Structured Review

Millipore shrnas
SHROOM2 inhibits EMT. a Gene set enrichment analysis (GSEA) of microarray data of control and SHROOM2 knockdown HONE1 cells. NES normalized enrichment score. b GSEA plot showing an enrichment of gene signatures associated with EMT between control and SHROOM2 knockdown HONE1 cells; FDR: false-discovery rate. c Heat map of the EMT-related genes up- and downregulated by SHROOM2 depletion from the microarray data. The scale is −2 to +2 in log 10. d Western blot analysis of EMT markers in HONE1 and SUNE1 cells infected with lentivirus carrying control <t>shRNA</t> or <t>shRNAs</t> targeting SHROOM2. e Reconstitution of SHROOM2 into SHROOM2-depleted HONE1 cells rescued E- and N-cadherin expression. Asterisk denotes shRNA-resistant SHROOM2. f Immunofluorescence staining of EMT markers (top) and keratins (bottom, left) in control and SHROOM2-depleted HONE1 cells. Quantification of the percentage of the positive staining was shown (bottom, right). Experiments were performed in triplicate and at least 100 cells were counted in each experiment. g qPCR analysis of cell–cell junction molecules and EMT markers in control and SHROOM2-depleted cells. Mean ± SD, n = 3. * p
Shrnas, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 284 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/shrnas/product/Millipore
Average 99 stars, based on 284 article reviews
Price from $9.99 to $1999.99
shrnas - by Bioz Stars, 2020-09
99/100 stars

Images

1) Product Images from "SHROOM2 inhibits tumor metastasis through RhoA–ROCK pathway-dependent and -independent mechanisms in nasopharyngeal carcinoma"

Article Title: SHROOM2 inhibits tumor metastasis through RhoA–ROCK pathway-dependent and -independent mechanisms in nasopharyngeal carcinoma

Journal: Cell Death & Disease

doi: 10.1038/s41419-019-1325-7

SHROOM2 inhibits EMT. a Gene set enrichment analysis (GSEA) of microarray data of control and SHROOM2 knockdown HONE1 cells. NES normalized enrichment score. b GSEA plot showing an enrichment of gene signatures associated with EMT between control and SHROOM2 knockdown HONE1 cells; FDR: false-discovery rate. c Heat map of the EMT-related genes up- and downregulated by SHROOM2 depletion from the microarray data. The scale is −2 to +2 in log 10. d Western blot analysis of EMT markers in HONE1 and SUNE1 cells infected with lentivirus carrying control shRNA or shRNAs targeting SHROOM2. e Reconstitution of SHROOM2 into SHROOM2-depleted HONE1 cells rescued E- and N-cadherin expression. Asterisk denotes shRNA-resistant SHROOM2. f Immunofluorescence staining of EMT markers (top) and keratins (bottom, left) in control and SHROOM2-depleted HONE1 cells. Quantification of the percentage of the positive staining was shown (bottom, right). Experiments were performed in triplicate and at least 100 cells were counted in each experiment. g qPCR analysis of cell–cell junction molecules and EMT markers in control and SHROOM2-depleted cells. Mean ± SD, n = 3. * p
Figure Legend Snippet: SHROOM2 inhibits EMT. a Gene set enrichment analysis (GSEA) of microarray data of control and SHROOM2 knockdown HONE1 cells. NES normalized enrichment score. b GSEA plot showing an enrichment of gene signatures associated with EMT between control and SHROOM2 knockdown HONE1 cells; FDR: false-discovery rate. c Heat map of the EMT-related genes up- and downregulated by SHROOM2 depletion from the microarray data. The scale is −2 to +2 in log 10. d Western blot analysis of EMT markers in HONE1 and SUNE1 cells infected with lentivirus carrying control shRNA or shRNAs targeting SHROOM2. e Reconstitution of SHROOM2 into SHROOM2-depleted HONE1 cells rescued E- and N-cadherin expression. Asterisk denotes shRNA-resistant SHROOM2. f Immunofluorescence staining of EMT markers (top) and keratins (bottom, left) in control and SHROOM2-depleted HONE1 cells. Quantification of the percentage of the positive staining was shown (bottom, right). Experiments were performed in triplicate and at least 100 cells were counted in each experiment. g qPCR analysis of cell–cell junction molecules and EMT markers in control and SHROOM2-depleted cells. Mean ± SD, n = 3. * p

Techniques Used: Microarray, Western Blot, Infection, shRNA, Expressing, Immunofluorescence, Staining, Real-time Polymerase Chain Reaction

SHROOM2 suppresses cell migration and invasion. a Immunobloting of SHROOM2 in HONE1 cells that stably expressing pBABE-SHROOM2. b Representative images (left) and quantification (right) of Transwell cell migration and invasion assays for HONE1 cells that stably expressing ectopic SHROOM2 or empty vector. Scale bar: 100 μm. Mean ± SD, n = 3. c Western blot analysis of HONE1 cells infected with control lentivirus or lentivirus carrying SHROOM2-specific shRNAs. d Representative images (top) and quantification (bottom) of Transwell cell migration and invasion assays for control HONE1 cells or HONE1 cells with SHROOM2 knockdown by three independent shRNAs. Scale bar: 100 μm. Mean ± SD, n = 3. e Wound healing assays for control and SHROOM2 knockdown HONE1 cells. Scale bar: 100 μm. f Representative images (left) and quantification (right) of Transwell cell migration assays for control and SHROOM2 knockdown HONE1 cells treated with 20 μM Y-27632 or DMSO for 24 h. Scale bar: 50 μm. Mean ± SD, n = 3. g Transwell invasion assays as in f except the upper chamber was coated with Matrigel. Scale bar: 50 μm. * p
Figure Legend Snippet: SHROOM2 suppresses cell migration and invasion. a Immunobloting of SHROOM2 in HONE1 cells that stably expressing pBABE-SHROOM2. b Representative images (left) and quantification (right) of Transwell cell migration and invasion assays for HONE1 cells that stably expressing ectopic SHROOM2 or empty vector. Scale bar: 100 μm. Mean ± SD, n = 3. c Western blot analysis of HONE1 cells infected with control lentivirus or lentivirus carrying SHROOM2-specific shRNAs. d Representative images (top) and quantification (bottom) of Transwell cell migration and invasion assays for control HONE1 cells or HONE1 cells with SHROOM2 knockdown by three independent shRNAs. Scale bar: 100 μm. Mean ± SD, n = 3. e Wound healing assays for control and SHROOM2 knockdown HONE1 cells. Scale bar: 100 μm. f Representative images (left) and quantification (right) of Transwell cell migration assays for control and SHROOM2 knockdown HONE1 cells treated with 20 μM Y-27632 or DMSO for 24 h. Scale bar: 50 μm. Mean ± SD, n = 3. g Transwell invasion assays as in f except the upper chamber was coated with Matrigel. Scale bar: 50 μm. * p

Techniques Used: Migration, Western Blot, Stable Transfection, Expressing, Plasmid Preparation, Infection

2) Product Images from "Class III PI-3-kinase activates phospholipase D in an amino acid-sensing mTORC1 pathway"

Article Title: Class III PI-3-kinase activates phospholipase D in an amino acid-sensing mTORC1 pathway

