
Figure Legend Snippet: HuR positively regulates FOXO1 expression. MDA-MB-231 cells were seeded into 6-well plates and transfected with pcDNA-flag or pcDNA-flag-HuR plasmids and siRNA-Con or siRNA-HuR plasmids. (A and B) mRNA and (C) protein levels were determined by RT-PCR and western blot analysis, respectively. Tubulin was used as an internal control, and values are expressed as means ± SEM of at least three independent experiments. * P

Techniques Used: Expressing, Multiple Displacement Amplification, Transfection, Reverse Transcription Polymerase Chain Reaction, Western Blot

5-FU induces FOXO1 expression in a HuR-dependent manner. MDA-MB-231 cells were seeded into 6-well plates and treated with 5 μ g/ml 5-FU. At the indicated time, cells were collected and (A) RT-PCR and (B) western blot analysis were conducted to detect HuR and FOXO1 expression. (C) MDA-MB-231 cells were seeded into 6-well plates and transfected with siRNA-Con, siRNA-HuR and FOXO1 overexpression and control lentivirus, respectively. After 24 h, cells were treated with 5-FU. Following 24 h of incubation, the apoptotic cells were measured by PI and Annexin V-FITC staining and analyzed by flow cytometry. Values are expressed as mean ± SEM of at least three independent experiments. * P
Figure Legend Snippet: 5-FU induces FOXO1 expression in a HuR-dependent manner. MDA-MB-231 cells were seeded into 6-well plates and treated with 5 μ g/ml 5-FU. At the indicated time, cells were collected and (A) RT-PCR and (B) western blot analysis were conducted to detect HuR and FOXO1 expression. (C) MDA-MB-231 cells were seeded into 6-well plates and transfected with siRNA-Con, siRNA-HuR and FOXO1 overexpression and control lentivirus, respectively. After 24 h, cells were treated with 5-FU. Following 24 h of incubation, the apoptotic cells were measured by PI and Annexin V-FITC staining and analyzed by flow cytometry. Values are expressed as mean ± SEM of at least three independent experiments. * P

Techniques Used: Expressing, Multiple Displacement Amplification, Reverse Transcription Polymerase Chain Reaction, Western Blot, Transfection, Over Expression, Incubation, Staining, Flow Cytometry, Cytometry

21) Product Images from "Repression of E-cadherin by the Polycomb Group Protein EZH2 in Cancer"

Article Title: Repression of E-cadherin by the Polycomb Group Protein EZH2 in Cancer

Journal: Oncogene

doi: 10.1038/onc.2008.333

E-cadherin over-expression attenuates EZH2-mediated cell invasion ( a ) H16N2 cells were transfected with E-cadherin or vector alone. Transfected cells were infected with EZH2, EZH2ΔSET, and control adenovirus. Cell invasion was assessed by Boyden chamber assay, and p values were calculated between EZH2 and EZH2+E-cadherin samples. ( b ) E-cadherin knockdown in H16N2 cells was carried out using siRNA duplex. siRNA targeting luciferase served as a control. The p values were calculated between Luciferease RNAi and EZH2 RNAi samples. The inset demonstrates knockdown of E-cadherin protein by RNA interference.
Figure Legend Snippet: E-cadherin over-expression attenuates EZH2-mediated cell invasion ( a ) H16N2 cells were transfected with E-cadherin or vector alone. Transfected cells were infected with EZH2, EZH2ΔSET, and control adenovirus. Cell invasion was assessed by Boyden chamber assay, and p values were calculated between EZH2 and EZH2+E-cadherin samples. ( b ) E-cadherin knockdown in H16N2 cells was carried out using siRNA duplex. siRNA targeting luciferase served as a control. The p values were calculated between Luciferease RNAi and EZH2 RNAi samples. The inset demonstrates knockdown of E-cadherin protein by RNA interference.

Techniques Used: Over Expression, Transfection, Plasmid Preparation, Infection, Boyden Chamber Assay, Luciferase

Overexpression of EZH2 enhances invasion ( a ) Ectopic expression of EZH2 induces invasion of primary prostate epithelial cells and benign immortalized breast cell lines. A reconstituted basement membrane invasion chamber assay (Boyden chamber assay) was used to assess the invasive potential of primary prostate and benign breast epithelial cell lines infected with EZH2, EZH2ΔSET or control adenovirus. EZH2 infected cells were also treated with the histone deacetylase inhibitor SAHA (500nM). Representative fields of invaded and stained cells are shown (left). Invasion was quantitated using colorimetry (absorbance at 560 nm, right). All p values were calculated between EZH2 and vector treated samples. ( b ) The SET domain mutant of EZH2 inhibits cancer cell invasion. DU145 cells, which express high levels of endogenous EZH2, were infected with EZH2, EZH2ΔSET, and control adenoviruses. Invasion was quantitated using colorimetry. The p value was calculated between EZH2ΔSET and vectors. ( c ) Cell invasion is attenuated by EZH2 knockdown. Boyden chamber invasion assay using DU145 cells treated with siRNA duplexes targeting EZH2. Inset demonstrates knockdown of EZH2 protein by RNA interference. All p values were calculated between control and EZH2 knockdown clones. ( d ) Stable knockdown of EZH2 decreases invasiveness of DU145 cells. DU145 cells were stably transfected with EZH2 shRNA and assessed by invasion assay. Three stable clones exhibiting knockdown of EZH2 are shown. Inset demonstrates knockdown of EZH2 protein by RNA interference.
Figure Legend Snippet: Overexpression of EZH2 enhances invasion ( a ) Ectopic expression of EZH2 induces invasion of primary prostate epithelial cells and benign immortalized breast cell lines. A reconstituted basement membrane invasion chamber assay (Boyden chamber assay) was used to assess the invasive potential of primary prostate and benign breast epithelial cell lines infected with EZH2, EZH2ΔSET or control adenovirus. EZH2 infected cells were also treated with the histone deacetylase inhibitor SAHA (500nM). Representative fields of invaded and stained cells are shown (left). Invasion was quantitated using colorimetry (absorbance at 560 nm, right). All p values were calculated between EZH2 and vector treated samples. ( b ) The SET domain mutant of EZH2 inhibits cancer cell invasion. DU145 cells, which express high levels of endogenous EZH2, were infected with EZH2, EZH2ΔSET, and control adenoviruses. Invasion was quantitated using colorimetry. The p value was calculated between EZH2ΔSET and vectors. ( c ) Cell invasion is attenuated by EZH2 knockdown. Boyden chamber invasion assay using DU145 cells treated with siRNA duplexes targeting EZH2. Inset demonstrates knockdown of EZH2 protein by RNA interference. All p values were calculated between control and EZH2 knockdown clones. ( d ) Stable knockdown of EZH2 decreases invasiveness of DU145 cells. DU145 cells were stably transfected with EZH2 shRNA and assessed by invasion assay. Three stable clones exhibiting knockdown of EZH2 are shown. Inset demonstrates knockdown of EZH2 protein by RNA interference.

Techniques Used: Over Expression, Expressing, Invasion Chamber Assay, Boyden Chamber Assay, Infection, Histone Deacetylase Assay, Staining, Colorimetric Assay, Plasmid Preparation, Mutagenesis, Invasion Assay, Clone Assay, Stable Transfection, Transfection, shRNA

22) Product Images from "The COG and COPI Complexes Interact to Control the Abundance of GEARs, a Subset of Golgi Integral Membrane Proteins D⃞"

Article Title: The COG and COPI Complexes Interact to Control the Abundance of GEARs, a Subset of Golgi Integral Membrane Proteins D⃞

Journal: Molecular Biology of the Cell

doi: 10.1091/mbc.E03-09-0699

Effects of siRNA depletion of ε-COP in ldlB and ldlC cells on the immunofluorescence of GOS-28, GM130, and ε-COP. ldlB and ldlC mutants were transfected without (control) or with (+siRNA) ε-COP–specific siRNA. Cells were incubated at 34°C for 48 h and then fixed and stained with antibodies to either GOS-28 (red) or GM130 (red) and ε-COP (green). To facilitate visualization of the distribution of GOS-28 by using confocal microscopy, the images from ldlB and ldlC cells (weaker signals) were collected with relatively high signal gains. Arrowheads indicate cells in which there was a loss or reduction the signal intensity for ε-COP. Bar, 10 μm.
Figure Legend Snippet: Effects of siRNA depletion of ε-COP in ldlB and ldlC cells on the immunofluorescence of GOS-28, GM130, and ε-COP. ldlB and ldlC mutants were transfected without (control) or with (+siRNA) ε-COP–specific siRNA. Cells were incubated at 34°C for 48 h and then fixed and stained with antibodies to either GOS-28 (red) or GM130 (red) and ε-COP (green). To facilitate visualization of the distribution of GOS-28 by using confocal microscopy, the images from ldlB and ldlC cells (weaker signals) were collected with relatively high signal gains. Arrowheads indicate cells in which there was a loss or reduction the signal intensity for ε-COP. Bar, 10 μm.

Techniques Used: Immunofluorescence, Transfection, Incubation, Staining, Confocal Microscopy

Effects of siRNA depletion of ε-COP in wild-type CHO cells on the immunofluorescence of Cog1, GOS-28, GM130, and β-COP. Wild-type CHO cells were transiently transfected without (control) or with (+siRNA) a 21-base pair siRNA duplex specific for hamster ε-COP. After a 46.5-h incubation at 34°C, the cells were further incubated for 90 min at either 34°C (where the loss of ε-COP had no apparent phenotype) or 39.5°C and then fixed and stained with antibodies to either ε-COP or β-COP (green) together with antibodies (red) to either Cog1, GM130, or GOS-28. Arrowheads indicate the cells in which there was a loss or major reduction in the signal intensity for either ε-COP (A and B) or GOS-28 (C), which indicated effective knockdown of ε-COP expression. Bars, 10 μm.
Figure Legend Snippet: Effects of siRNA depletion of ε-COP in wild-type CHO cells on the immunofluorescence of Cog1, GOS-28, GM130, and β-COP. Wild-type CHO cells were transiently transfected without (control) or with (+siRNA) a 21-base pair siRNA duplex specific for hamster ε-COP. After a 46.5-h incubation at 34°C, the cells were further incubated for 90 min at either 34°C (where the loss of ε-COP had no apparent phenotype) or 39.5°C and then fixed and stained with antibodies to either ε-COP or β-COP (green) together with antibodies (red) to either Cog1, GM130, or GOS-28. Arrowheads indicate the cells in which there was a loss or major reduction in the signal intensity for either ε-COP (A and B) or GOS-28 (C), which indicated effective knockdown of ε-COP expression. Bars, 10 μm.

Techniques Used: Immunofluorescence, Transfection, Incubation, Staining, Expressing

23) Product Images from "UNR translation can be driven by an IRES element that is negatively regulated by polypyrimidine tract binding protein"

Article Title: UNR translation can be driven by an IRES element that is negatively regulated by polypyrimidine tract binding protein

Journal: Nucleic Acids Research

doi: 10.1093/nar/gki611

RNAi-mediated depletion of PTB in HEK293T cells stimulates UNR IRES activity. Di-pRF-UNR was transfected in HEK293T cells treated with PTB siRNA as described in Materials and Methods. Cells were analyzed 24 and 48 h after the last siRNA transfection for UNR IRES activity by measuring Rluc and Fluc activities, which are expressed as a ratio of Fluc to Rluc ( n = 2) ± SD. Bars are representative of two independent experiments. Western blot analysis of HEK293T cells treated with PTB siRNA or with a nonspecific RNAi duplex (NT siRNA) revealed that PTB expression was strongly reduced upon PTB siRNA transfection. Actin was used as an internal control.
Figure Legend Snippet: RNAi-mediated depletion of PTB in HEK293T cells stimulates UNR IRES activity. Di-pRF-UNR was transfected in HEK293T cells treated with PTB siRNA as described in Materials and Methods. Cells were analyzed 24 and 48 h after the last siRNA transfection for UNR IRES activity by measuring Rluc and Fluc activities, which are expressed as a ratio of Fluc to Rluc ( n = 2) ± SD. Bars are representative of two independent experiments. Western blot analysis of HEK293T cells treated with PTB siRNA or with a nonspecific RNAi duplex (NT siRNA) revealed that PTB expression was strongly reduced upon PTB siRNA transfection. Actin was used as an internal control.

