shs231 target site  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95

    Structured Review

    New England Biolabs shs231 target site
    Stable expression, functional gene editing, and gene activation by <t>SHS231</t> integrated transgenes. (A) cultured in the absence of antibiotic selection. (B) Relative Cas9 expression level (cycle threshold [Ct]) from a SHS231 integrated Cas9 cassette compared to cells transduced with high-titer Cas9 expressing lentivirus or the endogenous expression level of GAPDH. Both SHS231 and lentiviral Cas9 variants were expressed from the human EF1α promoter. (C) Targeted deletion of a 17,188 bp gDNA segment of the PAX3 / FOXO1 fusion oncogene in a third RMS cell line, Rh30, by Cas9 protein expressed from the SHS231 locus. Dual gRNA target sites ( blue and green triangles ) and deletion PCR primer sites ( purple arrows ) are identified. (D) Demonstration of endogenous MYF5 gene activation with SHS231 expressed dCas9-VPR and Cas9-VPR transgenes relative to wild-type (unmodified) RMS cells. Gene activation was achieved by targeting full-length (20 bp) or truncated (14 bp) gRNAs ( blue , green , and red triangles ) to the promoter region of the MYF5 gene.
    Shs231 Target Site, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/shs231 target site/product/New England Biolabs
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    shs231 target site - by Bioz Stars, 2020-04
    95/100 stars

    Related Products / Commonly Used Together

    pcr amplification
    shs231-specific targeted integration

    Images

    1) Product Images from "New Human Chromosomal Sites with “Safe Harbor” Potential for Targeted Transgene Insertion"

    Article Title: New Human Chromosomal Sites with “Safe Harbor” Potential for Targeted Transgene Insertion

    Journal: Human Gene Therapy

    doi: 10.1089/hum.2018.169

    Stable expression, functional gene editing, and gene activation by SHS231 integrated transgenes. (A) cultured in the absence of antibiotic selection. (B) Relative Cas9 expression level (cycle threshold [Ct]) from a SHS231 integrated Cas9 cassette compared to cells transduced with high-titer Cas9 expressing lentivirus or the endogenous expression level of GAPDH. Both SHS231 and lentiviral Cas9 variants were expressed from the human EF1α promoter. (C) Targeted deletion of a 17,188 bp gDNA segment of the PAX3 / FOXO1 fusion oncogene in a third RMS cell line, Rh30, by Cas9 protein expressed from the SHS231 locus. Dual gRNA target sites ( blue and green triangles ) and deletion PCR primer sites ( purple arrows ) are identified. (D) Demonstration of endogenous MYF5 gene activation with SHS231 expressed dCas9-VPR and Cas9-VPR transgenes relative to wild-type (unmodified) RMS cells. Gene activation was achieved by targeting full-length (20 bp) or truncated (14 bp) gRNAs ( blue , green , and red triangles ) to the promoter region of the MYF5 gene.
    Figure Legend Snippet: Stable expression, functional gene editing, and gene activation by SHS231 integrated transgenes. (A) cultured in the absence of antibiotic selection. (B) Relative Cas9 expression level (cycle threshold [Ct]) from a SHS231 integrated Cas9 cassette compared to cells transduced with high-titer Cas9 expressing lentivirus or the endogenous expression level of GAPDH. Both SHS231 and lentiviral Cas9 variants were expressed from the human EF1α promoter. (C) Targeted deletion of a 17,188 bp gDNA segment of the PAX3 / FOXO1 fusion oncogene in a third RMS cell line, Rh30, by Cas9 protein expressed from the SHS231 locus. Dual gRNA target sites ( blue and green triangles ) and deletion PCR primer sites ( purple arrows ) are identified. (D) Demonstration of endogenous MYF5 gene activation with SHS231 expressed dCas9-VPR and Cas9-VPR transgenes relative to wild-type (unmodified) RMS cells. Gene activation was achieved by targeting full-length (20 bp) or truncated (14 bp) gRNAs ( blue , green , and red triangles ) to the promoter region of the MYF5 gene.