Journal: The Journal of Cell Biology

doi: 10.1083/jcb.201107033

hVps34 and PLD1 regulate cell size. (A) HEK293 cells were transduced with lentiviruses expressing shRNAs for raptor, hVps34, or PLD1, puromycin selected, and then subjected to cell size measurement of median forward scatter-height. The result of overnight treatment with 100 nM rapamycin is included as a control. Representative histograms are also shown, with cell counts in arbitrary units. (B) Cells were transfected with wt- or ΔPX-PLD1 together in pCDNA3 (vector), selected with G418 for 3 d, and then subjected to cell size measurement as described in A. A one-sample t test was performed to compare each data with the control. Three independent experiments were performed, and the results of mean ± SD are shown in the graphs. *, P
Figure Legend Snippet: hVps34 and PLD1 regulate cell size. (A) HEK293 cells were transduced with lentiviruses expressing shRNAs for raptor, hVps34, or PLD1, puromycin selected, and then subjected to cell size measurement of median forward scatter-height. The result of overnight treatment with 100 nM rapamycin is included as a control. Representative histograms are also shown, with cell counts in arbitrary units. (B) Cells were transfected with wt- or ΔPX-PLD1 together in pCDNA3 (vector), selected with G418 for 3 d, and then subjected to cell size measurement as described in A. A one-sample t test was performed to compare each data with the control. Three independent experiments were performed, and the results of mean ± SD are shown in the graphs. *, P

Techniques Used: Transduction, Expressing, Transfection, Plasmid Preparation

PLD1 and Rag pathways act in parallel to mediate amino acid activation of mTORC1. (A) HEK293 cells were transduced with lentiviruses expressing shRNAs, selected with puromycin, serum starved, and amino acid (AA) deprived followed by amino acid stimulation for 30 min. Cell lysates were analyzed by Western blotting. scram, scrambled. (B) Cells were treated as in A, and in vivo PLD assays were performed. *, P
Figure Legend Snippet: PLD1 and Rag pathways act in parallel to mediate amino acid activation of mTORC1. (A) HEK293 cells were transduced with lentiviruses expressing shRNAs, selected with puromycin, serum starved, and amino acid (AA) deprived followed by amino acid stimulation for 30 min. Cell lysates were analyzed by Western blotting. scram, scrambled. (B) Cells were treated as in A, and in vivo PLD assays were performed. *, P

Techniques Used: Activated Clotting Time Assay, Activation Assay, Transduction, Expressing, Western Blot, In Vivo

hVps34 is necessary for amino acid activation of PLD1 upstream of mTORC1. HEK293 cells were treated as described below, and in vivo PLD assays and Western analysis of cell lysates were performed in parallel. (A) Serum-starved cells were subjected to amino acid withdrawal for 2 h and were then stimulated with amino acids for 30 min. 10 mM 3-MA and 100 nM rapamycin were added 60 and 30 min before stimulation, respectively, where indicated. (B and C) Cells were transduced with lentiviruses expressing two independent shRNAs against hVps34 and a scrambled (scram) sequence as a negative control, selected with puromycin, serum starved overnight, and amino acid deprived for 2 h followed by 30 min of amino acid (AA) stimulation (B) or insulin (100 nM) stimulation (C). (D) Cells transduced with lentiviruses expressing PLD1-shRNA or scramble control and selected with puromycin were transiently transfected with an Myc-hVps34/V5-hVps15 bicistronic construct or empty vector. The cells were then serum starved overnight and amino acid deprived for 2 h followed by amino acid stimulation for 30 min. Cell lysates were subjected to Western analysis. (E) Cells were transduced with lentiviruses expressing hVps34-shRNA or scramble control, selected with puromycin, serum starved overnight, and then stimulated with 300 µM PA for 30 min. Cell lysates were subjected to Western analysis. (F) Cells were treated as in E but amino acid deprived for 2 h followed by amino acid stimulation, PA (300 µM) stimulation, or both for 30 min. Predicted molecular masses of the proteins are indicated for Western blots. S6K1 migrated on SDS-PAGE as a 70-kD protein. (A–C) All data are mean ± SD or representative blots from three to five independent experiments. A one-sample or paired t test was performed to compare the indicated pairs of data. *, P
Figure Legend Snippet: hVps34 is necessary for amino acid activation of PLD1 upstream of mTORC1. HEK293 cells were treated as described below, and in vivo PLD assays and Western analysis of cell lysates were performed in parallel. (A) Serum-starved cells were subjected to amino acid withdrawal for 2 h and were then stimulated with amino acids for 30 min. 10 mM 3-MA and 100 nM rapamycin were added 60 and 30 min before stimulation, respectively, where indicated. (B and C) Cells were transduced with lentiviruses expressing two independent shRNAs against hVps34 and a scrambled (scram) sequence as a negative control, selected with puromycin, serum starved overnight, and amino acid deprived for 2 h followed by 30 min of amino acid (AA) stimulation (B) or insulin (100 nM) stimulation (C). (D) Cells transduced with lentiviruses expressing PLD1-shRNA or scramble control and selected with puromycin were transiently transfected with an Myc-hVps34/V5-hVps15 bicistronic construct or empty vector. The cells were then serum starved overnight and amino acid deprived for 2 h followed by amino acid stimulation for 30 min. Cell lysates were subjected to Western analysis. (E) Cells were transduced with lentiviruses expressing hVps34-shRNA or scramble control, selected with puromycin, serum starved overnight, and then stimulated with 300 µM PA for 30 min. Cell lysates were subjected to Western analysis. (F) Cells were treated as in E but amino acid deprived for 2 h followed by amino acid stimulation, PA (300 µM) stimulation, or both for 30 min. Predicted molecular masses of the proteins are indicated for Western blots. S6K1 migrated on SDS-PAGE as a 70-kD protein. (A–C) All data are mean ± SD or representative blots from three to five independent experiments. A one-sample or paired t test was performed to compare the indicated pairs of data. *, P

Techniques Used: Activation Assay, In Vivo, Western Blot, Transduction, Expressing, Sequencing, Negative Control, shRNA, Transfection, Construct, Plasmid Preparation, SDS Page

3) Product Images from "Integrated high-throughput analysis identifies Sp1 as a crucial determinant of p53-mediated apoptosis"

Article Title: Integrated high-throughput analysis identifies Sp1 as a crucial determinant of p53-mediated apoptosis

Journal: Cell Death and Differentiation

doi: 10.1038/cdd.2014.69

Genome-wide shRNA screen for identifying modulators of p53-mediated apoptosis. ( a and b ) Induction of apoptosis by RITA or nutlin in MCF-7, HCT116 and HCT116 TP53−/− cells, as assessed by FACS of Rho123-PI-stained cells. Apoptosis was assayed also by FACS of Annexin V-PI-stained cells or sub-G1 population detection using PI staining. In each experiment, at least two methods were used, and conclusions were only made when similar results had been obtained with both methods. Detailed results are shown in Supplementary Figure S1B . ( b ) Induction of apoptosis by RITA was halted by blocking the p53 transcriptional activity with PFT- α , 18 but not by blocking the cytoplasmic function of p53 with PFT- μ . 19 ( c ) Effect of RITA and nutlin on cell cycle in MCF-7, HCT116 and HCT116 TP53−/− cells was assessed by FACS using PI staining. ( d ) Schematic representation showing the design of the genome-wide shRNA screen in MCF-7 cells. ( e ) Hierarchical clustering analysis of the shRNA screen data identifies two groups of hits: SLNs and RNs. Light blue indicates low abundance of shRNA (SLNs) and dark blue reflects high abundance (RNs). Rows indicate shRNAs. Raw data were normalized within each shRNA. P
Figure Legend Snippet: Genome-wide shRNA screen for identifying modulators of p53-mediated apoptosis. ( a and b ) Induction of apoptosis by RITA or nutlin in MCF-7, HCT116 and HCT116 TP53−/− cells, as assessed by FACS of Rho123-PI-stained cells. Apoptosis was assayed also by FACS of Annexin V-PI-stained cells or sub-G1 population detection using PI staining. In each experiment, at least two methods were used, and conclusions were only made when similar results had been obtained with both methods. Detailed results are shown in Supplementary Figure S1B . ( b ) Induction of apoptosis by RITA was halted by blocking the p53 transcriptional activity with PFT- α , 18 but not by blocking the cytoplasmic function of p53 with PFT- μ . 19 ( c ) Effect of RITA and nutlin on cell cycle in MCF-7, HCT116 and HCT116 TP53−/− cells was assessed by FACS using PI staining. ( d ) Schematic representation showing the design of the genome-wide shRNA screen in MCF-7 cells. ( e ) Hierarchical clustering analysis of the shRNA screen data identifies two groups of hits: SLNs and RNs. Light blue indicates low abundance of shRNA (SLNs) and dark blue reflects high abundance (RNs). Rows indicate shRNAs. Raw data were normalized within each shRNA. P