Techniques Used: Activity Assay, Transfection, Western Blot, Expressing

24) Product Images from "Cytoplasmic Accumulation of the RNA-binding Protein HuR Stabilizes the Ornithine Decarboxylase Transcript in a Murine Nonmelanoma Skin Cancer Model *"

Article Title: Cytoplasmic Accumulation of the RNA-binding Protein HuR Stabilizes the Ornithine Decarboxylase Transcript in a Murine Nonmelanoma Skin Cancer Model *

Journal: The Journal of Biological Chemistry

doi: 10.1074/jbc.M110.148767

HuR knockdown in C5N cells does not affect ODC mRNA stability. A , Western blot analysis to detect HuR knockdown. C5N cells were grown and transfected with siRNA duplexes specific for the HuR coding region or a negative control siRNA (denoted as siHuR
Figure Legend Snippet: HuR knockdown in C5N cells does not affect ODC mRNA stability. A , Western blot analysis to detect HuR knockdown. C5N cells were grown and transfected with siRNA duplexes specific for the HuR coding region or a negative control siRNA (denoted as siHuR

Techniques Used: Western Blot, Transfection, Negative Control

25) Product Images from "Actin-associated protein palladin promotes tumor cell invasion by linking extracellular matrix degradation to cell cytoskeleton"

Article Title: Actin-associated protein palladin promotes tumor cell invasion by linking extracellular matrix degradation to cell cytoskeleton

Journal: Molecular Biology of the Cell

doi: 10.1091/mbc.E13-11-0667

Palladin promotes MT1-MMP and Src family kinase–dependent tumor cell invasion. (A) Stable pools of GFP-tagged palladin or GFP-expressing WM852 melanoma cells were stained with phalloidin and DAPI (blue; n = 3). (B) The cells were also subjected to immunoblotting as indicated ( n = 3). (C, D) The cells were embedded as single-cell suspension (C) or preformed spheroids of 500 cells (D) within cross-linked 3D collagen and cultured for 7 d with PDGF-AB. Confocal micrographs show F-actin (phalloidin; red) in representative colonies (six collagen preparations/cell; see also Supplemental Figure S2A). (E) The cells were embedded within 3D collagen as spheroids containing 3000 cells, and sprouting was quantified after 7 d (sprouts/spheroid; mean ± SEM; four collagen preparations/cell). (F) HA-tagged palladin was transfected in WM852 cells stably expressing GFP-tagged MT1-MMP, followed by immunoprecipitation using anti–HA-agarose beads and immunoblotting as indicated. (G) The cells expressing GFP or GFP-palladin were plated atop 3D cross-linked collagen. Invasion was quantified as number of cells that invaded > 10 μm/cross section. Invasion of control cells (Mock) was set to 1 (mean ± SEM; three collagen preparations/cell). (H) Light micrographs of collagen cross sections visualize the H E-stained invasive cells. (I) The cells were treated with control (top) or MT1-MMP siRNA (bottom) before embedding preformed spheroids containing 500 cells within collagen. Silencing MT1-MMP reduced invasion (three collagen preparations/cell). (J) Western blot shows efficient knockdown of MT1-MMP 72 h after siRNA transfection. (K) PDGF-AB induces tyrosine phosphorylation of palladin. The cells were incubated with PP2 (5 μM), PDGF (20 ng/μl), or both for 16 h, followed by immunoprecipitation and immunoblotting as indicated. Ponceau or GAPDH served as loading control ( n = 3). (L) The invasion of GFP-palladin–expressing cells embedded within collagen was reduced by the Src family kinase inhibitor PP2 (10 μM; three collagen preparations/cell). Representative confocal micrographs show MT1-MMP in red.
Figure Legend Snippet: Palladin promotes MT1-MMP and Src family kinase–dependent tumor cell invasion. (A) Stable pools of GFP-tagged palladin or GFP-expressing WM852 melanoma cells were stained with phalloidin and DAPI (blue; n = 3). (B) The cells were also subjected to immunoblotting as indicated ( n = 3). (C, D) The cells were embedded as single-cell suspension (C) or preformed spheroids of 500 cells (D) within cross-linked 3D collagen and cultured for 7 d with PDGF-AB. Confocal micrographs show F-actin (phalloidin; red) in representative colonies (six collagen preparations/cell; see also Supplemental Figure S2A). (E) The cells were embedded within 3D collagen as spheroids containing 3000 cells, and sprouting was quantified after 7 d (sprouts/spheroid; mean ± SEM; four collagen preparations/cell). (F) HA-tagged palladin was transfected in WM852 cells stably expressing GFP-tagged MT1-MMP, followed by immunoprecipitation using anti–HA-agarose beads and immunoblotting as indicated. (G) The cells expressing GFP or GFP-palladin were plated atop 3D cross-linked collagen. Invasion was quantified as number of cells that invaded > 10 μm/cross section. Invasion of control cells (Mock) was set to 1 (mean ± SEM; three collagen preparations/cell). (H) Light micrographs of collagen cross sections visualize the H E-stained invasive cells. (I) The cells were treated with control (top) or MT1-MMP siRNA (bottom) before embedding preformed spheroids containing 500 cells within collagen. Silencing MT1-MMP reduced invasion (three collagen preparations/cell). (J) Western blot shows efficient knockdown of MT1-MMP 72 h after siRNA transfection. (K) PDGF-AB induces tyrosine phosphorylation of palladin. The cells were incubated with PP2 (5 μM), PDGF (20 ng/μl), or both for 16 h, followed by immunoprecipitation and immunoblotting as indicated. Ponceau or GAPDH served as loading control ( n = 3). (L) The invasion of GFP-palladin–expressing cells embedded within collagen was reduced by the Src family kinase inhibitor PP2 (10 μM; three collagen preparations/cell). Representative confocal micrographs show MT1-MMP in red.

Techniques Used: Expressing, Staining, Cell Culture, Transfection, Stable Transfection, Immunoprecipitation, Western Blot, Incubation

Palladin binds MT-MMPs in vitro. (A) Schematic representation of myotilin, MT1-MMP bait region, myotilin yeast two-hybrid (Y2H) cDNA hit, three main palladin isoforms and the used palladin and MT1-MMP fragments. Cat, catalytic; Cyt, cytoplasmic; Ig, immunoglobulin-like; Pex, pexin-like; Pro-rich, proline-rich; TM, transmembrane. Respective protein tags are also indicated. Asterisk indicates the siRNA target sequence in the corresponding transcripts encoding 200- and 140-kDa palladin isoforms. (B–D) GST, GST-myotilin, GST-palladin, and GST-palladin fragments prebound to glutathione-Sepharose were allowed to interact in vitro with lysates from HA-tagged (B) or untagged (C, D) MT1-, MT1-ΔC–, MT2-, or MT3-MMP–expressing COS1 cells as indicated. The bound MT-MMPs were detected by immunoblotting ( n = 3). Immunoblotting or Ponceau staining visualized GST-tagged proteins (bottom). (E) Quantification of the MT1-MMP binding indicates the strongest binding of Ig3-5 fragments (full-length palladin set to 1; mean ± SD, n = 3). (F) Lysates from COS1 cells expressing HA-tagged palladin were allowed to interact with biotinylated synthetic peptides consisting of the intracellular C-terminal 20 amino acids of MT1-MMP, MT2-MMP, and MT3-MMP, as well as a peptide with scrambled sequence (Scr) of the MT1-MMP cytoplasmic amino acids. Peptide-bound palladin pulled down using streptavidin Sepharose was detected by immunoblotting. (G) The HA-tagged Ig domains 4 and 5 or full-length palladin expressed in COS-1 cells was bound to anti–HA-conjugated agarose beads and allowed to interact with lysates from COS1 cells transfected with control (Mock) or MT1-MMP vectors. Bead-bound proteins were detected by immunoblotting as indicated. GAPDH served as loading control. MT1-MMP precipitates with both Ig domains 4 and 5 and full-length palladin.
Figure Legend Snippet: Palladin binds MT-MMPs in vitro. (A) Schematic representation of myotilin, MT1-MMP bait region, myotilin yeast two-hybrid (Y2H) cDNA hit, three main palladin isoforms and the used palladin and MT1-MMP fragments. Cat, catalytic; Cyt, cytoplasmic; Ig, immunoglobulin-like; Pex, pexin-like; Pro-rich, proline-rich; TM, transmembrane. Respective protein tags are also indicated. Asterisk indicates the siRNA target sequence in the corresponding transcripts encoding 200- and 140-kDa palladin isoforms. (B–D) GST, GST-myotilin, GST-palladin, and GST-palladin fragments prebound to glutathione-Sepharose were allowed to interact in vitro with lysates from HA-tagged (B) or untagged (C, D) MT1-, MT1-ΔC–, MT2-, or MT3-MMP–expressing COS1 cells as indicated. The bound MT-MMPs were detected by immunoblotting ( n = 3). Immunoblotting or Ponceau staining visualized GST-tagged proteins (bottom). (E) Quantification of the MT1-MMP binding indicates the strongest binding of Ig3-5 fragments (full-length palladin set to 1; mean ± SD, n = 3). (F) Lysates from COS1 cells expressing HA-tagged palladin were allowed to interact with biotinylated synthetic peptides consisting of the intracellular C-terminal 20 amino acids of MT1-MMP, MT2-MMP, and MT3-MMP, as well as a peptide with scrambled sequence (Scr) of the MT1-MMP cytoplasmic amino acids. Peptide-bound palladin pulled down using streptavidin Sepharose was detected by immunoblotting. (G) The HA-tagged Ig domains 4 and 5 or full-length palladin expressed in COS-1 cells was bound to anti–HA-conjugated agarose beads and allowed to interact with lysates from COS1 cells transfected with control (Mock) or MT1-MMP vectors. Bead-bound proteins were detected by immunoblotting as indicated. GAPDH served as loading control. MT1-MMP precipitates with both Ig domains 4 and 5 and full-length palladin.

Techniques Used: In Vitro, Sequencing, Expressing, Staining, Binding Assay, Transfection

Palladin localizes to cell–ECM contact structures of invasive breast carcinoma cells. Hs578T breast carcinoma cells were seeded on monomeric collagen I. Representative confocal micrographs show palladin. (A) Palladin colocalizes with F-actin (phalloidin) and α-actinin. DAPI (blue) visualizes nuclei. (B) Palladin colocalizes with pFAK and the invadopodia marker cortactin. (C) Colocalization of MT1-MMP and palladin with or without F-actin staining in Hs578T (top) and MDA-MB-231 cells (bottom) is visualized in merged images (see also Supplemental Figure S1C). (D) Lysates of control or HA-palladin–expressing Hs578T cells were subjected to coimmunoprecipitation and immunoblotting as indicated. (E) Hs578T and MDA-MB-231 cells were seeded on fluorescein isothiocyanate–gelatin. Representative epifluorescence micrographs show palladin enriched at matrix-free spots, displaying sites of gelatin degradation. (F) Relative gelatin degradation by MDA-MB-231 cells after palladin silencing, quantified as number of gelatin-free spots/nuclei. Value of control cells (scrambled siRNA) was set to 1.
Figure Legend Snippet: Palladin localizes to cell–ECM contact structures of invasive breast carcinoma cells. Hs578T breast carcinoma cells were seeded on monomeric collagen I. Representative confocal micrographs show palladin. (A) Palladin colocalizes with F-actin (phalloidin) and α-actinin. DAPI (blue) visualizes nuclei. (B) Palladin colocalizes with pFAK and the invadopodia marker cortactin. (C) Colocalization of MT1-MMP and palladin with or without F-actin staining in Hs578T (top) and MDA-MB-231 cells (bottom) is visualized in merged images (see also Supplemental Figure S1C). (D) Lysates of control or HA-palladin–expressing Hs578T cells were subjected to coimmunoprecipitation and immunoblotting as indicated. (E) Hs578T and MDA-MB-231 cells were seeded on fluorescein isothiocyanate–gelatin. Representative epifluorescence micrographs show palladin enriched at matrix-free spots, displaying sites of gelatin degradation. (F) Relative gelatin degradation by MDA-MB-231 cells after palladin silencing, quantified as number of gelatin-free spots/nuclei. Value of control cells (scrambled siRNA) was set to 1.