    Techniques Used: Expressing, Functional Assay, Activation Assay, Cell Culture, Selection, Transduction, Polymerase Chain Reaction

    Structure of three representative new target sites indicating location of mCreI, Cas9, and TALEN target sites. The top two sequence diagrams detail features of the chr2 SHS229 and SHS253, whereas the bottom diagram provides additional detail and results on the chr 4q SHS231. Locations of cleavage sites for mCreI, TALEN, and CRISPR/Cas9 nucleases centered on mCreI target/cleavage sites (key shown top right ). The SHS231 repair template is shown below the chr 4 target site region, which also indicates the location of the variable 108 bp SINE-derived insertion sequence identified in one or both alleles of a subset of the cell lines examined. The bottom panel shows independently cloned and sequenced inserts from targeted SHS231 insertions by all three nucleases. The mCreI targeting experiments used an expression vector that encoded both mCreI and the TREX2 nuclease (see text), and Cas9 targeting was performed using a common guide RNA and either a Cas9 cleavase or nickase. Numbers to the right of each row indicate the number of independent targeting events that were cloned and sequenced (see text for additional details).
    Figure Legend Snippet: Structure of three representative new target sites indicating location of mCreI, Cas9, and TALEN target sites. The top two sequence diagrams detail features of the chr2 SHS229 and SHS253, whereas the bottom diagram provides additional detail and results on the chr 4q SHS231. Locations of cleavage sites for mCreI, TALEN, and CRISPR/Cas9 nucleases centered on mCreI target/cleavage sites (key shown top right ). The SHS231 repair template is shown below the chr 4 target site region, which also indicates the location of the variable 108 bp SINE-derived insertion sequence identified in one or both alleles of a subset of the cell lines examined. The bottom panel shows independently cloned and sequenced inserts from targeted SHS231 insertions by all three nucleases. The mCreI targeting experiments used an expression vector that encoded both mCreI and the TREX2 nuclease (see text), and Cas9 targeting was performed using a common guide RNA and either a Cas9 cleavase or nickase. Numbers to the right of each row indicate the number of independent targeting events that were cloned and sequenced (see text for additional details).

    Techniques Used: Sequencing, CRISPR, Derivative Assay, Clone Assay, Expressing, Plasmid Preparation

    Integration of transgenes into chromosome 4q SHS231 locus using homology-independent non-homologous end joining (NHEJ) DNA repair mechanisms. (A) Homology-independent transgene integration is mediated by targeting both the repair template and genomic target site using dual CRISPR guide RNAs (gRNAs; blue and green triangles represent gRNA target sites). The structure of a SH231 repair template expressing the puromycin resistance gene is indicated, including the size of a puromycin transgene cassette and locations of CRISPR gRNAs. Representative sequences from the 5′ transgene integration site after knock-in-specific polymerase chain reaction (PCR) amplification (PCR primers; purple arrows ). (B) Crystal violet staining was used to visualize the percentage of stable puromycin-resistant colonies resulting from 3 × 10 4 transfected cells after 10 days in culture. No colonies were identified from CRISPR only or repair template only controls. (C) Quantification of crystal violet staining from SHS231 knock-in stable cells generated from the same RMS cell lines used in (B) above. Asterisk indicates significant difference between NHEJ- and HDR-mediated SHS231 knock-in approaches, p
    Figure Legend Snippet: Integration of transgenes into chromosome 4q SHS231 locus using homology-independent non-homologous end joining (NHEJ) DNA repair mechanisms. (A) Homology-independent transgene integration is mediated by targeting both the repair template and genomic target site using dual CRISPR guide RNAs (gRNAs; blue and green triangles represent gRNA target sites). The structure of a SH231 repair template expressing the puromycin resistance gene is indicated, including the size of a puromycin transgene cassette and locations of CRISPR gRNAs. Representative sequences from the 5′ transgene integration site after knock-in-specific polymerase chain reaction (PCR) amplification (PCR primers; purple arrows ). (B) Crystal violet staining was used to visualize the percentage of stable puromycin-resistant colonies resulting from 3 × 10 4 transfected cells after 10 days in culture. No colonies were identified from CRISPR only or repair template only controls. (C) Quantification of crystal violet staining from SHS231 knock-in stable cells generated from the same RMS cell lines used in (B) above. Asterisk indicates significant difference between NHEJ- and HDR-mediated SHS231 knock-in approaches, p