Techniques Used: Genome Wide, shRNA, FACS, Staining, Blocking Assay, Activity Assay

4) Product Images from "The Dyslexia-susceptibility Protein KIAA0319 Inhibits Axon Growth Through Smad2 Signaling"

Article Title: The Dyslexia-susceptibility Protein KIAA0319 Inhibits Axon Growth Through Smad2 Signaling

Journal: Cerebral Cortex (New York, NY)

doi: 10.1093/cercor/bhx023

KIAA0319 inhibits axon growth through Smad2 activation. ( A, B ) Quantification of the ratios of phosphorylated/total ERK (pERK/ERK), JNK (pJNK/JNK), AKT (pAKT(S473)/AKT and pAKT(T308)/AKT), STAT3 (pSTAT3/STAT3), Smad2 (pSmad2/Smad2), Smad1/5/8 (Smad1/5/8/AKT), and GSK3β (pGSK3βS9/GSK3) as determined by western blot of CAD cell lysates collected either 24 h ( A ), or 48 h ( B ) after transfection with full-length WT human KIAA0319 (hKA); controls were CAD cells transfected with empty plasmid. ( C, D ) Representative anti-pSmad2 and anti-total Smad2 western blots 24 h ( C ) and 48 h ( D ) post-transfection of CAD cells with full-length WT human KIAA0319 (hKA). ( E–G ) Quantification of pSmad2 and Smad2 48 h post-transfection of CAD cells with either hKA or KIAA0319 mutants lacking the PKD domains (hKAd5-15) ( E ), the whole extracellular domain (hKAd3-18) ( F ), or a KIAA0319 mutant lacking the cytosolic domain (hKAd20-21) ( G ). ( F–H ) Representative western blots of E ( F ) and G ( H ). ( I ) Western blots of pSmad2 and total Smad2 in hippocampal neurons treated either with TGF-βRI inhibitor SM16 (SM16) or with vehicle DMSO (control). ( J ) Quantification of axon length in I ; DMSO (control: n = 83; hKA: n = 64 neurons) or SM16 (control: n = 30; hKA: n = 44 neurons). ( K ) Representative images of βIII-tubulin immunofluorescence of GFP-positive hippocampal neurons transfected with either hKA or empty vector (control) and grown in the presence of SM16 or DMSO. Scale bar, 50 μm. ( L ) Western blot analysis of Smad2 levels in CAD cells transfected with shRNAs against Smad2 (shSmad2#1 and shSmad2#2) or a control plasmid (shControl). ( M ) Quantification of L . ( N ) Quantification of neurite length in CAD cells transfected with a control shRNA or specific shRNAs against Smad2 (shSmad2#1 and shSmad2#2) and overexpressing either KIAA0319 (hKA) or an empty vector (control); shControl (control: n = 143; hKA: n = 186 cells), shSmad2#1 (control: n = 155; hKA: n = 169 cells) and shSmad2#2 (control: n = 153; hKA: n = 104 cells). ( O ) Representative photomicrographs of βIII-tubulin immunofluorescence images of differentiated CAD cells transfected with either a control shRNA plasmid (shControl) and 2 shRNA against Smad2 (shSmad2#1 and shSmad2#2) and overexpressing either KIAA0319 (hKA) or an empty vector (control). Scale bar, 50 μm. Results are expressed in mean ± SEM. * P
Figure Legend Snippet: KIAA0319 inhibits axon growth through Smad2 activation. ( A, B ) Quantification of the ratios of phosphorylated/total ERK (pERK/ERK), JNK (pJNK/JNK), AKT (pAKT(S473)/AKT and pAKT(T308)/AKT), STAT3 (pSTAT3/STAT3), Smad2 (pSmad2/Smad2), Smad1/5/8 (Smad1/5/8/AKT), and GSK3β (pGSK3βS9/GSK3) as determined by western blot of CAD cell lysates collected either 24 h ( A ), or 48 h ( B ) after transfection with full-length WT human KIAA0319 (hKA); controls were CAD cells transfected with empty plasmid. ( C, D ) Representative anti-pSmad2 and anti-total Smad2 western blots 24 h ( C ) and 48 h ( D ) post-transfection of CAD cells with full-length WT human KIAA0319 (hKA). ( E–G ) Quantification of pSmad2 and Smad2 48 h post-transfection of CAD cells with either hKA or KIAA0319 mutants lacking the PKD domains (hKAd5-15) ( E ), the whole extracellular domain (hKAd3-18) ( F ), or a KIAA0319 mutant lacking the cytosolic domain (hKAd20-21) ( G ). ( F–H ) Representative western blots of E ( F ) and G ( H ). ( I ) Western blots of pSmad2 and total Smad2 in hippocampal neurons treated either with TGF-βRI inhibitor SM16 (SM16) or with vehicle DMSO (control). ( J ) Quantification of axon length in I ; DMSO (control: n = 83; hKA: n = 64 neurons) or SM16 (control: n = 30; hKA: n = 44 neurons). ( K ) Representative images of βIII-tubulin immunofluorescence of GFP-positive hippocampal neurons transfected with either hKA or empty vector (control) and grown in the presence of SM16 or DMSO. Scale bar, 50 μm. ( L ) Western blot analysis of Smad2 levels in CAD cells transfected with shRNAs against Smad2 (shSmad2#1 and shSmad2#2) or a control plasmid (shControl). ( M ) Quantification of L . ( N ) Quantification of neurite length in CAD cells transfected with a control shRNA or specific shRNAs against Smad2 (shSmad2#1 and shSmad2#2) and overexpressing either KIAA0319 (hKA) or an empty vector (control); shControl (control: n = 143; hKA: n = 186 cells), shSmad2#1 (control: n = 155; hKA: n = 169 cells) and shSmad2#2 (control: n = 153; hKA: n = 104 cells). ( O ) Representative photomicrographs of βIII-tubulin immunofluorescence images of differentiated CAD cells transfected with either a control shRNA plasmid (shControl) and 2 shRNA against Smad2 (shSmad2#1 and shSmad2#2) and overexpressing either KIAA0319 (hKA) or an empty vector (control). Scale bar, 50 μm. Results are expressed in mean ± SEM. * P

Techniques Used: Activation Assay, Western Blot, Transfection, Plasmid Preparation, Mutagenesis, Immunofluorescence, shRNA