Techniques Used: Marker, Staining, Multiple Displacement Amplification, Expressing

Palladin and MT1-MMP are coexpressed in breast and prostate carcinoma cell lines. (A) Immunoblotting of breast carcinoma cell lines as indicated. (B, C) The detection of 140- and 90-kDa palladin isoforms (arrows) was verified by transfection with scrambled (siCtrl), a pool of siRNAs designed to target the different palladin isoforms (siPalladin), and a specific siRNA targeting the mRNA sequence of the 140-kDa isoform (aa 625–629; UniProt ID Q8WX93), absent from the 90-kDa palladin. (D) Palladin (arrows) and MT1-MMP protein expression in PC3 and DU145 cells. Palladin was detected using an antibody recognizing all the major isoforms and MT1-MMP with an antibody against the catalytic domain recognizing both the latent and active protease. Where indicated, an antibody against the N-terminus of the 140-kDa isoform not present in the 90-kDa palladin (4Ig Ab) was used. α-Tubulin or GAPDH served as loading control ( n = 3).
Figure Legend Snippet: Palladin and MT1-MMP are coexpressed in breast and prostate carcinoma cell lines. (A) Immunoblotting of breast carcinoma cell lines as indicated. (B, C) The detection of 140- and 90-kDa palladin isoforms (arrows) was verified by transfection with scrambled (siCtrl), a pool of siRNAs designed to target the different palladin isoforms (siPalladin), and a specific siRNA targeting the mRNA sequence of the 140-kDa isoform (aa 625–629; UniProt ID Q8WX93), absent from the 90-kDa palladin. (D) Palladin (arrows) and MT1-MMP protein expression in PC3 and DU145 cells. Palladin was detected using an antibody recognizing all the major isoforms and MT1-MMP with an antibody against the catalytic domain recognizing both the latent and active protease. Where indicated, an antibody against the N-terminus of the 140-kDa isoform not present in the 90-kDa palladin (4Ig Ab) was used. α-Tubulin or GAPDH served as loading control ( n = 3).

Techniques Used: Transfection, Sequencing, Expressing

26) Product Images from "La Autoantigen Is Necessary for Optimal Function of the Poliovirus and Hepatitis C Virus Internal Ribosome Entry Site In Vivo and In Vitro †"

Article Title: La Autoantigen Is Necessary for Optimal Function of the Poliovirus and Hepatitis C Virus Internal Ribosome Entry Site In Vivo and In Vitro †

Journal: Molecular and Cellular Biology

doi: 10.1128/MCB.24.15.6861-6870.2004

IRES-driven translation of poliovirus RNA is inhibited by La85-siRNA. A schematic diagram of the bicistronic construct pcDNA3-RLuc-PolioIRES-FLuc is shown at the top of the figure (CMV, cytomegalovirus). The bicistronic construct pcDNA3-RLuc-PolioIRES-FLuc was cotransfected into HeLa cells with either La85-siRNA or control siRNA (Ctlr-siRNA). Twenty hours after transfection, cells were analyzed for FLuc and RLuc activities. The ratios of RLuc/FLuc activity are presented by the bars in the histogram. Absolute levels of RLuc and FLuc activities (in relative light units) are presented below the histogram.
Figure Legend Snippet: IRES-driven translation of poliovirus RNA is inhibited by La85-siRNA. A schematic diagram of the bicistronic construct pcDNA3-RLuc-PolioIRES-FLuc is shown at the top of the figure (CMV, cytomegalovirus). The bicistronic construct pcDNA3-RLuc-PolioIRES-FLuc was cotransfected into HeLa cells with either La85-siRNA or control siRNA (Ctlr-siRNA). Twenty hours after transfection, cells were analyzed for FLuc and RLuc activities. The ratios of RLuc/FLuc activity are presented by the bars in the histogram. Absolute levels of RLuc and FLuc activities (in relative light units) are presented below the histogram.

Techniques Used: Construct, Transfection, Activity Assay

La knockdown diminishes translation and replication of poliovirus. Transfection of siRNA in HeLa cells (CLL2) was performed in 24-well plates. Twenty-four hours after transfection, cells were infected with poliovirus (A) or adenovirus (B) or mock infected, and protein synthesis was examined by pulse-labeling at various times as described in Materials and Methods. Cells were transfected with a nonspecific siRNA (control siRNA [Ctlr-siRNA]), La85-siRNA, or siRNA against nucleolin (Nuc-siRNA). (C) Western blot analysis of La protein. (D) Poliovirus yield is affected by La knockdown. A plaque assay was performed on a confluent monolayer of HeLa cells using serial dilutions of samples obtained from the lysates shown in panel A (5 h postinfection.).
Figure Legend Snippet: La knockdown diminishes translation and replication of poliovirus. Transfection of siRNA in HeLa cells (CLL2) was performed in 24-well plates. Twenty-four hours after transfection, cells were infected with poliovirus (A) or adenovirus (B) or mock infected, and protein synthesis was examined by pulse-labeling at various times as described in Materials and Methods. Cells were transfected with a nonspecific siRNA (control siRNA [Ctlr-siRNA]), La85-siRNA, or siRNA against nucleolin (Nuc-siRNA). (C) Western blot analysis of La protein. (D) Poliovirus yield is affected by La knockdown. A plaque assay was performed on a confluent monolayer of HeLa cells using serial dilutions of samples obtained from the lysates shown in panel A (5 h postinfection.).

Techniques Used: Transfection, Infection, Labeling, Western Blot, Plaque Assay

27) Product Images from "Regulation of Microtubule-dependent Recycling at the Trans-Golgi Network by Rab6A and Rab6A' D⃞"

Article Title: Regulation of Microtubule-dependent Recycling at the Trans-Golgi Network by Rab6A and Rab6A' D⃞

Journal: Molecular Biology of the Cell

doi: 10.1091/mbc.E04-03-0260

Reduction of both rab6A and A' by RNA interference (RNAi) effects Golgi structure and transport. (A) Western blot demonstration of reduced total rab6 protein levels by two different siRNA sequences (labeled A/A'-siRNA1 and 2) or reduced rab6A or A' protein upon addition of the respective isoform-specific duplex (labeled A-siRNA and A'-siRNA). Whole cell extracts were prepared 92 h after repeated transfection with the appropriate siRNA and analyzed by Western blotting with anti-rab6 mAb. Levels of rab6 in cells treated with control-siRNA (Ctrl-siRNA), and levels of α-tubulin were not affected. (B) Suppression of individual rab6 isoforms by isoform-specific siRNA sequences. Cells treated with siRNA for 22 h were transiently transfected with plasmids encoding GFP-rab6A or GFP-rab6A' and prepared for immunoblot 28 h postplasmid transfection. The anti-GFP immunoblot shows the efficiency and specificity of each siRNA under these conditions. Thus, each GFP-rab6 isoform is not expressed when targeted by its siRNA and is expressed when incubated with siRNA against the other isoform. siRNA targeting both rab6A and A' inhibited expression from GFP-rab6A and GFP- rab6A' plasmids as expected. GFP-rab6 expression in cells treated with an unrelated control siRNA and α-tubulin were not affected. (C-J) Immunofluorescence images of cells expressing the Golgi marker GalNAc-T2 GFP after double treatment with the corresponding siRNAs for 92 h and immunostaining with rabbit anti-rab6 antibody. These illustrations were imaged with the same camera exposure settings, allowing a direct comparison of rab6 levels after RNAi treatment (C-F). The minor effect of reduced levels of rab6A (D and H) or A' (E and I) on Golgi structure. Reduction of rab6A and A' combined (F and J) affects overall Golgi morphology compared with control-treated cells (C and G). Arrowheads indicate the cells in which there was a major reduction in Golgi size. (K-N) Relocalization of GalNAc-T2 GFP to the ER after the introduction of Sar1p (GTP) is delayed in rab6 knockdown cells. Stably transfected GalNAc-T2 GFP cells treated with Ctrl-siRNA (K and L) or A/A'-siRNA1 (M and N) for 92 h were injected with DNA encoding dominant negative Sar1p (asterisks) and incubated for 4 h. Cells were then processed for double labeling with antibodies directed against rab6 (our unpublished data) and Sar1p (L and N) and observed by microscopy. Cells were analyzed for the amount of GalNAc-T2 GFP redistribution (K and M). Bar, 10 μm.
Figure Legend Snippet: Reduction of both rab6A and A' by RNA interference (RNAi) effects Golgi structure and transport. (A) Western blot demonstration of reduced total rab6 protein levels by two different siRNA sequences (labeled A/A'-siRNA1 and 2) or reduced rab6A or A' protein upon addition of the respective isoform-specific duplex (labeled A-siRNA and A'-siRNA). Whole cell extracts were prepared 92 h after repeated transfection with the appropriate siRNA and analyzed by Western blotting with anti-rab6 mAb. Levels of rab6 in cells treated with control-siRNA (Ctrl-siRNA), and levels of α-tubulin were not affected. (B) Suppression of individual rab6 isoforms by isoform-specific siRNA sequences. Cells treated with siRNA for 22 h were transiently transfected with plasmids encoding GFP-rab6A or GFP-rab6A' and prepared for immunoblot 28 h postplasmid transfection. The anti-GFP immunoblot shows the efficiency and specificity of each siRNA under these conditions. Thus, each GFP-rab6 isoform is not expressed when targeted by its siRNA and is expressed when incubated with siRNA against the other isoform. siRNA targeting both rab6A and A' inhibited expression from GFP-rab6A and GFP- rab6A' plasmids as expected. GFP-rab6 expression in cells treated with an unrelated control siRNA and α-tubulin were not affected. (C-J) Immunofluorescence images of cells expressing the Golgi marker GalNAc-T2 GFP after double treatment with the corresponding siRNAs for 92 h and immunostaining with rabbit anti-rab6 antibody. These illustrations were imaged with the same camera exposure settings, allowing a direct comparison of rab6 levels after RNAi treatment (C-F). The minor effect of reduced levels of rab6A (D and H) or A' (E and I) on Golgi structure. Reduction of rab6A and A' combined (F and J) affects overall Golgi morphology compared with control-treated cells (C and G). Arrowheads indicate the cells in which there was a major reduction in Golgi size. (K-N) Relocalization of GalNAc-T2 GFP to the ER after the introduction of Sar1p (GTP) is delayed in rab6 knockdown cells. Stably transfected GalNAc-T2 GFP cells treated with Ctrl-siRNA (K and L) or A/A'-siRNA1 (M and N) for 92 h were injected with DNA encoding dominant negative Sar1p (asterisks) and incubated for 4 h. Cells were then processed for double labeling with antibodies directed against rab6 (our unpublished data) and Sar1p (L and N) and observed by microscopy. Cells were analyzed for the amount of GalNAc-T2 GFP redistribution (K and M). Bar, 10 μm.

Techniques Used: Western Blot, Labeling, Transfection, Incubation, Expressing, Immunofluorescence, Marker, Immunostaining, Stable Transfection, Injection, Dominant Negative Mutation, Microscopy

KIF3 is not required for rab6-induced Golgi-to-ER transport. (A) HeLa cells were treated with KAP3 siRNA or control duplexes for 48 h and then lysed in sample buffer. Western Blot analysis was performed with antibodies to KAP3 and α-tubulin for normalization of protein levels. KAP3 RNAi interference specifically decreases KAP3. (B) KAP3-depleted cells show a typical redistribution of GalNAcT2 GFP to the ER, 7 h after injection of DNA encoding rab6-GTP (asterisks).
Figure Legend Snippet: KIF3 is not required for rab6-induced Golgi-to-ER transport. (A) HeLa cells were treated with KAP3 siRNA or control duplexes for 48 h and then lysed in sample buffer. Western Blot analysis was performed with antibodies to KAP3 and α-tubulin for normalization of protein levels. KAP3 RNAi interference specifically decreases KAP3. (B) KAP3-depleted cells show a typical redistribution of GalNAcT2 GFP to the ER, 7 h after injection of DNA encoding rab6-GTP (asterisks).