    Techniques Used: Non-Homologous End Joining, CRISPR, Expressing, Knock-In, Polymerase Chain Reaction, Amplification, Staining, Transfection, Generated

    Related Articles

    Transfection:

    Article Title: New Human Chromosomal Sites with “Safe Harbor” Potential for Targeted Transgene Insertion
    Article Snippet: SHS231-specific gRNAs SHS231-gRNA1: 5′-GCCTCCCCCATAGTACCAT-3′ and SHS231-gRNA2: 5′-GATGTGCTCACTGAGTCTGA-3′ were designed to target and cleave both the SHS231 genomic locus and each arm of the SH231 repair template ( ; ) to promote efficient transgene integration by NHEJ-mediated DNA repair., Transgene cassettes were flanked by Bxb1 recombinase and ΦC31 attP integrase target sites that, once integrated, could be used for high-efficiency SHS-specific editing by these recombinase/integrase proteins., Homology-independent SHS231 editing was performed by electroporating the pUS2-SH231 dual guide-targeting Cas9 expression vector (3 μg) and repair templates (3 μg) into each of three different human RMS cell lines (Rh5, Rh30, and SMS-CTR [Hinson 2013]; 1 × 106 cells per transfection) in 100 μL volumes using a Neon e lectroporation system (Life Technologies, Carlsbad, CA) according to the manufacturer's protocol. .. SHS231-specific targeted integration was confirmed with PCR amplification of the SHS231 target site (Q5 polymerase; New England Biolabs) using a transgene-specific and adjacent, genome-anchored primer pair (SHS231 gFwd: GAACCAGAGCCACCCAGTTG, and Bxb1 rev; GTTTGTACCGTACACCACTGAGAC).

    Amplification:

    Article Title: New Human Chromosomal Sites with “Safe Harbor” Potential for Targeted Transgene Insertion
    Article Snippet: .. SHS231-specific targeted integration was confirmed with PCR amplification of the SHS231 target site (Q5 polymerase; New England Biolabs) using a transgene-specific and adjacent, genome-anchored primer pair (SHS231 gFwd: GAACCAGAGCCACCCAGTTG, and Bxb1 rev; GTTTGTACCGTACACCACTGAGAC). .. The efficiency of SHS231 editing by different endonucleases was determined by co-transfecting two independent RMS cells lines (SMS-CTR and RD) with a puromycin resistance cassette-containing SH231 repair template along with an expression vector for mCreI, Cas9 nickase (with a single gRNA), or Cas9 cleavase (with single and dual gRNAs).

    Expressing:

    Article Title: New Human Chromosomal Sites with “Safe Harbor” Potential for Targeted Transgene Insertion
    Article Snippet: SHS231-specific gRNAs SHS231-gRNA1: 5′-GCCTCCCCCATAGTACCAT-3′ and SHS231-gRNA2: 5′-GATGTGCTCACTGAGTCTGA-3′ were designed to target and cleave both the SHS231 genomic locus and each arm of the SH231 repair template ( ; ) to promote efficient transgene integration by NHEJ-mediated DNA repair., Transgene cassettes were flanked by Bxb1 recombinase and ΦC31 attP integrase target sites that, once integrated, could be used for high-efficiency SHS-specific editing by these recombinase/integrase proteins., Homology-independent SHS231 editing was performed by electroporating the pUS2-SH231 dual guide-targeting Cas9 expression vector (3 μg) and repair templates (3 μg) into each of three different human RMS cell lines (Rh5, Rh30, and SMS-CTR [Hinson 2013]; 1 × 106 cells per transfection) in 100 μL volumes using a Neon e lectroporation system (Life Technologies, Carlsbad, CA) according to the manufacturer's protocol. .. SHS231-specific targeted integration was confirmed with PCR amplification of the SHS231 target site (Q5 polymerase; New England Biolabs) using a transgene-specific and adjacent, genome-anchored primer pair (SHS231 gFwd: GAACCAGAGCCACCCAGTTG, and Bxb1 rev; GTTTGTACCGTACACCACTGAGAC).