JAK2 and SH2B1β are necessary for KIAA0319-induced activation of Smad2 and inhibition of axon growth. ( A ) Western blot analysis of SH2B1β levels in CAD cells transfected with different shRNA against SH2B1 (shSH2B1#1, upper panel; and shSH2B1#2, lower panel) or a control plasmid (shControl) following puromycin selection. ( B ) Quantification of A . ( C ) Western blot analysis of pSmad2 and total Smad2 levels in CAD cells depleted of SH2B1 (shSH2B1#1, upper panel and shSH2B1#2, lower panel) or transfected with a control shRNA plasmid (shControl) overexpressing either KIAA0319 (hKA) or an empty vector (control). ( D ) Quantification of C . ( E ) Western blot analysis of pSmad2 and Smad2 levels in JAK2-deficient cells (gamma-2-A; γ2A) and in the control parental cell line (2C4) upon overexpression of KIAA0319 (hKA) or an empty vector (control). ( F ) Quantification of E . ( G ) Western blot analysis of JAK2 levels in CAD cells transfected with different shRNA against JAK2 (shJAK2#1, upper panel; shJAK2#2 and shJAK2#3, lower panel) or a control shRNA, following puromycin selection. ( H ) Quantification of G . ( I ) Representative photomicrographs of anti-βIII-tubulin immunofluorescence in differentiated GFP-positive CAD cells (highlighted with an arrowhed) stably transfected with either a control shRNA plasmid (shControl), a shRNA against SH2B1 (shSH2B1#1), or a shRNA against JAK2 (shJAK2#1) and overexpressing either KIAA0319 (hKA) or an empty vector (control). Scale bar, 50 μm. ( J ) Quantification of total neurite length of I ; shControl (control: n = 162; hKA: n = 152 cells), shSH2B1#1 (control: n = 112; hKA: n = 72 cells), shSH2B1#2 (control: n = 201; hKA: n = 149 cells), shJAK2#1 (control: n = 126; hKA: n = 89 cells), shJAK2#2 (control: n = 136; hKA: n = 167 cells) and shJAK2#3 (control: n = 80; hKA: n = 87 cells). ( K ) Quantification of axon length of hippocampal neurons transfected with both hKA and different shRNAs- shControl (control: n = 188; hKA: n = 67 cells), a shRNA against SH2B1 (shSH2B1#1; control: n = 78; hKA: n = 56 cells) or a shRNA against JAK2 (shJAK2#1; control: n = 32; hKA: n = 81 cells). Results are expressed in mean ± SEM. ** P
Figure Legend Snippet: JAK2 and SH2B1β are necessary for KIAA0319-induced activation of Smad2 and inhibition of axon growth. ( A ) Western blot analysis of SH2B1β levels in CAD cells transfected with different shRNA against SH2B1 (shSH2B1#1, upper panel; and shSH2B1#2, lower panel) or a control plasmid (shControl) following puromycin selection. ( B ) Quantification of A . ( C ) Western blot analysis of pSmad2 and total Smad2 levels in CAD cells depleted of SH2B1 (shSH2B1#1, upper panel and shSH2B1#2, lower panel) or transfected with a control shRNA plasmid (shControl) overexpressing either KIAA0319 (hKA) or an empty vector (control). ( D ) Quantification of C . ( E ) Western blot analysis of pSmad2 and Smad2 levels in JAK2-deficient cells (gamma-2-A; γ2A) and in the control parental cell line (2C4) upon overexpression of KIAA0319 (hKA) or an empty vector (control). ( F ) Quantification of E . ( G ) Western blot analysis of JAK2 levels in CAD cells transfected with different shRNA against JAK2 (shJAK2#1, upper panel; shJAK2#2 and shJAK2#3, lower panel) or a control shRNA, following puromycin selection. ( H ) Quantification of G . ( I ) Representative photomicrographs of anti-βIII-tubulin immunofluorescence in differentiated GFP-positive CAD cells (highlighted with an arrowhed) stably transfected with either a control shRNA plasmid (shControl), a shRNA against SH2B1 (shSH2B1#1), or a shRNA against JAK2 (shJAK2#1) and overexpressing either KIAA0319 (hKA) or an empty vector (control). Scale bar, 50 μm. ( J ) Quantification of total neurite length of I ; shControl (control: n = 162; hKA: n = 152 cells), shSH2B1#1 (control: n = 112; hKA: n = 72 cells), shSH2B1#2 (control: n = 201; hKA: n = 149 cells), shJAK2#1 (control: n = 126; hKA: n = 89 cells), shJAK2#2 (control: n = 136; hKA: n = 167 cells) and shJAK2#3 (control: n = 80; hKA: n = 87 cells). ( K ) Quantification of axon length of hippocampal neurons transfected with both hKA and different shRNAs- shControl (control: n = 188; hKA: n = 67 cells), a shRNA against SH2B1 (shSH2B1#1; control: n = 78; hKA: n = 56 cells) or a shRNA against JAK2 (shJAK2#1; control: n = 32; hKA: n = 81 cells). Results are expressed in mean ± SEM. ** P

Techniques Used: Activation Assay, Inhibition, Western Blot, Transfection, shRNA, Plasmid Preparation, Selection, Over Expression, Immunofluorescence, Stable Transfection

5) Product Images from "Cellular Depletion of BRD8 Causes p53-Dependent Apoptosis and Induces a DNA Damage Response in Non-Stressed Cells"

Article Title: Cellular Depletion of BRD8 Causes p53-Dependent Apoptosis and Induces a DNA Damage Response in Non-Stressed Cells

Journal: Scientific Reports

doi: 10.1038/s41598-018-32323-3

BRD8 knockdown causes spontaneous DNA damage and decreases chromatin- bound H4K16 acetylation. ( a ) Detection of DNA damage foci in BRD8 knockdown cells. HCT116 p53+/+ cells were transfected with BRD8-targeting (siBRD8-35) or control (Ctrl) siRNAs. Cells were fixed and γH2A.X foci (red) and BRD8 (green) localization were monitored by immunostaining. Nuclei were counterstained with DAPI. Scale bar is 20 μm. ( b ) The histogram represents the percentage of cells with more than 10 γH2A.X foci. Total cell extracts were subjected to immunoblot assays using the indicated antibodies 48 h following knockdown with BRD8-targeting (siBRD8-35 and siBRD8-36) or control (Ctrl) siRNAs in HCT116 p53+/+ cells ( c ) and with BRD8-targeting (shBRD8) or control (Ctrl) shRNAs in HCT116 p53−/− cells ( d ). ( e ) Total histone extracts of HCT116 p53+/+ were subjected to immunoblot assays using indicated antibodies 48 h post transfection with BRD8-targeting (siBRD8-35 and siBRD8-36) or control (Ctrl) siRNAs. ( f ) Densitometric analysis of Western blot with average intensity values from three independent experiments. Intensities were calculated using Image Lab and normalized to the intensities of total histone H4. The mean ± SD from three independent experiments are shown. An ANOVA test followed up with a Dunnett analysis was used to compare each mean to its relative control. *P ≤ 0.05; compared to control.
Figure Legend Snippet: BRD8 knockdown causes spontaneous DNA damage and decreases chromatin- bound H4K16 acetylation. ( a ) Detection of DNA damage foci in BRD8 knockdown cells. HCT116 p53+/+ cells were transfected with BRD8-targeting (siBRD8-35) or control (Ctrl) siRNAs. Cells were fixed and γH2A.X foci (red) and BRD8 (green) localization were monitored by immunostaining. Nuclei were counterstained with DAPI. Scale bar is 20 μm. ( b ) The histogram represents the percentage of cells with more than 10 γH2A.X foci. Total cell extracts were subjected to immunoblot assays using the indicated antibodies 48 h following knockdown with BRD8-targeting (siBRD8-35 and siBRD8-36) or control (Ctrl) siRNAs in HCT116 p53+/+ cells ( c ) and with BRD8-targeting (shBRD8) or control (Ctrl) shRNAs in HCT116 p53−/− cells ( d ). ( e ) Total histone extracts of HCT116 p53+/+ were subjected to immunoblot assays using indicated antibodies 48 h post transfection with BRD8-targeting (siBRD8-35 and siBRD8-36) or control (Ctrl) siRNAs. ( f ) Densitometric analysis of Western blot with average intensity values from three independent experiments. Intensities were calculated using Image Lab and normalized to the intensities of total histone H4. The mean ± SD from three independent experiments are shown. An ANOVA test followed up with a Dunnett analysis was used to compare each mean to its relative control. *P ≤ 0.05; compared to control.