Techniques Used: Western Blot, Injection

28) Product Images from "Resveratrol induces p53 and suppresses myocardin-mediated vascular smooth muscle cell differentiation"

Article Title: Resveratrol induces p53 and suppresses myocardin-mediated vascular smooth muscle cell differentiation

Journal: Toxicology letters

doi: 10.1016/j.toxlet.2010.08.010

RSVL induces VSMCs phenotypic modulation through p53-independent mechanisms in PAC1 cells. (A) the effect of p53 silencing on nuclear p53 protein level in the presence or absence of RSVL (50 µM for 24 hours) by Western blot (left panel) with the quantification of nuclear p53 protein level change after being normalized by the internal control β-actin (right panel). (B) The effect of knockingdown p53 by p53 siRNA on RSVL-induced VSMC dedifferentiation. (C) The expression level of the nuclear p53 protein level after pCEP4-p53 transfection was measured by Western blot (left panel) with the quantification of the nuclear p53 protein level (right panel). (D) The effect of pCEP4-p53 transfection on Myocd enhancer driven promoter activities in the presence and absence of RSVL. V and R indicate the vehicle and resveratrol respectively. Mock and p53 refer to pCEP4 and pCEP4-p53 plasmids respectively.
Figure Legend Snippet: RSVL induces VSMCs phenotypic modulation through p53-independent mechanisms in PAC1 cells. (A) the effect of p53 silencing on nuclear p53 protein level in the presence or absence of RSVL (50 µM for 24 hours) by Western blot (left panel) with the quantification of nuclear p53 protein level change after being normalized by the internal control β-actin (right panel). (B) The effect of knockingdown p53 by p53 siRNA on RSVL-induced VSMC dedifferentiation. (C) The expression level of the nuclear p53 protein level after pCEP4-p53 transfection was measured by Western blot (left panel) with the quantification of the nuclear p53 protein level (right panel). (D) The effect of pCEP4-p53 transfection on Myocd enhancer driven promoter activities in the presence and absence of RSVL. V and R indicate the vehicle and resveratrol respectively. Mock and p53 refer to pCEP4 and pCEP4-p53 plasmids respectively.

Techniques Used: Western Blot, Expressing, Transfection

29) Product Images from "A phospholipase C?1-activated pathway regulates transcription in human vascular smooth muscle cells"

Article Title: A phospholipase C?1-activated pathway regulates transcription in human vascular smooth muscle cells

Journal: Cardiovascular Research

doi: 10.1093/cvr/cvr039

PLCγ1 knockdown reduces nuclear translocation of phospho-ERK1/2. ( A ) HCoASM cells were transfected with control or PLCγ1 siRNA (100 nmol/L) for 48 h, transferred to serum-free medium for a further 24 h, and treated with vehicle or PDGF-BB
Figure Legend Snippet: PLCγ1 knockdown reduces nuclear translocation of phospho-ERK1/2. ( A ) HCoASM cells were transfected with control or PLCγ1 siRNA (100 nmol/L) for 48 h, transferred to serum-free medium for a further 24 h, and treated with vehicle or PDGF-BB

Techniques Used: Translocation Assay, Transfection

PLCγ1 knockdown inhibits PDGF-induced repression of SM α-actin gene and protein expression. ( A ) HCoASM cells were transfected with control or PLCγ1 siRNA (100 nmol/L) for 48 h, transferred to serum-free medium, and treated with
Figure Legend Snippet: PLCγ1 knockdown inhibits PDGF-induced repression of SM α-actin gene and protein expression. ( A ) HCoASM cells were transfected with control or PLCγ1 siRNA (100 nmol/L) for 48 h, transferred to serum-free medium, and treated with

Techniques Used: Expressing, Transfection

30) Product Images from "Microprocessor-dependent processing of splice site overlapping microRNA exons does not result in changes in alternative splicing"

Article Title: Microprocessor-dependent processing of splice site overlapping microRNA exons does not result in changes in alternative splicing

Journal: RNA

doi: 10.1261/rna.063438.117

Effect of Drosha siRNA effect on intronic and SO-miRNA-containing transcripts. Chromatin RNA-seq analysis. ( A ) Box plot showing fold increase of Drosha distribution in the intronic miRNAs and SO-miRNAs expressed in HeLa cells with a gene body RPKM ≥ 1. The P -value calculated with a two-sided Mann-Whitney-Wilcoxon test is indicated above . ( B ) List of the 31 SO-miRNA-hosting transcripts expressed in HeLa cells with a gene body RPKM ≥ 1. Graph showing fold increase of normalized read counts of Drosha siRNA-treated cells relative to control siRNA-treated cells were plotted in the graph. P -values were calculated using two-way ANOVA test. (****) P
Figure Legend Snippet: Effect of Drosha siRNA effect on intronic and SO-miRNA-containing transcripts. Chromatin RNA-seq analysis. ( A ) Box plot showing fold increase of Drosha distribution in the intronic miRNAs and SO-miRNAs expressed in HeLa cells with a gene body RPKM ≥ 1. The P -value calculated with a two-sided Mann-Whitney-Wilcoxon test is indicated above . ( B ) List of the 31 SO-miRNA-hosting transcripts expressed in HeLa cells with a gene body RPKM ≥ 1. Graph showing fold increase of normalized read counts of Drosha siRNA-treated cells relative to control siRNA-treated cells were plotted in the graph. P -values were calculated using two-way ANOVA test. (****) P

Techniques Used: RNA Sequencing Assay, MANN-WHITNEY

31) Product Images from "Human Argonaute3 has slicer activity"

Article Title: Human Argonaute3 has slicer activity

Journal: Nucleic Acids Research

doi: 10.1093/nar/gkx916

In vitro cleavage assays of AGO2 and AGO3. ( A ) SDS-PAGE analysis of the recombinant AGO2 and AGO3 purified from insect cells and used in the functional studies depicted in panels D and E . The gel was stained with Coomassie blue. ( B ) Native mass spectra of recombinant AGO2 and AGO3. Molecular weights with standard deviations for the main species as well as the charge states are indicated. The molecular weights correspond to those expected for the AGO proteins with bound RNA. ( C ) Guide and target RNAs used in D–F . The cap-labels are depicted as black spheres. ( D ) RNA Cleavage by AGO2 and AGO3 with different guide RNAs. Top: representative gel images of in vitro cleavage assay with the recombinant AGO2 and AGO3. The cap-labeled targets were incubated with either of 1 μM recombinant AGO2 or AGO3 for 1 h and resolved on 16% (w/v) polyacrylamide/7 M urea PAGE. Bottom: average of three experiments are shown in bar graphs with error bars calculated as standard deviation. ( E ) A representative gel image of in vitro cleavage assay with the recombinant AGO2 (1–5 μM) and AGO3 (1–25 μM). The cap-labeled 60-nt target of miR-20a was incubated with either of recombinant AGO2 or AGO3 for 1 h and resolved on 16% (w/v) polyacrylamide/7M urea PAGE. ( F ) A representative gel image of in vitro cleavage assay with the catalytic mutant of immunopurified FLAG-tagged AGO2 and AGO3 as well as their wild - type counterpart. Lysates of HEK293T cells expressing either of FLAG-tagged proteins were pre-incubated with a siRNA-like duplex of miR-20a for 2 h, followed by immunoprecipitation with anti-FLAG beads. The purified RISCs were incubated with the cap-labeled 60-nt target of miR-20a for 60 min. The reactions were resolved on a 16% (w/v) polyacrylamide/7 M urea PAGE.
Figure Legend Snippet: In vitro cleavage assays of AGO2 and AGO3. ( A ) SDS-PAGE analysis of the recombinant AGO2 and AGO3 purified from insect cells and used in the functional studies depicted in panels D and E . The gel was stained with Coomassie blue. ( B ) Native mass spectra of recombinant AGO2 and AGO3. Molecular weights with standard deviations for the main species as well as the charge states are indicated. The molecular weights correspond to those expected for the AGO proteins with bound RNA. ( C ) Guide and target RNAs used in D–F . The cap-labels are depicted as black spheres. ( D ) RNA Cleavage by AGO2 and AGO3 with different guide RNAs. Top: representative gel images of in vitro cleavage assay with the recombinant AGO2 and AGO3. The cap-labeled targets were incubated with either of 1 μM recombinant AGO2 or AGO3 for 1 h and resolved on 16% (w/v) polyacrylamide/7 M urea PAGE. Bottom: average of three experiments are shown in bar graphs with error bars calculated as standard deviation. ( E ) A representative gel image of in vitro cleavage assay with the recombinant AGO2 (1–5 μM) and AGO3 (1–25 μM). The cap-labeled 60-nt target of miR-20a was incubated with either of recombinant AGO2 or AGO3 for 1 h and resolved on 16% (w/v) polyacrylamide/7M urea PAGE. ( F ) A representative gel image of in vitro cleavage assay with the catalytic mutant of immunopurified FLAG-tagged AGO2 and AGO3 as well as their wild - type counterpart. Lysates of HEK293T cells expressing either of FLAG-tagged proteins were pre-incubated with a siRNA-like duplex of miR-20a for 2 h, followed by immunoprecipitation with anti-FLAG beads. The purified RISCs were incubated with the cap-labeled 60-nt target of miR-20a for 60 min. The reactions were resolved on a 16% (w/v) polyacrylamide/7 M urea PAGE.

Techniques Used: In Vitro, SDS Page, Recombinant, Purification, Functional Assay, Staining, Cleavage Assay, Labeling, Incubation, Polyacrylamide Gel Electrophoresis, Standard Deviation, Mutagenesis, Expressing, Immunoprecipitation

32) Product Images from "ARF6 controls post-endocytic recycling through its downstream exocyst complex effector"

Article Title: ARF6 controls post-endocytic recycling through its downstream exocyst complex effector

Journal: The Journal of Cell Biology

doi: 10.1083/jcb.200305029

Kinetics of Tf recycling in control and Sec5 siRNA-treated HeLa cells. (A) Equal protein loadings of lysates of either mock-transfected cells (two independent experiments) or cells transfected with siRNA directed against the exocyst Sec5 subunit (three independent experiments) were separated by SDS-PAGE and analyzed by immunoblotting with anti-Sec5 antibodies (left), or anti-actin antibodies as a control (right). 72 h of treatment with siRNA causes depletion in the Sec5 subunit. (B) HeLa cells were transfected with Sec5 siRNA or were mock transfected. 72 h after transfection, cells were detached and incubated in medium containing 50 nM Alexa ® 488–Tf for 30 min at 37°C. Recycling of Tf was then measured by FACS ® as described in the Materials and methods section. The mean Alexa ® 488–Tf fluorescence was calculated for each time point measured in duplicate, and expressed as a percentage of the fluorescence obtained after 30 min of internalization (zero time point). The plots represent the mean ± SEM of three independent experiments. Cells depleted in the Sec5 subunit recycle Tf with reduced kinetics.
Figure Legend Snippet: Kinetics of Tf recycling in control and Sec5 siRNA-treated HeLa cells. (A) Equal protein loadings of lysates of either mock-transfected cells (two independent experiments) or cells transfected with siRNA directed against the exocyst Sec5 subunit (three independent experiments) were separated by SDS-PAGE and analyzed by immunoblotting with anti-Sec5 antibodies (left), or anti-actin antibodies as a control (right). 72 h of treatment with siRNA causes depletion in the Sec5 subunit. (B) HeLa cells were transfected with Sec5 siRNA or were mock transfected. 72 h after transfection, cells were detached and incubated in medium containing 50 nM Alexa ® 488–Tf for 30 min at 37°C. Recycling of Tf was then measured by FACS ® as described in the Materials and methods section. The mean Alexa ® 488–Tf fluorescence was calculated for each time point measured in duplicate, and expressed as a percentage of the fluorescence obtained after 30 min of internalization (zero time point). The plots represent the mean ± SEM of three independent experiments. Cells depleted in the Sec5 subunit recycle Tf with reduced kinetics.