    Polymerase Chain Reaction:

    Article Title: New Human Chromosomal Sites with “Safe Harbor” Potential for Targeted Transgene Insertion
    Article Snippet: .. SHS231-specific targeted integration was confirmed with PCR amplification of the SHS231 target site (Q5 polymerase; New England Biolabs) using a transgene-specific and adjacent, genome-anchored primer pair (SHS231 gFwd: GAACCAGAGCCACCCAGTTG, and Bxb1 rev; GTTTGTACCGTACACCACTGAGAC). .. The efficiency of SHS231 editing by different endonucleases was determined by co-transfecting two independent RMS cells lines (SMS-CTR and RD) with a puromycin resistance cassette-containing SH231 repair template along with an expression vector for mCreI, Cas9 nickase (with a single gRNA), or Cas9 cleavase (with single and dual gRNAs).

    Selection:

    Article Title: New Human Chromosomal Sites with “Safe Harbor” Potential for Targeted Transgene Insertion
    Article Snippet: Two 1,150 V pulses for 30 ms each were performed, followed by growth for 2 weeks in the presence of selection (puromycin, hygromycin, or blasticin, depending on the repair template; see and ) to select pools of transgene-containing cells. .. SHS231-specific targeted integration was confirmed with PCR amplification of the SHS231 target site (Q5 polymerase; New England Biolabs) using a transgene-specific and adjacent, genome-anchored primer pair (SHS231 gFwd: GAACCAGAGCCACCCAGTTG, and Bxb1 rev; GTTTGTACCGTACACCACTGAGAC).

    Non-Homologous End Joining:

    Article Title: New Human Chromosomal Sites with “Safe Harbor” Potential for Targeted Transgene Insertion
    Article Snippet: SHS231-specific gRNAs SHS231-gRNA1: 5′-GCCTCCCCCATAGTACCAT-3′ and SHS231-gRNA2: 5′-GATGTGCTCACTGAGTCTGA-3′ were designed to target and cleave both the SHS231 genomic locus and each arm of the SH231 repair template ( ; ) to promote efficient transgene integration by NHEJ-mediated DNA repair., Transgene cassettes were flanked by Bxb1 recombinase and ΦC31 attP integrase target sites that, once integrated, could be used for high-efficiency SHS-specific editing by these recombinase/integrase proteins., Homology-independent SHS231 editing was performed by electroporating the pUS2-SH231 dual guide-targeting Cas9 expression vector (3 μg) and repair templates (3 μg) into each of three different human RMS cell lines (Rh5, Rh30, and SMS-CTR [Hinson 2013]; 1 × 106 cells per transfection) in 100 μL volumes using a Neon e lectroporation system (Life Technologies, Carlsbad, CA) according to the manufacturer's protocol. .. SHS231-specific targeted integration was confirmed with PCR amplification of the SHS231 target site (Q5 polymerase; New England Biolabs) using a transgene-specific and adjacent, genome-anchored primer pair (SHS231 gFwd: GAACCAGAGCCACCCAGTTG, and Bxb1 rev; GTTTGTACCGTACACCACTGAGAC).

    Mass Spectrometry:

    Article Title: New Human Chromosomal Sites with “Safe Harbor” Potential for Targeted Transgene Insertion
    Article Snippet: Two 1,150 V pulses for 30 ms each were performed, followed by growth for 2 weeks in the presence of selection (puromycin, hygromycin, or blasticin, depending on the repair template; see and ) to select pools of transgene-containing cells. .. SHS231-specific targeted integration was confirmed with PCR amplification of the SHS231 target site (Q5 polymerase; New England Biolabs) using a transgene-specific and adjacent, genome-anchored primer pair (SHS231 gFwd: GAACCAGAGCCACCCAGTTG, and Bxb1 rev; GTTTGTACCGTACACCACTGAGAC).