Techniques Used: Transfection, Immunostaining, Western Blot

6) Product Images from "MERTK mediated novel site Akt phosphorylation alleviates SAV1 suppression"

Article Title: MERTK mediated novel site Akt phosphorylation alleviates SAV1 suppression

Journal: Nature Communications

doi: 10.1038/s41467-019-09233-7

MERTK phosphorylates and activates Akt by releasing SAV1 binding. a IB analysis of WCL and GST-pulldown products derived from HEK293 cells transfected with CMV-GST-SAV1 and HA-Akt1 constructs and treated with indicated kinase inhibitors for 12 h before cell collection. Doses for inhibitors used as following: cabozantinib (c-Met and VEGFR2 inhibitor, 100 nM), dasatinib (Src inhibitor, 100 nM), pazopanib (VEGFR inhibitor, 100 nM), UNC2025 (MERTK inhibitor, 300 nM), UNC4241 (MERTK inhibitor, 300 nM), BKM120 (PI3Kα inhibitor, 100 nM), IPI549 (PI3Kγ inhibitor, 100 nM), and Torin 2 (mTOR inhibitor, 100 nM). b IB analysis of WCL derived from RCC4 cells deleted of endogenous MERTK using indicated sgRNAs by CRISPR-Cas9. c IB analysis of WCL derived from UMRC6 cells depleted of endogenous MERTK using indicated shRNAs. d Deletion of MERTK in RCC4 cells leads to reduced colony formation ability. e , f IB analysis of WCL derived from RCC4 ( e ) or UMRC6 ( f ) cells treated with indicated MERTK inhibitors with indicated doses for 2 h. g In vitro kinase assays to demonstrate that MERTK directly phosphorylates the Akt1-Y26 in vitro. h – j IB analysis of WCL derived from RCC4 cells treated with 80 μM phosphatidylserine (PtdSer) ( h ) or 10 μM pervanadate (PV) ( i , j ) for 30 min in the absence or presence of 300 nM MERTK inhibitor UNC2025 ( h , i ) or MERTK deletion by CRISPR ( j ). k , l IB analysis of WCL derived from RCC4 cells serum starved overnight and then treated with indicated stimulation and inhibitors. EGF (100 ng/ml, 10 min), insulin (100 nM, 30 min), PV (60 μM, 30 min), BKM120 (200 nM, 10 h), IPI549 (100 nM, 10 h), UNC2025 (300 nM, 2 h). m IB analysis of WCL and PI(3,4,5)P 3 beads pulldown products derived from RCC4 cells transfected with indicated DNA constructs. n IB analysis of WCL derived from DLD1-Akt1/2 −/− cells transfected with indicated HA-Akt1 constructs. o A cartoon illustration indicating that MERTK-mediated Akt1-Y26 phosphorylation releases SAV1 binding and promotes Akt activation
Figure Legend Snippet: MERTK phosphorylates and activates Akt by releasing SAV1 binding. a IB analysis of WCL and GST-pulldown products derived from HEK293 cells transfected with CMV-GST-SAV1 and HA-Akt1 constructs and treated with indicated kinase inhibitors for 12 h before cell collection. Doses for inhibitors used as following: cabozantinib (c-Met and VEGFR2 inhibitor, 100 nM), dasatinib (Src inhibitor, 100 nM), pazopanib (VEGFR inhibitor, 100 nM), UNC2025 (MERTK inhibitor, 300 nM), UNC4241 (MERTK inhibitor, 300 nM), BKM120 (PI3Kα inhibitor, 100 nM), IPI549 (PI3Kγ inhibitor, 100 nM), and Torin 2 (mTOR inhibitor, 100 nM). b IB analysis of WCL derived from RCC4 cells deleted of endogenous MERTK using indicated sgRNAs by CRISPR-Cas9. c IB analysis of WCL derived from UMRC6 cells depleted of endogenous MERTK using indicated shRNAs. d Deletion of MERTK in RCC4 cells leads to reduced colony formation ability. e , f IB analysis of WCL derived from RCC4 ( e ) or UMRC6 ( f ) cells treated with indicated MERTK inhibitors with indicated doses for 2 h. g In vitro kinase assays to demonstrate that MERTK directly phosphorylates the Akt1-Y26 in vitro. h – j IB analysis of WCL derived from RCC4 cells treated with 80 μM phosphatidylserine (PtdSer) ( h ) or 10 μM pervanadate (PV) ( i , j ) for 30 min in the absence or presence of 300 nM MERTK inhibitor UNC2025 ( h , i ) or MERTK deletion by CRISPR ( j ). k , l IB analysis of WCL derived from RCC4 cells serum starved overnight and then treated with indicated stimulation and inhibitors. EGF (100 ng/ml, 10 min), insulin (100 nM, 30 min), PV (60 μM, 30 min), BKM120 (200 nM, 10 h), IPI549 (100 nM, 10 h), UNC2025 (300 nM, 2 h). m IB analysis of WCL and PI(3,4,5)P 3 beads pulldown products derived from RCC4 cells transfected with indicated DNA constructs. n IB analysis of WCL derived from DLD1-Akt1/2 −/− cells transfected with indicated HA-Akt1 constructs. o A cartoon illustration indicating that MERTK-mediated Akt1-Y26 phosphorylation releases SAV1 binding and promotes Akt activation

Techniques Used: Binding Assay, Derivative Assay, Transfection, Construct, CRISPR, In Vitro, Activation Assay

7) Product Images from "Biochemical and Epigenetic Insights into L-2-Hydroxyglutarate, a Potential Therapeutic Target in Renal Cancer"

Article Title: Biochemical and Epigenetic Insights into L-2-Hydroxyglutarate, a Potential Therapeutic Target in Renal Cancer

Journal: Clinical cancer research : an official journal of the American Association for Cancer Research