Techniques Used: Transfection, SDS Page, Incubation, FACS, Fluorescence

33) Product Images from "HIV-1 Tat potently stabilises Mdm2 and enhances viral replication"

Article Title: HIV-1 Tat potently stabilises Mdm2 and enhances viral replication

Journal: Biochemical Journal

doi: 10.1042/BCJ20160825

HIV-1 Tat-mediated Mdm2 increase is p53 independent. ( a ) MOLT-3 cells were infected at an MOI of 1 with VSVG-pseudotyped HIV-1. The cells were collected at 12, 24 and 48 h post-infection and subjected to western blot analysis with anti-p53 and anti-phospho-p53 (S15) antibodies. GAPDH was used as a loading control. ( b ) MOLT-3 cells were transfected with shRNA scrambled (control) or p53-specific shRNA (20 µg/100 mm Petri dish) and selected using puromycin (5 µg/ml) as described in materials and methods section. The cells were collected after selection in puromycin-rich media and subjected to western blot analysis with p53 antibody. Bax was used as a positive control for the p53 knockdown experiment. GAPDH was used as a loading control. Band intensities of p53, p-p53 and GAPDH were measured by Image J software. p53/GAPDH and p-p53/GAPDH ratios were calculated for each sample. After normalisation, values of p53 and p-p53 for uninfected/control sample were assigned a value of 1 unit and compared with those of other samples in order to obtain the relative protein expression levels, as shown in the bar diagram. ( c ) MOLT-3 p53 kd cells were infected with VSVG-pseudotyped HIV-1 at an MOI of 1. The cells were collected at 12, 24 and 48 h post-infection and subjected to western blot analysis with anti-Mdm2 and anti-phospho-Mdm2 (S166) antibodies. GAPDH was used as a loading control. Band intensities of Mdm2, p-Mdm2 and GAPDH were measured by Image J software. Mdm2/GAPDH and p-Mdm2/GAPDH ratios were calculated for each sample. After normalisation, values of Mdm2 and p-Mdm2 for uninfected/control sample were assigned a value of 1 unit and compared with other samples in order to obtain the relative protein expression levels, as shown in the bar diagram. ( d ) H1299 p53-null cells were transfected with 2 µg of Myc-Mdm2 alone or in the presence of HA-Tat, and the cell lysates were collected 36 h post-transfection. Anti-Mdm2 and anti-phospho-Mdm2 (S166) antibodies were used for western blot analysis. ( e ) Cycloheximide chase assay was performed to assess the effect of Tat on Mdm2 stability in the absence of p53 using H1299 (p53-null) cells by treating the cells with 100 µg/ml of CHX 36 h post-transfection for the indicated time periods. The results are representative of four independent experiments. P -values were calculated by a two-tailed t -test (** P
Figure Legend Snippet: HIV-1 Tat-mediated Mdm2 increase is p53 independent. ( a ) MOLT-3 cells were infected at an MOI of 1 with VSVG-pseudotyped HIV-1. The cells were collected at 12, 24 and 48 h post-infection and subjected to western blot analysis with anti-p53 and anti-phospho-p53 (S15) antibodies. GAPDH was used as a loading control. ( b ) MOLT-3 cells were transfected with shRNA scrambled (control) or p53-specific shRNA (20 µg/100 mm Petri dish) and selected using puromycin (5 µg/ml) as described in materials and methods section. The cells were collected after selection in puromycin-rich media and subjected to western blot analysis with p53 antibody. Bax was used as a positive control for the p53 knockdown experiment. GAPDH was used as a loading control. Band intensities of p53, p-p53 and GAPDH were measured by Image J software. p53/GAPDH and p-p53/GAPDH ratios were calculated for each sample. After normalisation, values of p53 and p-p53 for uninfected/control sample were assigned a value of 1 unit and compared with those of other samples in order to obtain the relative protein expression levels, as shown in the bar diagram. ( c ) MOLT-3 p53 kd cells were infected with VSVG-pseudotyped HIV-1 at an MOI of 1. The cells were collected at 12, 24 and 48 h post-infection and subjected to western blot analysis with anti-Mdm2 and anti-phospho-Mdm2 (S166) antibodies. GAPDH was used as a loading control. Band intensities of Mdm2, p-Mdm2 and GAPDH were measured by Image J software. Mdm2/GAPDH and p-Mdm2/GAPDH ratios were calculated for each sample. After normalisation, values of Mdm2 and p-Mdm2 for uninfected/control sample were assigned a value of 1 unit and compared with other samples in order to obtain the relative protein expression levels, as shown in the bar diagram. ( d ) H1299 p53-null cells were transfected with 2 µg of Myc-Mdm2 alone or in the presence of HA-Tat, and the cell lysates were collected 36 h post-transfection. Anti-Mdm2 and anti-phospho-Mdm2 (S166) antibodies were used for western blot analysis. ( e ) Cycloheximide chase assay was performed to assess the effect of Tat on Mdm2 stability in the absence of p53 using H1299 (p53-null) cells by treating the cells with 100 µg/ml of CHX 36 h post-transfection for the indicated time periods. The results are representative of four independent experiments. P -values were calculated by a two-tailed t -test (** P

Techniques Used: Infection, Western Blot, Transfection, shRNA, Selection, Positive Control, Software, Expressing, Two Tailed Test

34) Product Images from "Caveolae and propofol effects on airway smooth muscle"

Article Title: Caveolae and propofol effects on airway smooth muscle

Journal: BJA: British Journal of Anaesthesia

doi: 10.1093/bja/aes130

Effect of caveolin-1 siRNA on propofol effects. In human ASM cells, inhibition of caveolin-1 expression using siRNA blunted the normal [Ca 2+ ] i responses to histamine. Under these conditions, the effect of propofol (30 µM) on [Ca 2+ ] i responses
Figure Legend Snippet: Effect of caveolin-1 siRNA on propofol effects. In human ASM cells, inhibition of caveolin-1 expression using siRNA blunted the normal [Ca 2+ ] i responses to histamine. Under these conditions, the effect of propofol (30 µM) on [Ca 2+ ] i responses

Techniques Used: Inhibition, Expressing

35) Product Images from "RAD6-Mediated Transcription-Coupled H2B Ubiquitylation Directly Stimulates H3K4 Methylation in Human Cells"

Article Title: RAD6-Mediated Transcription-Coupled H2B Ubiquitylation Directly Stimulates H3K4 Methylation in Human Cells

Journal: Cell

doi: 10.1016/j.cell.2009.02.027

RAD6 Mediates Endogenous H2B Ubiquitylation and H3K4-H3K79 Methylation in Human Cells (A) Human RAD6 can fully complement the function of yeast Rad6 for H2B ubiquitylation and H3K4-H3K79 methylation. Yeast whole cell extracts from a wild-type strain (containing a chromosomal FLAG-H2B gene), its isogenic Δrad6 strain, and Δrad6 strains that harbor the indicated E2 expression plasmids (driven by the natural yeast Rad6 promoter) were subjected to immunoblotting with the indicated antibodies. Two different amounts of cell extracts were loaded. (B) Effects of siRNA-mediated knockdown of H2B ubiquitylation factors on histone modifications. 293T cells were treated with control, hBRE1A, hBRE1B, hRAD6A, hRAD6B and hUbcH6 siRNAs indicated. Total cell lysates were subjected to immunoblot analyses with indicated antibodies. A nonspecific band in the hUbcH6 immunoblot is indicated by an asterisk. (C) Total RNAs from siRNA-treated cells were subjected to RT-PCR analyses for mRNA levels of indicated genes.
Figure Legend Snippet: RAD6 Mediates Endogenous H2B Ubiquitylation and H3K4-H3K79 Methylation in Human Cells (A) Human RAD6 can fully complement the function of yeast Rad6 for H2B ubiquitylation and H3K4-H3K79 methylation. Yeast whole cell extracts from a wild-type strain (containing a chromosomal FLAG-H2B gene), its isogenic Δrad6 strain, and Δrad6 strains that harbor the indicated E2 expression plasmids (driven by the natural yeast Rad6 promoter) were subjected to immunoblotting with the indicated antibodies. Two different amounts of cell extracts were loaded. (B) Effects of siRNA-mediated knockdown of H2B ubiquitylation factors on histone modifications. 293T cells were treated with control, hBRE1A, hBRE1B, hRAD6A, hRAD6B and hUbcH6 siRNAs indicated. Total cell lysates were subjected to immunoblot analyses with indicated antibodies. A nonspecific band in the hUbcH6 immunoblot is indicated by an asterisk. (C) Total RNAs from siRNA-treated cells were subjected to RT-PCR analyses for mRNA levels of indicated genes.

Techniques Used: Methylation, Expressing, Reverse Transcription Polymerase Chain Reaction

36) Product Images from "Functional Inactivation of CXC Chemokine Receptor 4-mediated Responses through SOCS3 Up-regulation"

Article Title: Functional Inactivation of CXC Chemokine Receptor 4-mediated Responses through SOCS3 Up-regulation

Journal: The Journal of Experimental Medicine

doi: 10.1084/jem.20012041

GH treatment affects CXCL12-mediated responses. (A) hGHR levels were measured by flow cytometry in IM-9 cells incubated with biotin-labeled hGHR-05 mAb, followed by FITC-streptavidin. mAb binding is compared with that of a negative control (mIgM). (B) GH-activated IM-9 cell lysates were analyzed in Western blot with anti-SOCS3 antibody. Protein loading was controlled by reprobing the membrane with anti-β actin mAb. Data were quantitated using NIH software, normalized using the signal of an unrelated band, and represented as the x -fold increase compared with unstimulated cells. (C) CXCL12- or GH-induced Ca 2+ mobilization in IM-9 cells, untreated or GH-pretreated, was measured in flow cytometry. (D) Untreated or GH-treated IM-9 cells were allowed to migrate in response to 50 nM CXCL12 (left). Cells that migrated to the lower chamber were counted and expressed as a migration index. Data represent the mean of triplicate determinations, with SD indicated. IM-9 cells transfected with pEF-Flag-I/mSOCS3, a siRNA sequence targeting SOCS3, or a scrambled siRNA, were left untreated or GH-treated (60 min, 37°C) and allowed to migrate in response to 50 nM CXCL12 as before (top right). To control SOCS3 silencing, mRNA was extracted from untreated or GH-treated cells previously transfected with a siRNA sequence targeting SOCS3, or with scrambled siRNA. SOCS3 mRNA was analyzed in Northern blot (bottom right).
Figure Legend Snippet: GH treatment affects CXCL12-mediated responses. (A) hGHR levels were measured by flow cytometry in IM-9 cells incubated with biotin-labeled hGHR-05 mAb, followed by FITC-streptavidin. mAb binding is compared with that of a negative control (mIgM). (B) GH-activated IM-9 cell lysates were analyzed in Western blot with anti-SOCS3 antibody. Protein loading was controlled by reprobing the membrane with anti-β actin mAb. Data were quantitated using NIH software, normalized using the signal of an unrelated band, and represented as the x -fold increase compared with unstimulated cells. (C) CXCL12- or GH-induced Ca 2+ mobilization in IM-9 cells, untreated or GH-pretreated, was measured in flow cytometry. (D) Untreated or GH-treated IM-9 cells were allowed to migrate in response to 50 nM CXCL12 (left). Cells that migrated to the lower chamber were counted and expressed as a migration index. Data represent the mean of triplicate determinations, with SD indicated. IM-9 cells transfected with pEF-Flag-I/mSOCS3, a siRNA sequence targeting SOCS3, or a scrambled siRNA, were left untreated or GH-treated (60 min, 37°C) and allowed to migrate in response to 50 nM CXCL12 as before (top right). To control SOCS3 silencing, mRNA was extracted from untreated or GH-treated cells previously transfected with a siRNA sequence targeting SOCS3, or with scrambled siRNA. SOCS3 mRNA was analyzed in Northern blot (bottom right).