    Knock-In:

    Article Title: New Human Chromosomal Sites with “Safe Harbor” Potential for Targeted Transgene Insertion
    Article Snippet: SHS231-specific targeted integration was confirmed with PCR amplification of the SHS231 target site (Q5 polymerase; New England Biolabs) using a transgene-specific and adjacent, genome-anchored primer pair (SHS231 gFwd: GAACCAGAGCCACCCAGTTG, and Bxb1 rev; GTTTGTACCGTACACCACTGAGAC). .. RMS cells were also co-transfected with the piggybac transposon-enabled SHS231 repair template and a piggybac transposase plasmid (PB210PA-1, Palo Alto, CA) to compare the SHS231 knock-in efficiencies of Cas9, mCreI, and transposase-mediated random transgene integration.

    Plasmid Preparation:

    Article Title: New Human Chromosomal Sites with “Safe Harbor” Potential for Targeted Transgene Insertion
    Article Snippet: SHS231-specific gRNAs SHS231-gRNA1: 5′-GCCTCCCCCATAGTACCAT-3′ and SHS231-gRNA2: 5′-GATGTGCTCACTGAGTCTGA-3′ were designed to target and cleave both the SHS231 genomic locus and each arm of the SH231 repair template ( ; ) to promote efficient transgene integration by NHEJ-mediated DNA repair., Transgene cassettes were flanked by Bxb1 recombinase and ΦC31 attP integrase target sites that, once integrated, could be used for high-efficiency SHS-specific editing by these recombinase/integrase proteins., Homology-independent SHS231 editing was performed by electroporating the pUS2-SH231 dual guide-targeting Cas9 expression vector (3 μg) and repair templates (3 μg) into each of three different human RMS cell lines (Rh5, Rh30, and SMS-CTR [Hinson 2013]; 1 × 106 cells per transfection) in 100 μL volumes using a Neon e lectroporation system (Life Technologies, Carlsbad, CA) according to the manufacturer's protocol. .. SHS231-specific targeted integration was confirmed with PCR amplification of the SHS231 target site (Q5 polymerase; New England Biolabs) using a transgene-specific and adjacent, genome-anchored primer pair (SHS231 gFwd: GAACCAGAGCCACCCAGTTG, and Bxb1 rev; GTTTGTACCGTACACCACTGAGAC).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    New England Biolabs shs231 target site
    Stable expression, functional gene editing, and gene activation by <t>SHS231</t> integrated transgenes. (A) cultured in the absence of antibiotic selection. (B) Relative Cas9 expression level (cycle threshold [Ct]) from a SHS231 integrated Cas9 cassette compared to cells transduced with high-titer Cas9 expressing lentivirus or the endogenous expression level of GAPDH. Both SHS231 and lentiviral Cas9 variants were expressed from the human EF1α promoter. (C) Targeted deletion of a 17,188 bp gDNA segment of the PAX3 / FOXO1 fusion oncogene in a third RMS cell line, Rh30, by Cas9 protein expressed from the SHS231 locus. Dual gRNA target sites ( blue and green triangles ) and deletion PCR primer sites ( purple arrows ) are identified. (D) Demonstration of endogenous MYF5 gene activation with SHS231 expressed dCas9-VPR and Cas9-VPR transgenes relative to wild-type (unmodified) RMS cells. Gene activation was achieved by targeting full-length (20 bp) or truncated (14 bp) gRNAs ( blue , green , and red triangles ) to the promoter region of the MYF5 gene.
    Shs231 Target Site, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/shs231 target site/product/New England Biolabs
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    shs231 target site - by Bioz Stars, 2020-04
    95/100 stars
      Buy from Supplier