doi: 10.1158/1078-0432.CCR-18-1727

The L2HGDH/L-2-HG axis regulates migratory phenotypes. (A) HK-2 cells were transduced with control shRNA or three shRNAs targeting L2HGDH (sh3, sh4 and sh5) and puromycin resistant cells were selected to generate pooled stable cell lines. Validation of L2HGDH knockdown by immunoblotting (black arrow). (B and C) Wound healing of shL2HGDH stable cell lines seen using time-lapse phase contrast photography. Migration distance (%) calculated at 28 hr post-wound healing. Data are representative of two independent experiments (n=3/group). (D) Representative bright field images captured 26 hr post-wound creation in HK-2 cells treated with L-2-HG octyl ester. Data are representative of two independent experiments. (E) LC-MS analysis of L-2-HG and D-2-HG levels in control vector, WT L2HGDH, A241G expressing A498 cells. (F) Representative bright field images of A498 cells at day 0 and day 2 post-wound creation. (G) Relative wound healing of A498, OSRC-2, 769-P, A704 stably expressing control, L2HGDH and A241G vectors at 48, 36, 24 and 120 hrs post-wound creation, respectively. Data shown are the means ± SEM of two independent experiments (n=3/group). (H) Quantification of RCC cell migration (A498, OSRC-2, and A704) expressing control, L2HGDH and A241G. Data shown are the means ± SEM of two independent experiments (n=3/group). (I) Representative images of cell migration of A498 cells stably expressing control, L2HGDH and A241G vectors after 16 hrs incubation. (* indicates p
Figure Legend Snippet: The L2HGDH/L-2-HG axis regulates migratory phenotypes. (A) HK-2 cells were transduced with control shRNA or three shRNAs targeting L2HGDH (sh3, sh4 and sh5) and puromycin resistant cells were selected to generate pooled stable cell lines. Validation of L2HGDH knockdown by immunoblotting (black arrow). (B and C) Wound healing of shL2HGDH stable cell lines seen using time-lapse phase contrast photography. Migration distance (%) calculated at 28 hr post-wound healing. Data are representative of two independent experiments (n=3/group). (D) Representative bright field images captured 26 hr post-wound creation in HK-2 cells treated with L-2-HG octyl ester. Data are representative of two independent experiments. (E) LC-MS analysis of L-2-HG and D-2-HG levels in control vector, WT L2HGDH, A241G expressing A498 cells. (F) Representative bright field images of A498 cells at day 0 and day 2 post-wound creation. (G) Relative wound healing of A498, OSRC-2, 769-P, A704 stably expressing control, L2HGDH and A241G vectors at 48, 36, 24 and 120 hrs post-wound creation, respectively. Data shown are the means ± SEM of two independent experiments (n=3/group). (H) Quantification of RCC cell migration (A498, OSRC-2, and A704) expressing control, L2HGDH and A241G. Data shown are the means ± SEM of two independent experiments (n=3/group). (I) Representative images of cell migration of A498 cells stably expressing control, L2HGDH and A241G vectors after 16 hrs incubation. (* indicates p

Techniques Used: Transduction, shRNA, Stable Transfection, Migration, Liquid Chromatography with Mass Spectroscopy, Plasmid Preparation, Expressing, Incubation

8) Product Images from "Clinical, prognostic, and therapeutic significance of heat shock protein 27 in bladder cancer"

Article Title: Clinical, prognostic, and therapeutic significance of heat shock protein 27 in bladder cancer

Journal: Oncotarget

doi: 10.18632/oncotarget.24091

shRNA-mediated knockdown of HSP27 in BC cells BC cells were transfected with HSP27 shRNAs by lentivirus infection. shRNA-transfected J82 ( A ), 253J ( B ), and TCCSUP cells ( C ) were isolated by 3 weeks of puromycin selection, and HSP27 expression in each cell line was analyzed by western blot. GAPDH was used as a housekeeping protein control. ct: non-transfected control; sc: scramble shRNA; shRNA: shRNA against HSP27.
Figure Legend Snippet: shRNA-mediated knockdown of HSP27 in BC cells BC cells were transfected with HSP27 shRNAs by lentivirus infection. shRNA-transfected J82 ( A ), 253J ( B ), and TCCSUP cells ( C ) were isolated by 3 weeks of puromycin selection, and HSP27 expression in each cell line was analyzed by western blot. GAPDH was used as a housekeeping protein control. ct: non-transfected control; sc: scramble shRNA; shRNA: shRNA against HSP27.

Techniques Used: shRNA, Transfection, Infection, Isolation, Selection, Expressing, Western Blot

9) Product Images from "Cellular Depletion of BRD8 Causes p53-Dependent Apoptosis and Induces a DNA Damage Response in Non-Stressed Cells"

Article Title: Cellular Depletion of BRD8 Causes p53-Dependent Apoptosis and Induces a DNA Damage Response in Non-Stressed Cells

Journal: Scientific Reports

doi: 10.1038/s41598-018-32323-3

BRD8 knockdown causes spontaneous DNA damage and decreases chromatin- bound H4K16 acetylation. ( a ) Detection of DNA damage foci in BRD8 knockdown cells. HCT116 p53+/+ cells were transfected with BRD8-targeting (siBRD8-35) or control (Ctrl) siRNAs. Cells were fixed and γH2A.X foci (red) and BRD8 (green) localization were monitored by immunostaining. Nuclei were counterstained with DAPI. Scale bar is 20 μm. ( b ) The histogram represents the percentage of cells with more than 10 γH2A.X foci. Total cell extracts were subjected to immunoblot assays using the indicated antibodies 48 h following knockdown with BRD8-targeting (siBRD8-35 and siBRD8-36) or control (Ctrl) siRNAs in HCT116 p53+/+ cells ( c ) and with BRD8-targeting (shBRD8) or control (Ctrl) shRNAs in HCT116 p53−/− cells ( d ). ( e ) Total histone extracts of HCT116 p53+/+ were subjected to immunoblot assays using indicated antibodies 48 h post transfection with BRD8-targeting (siBRD8-35 and siBRD8-36) or control (Ctrl) siRNAs. ( f ) Densitometric analysis of Western blot with average intensity values from three independent experiments. Intensities were calculated using Image Lab and normalized to the intensities of total histone H4. The mean ± SD from three independent experiments are shown. An ANOVA test followed up with a Dunnett analysis was used to compare each mean to its relative control. *P ≤ 0.05; compared to control.
Figure Legend Snippet: BRD8 knockdown causes spontaneous DNA damage and decreases chromatin- bound H4K16 acetylation. ( a ) Detection of DNA damage foci in BRD8 knockdown cells. HCT116 p53+/+ cells were transfected with BRD8-targeting (siBRD8-35) or control (Ctrl) siRNAs. Cells were fixed and γH2A.X foci (red) and BRD8 (green) localization were monitored by immunostaining. Nuclei were counterstained with DAPI. Scale bar is 20 μm. ( b ) The histogram represents the percentage of cells with more than 10 γH2A.X foci. Total cell extracts were subjected to immunoblot assays using the indicated antibodies 48 h following knockdown with BRD8-targeting (siBRD8-35 and siBRD8-36) or control (Ctrl) siRNAs in HCT116 p53+/+ cells ( c ) and with BRD8-targeting (shBRD8) or control (Ctrl) shRNAs in HCT116 p53−/− cells ( d ). ( e ) Total histone extracts of HCT116 p53+/+ were subjected to immunoblot assays using indicated antibodies 48 h post transfection with BRD8-targeting (siBRD8-35 and siBRD8-36) or control (Ctrl) siRNAs. ( f ) Densitometric analysis of Western blot with average intensity values from three independent experiments. Intensities were calculated using Image Lab and normalized to the intensities of total histone H4. The mean ± SD from three independent experiments are shown. An ANOVA test followed up with a Dunnett analysis was used to compare each mean to its relative control. *P ≤ 0.05; compared to control.

Techniques Used: Transfection, Immunostaining, Western Blot

10) Product Images from "TGF-β receptor I/II trafficking and signaling at primary cilia are inhibited by ceramide to attenuate cell migration and tumor metastasis"

Article Title: TGF-β receptor I/II trafficking and signaling at primary cilia are inhibited by ceramide to attenuate cell migration and tumor metastasis

Journal: Science signaling

doi: 10.1126/scisignal.aam7464

CerS4 knockdown mediates cell migration ( A ) Fibronectin-coated Boyden chamber assays measuring migration of A549 cells after being transfected with control (Scr) or CerS1- or CerS4-targeted siRNA. Scale bar, 100 μm. ( B ) Effect of siRNA-mediated CerS4 knockdown on A549 cell migration measured by the clearance of fluorescent micro-spheres on fibronectin-coated wells. The ability of cells to create phagokinetic nonfluorescent tracks was evaluated by fluorescence microscopy and quantified using National Institutes of Health Image software. ( C ) As described in (A), using two shRNAs against CerS4. Scale bar, 100 μm. ( D ) As in (B), using UM-SCC-22A cells transfected with CerS4-targeted or control shRNA. Data are means ± SD of n = 3 independent experiments. * P
Figure Legend Snippet: CerS4 knockdown mediates cell migration ( A ) Fibronectin-coated Boyden chamber assays measuring migration of A549 cells after being transfected with control (Scr) or CerS1- or CerS4-targeted siRNA. Scale bar, 100 μm. ( B ) Effect of siRNA-mediated CerS4 knockdown on A549 cell migration measured by the clearance of fluorescent micro-spheres on fibronectin-coated wells. The ability of cells to create phagokinetic nonfluorescent tracks was evaluated by fluorescence microscopy and quantified using National Institutes of Health Image software. ( C ) As described in (A), using two shRNAs against CerS4. Scale bar, 100 μm. ( D ) As in (B), using UM-SCC-22A cells transfected with CerS4-targeted or control shRNA. Data are means ± SD of n = 3 independent experiments. * P