Techniques Used: Flow Cytometry, Cytometry, Incubation, Labeling, Binding Assay, Negative Control, Western Blot, Software, Migration, Transfection, Sequencing, Northern Blot

37) Product Images from "Ubiquitylation of MHC class I by the K3 viral protein signals internalization and TSG101-dependent degradation"

Article Title: Ubiquitylation of MHC class I by the K3 viral protein signals internalization and TSG101-dependent degradation

Journal: The EMBO Journal

doi: 10.1093/emboj/21.10.2418

Fig. 7. Cellular depletion of the TSG101 protein inhibits KK3-induced MHC class I degradation. ( A ) Depletion of TSG101 from HeLa-M and HeLa-KK3 using siRNA. Cells were co-transfected twice with 50 nM RNAi (lanes 2 and 5) or mock transfected (lanes 1 and 4) at 24 h intervals. Forty-eight hours after the first transfection, 2 × 10 5 cells were extracted in 1% Triton X-100, and lysates separated by 10% SDS–PAGE, transferred to Immobilon P membranes, and probed with the A410 anti-TSG101-specific mAb (upper panel) or control anti-calnexin antisera (lower panel). ( B ) Cytofluorometric analysis of cell surface MHC class I expression in HeLa-M and HeLa-KK3 cells following TSG101 depletion. Cells (2 × 10 5 ) were stained with the monoclonal mAb W6/32 and a FITC-conjugated secondary antibody at 24 h (left and middle panel) and 48 h (right panel) post-TSG101RNAi transfection. ( C ) TSG101-depleted HeLa-KK3 cells were sorted at the 48 h time point [as in (B), right panel] into class I ‘high’ and ‘low’ populations and probed with the A410 anti-TSG101-specific mAb (upper panel) or FLAG mAb M2 (for KK3) (lower panel). ( D ) TSG101 depletion prevents class I degradation. HeLa-M or Hela-KK3 cells (5 × 10 5 ) were pulse-labelled for 10 min and chased for 3 h. Triton X-100 cell lysates were immunoprecipitated with the β 2 M antiserum and resolved by SDS–PAGE and subsequent autoradiography. ( E ) Class I remains ubiquitylated in TSG101-depleted KK3 cells. IFN-γ-stimulated HeLa-KK3 or TSG101-depleted HeLa-KK3 cells (1.4 × 10 7 ) were pulse-labelled for 8 min and chased for 60–180 min. The KK3 protein was immunoprecipitated with the FLAG mAb M2, dissociated in 1% SDS and lysates re-precipitated with the heavy chain-specific mAb (HC10) (left panel). Proteins not precipitated with the FLAG mAb were re-precipitated with the rabbit β 2 M-specific antiserum, dissociated in 1% SDS and re-precipitated with the heavy chain-specific mAb HC10 (right panel), and resolved on a 10% SDS–PAGE gel. The 29 kDa band represents a class I degradation product.
Figure Legend Snippet: Fig. 7. Cellular depletion of the TSG101 protein inhibits KK3-induced MHC class I degradation. ( A ) Depletion of TSG101 from HeLa-M and HeLa-KK3 using siRNA. Cells were co-transfected twice with 50 nM RNAi (lanes 2 and 5) or mock transfected (lanes 1 and 4) at 24 h intervals. Forty-eight hours after the first transfection, 2 × 10 5 cells were extracted in 1% Triton X-100, and lysates separated by 10% SDS–PAGE, transferred to Immobilon P membranes, and probed with the A410 anti-TSG101-specific mAb (upper panel) or control anti-calnexin antisera (lower panel). ( B ) Cytofluorometric analysis of cell surface MHC class I expression in HeLa-M and HeLa-KK3 cells following TSG101 depletion. Cells (2 × 10 5 ) were stained with the monoclonal mAb W6/32 and a FITC-conjugated secondary antibody at 24 h (left and middle panel) and 48 h (right panel) post-TSG101RNAi transfection. ( C ) TSG101-depleted HeLa-KK3 cells were sorted at the 48 h time point [as in (B), right panel] into class I ‘high’ and ‘low’ populations and probed with the A410 anti-TSG101-specific mAb (upper panel) or FLAG mAb M2 (for KK3) (lower panel). ( D ) TSG101 depletion prevents class I degradation. HeLa-M or Hela-KK3 cells (5 × 10 5 ) were pulse-labelled for 10 min and chased for 3 h. Triton X-100 cell lysates were immunoprecipitated with the β 2 M antiserum and resolved by SDS–PAGE and subsequent autoradiography. ( E ) Class I remains ubiquitylated in TSG101-depleted KK3 cells. IFN-γ-stimulated HeLa-KK3 or TSG101-depleted HeLa-KK3 cells (1.4 × 10 7 ) were pulse-labelled for 8 min and chased for 60–180 min. The KK3 protein was immunoprecipitated with the FLAG mAb M2, dissociated in 1% SDS and lysates re-precipitated with the heavy chain-specific mAb (HC10) (left panel). Proteins not precipitated with the FLAG mAb were re-precipitated with the rabbit β 2 M-specific antiserum, dissociated in 1% SDS and re-precipitated with the heavy chain-specific mAb HC10 (right panel), and resolved on a 10% SDS–PAGE gel. The 29 kDa band represents a class I degradation product.

Techniques Used: Transfection, SDS Page, Expressing, Staining, Immunoprecipitation, Autoradiography

38) Product Images from "YAP-dependent induction of amphiregulin identifies a non-cell-autonomous component of the Hippo pathway"

Article Title: YAP-dependent induction of amphiregulin identifies a non-cell-autonomous component of the Hippo pathway

Journal: Nature cell biology

doi: 10.1038/ncb1993

Regulation of AREG by the Hippo pathway ( a ) Recombinant AREG has an equivalent effect on MCF10A 3D acini growth as EGF. (Scale bars, 100 μ m) ( b ) YAP-S127A induces activation of ErbB receptor family. Human EGFR Phosphorylation Antibody Array analysis (RayBiotech, Norcross, GA) was performed using lysate from either vector or YAP-S127A transduced cells cultured in the presence and absence of EGF. Each dot presents the tyrosine phosphorylation of ErbB family members at a specific site. ( c ) AREG expression induced by YAP-S127A is independent from EGFR activation. qRT-PCR analysis of AREG expression in vector or YAP-S127A transduced cells in the presence and absence of EGFR inhibitor (Erlotinib). ( d ) Effectiveness of EGFR inhibition by erlotinib, demonstrated by abrogation of EGFR phosphorylation, shown by immunoblot. ( e ) EGFR inhibitor treatment abolishes YAP-induced 3D culture growth in the absence of EGF, indicating the requirement for EGFR signaling. (Scale bars, 100 μ m) ( f ) qRT-PCR analysis of AREG expression in ACHN cells infected with shRNAs targeting YAP. The Hippo pathway is activated in these cells by mutation of the upstream regulator Salvdador. ( g ) Knockdown of LATS1/2 induces expression of AREG. Immunoblotting analysis of AREG, LATS1 and LATS2; after treatment of MCF10A cells with control or LATS1/2 siRNA. β-Tubulin used as loading control.
Figure Legend Snippet: Regulation of AREG by the Hippo pathway ( a ) Recombinant AREG has an equivalent effect on MCF10A 3D acini growth as EGF. (Scale bars, 100 μ m) ( b ) YAP-S127A induces activation of ErbB receptor family. Human EGFR Phosphorylation Antibody Array analysis (RayBiotech, Norcross, GA) was performed using lysate from either vector or YAP-S127A transduced cells cultured in the presence and absence of EGF. Each dot presents the tyrosine phosphorylation of ErbB family members at a specific site. ( c ) AREG expression induced by YAP-S127A is independent from EGFR activation. qRT-PCR analysis of AREG expression in vector or YAP-S127A transduced cells in the presence and absence of EGFR inhibitor (Erlotinib). ( d ) Effectiveness of EGFR inhibition by erlotinib, demonstrated by abrogation of EGFR phosphorylation, shown by immunoblot. ( e ) EGFR inhibitor treatment abolishes YAP-induced 3D culture growth in the absence of EGF, indicating the requirement for EGFR signaling. (Scale bars, 100 μ m) ( f ) qRT-PCR analysis of AREG expression in ACHN cells infected with shRNAs targeting YAP. The Hippo pathway is activated in these cells by mutation of the upstream regulator Salvdador. ( g ) Knockdown of LATS1/2 induces expression of AREG. Immunoblotting analysis of AREG, LATS1 and LATS2; after treatment of MCF10A cells with control or LATS1/2 siRNA. β-Tubulin used as loading control.

Techniques Used: Recombinant, Activation Assay, Ab Array, Plasmid Preparation, Cell Culture, Expressing, Quantitative RT-PCR, Inhibition, Infection, Mutagenesis

Related Articles

Sequencing:

Article Title: The DNA crosslink-induced S-phase checkpoint depends on ATR-CHK1 and ATR-NBS1-FANCD2 pathways
Article Snippet: .. CHK1 expressions were knocked down by transfection with an siRNA duplex (Dharmacon, USA) directed against the sequence GCGTGCCGTAGACTGTCCA (CHK1) as described ( ). .. MRE11 expression was knocked down by transfection with a mix of three siRNAs directed against the following sequences of the MRE11 mRNA: CCTGCCTCGAGTTATTAAG; CTGCGAGTGGACTATAGTG; GATGCCATTGAGGAATTAG.

Article Title: Therapeutic Ultrasound Bypasses Canonical Syndecan-4 Signaling to Activate Rac1 *Therapeutic Ultrasound Bypasses Canonical Syndecan-4 Signaling to Activate Rac1 * S⃞
Article Snippet: .. RNAi Knockdown of PKC α—An siRNA duplex of sequence (sense) GAAGGGUUCUCGUAUGUCAUU (with ON TARGET™ modification for enhanced specificity) and an siGLO®, nontargeting control duplex were purchased from Dharmacon (Thermo Fisher Scientific). .. 0.8 nmol of oligonucleotide was transfected into a 90% confluent 75-cm2 flask of wild-type MEFs using Lipofectamine™ 2000 reagent (Invitrogen).

Modification:

Article Title: Therapeutic Ultrasound Bypasses Canonical Syndecan-4 Signaling to Activate Rac1 *Therapeutic Ultrasound Bypasses Canonical Syndecan-4 Signaling to Activate Rac1 * S⃞
Article Snippet: .. RNAi Knockdown of PKC α—An siRNA duplex of sequence (sense) GAAGGGUUCUCGUAUGUCAUU (with ON TARGET™ modification for enhanced specificity) and an siGLO®, nontargeting control duplex were purchased from Dharmacon (Thermo Fisher Scientific). .. 0.8 nmol of oligonucleotide was transfected into a 90% confluent 75-cm2 flask of wild-type MEFs using Lipofectamine™ 2000 reagent (Invitrogen).

Transfection:

Article Title: Optineurin links myosin VI to the Golgi complex and is involved in Golgi organization and exocytosis
Article Snippet: .. Knockdown of optineurin by siRNA HeLa and NRK cells were transfected with siRNA duplex (20 μM; Dharmacon Research) using OligofectAMINE (Invitrogen) according to the manufacturer's manual. .. For efficient knockdown of optineurin cells were transfected twice with siRNA duplex on day 1 and day 3.

Article Title: Impairment of Protein Trafficking upon Overexpression and Mutation of Optineurin
Article Snippet: .. The cells were transfected with 50 nM of siRNA duplex (Dharmacon, Lafayette, CO) for 2 days using TransIT-TKO transfection reagent (Mirus Bio Corporation, Madison, WI) according to the manufacturer's protocol. .. Target sequence of optineurin siRNA was 5′-GAAGCCATGAAGCTAAATA-3′ and matched to 166–184 bp of ORF.