    Image Search Results


    Stable expression, functional gene editing, and gene activation by SHS231 integrated transgenes. (A) cultured in the absence of antibiotic selection. (B) Relative Cas9 expression level (cycle threshold [Ct]) from a SHS231 integrated Cas9 cassette compared to cells transduced with high-titer Cas9 expressing lentivirus or the endogenous expression level of GAPDH. Both SHS231 and lentiviral Cas9 variants were expressed from the human EF1α promoter. (C) Targeted deletion of a 17,188 bp gDNA segment of the PAX3 / FOXO1 fusion oncogene in a third RMS cell line, Rh30, by Cas9 protein expressed from the SHS231 locus. Dual gRNA target sites ( blue and green triangles ) and deletion PCR primer sites ( purple arrows ) are identified. (D) Demonstration of endogenous MYF5 gene activation with SHS231 expressed dCas9-VPR and Cas9-VPR transgenes relative to wild-type (unmodified) RMS cells. Gene activation was achieved by targeting full-length (20 bp) or truncated (14 bp) gRNAs ( blue , green , and red triangles ) to the promoter region of the MYF5 gene.

    Journal: Human Gene Therapy

    Article Title: New Human Chromosomal Sites with “Safe Harbor” Potential for Targeted Transgene Insertion

    doi: 10.1089/hum.2018.169

    Figure Lengend Snippet: Stable expression, functional gene editing, and gene activation by SHS231 integrated transgenes. (A) cultured in the absence of antibiotic selection. (B) Relative Cas9 expression level (cycle threshold [Ct]) from a SHS231 integrated Cas9 cassette compared to cells transduced with high-titer Cas9 expressing lentivirus or the endogenous expression level of GAPDH. Both SHS231 and lentiviral Cas9 variants were expressed from the human EF1α promoter. (C) Targeted deletion of a 17,188 bp gDNA segment of the PAX3 / FOXO1 fusion oncogene in a third RMS cell line, Rh30, by Cas9 protein expressed from the SHS231 locus. Dual gRNA target sites ( blue and green triangles ) and deletion PCR primer sites ( purple arrows ) are identified. (D) Demonstration of endogenous MYF5 gene activation with SHS231 expressed dCas9-VPR and Cas9-VPR transgenes relative to wild-type (unmodified) RMS cells. Gene activation was achieved by targeting full-length (20 bp) or truncated (14 bp) gRNAs ( blue , green , and red triangles ) to the promoter region of the MYF5 gene.

    Article Snippet: SHS231-specific targeted integration was confirmed with PCR amplification of the SHS231 target site (Q5 polymerase; New England Biolabs) using a transgene-specific and adjacent, genome-anchored primer pair (SHS231 gFwd: GAACCAGAGCCACCCAGTTG, and Bxb1 rev; GTTTGTACCGTACACCACTGAGAC).

    Techniques: Expressing, Functional Assay, Activation Assay, Cell Culture, Selection, Transduction, Polymerase Chain Reaction

    Structure of three representative new target sites indicating location of mCreI, Cas9, and TALEN target sites. The top two sequence diagrams detail features of the chr2 SHS229 and SHS253, whereas the bottom diagram provides additional detail and results on the chr 4q SHS231. Locations of cleavage sites for mCreI, TALEN, and CRISPR/Cas9 nucleases centered on mCreI target/cleavage sites (key shown top right ). The SHS231 repair template is shown below the chr 4 target site region, which also indicates the location of the variable 108 bp SINE-derived insertion sequence identified in one or both alleles of a subset of the cell lines examined. The bottom panel shows independently cloned and sequenced inserts from targeted SHS231 insertions by all three nucleases. The mCreI targeting experiments used an expression vector that encoded both mCreI and the TREX2 nuclease (see text), and Cas9 targeting was performed using a common guide RNA and either a Cas9 cleavase or nickase. Numbers to the right of each row indicate the number of independent targeting events that were cloned and sequenced (see text for additional details).