Techniques Used: Migration, Transfection, Fluorescence, Microscopy, Software, shRNA

CerS4 knockdown induces cell migration through increased TβRI/II membrane trafficking and signaling ( A ) Cell surface abundance of TβRI/II measured by flow cytometry in A549 cells transfected with CerS4-shRNAs or Scr shRNAs using two different sets of anti-TβRI or anti-TβRII antibodies. ( B ) Effects of TβRI inhibition by SB431542 on migration of A549 cells transfected with CerS4-targeted compared to Scr shRNAs, as measured in fibronectin-coated Boyden chambers. ( C ) Boyden chamber assays using fibronectin-coated chambers assessing migration of 4T1 cells after expression of wild-type (WT) or D/N-mutant TβRI (confirmed with Western blot, below the graph) and CerS4-targeted or control siRNA in the presence of vehicle or TGF-β (5 ng/ml). OD, optical density. ( D ) Effects of shRNA-mediated knockdown of CerS4 on total and cell surface protein abundance of Smad7, TβRI, and TβRII measured by biotin-labeling followed by Western blotting. Actin and Na + /K + -ATPase were used as controls for total or cell surface, respectively. Graph shows the amount of each protein at the cell surface (quantified relative to total protein in the whole lysate) in CerS4-shRNA–transfected cells (gray bars) relative to that in control, Scr shRNA–transfected cells (black bars). ( E ) Western blotting for Smad7 in whole-cell lysates from 4T1 cells cotransfected with a control (vector) or FLAG-tagged Smad7 expression vector and Scr- or CerS4-targeting shRNA. ( F ) Effects of WT-Smad7 on migration in Boyden chambers in A549 cells expressing Scr shRNA or CerS4-shRNAs were measured. ( G to I ) Luciferase reporter assay (G) and Western blotting (H and I) to assess the effects of CerS4 knockdown by shRNA in 4T1 cells on Smad-dependent promoter activation (G) and the phosphorylation of Smad3 (H) and Smad2 (I). Cells were cultured in the presence or absence of exogenous TGF-β exposure (5 ng/ml), as indicated. Data are means ± SD ( n = 3 independent experiments). Blots are representative of n ≥ 3. * P
Figure Legend Snippet: CerS4 knockdown induces cell migration through increased TβRI/II membrane trafficking and signaling ( A ) Cell surface abundance of TβRI/II measured by flow cytometry in A549 cells transfected with CerS4-shRNAs or Scr shRNAs using two different sets of anti-TβRI or anti-TβRII antibodies. ( B ) Effects of TβRI inhibition by SB431542 on migration of A549 cells transfected with CerS4-targeted compared to Scr shRNAs, as measured in fibronectin-coated Boyden chambers. ( C ) Boyden chamber assays using fibronectin-coated chambers assessing migration of 4T1 cells after expression of wild-type (WT) or D/N-mutant TβRI (confirmed with Western blot, below the graph) and CerS4-targeted or control siRNA in the presence of vehicle or TGF-β (5 ng/ml). OD, optical density. ( D ) Effects of shRNA-mediated knockdown of CerS4 on total and cell surface protein abundance of Smad7, TβRI, and TβRII measured by biotin-labeling followed by Western blotting. Actin and Na + /K + -ATPase were used as controls for total or cell surface, respectively. Graph shows the amount of each protein at the cell surface (quantified relative to total protein in the whole lysate) in CerS4-shRNA–transfected cells (gray bars) relative to that in control, Scr shRNA–transfected cells (black bars). ( E ) Western blotting for Smad7 in whole-cell lysates from 4T1 cells cotransfected with a control (vector) or FLAG-tagged Smad7 expression vector and Scr- or CerS4-targeting shRNA. ( F ) Effects of WT-Smad7 on migration in Boyden chambers in A549 cells expressing Scr shRNA or CerS4-shRNAs were measured. ( G to I ) Luciferase reporter assay (G) and Western blotting (H and I) to assess the effects of CerS4 knockdown by shRNA in 4T1 cells on Smad-dependent promoter activation (G) and the phosphorylation of Smad3 (H) and Smad2 (I). Cells were cultured in the presence or absence of exogenous TGF-β exposure (5 ng/ml), as indicated. Data are means ± SD ( n = 3 independent experiments). Blots are representative of n ≥ 3. * P

Techniques Used: Migration, Flow Cytometry, Cytometry, Transfection, Inhibition, Expressing, Mutagenesis, Western Blot, shRNA, Labeling, Plasmid Preparation, Luciferase, Reporter Assay, Activation Assay, Cell Culture

Association of TβRI with inhibitory Smad7 regulates receptor signaling ( A ) Colocalization (white) of ceramide (Cer) (green), Smad7 (red), and TβRI (cyan) was detected by immunofluorescence in 4T1 cells stably expressing Scr shRNA or CerS4-shRNAs. Images represent three independent studies, which are quantified using ImageJ, and * P
Figure Legend Snippet: Association of TβRI with inhibitory Smad7 regulates receptor signaling ( A ) Colocalization (white) of ceramide (Cer) (green), Smad7 (red), and TβRI (cyan) was detected by immunofluorescence in 4T1 cells stably expressing Scr shRNA or CerS4-shRNAs. Images represent three independent studies, which are quantified using ImageJ, and * P

Techniques Used: Immunofluorescence, Stable Transfection, Expressing, shRNA

11) Product Images from "Protein phosphatase 2A Aα regulates Aβ protein expression and stability"

Article Title: Protein phosphatase 2A Aα regulates Aβ protein expression and stability

Journal: The Journal of Biological Chemistry

doi: 10.1074/jbc.RA119.007593

Knockdown of specific Aβ holoenzymes restores colony formation ability and tumor growth in Aα KO cells. A , representative immunoblot of lysate from co-immunoprecipitation of endogenous Aβ from SW620 control or Aα KO.1 cells. B , quantification of binding of PP2A subunits, normalized to Aβ. n = 3; error bars , mean ± S.D. C , representative immunoblot of SW620 control or Aα KO.1 stable cell lines expressing shRNAs directed at select B subunits. n = 3. D, quantification of PP2A B subunit levels in C , normalized to vinculin and graphed relative to shControl. n = 3, error bars , mean ± S.D. (two-way ANOVA with Dunnett's multiple comparisons test, compared with shControl; p values: ***
Figure Legend Snippet: Knockdown of specific Aβ holoenzymes restores colony formation ability and tumor growth in Aα KO cells. A , representative immunoblot of lysate from co-immunoprecipitation of endogenous Aβ from SW620 control or Aα KO.1 cells. B , quantification of binding of PP2A subunits, normalized to Aβ. n = 3; error bars , mean ± S.D. C , representative immunoblot of SW620 control or Aα KO.1 stable cell lines expressing shRNAs directed at select B subunits. n = 3. D, quantification of PP2A B subunit levels in C , normalized to vinculin and graphed relative to shControl. n = 3, error bars , mean ± S.D. (two-way ANOVA with Dunnett's multiple comparisons test, compared with shControl; p values: ***