Article Title: The DNA crosslink-induced S-phase checkpoint depends on ATR-CHK1 and ATR-NBS1-FANCD2 pathways
Article Snippet: .. CHK1 expressions were knocked down by transfection with an siRNA duplex (Dharmacon, USA) directed against the sequence GCGTGCCGTAGACTGTCCA (CHK1) as described ( ). .. MRE11 expression was knocked down by transfection with a mix of three siRNAs directed against the following sequences of the MRE11 mRNA: CCTGCCTCGAGTTATTAAG; CTGCGAGTGGACTATAGTG; GATGCCATTGAGGAATTAG.

Article Title: Germinal Cell Aplasia in Kif18a Mutant Male Mice Due to Impaired Chromosome Congression and Dysregulated BubR1 and CENP-E
Article Snippet: .. The negative controls were cells transfected with 100 nM siRNA duplex targeting firefly ( Photinus pyralis ) luciferase (5′UUCCTACGCTGAGTACTTCGA3′, GL-3 from Dharmacon). .. The HeLa cell line expressing GFP-tubulin was kindly provided by Dr. Xiaoqi Liu at Purdue University.

Luciferase:

Article Title: Germinal Cell Aplasia in Kif18a Mutant Male Mice Due to Impaired Chromosome Congression and Dysregulated BubR1 and CENP-E
Article Snippet: .. The negative controls were cells transfected with 100 nM siRNA duplex targeting firefly ( Photinus pyralis ) luciferase (5′UUCCTACGCTGAGTACTTCGA3′, GL-3 from Dharmacon). .. The HeLa cell line expressing GFP-tubulin was kindly provided by Dr. Xiaoqi Liu at Purdue University.

Negative Control:

Article Title: Caveolin-1 and force regulation in porcine airway smooth muscle
Article Snippet: .. Briefly, siRNA duplex corresponding to bovine caveolin-1 or 2 mRNA targeting the open reading frame of human caveolin-1 mRNA (223–241 bases; 5′-CCA GAA GGA ACA CAC AGU U-dTdT-3′; negative control siRNA 5′-GCG CGC UUU GUA GGA UUC G-dTdT-3′) (Dharmacon, Lafayette, CO). .. In initial studies, we found considerable suppression of caveolin-1 in porcine ASM by using these siRNA constructs.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 84
    Horizon Discovery vectors enclosing crry shrna
    Decrease in <t>Crry</t> expression was placenta specific. Lentiviral vectors enclosing Crry or non-target <t>shRNA</t> were injected into right uterine horn of pregnant mice (n = 5–7) on 3.5 dpc, shRNA was induced on 10.5 dpc. Expression of Crry on 17.5 dpc in uterine tissue and liver was analyzed. Left panel is representative Western blot showing Crry levels in uterine tissue and density analysis. Right panel is representative Western blot showing Crry levels in liver and density analysis.
    Vectors Enclosing Crry Shrna, supplied by Horizon Discovery, used in various techniques. Bioz Stars score: 84/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/vectors enclosing crry shrna/product/Horizon Discovery
    Average 84 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    vectors enclosing crry shrna - by Bioz Stars, 2020-09
    84/100 stars
      Buy from Supplier

    94
    Horizon Discovery sirna
    The domain structure of <t>RPC5</t> is shown (a). N-terminally, HA-tagged DNA constructs were ordered constituting either amino acids 1-708 RPC5 Full Length (FL) or amino acids 1-253 (DC) where the tandem wing helix domains had been removed. Coimmunoprecipitation in HEK293T cells were performed to investigate whether truncated RPC5 would affect RNA Pol III complex assembly (b). Endogenous RPC5 was knocked down using <t>siRNA</t> before either FL or DC HA-tagged RPC5 constructs were transfected in. Magnetic HA-beads were used to pull down components of the RNA Pol III complex (RPC1, 2 and 4). From this is was concluded that truncation of RPC5 does not inhibit Pol III complex assembly
    Sirna, supplied by Horizon Discovery, used in various techniques. Bioz Stars score: 94/100, based on 807 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sirna/product/Horizon Discovery
    Average 94 stars, based on 807 article reviews
    Price from $9.99 to $1999.99
    sirna - by Bioz Stars, 2020-09
    94/100 stars
      Buy from Supplier

    84
    Horizon Discovery sirna targeting sec22a
    <t>SEC22A</t> associates with RAB18 and influences LD morphology. (A) Confocal micrograph to show overlapping localization of exogenous mEmerald-SEC22A (Green) and mCherry-ER (Red) in HeLa cells. (B) RAB18 LFQ intensities from a reciprocal BioID experiment showing a reduced association between BioID2(Gly40Ser)-SEC22A and endogenous RAB18 in RAB3GAP-null compared to wild-type HeLa cells. Data were adjusted to account for non-specific binding of RAB18 to beads and normalized by SEC22A LFQ intensities in each replicate experiment. Error bars represent s.e.m. Data for other BioID2(Gly40Ser)-SEC22A-associated proteins are provided in table S5. (C) Bar graphs to show effects of ZW10, NBAS and SEC22A knockdowns on lipid droplet number and diameter. siRNA-treated IHH cells were loaded with 200nM BSA-conjugated oleate, fixed and stained with BODIPY and DAPI, and imaged. Images were analysed using ImageJ. Data are derived from measurements from > 100 cells/condition and are representative of three independent experiments. Error bars represent SD. *p
    Sirna Targeting Sec22a, supplied by Horizon Discovery, used in various techniques. Bioz Stars score: 84/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sirna targeting sec22a/product/Horizon Discovery
    Average 84 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    sirna targeting sec22a - by Bioz Stars, 2020-09
    84/100 stars
      Buy from Supplier

    84
    Horizon Discovery intranasal infusion treatment sirna
    Behavioral Analyses of Mice Receiving Intranasal <t>p75NTR</t> <t>Pen-siRNA</t> or Control Pen-siRNA. (A) Outline of the experimental paradigm of CCI injury and behavioral testing. Control and p75NTR Pen-siRNA were infused intranasally to each nostril every 2 min for a total of 20 µl immediately after CCI. (B) Composite mNSS scores for naive, sham-treated, control Pen-siRNA-treated, or p75NTR Pen-siRNA-treated mice evaluated 2 days following the injury. (C) Hang test measured in time (seconds) 2 days following the injury. (D) Average foot slips per run on horizontal ladder with irregularly placed rugs evaluated 3 days following the injury. (E) Average foot slips per run on 1.0-cm wide balance beam evaluated 3 days following the injury. Data were collected across 7 to 9 animals per group; * p
    Intranasal Infusion Treatment Sirna, supplied by Horizon Discovery, used in various techniques. Bioz Stars score: 84/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/intranasal infusion treatment sirna/product/Horizon Discovery
    Average 84 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    intranasal infusion treatment sirna - by Bioz Stars, 2020-09
    84/100 stars
      Buy from Supplier

    Image Search Results


    Decrease in Crry expression was placenta specific. Lentiviral vectors enclosing Crry or non-target shRNA were injected into right uterine horn of pregnant mice (n = 5–7) on 3.5 dpc, shRNA was induced on 10.5 dpc. Expression of Crry on 17.5 dpc in uterine tissue and liver was analyzed. Left panel is representative Western blot showing Crry levels in uterine tissue and density analysis. Right panel is representative Western blot showing Crry levels in liver and density analysis.

    Journal: PLoS ONE

    Article Title: Complement inhibitor Crry expression in mouse placenta is essential for maintaining normal blood pressure and fetal growth

    doi: 10.1371/journal.pone.0236968

    Figure Lengend Snippet: Decrease in Crry expression was placenta specific. Lentiviral vectors enclosing Crry or non-target shRNA were injected into right uterine horn of pregnant mice (n = 5–7) on 3.5 dpc, shRNA was induced on 10.5 dpc. Expression of Crry on 17.5 dpc in uterine tissue and liver was analyzed. Left panel is representative Western blot showing Crry levels in uterine tissue and density analysis. Right panel is representative Western blot showing Crry levels in liver and density analysis.

    Article Snippet: Crry shRNA-vector preparationDoxycycline inducible “SMARTvector Lentiviral” vectors enclosing Crry shRNA and non-target shRNA were purchased from Horizon discovery (Lafayette, CO, USA).

    Techniques: Expressing, shRNA, Injection, Mouse Assay, Western Blot

    Downregulation of placental Crry. Lentiviral vectors enclosing Crry or non-target shRNA were injected into right uterine horn of pregnant mice (n = 5–7) on 3.5 dpc, shRNA was induced on 10.5 dpc and placental expression of Crry on 17.5 dpc was analyzed. A) Representative Western blot showing downregulation of Crry in CrryshRNA mice. In each group placentas from both left and right uterine horn were used in the blot. B) Density analysis of Crry Western bands showing about 30% reduction in Crry levels in CrryshRNA mice compared to control mice ( p

    Journal: PLoS ONE

    Article Title: Complement inhibitor Crry expression in mouse placenta is essential for maintaining normal blood pressure and fetal growth

    doi: 10.1371/journal.pone.0236968

    Figure Lengend Snippet: Downregulation of placental Crry. Lentiviral vectors enclosing Crry or non-target shRNA were injected into right uterine horn of pregnant mice (n = 5–7) on 3.5 dpc, shRNA was induced on 10.5 dpc and placental expression of Crry on 17.5 dpc was analyzed. A) Representative Western blot showing downregulation of Crry in CrryshRNA mice. In each group placentas from both left and right uterine horn were used in the blot. B) Density analysis of Crry Western bands showing about 30% reduction in Crry levels in CrryshRNA mice compared to control mice ( p

    Article Snippet: Crry shRNA-vector preparationDoxycycline inducible “SMARTvector Lentiviral” vectors enclosing Crry shRNA and non-target shRNA were purchased from Horizon discovery (Lafayette, CO, USA).

    Techniques: shRNA, Injection, Mouse Assay, Expressing, Western Blot

    Crry downregulation triggered complement deposition on placenta. Placental complement deposition on 17.5 dpc was measured after shRNA induction on 10.5 dpc in pregnant mice (n = 5–7). Left panel is representative Western blot showing placental C3b deposition levels and density analysis of placental C3b Western blots showing significantly ( p = 0.03) higher deposition in CrryshRNA mice compared to control group. Right panel is representative immunofluorescence images showing increased C3b deposition in CrryshRNA mice and semi-quantitation of fluorescence intensity showing significantly higher C3b deposition ( p = 0.04) in the labyrinthine zone of CrryshRNA mice compared to control mice. There was no change in fluorescence intensity in junctional zone between the two groups.

    Journal: PLoS ONE

    Article Title: Complement inhibitor Crry expression in mouse placenta is essential for maintaining normal blood pressure and fetal growth

    doi: 10.1371/journal.pone.0236968

    Figure Lengend Snippet: Crry downregulation triggered complement deposition on placenta. Placental complement deposition on 17.5 dpc was measured after shRNA induction on 10.5 dpc in pregnant mice (n = 5–7). Left panel is representative Western blot showing placental C3b deposition levels and density analysis of placental C3b Western blots showing significantly ( p = 0.03) higher deposition in CrryshRNA mice compared to control group. Right panel is representative immunofluorescence images showing increased C3b deposition in CrryshRNA mice and semi-quantitation of fluorescence intensity showing significantly higher C3b deposition ( p = 0.04) in the labyrinthine zone of CrryshRNA mice compared to control mice. There was no change in fluorescence intensity in junctional zone between the two groups.

    Article Snippet: Crry shRNA-vector preparationDoxycycline inducible “SMARTvector Lentiviral” vectors enclosing Crry shRNA and non-target shRNA were purchased from Horizon discovery (Lafayette, CO, USA).

    Techniques: shRNA, Mouse Assay, Western Blot, Immunofluorescence, Quantitation Assay, Fluorescence

    Decreased fetal weight in CrryshRNA mice. Fetal and placental weights were measured at 17.5 dpc soon after euthanasia (n = 5–7), A) Average fetal weight was significantly reduced ( p = 0.048) in CrryshRNA mice compared to control group B) Average placental weight was not different between the two groups C) Fetal-placental weight ratio was significantly decreased ( p = 0.045) in Crry shRNA mice compared to control mice.