    Journal: Human Gene Therapy

    Article Title: New Human Chromosomal Sites with “Safe Harbor” Potential for Targeted Transgene Insertion

    doi: 10.1089/hum.2018.169

    Figure Lengend Snippet: Structure of three representative new target sites indicating location of mCreI, Cas9, and TALEN target sites. The top two sequence diagrams detail features of the chr2 SHS229 and SHS253, whereas the bottom diagram provides additional detail and results on the chr 4q SHS231. Locations of cleavage sites for mCreI, TALEN, and CRISPR/Cas9 nucleases centered on mCreI target/cleavage sites (key shown top right ). The SHS231 repair template is shown below the chr 4 target site region, which also indicates the location of the variable 108 bp SINE-derived insertion sequence identified in one or both alleles of a subset of the cell lines examined. The bottom panel shows independently cloned and sequenced inserts from targeted SHS231 insertions by all three nucleases. The mCreI targeting experiments used an expression vector that encoded both mCreI and the TREX2 nuclease (see text), and Cas9 targeting was performed using a common guide RNA and either a Cas9 cleavase or nickase. Numbers to the right of each row indicate the number of independent targeting events that were cloned and sequenced (see text for additional details).

    Article Snippet: SHS231-specific targeted integration was confirmed with PCR amplification of the SHS231 target site (Q5 polymerase; New England Biolabs) using a transgene-specific and adjacent, genome-anchored primer pair (SHS231 gFwd: GAACCAGAGCCACCCAGTTG, and Bxb1 rev; GTTTGTACCGTACACCACTGAGAC).

    Techniques: Sequencing, CRISPR, Derivative Assay, Clone Assay, Expressing, Plasmid Preparation

    Integration of transgenes into chromosome 4q SHS231 locus using homology-independent non-homologous end joining (NHEJ) DNA repair mechanisms. (A) Homology-independent transgene integration is mediated by targeting both the repair template and genomic target site using dual CRISPR guide RNAs (gRNAs; blue and green triangles represent gRNA target sites). The structure of a SH231 repair template expressing the puromycin resistance gene is indicated, including the size of a puromycin transgene cassette and locations of CRISPR gRNAs. Representative sequences from the 5′ transgene integration site after knock-in-specific polymerase chain reaction (PCR) amplification (PCR primers; purple arrows ). (B) Crystal violet staining was used to visualize the percentage of stable puromycin-resistant colonies resulting from 3 × 10 4 transfected cells after 10 days in culture. No colonies were identified from CRISPR only or repair template only controls. (C) Quantification of crystal violet staining from SHS231 knock-in stable cells generated from the same RMS cell lines used in (B) above. Asterisk indicates significant difference between NHEJ- and HDR-mediated SHS231 knock-in approaches, p

    Journal: Human Gene Therapy

    Article Title: New Human Chromosomal Sites with “Safe Harbor” Potential for Targeted Transgene Insertion

    doi: 10.1089/hum.2018.169

    Figure Lengend Snippet: Integration of transgenes into chromosome 4q SHS231 locus using homology-independent non-homologous end joining (NHEJ) DNA repair mechanisms. (A) Homology-independent transgene integration is mediated by targeting both the repair template and genomic target site using dual CRISPR guide RNAs (gRNAs; blue and green triangles represent gRNA target sites). The structure of a SH231 repair template expressing the puromycin resistance gene is indicated, including the size of a puromycin transgene cassette and locations of CRISPR gRNAs. Representative sequences from the 5′ transgene integration site after knock-in-specific polymerase chain reaction (PCR) amplification (PCR primers; purple arrows ). (B) Crystal violet staining was used to visualize the percentage of stable puromycin-resistant colonies resulting from 3 × 10 4 transfected cells after 10 days in culture. No colonies were identified from CRISPR only or repair template only controls. (C) Quantification of crystal violet staining from SHS231 knock-in stable cells generated from the same RMS cell lines used in (B) above. Asterisk indicates significant difference between NHEJ- and HDR-mediated SHS231 knock-in approaches, p

    Article Snippet: SHS231-specific targeted integration was confirmed with PCR amplification of the SHS231 target site (Q5 polymerase; New England Biolabs) using a transgene-specific and adjacent, genome-anchored primer pair (SHS231 gFwd: GAACCAGAGCCACCCAGTTG, and Bxb1 rev; GTTTGTACCGTACACCACTGAGAC).

    Techniques: Non-Homologous End Joining, CRISPR, Expressing, Knock-In, Polymerase Chain Reaction, Amplification, Staining, Transfection, Generated