    Journal: PLoS ONE

    Article Title: Complement inhibitor Crry expression in mouse placenta is essential for maintaining normal blood pressure and fetal growth

    doi: 10.1371/journal.pone.0236968

    Figure Lengend Snippet: Decreased fetal weight in CrryshRNA mice. Fetal and placental weights were measured at 17.5 dpc soon after euthanasia (n = 5–7), A) Average fetal weight was significantly reduced ( p = 0.048) in CrryshRNA mice compared to control group B) Average placental weight was not different between the two groups C) Fetal-placental weight ratio was significantly decreased ( p = 0.045) in Crry shRNA mice compared to control mice.

    Article Snippet: Crry shRNA-vector preparationDoxycycline inducible “SMARTvector Lentiviral” vectors enclosing Crry shRNA and non-target shRNA were purchased from Horizon discovery (Lafayette, CO, USA).

    Techniques: Mouse Assay, shRNA

    The domain structure of RPC5 is shown (a). N-terminally, HA-tagged DNA constructs were ordered constituting either amino acids 1-708 RPC5 Full Length (FL) or amino acids 1-253 (DC) where the tandem wing helix domains had been removed. Coimmunoprecipitation in HEK293T cells were performed to investigate whether truncated RPC5 would affect RNA Pol III complex assembly (b). Endogenous RPC5 was knocked down using siRNA before either FL or DC HA-tagged RPC5 constructs were transfected in. Magnetic HA-beads were used to pull down components of the RNA Pol III complex (RPC1, 2 and 4). From this is was concluded that truncation of RPC5 does not inhibit Pol III complex assembly

    Journal: bioRxiv

    Article Title: Structure of human RNA Polymerase III

    doi: 10.1101/2020.06.29.177279

    Figure Lengend Snippet: The domain structure of RPC5 is shown (a). N-terminally, HA-tagged DNA constructs were ordered constituting either amino acids 1-708 RPC5 Full Length (FL) or amino acids 1-253 (DC) where the tandem wing helix domains had been removed. Coimmunoprecipitation in HEK293T cells were performed to investigate whether truncated RPC5 would affect RNA Pol III complex assembly (b). Endogenous RPC5 was knocked down using siRNA before either FL or DC HA-tagged RPC5 constructs were transfected in. Magnetic HA-beads were used to pull down components of the RNA Pol III complex (RPC1, 2 and 4). From this is was concluded that truncation of RPC5 does not inhibit Pol III complex assembly

    Article Snippet: For transient knockdown, 20nM siRNA of either ONTARGETplus siRNA for RPC5 (Horizon Discovery) or AllStars negative control siRNA (Qiagen) was used per 6 well.

    Techniques: Construct, Transfection

    Cycloheximide chase assay investigation of RPC5 protein stability. HEK293T cells were seeded, endogenous RPC5 was knocked down via siRNA and either the FL ( a ) or ΔC ( b ) RPC5 constructs were transfected. After 24 hours, cycloheximide was added in at a concentration of 300 µ g/ml and cells lysed at the specified time points. RPC1, 2 and 5 (as shown via HA-tag antibody) levels were probed by western blot.

    Journal: bioRxiv

    Article Title: Structure of human RNA Polymerase III

    doi: 10.1101/2020.06.29.177279

    Figure Lengend Snippet: Cycloheximide chase assay investigation of RPC5 protein stability. HEK293T cells were seeded, endogenous RPC5 was knocked down via siRNA and either the FL ( a ) or ΔC ( b ) RPC5 constructs were transfected. After 24 hours, cycloheximide was added in at a concentration of 300 µ g/ml and cells lysed at the specified time points. RPC1, 2 and 5 (as shown via HA-tag antibody) levels were probed by western blot.

    Article Snippet: For transient knockdown, 20nM siRNA of either ONTARGETplus siRNA for RPC5 (Horizon Discovery) or AllStars negative control siRNA (Qiagen) was used per 6 well.

    Techniques: Construct, Transfection, Concentration Assay, Western Blot

    SEC22A associates with RAB18 and influences LD morphology. (A) Confocal micrograph to show overlapping localization of exogenous mEmerald-SEC22A (Green) and mCherry-ER (Red) in HeLa cells. (B) RAB18 LFQ intensities from a reciprocal BioID experiment showing a reduced association between BioID2(Gly40Ser)-SEC22A and endogenous RAB18 in RAB3GAP-null compared to wild-type HeLa cells. Data were adjusted to account for non-specific binding of RAB18 to beads and normalized by SEC22A LFQ intensities in each replicate experiment. Error bars represent s.e.m. Data for other BioID2(Gly40Ser)-SEC22A-associated proteins are provided in table S5. (C) Bar graphs to show effects of ZW10, NBAS and SEC22A knockdowns on lipid droplet number and diameter. siRNA-treated IHH cells were loaded with 200nM BSA-conjugated oleate, fixed and stained with BODIPY and DAPI, and imaged. Images were analysed using ImageJ. Data are derived from measurements from > 100 cells/condition and are representative of three independent experiments. Error bars represent SD. *p

    Journal: bioRxiv

    Article Title: Comparative proximity biotinylation implicates RAB18 in cholesterol mobilization and biosynthesis

    doi: 10.1101/871517

    Figure Lengend Snippet: SEC22A associates with RAB18 and influences LD morphology. (A) Confocal micrograph to show overlapping localization of exogenous mEmerald-SEC22A (Green) and mCherry-ER (Red) in HeLa cells. (B) RAB18 LFQ intensities from a reciprocal BioID experiment showing a reduced association between BioID2(Gly40Ser)-SEC22A and endogenous RAB18 in RAB3GAP-null compared to wild-type HeLa cells. Data were adjusted to account for non-specific binding of RAB18 to beads and normalized by SEC22A LFQ intensities in each replicate experiment. Error bars represent s.e.m. Data for other BioID2(Gly40Ser)-SEC22A-associated proteins are provided in table S5. (C) Bar graphs to show effects of ZW10, NBAS and SEC22A knockdowns on lipid droplet number and diameter. siRNA-treated IHH cells were loaded with 200nM BSA-conjugated oleate, fixed and stained with BODIPY and DAPI, and imaged. Images were analysed using ImageJ. Data are derived from measurements from > 100 cells/condition and are representative of three independent experiments. Error bars represent SD. *p

    Article Snippet: Lipid loading experimentsFor LD number and diameter measurements, IHH cells were seeded onto glass coverslips. siRNA transfections were carried out using FuGene reagent (Promega) according to manufacturer’s instructions. siRNAs targeting ZW10 and NBAS were obtained from IDT, Coralville, IA; siRNA targeting SEC22A was obtained from Horizon Discovery, Cambridge, UK.

    Techniques: Binding Assay, Staining, Derivative Assay

    Behavioral Analyses of Mice Receiving Intranasal p75NTR Pen-siRNA or Control Pen-siRNA. (A) Outline of the experimental paradigm of CCI injury and behavioral testing. Control and p75NTR Pen-siRNA were infused intranasally to each nostril every 2 min for a total of 20 µl immediately after CCI. (B) Composite mNSS scores for naive, sham-treated, control Pen-siRNA-treated, or p75NTR Pen-siRNA-treated mice evaluated 2 days following the injury. (C) Hang test measured in time (seconds) 2 days following the injury. (D) Average foot slips per run on horizontal ladder with irregularly placed rugs evaluated 3 days following the injury. (E) Average foot slips per run on 1.0-cm wide balance beam evaluated 3 days following the injury. Data were collected across 7 to 9 animals per group; * p

    Journal: ASN NEURO

    Article Title: Proneurotrophins Induce Apoptotic Neuronal Death After Controlled Cortical Impact Injury in Adult Mice

    doi: 10.1177/1759091420930865

    Figure Lengend Snippet: Behavioral Analyses of Mice Receiving Intranasal p75NTR Pen-siRNA or Control Pen-siRNA. (A) Outline of the experimental paradigm of CCI injury and behavioral testing. Control and p75NTR Pen-siRNA were infused intranasally to each nostril every 2 min for a total of 20 µl immediately after CCI. (B) Composite mNSS scores for naive, sham-treated, control Pen-siRNA-treated, or p75NTR Pen-siRNA-treated mice evaluated 2 days following the injury. (C) Hang test measured in time (seconds) 2 days following the injury. (D) Average foot slips per run on horizontal ladder with irregularly placed rugs evaluated 3 days following the injury. (E) Average foot slips per run on 1.0-cm wide balance beam evaluated 3 days following the injury. Data were collected across 7 to 9 animals per group; * p

    Article Snippet: Intranasal Infusion Treatment siRNA directed against the p75NTR sequence (sense, SSUGGAACAGCUGCAAACAAAUU) or luciferase sequence (sense, SSCGUACGCGGAAUACUUCGAUU) was synthesized (Horizon Discovery, Dharmacon, Lafayette, CO, USA) and linked to Penetratin-1 ).

    Techniques: Mouse Assay

    Intranasal Infusion of p75NTR Pen-siRNA Reduces Damage Following CCI. (A) Infusion of p75NTR Pen-siRNA reduced p75NTR expression in the OB and cortex as measured by Western blot. Controls received luciferase Pen-siRNA. Values represent the means ± SEM. Asterisks indicate significance by two-tailed, unpaired Student’s t test with p = .04 for OB and p = .01 for cortex. n = 3 mice/treatment. (B) Adult mice were subjected to CCI and immediately infused intranasally with either p75NTR Pen-siRNA or luciferase Pen-siRNA control. Representative images of cresyl violet-stained coronal sections from luciferase or p75NTR Pen-siRNA-treated mice marked with their coordinates to bregma. Scale bar = 1 mm. The percentage of the area of damage (region of tissue loss and penumbra, indicated by the dotted line) shows less damage in the mice that received the p75NTR Pen-siRNA. Values represent the means ± SEM. Asterisks indicate significance by two-tailed, unpaired Student’s t test with p = .03. n = 3 mice/treatment. p75NTR = p75 neurotrophin receptor; OB = olfactory bulb.

    Journal: ASN NEURO

    Article Title: Proneurotrophins Induce Apoptotic Neuronal Death After Controlled Cortical Impact Injury in Adult Mice

    doi: 10.1177/1759091420930865

    Figure Lengend Snippet: Intranasal Infusion of p75NTR Pen-siRNA Reduces Damage Following CCI. (A) Infusion of p75NTR Pen-siRNA reduced p75NTR expression in the OB and cortex as measured by Western blot. Controls received luciferase Pen-siRNA. Values represent the means ± SEM. Asterisks indicate significance by two-tailed, unpaired Student’s t test with p = .04 for OB and p = .01 for cortex. n = 3 mice/treatment. (B) Adult mice were subjected to CCI and immediately infused intranasally with either p75NTR Pen-siRNA or luciferase Pen-siRNA control. Representative images of cresyl violet-stained coronal sections from luciferase or p75NTR Pen-siRNA-treated mice marked with their coordinates to bregma. Scale bar = 1 mm. The percentage of the area of damage (region of tissue loss and penumbra, indicated by the dotted line) shows less damage in the mice that received the p75NTR Pen-siRNA. Values represent the means ± SEM. Asterisks indicate significance by two-tailed, unpaired Student’s t test with p = .03. n = 3 mice/treatment. p75NTR = p75 neurotrophin receptor; OB = olfactory bulb.

    Article Snippet: Intranasal Infusion Treatment siRNA directed against the p75NTR sequence (sense, SSUGGAACAGCUGCAAACAAAUU) or luciferase sequence (sense, SSCGUACGCGGAAUACUUCGAUU) was synthesized (Horizon Discovery, Dharmacon, Lafayette, CO, USA) and linked to Penetratin-1 ).

    Techniques: Expressing, Western Blot, Luciferase, Two Tailed Test, Mouse Assay, Staining