Techniques Used: Immunoprecipitation, Binding Assay, Stable Transfection, Expressing

12) Product Images from "Nuclear Localization of Integrin Cytoplasmic Domain-associated Protein-1 (ICAP1) Influences β1 Integrin Activation and Recruits Krev/Interaction Trapped-1 (KRIT1) to the Nucleus *"

Article Title: Nuclear Localization of Integrin Cytoplasmic Domain-associated Protein-1 (ICAP1) Influences β1 Integrin Activation and Recruits Krev/Interaction Trapped-1 (KRIT1) to the Nucleus *

Journal: The Journal of Biological Chemistry

doi: 10.1074/jbc.M116.762393

Localization of exogenous KRIT1 in EAhy926 cells changes upon loss of ICAP1. A , representative fractionation of endogenous ICAP1 in EAhy926 cells. C , 28% of the cytoplasmic fraction; N , 80% of the nuclear fraction. Carbonyl reductase ( CBR1 ) and histone deacetylase ( HDAC1 ) represent quality controls for cytoplasmic and nuclear fractions, respectively. Results are representative of three independent experiments. B , immunoblot of EAhy926 lysates that overexpress either GFP or GFP-tagged KRIT1 constructs and have been infected with either an shSCR or shRNAs targeting ICAP1 (shICAP1-21, shICAP1-23). Vinculin ( VCL ) was used as a loading control. C–E , EAhy926 cells infected with either shSCR or shICAP1 and overexpressing GFP or GFP-tagged KRIT1 constructs were plated on fibronectin, fixed 24 h later, and stained with DAPI to identify nuclei. Representative images are shown; bar , 10 μm. F , percentage of GFP intensity in the nucleus compared with the integrated GFP intensity of the entire cell. Boxes , 25th through 50th and 50th through 75th percentile; whiskers , 5th through 95th percentile ( n = 88–93 cells from 3 independent experiments). *, p ≤ 0.0001 as determined by a one-way ANOVA with Tukey's correction for multiple tests.
Figure Legend Snippet: Localization of exogenous KRIT1 in EAhy926 cells changes upon loss of ICAP1. A , representative fractionation of endogenous ICAP1 in EAhy926 cells. C , 28% of the cytoplasmic fraction; N , 80% of the nuclear fraction. Carbonyl reductase ( CBR1 ) and histone deacetylase ( HDAC1 ) represent quality controls for cytoplasmic and nuclear fractions, respectively. Results are representative of three independent experiments. B , immunoblot of EAhy926 lysates that overexpress either GFP or GFP-tagged KRIT1 constructs and have been infected with either an shSCR or shRNAs targeting ICAP1 (shICAP1-21, shICAP1-23). Vinculin ( VCL ) was used as a loading control. C–E , EAhy926 cells infected with either shSCR or shICAP1 and overexpressing GFP or GFP-tagged KRIT1 constructs were plated on fibronectin, fixed 24 h later, and stained with DAPI to identify nuclei. Representative images are shown; bar , 10 μm. F , percentage of GFP intensity in the nucleus compared with the integrated GFP intensity of the entire cell. Boxes , 25th through 50th and 50th through 75th percentile; whiskers , 5th through 95th percentile ( n = 88–93 cells from 3 independent experiments). *, p ≤ 0.0001 as determined by a one-way ANOVA with Tukey's correction for multiple tests.

Techniques Used: Fractionation, Histone Deacetylase Assay, Construct, Infection, Staining

13) Product Images from "Oxidative guanine base damage regulates human telomerase activity"

Article Title: Oxidative guanine base damage regulates human telomerase activity

Journal: Nature structural & molecular biology

doi: 10.1038/nsmb.3319

Cells with shortened telomeres are hypersensitive to oxidized nucleotides HeLa cell lines with very short telomeres (VST) or long telomeres (LT) were analyzed 3 days after transduction with lentivirus expressing a non-targeting shRNA (scr) or different shRNAs against MTH1 (sh4 and sh5). ( a ) Immunoblot with antibodies against MTH1 or actin. The percent MTH1 expression relative to the control was calculated. ( b ) Population doubling values are the mean ± s.d. from four independent experiments. * p
Figure Legend Snippet: Cells with shortened telomeres are hypersensitive to oxidized nucleotides HeLa cell lines with very short telomeres (VST) or long telomeres (LT) were analyzed 3 days after transduction with lentivirus expressing a non-targeting shRNA (scr) or different shRNAs against MTH1 (sh4 and sh5). ( a ) Immunoblot with antibodies against MTH1 or actin. The percent MTH1 expression relative to the control was calculated. ( b ) Population doubling values are the mean ± s.d. from four independent experiments. * p

Techniques Used: Transduction, Expressing, shRNA

Oxidized nucleotides induce telomere defects in cells with shortened telomeres. HeLa cell lines with very short telomeres (VST) or long telomeres (LT) were analyzed 3 days after tansduction with lentivirus expressing a non-targeting shRNA (scr) or different shRNAs against MTH1 (sh4 and sh5). ( a ) 53BP1 foci (red) were visualized by immunofluorescence and telomeric foci were detected by fluorescence in situ hybridization (green). Additional immunostaining of telomeric RAP1 protein was required in HeLa VST cells to amplify the telomere signal. 53BP1 foci at telomeres appear yellow (white arrow). ( b ) The number of 53BP1 foci per nuclei after binning. Bars represent the mean ± sd from 3 independent experiments (100 – 150 cells per condition). ** p
Figure Legend Snippet: Oxidized nucleotides induce telomere defects in cells with shortened telomeres. HeLa cell lines with very short telomeres (VST) or long telomeres (LT) were analyzed 3 days after tansduction with lentivirus expressing a non-targeting shRNA (scr) or different shRNAs against MTH1 (sh4 and sh5). ( a ) 53BP1 foci (red) were visualized by immunofluorescence and telomeric foci were detected by fluorescence in situ hybridization (green). Additional immunostaining of telomeric RAP1 protein was required in HeLa VST cells to amplify the telomere signal. 53BP1 foci at telomeres appear yellow (white arrow). ( b ) The number of 53BP1 foci per nuclei after binning. Bars represent the mean ± sd from 3 independent experiments (100 – 150 cells per condition). ** p

Techniques Used: Expressing, shRNA, Immunofluorescence, Fluorescence, In Situ Hybridization, Immunostaining

14) Product Images from "A TAZ-AXL-ABL2 feed-forward signaling axis promotes lung adenocarcinoma brain metastasis"

Article Title: A TAZ-AXL-ABL2 feed-forward signaling axis promotes lung adenocarcinoma brain metastasis

Journal: Cell reports

doi: 10.1016/j.celrep.2019.11.018

The AXL and ABL2 tyrosine kinases engage in bidirectional signaling in lung cancer cells. A) Immunoblots of PC9-BrM3 cells treated with 500 ng/mL recombinant human GAS6 for 1 h prior to immunoprecipitation (IP) with anti-ABL2 antibody (n=3). B) Immunoblots of AXL and p-AXL Y702 in PC9 cells treated with GNF-5 for 24 h. C) Immunoblots of PC9 cells transduced with shRNAs for scramble (SCR), ABL1, ABL2, and ABL1/ABL2 double knockdown (AA) (n=3). D) Schematic of AXL and ABL2 protein structural domains. E) Co-IP of indicated proteins in 293T cells co-transfected with FLAG-AXL WT or phospho-mutants and WT ABL2-GFP plasmids as indicated. Cells were serum-starved for 1 hr prior to addition of 500 ng/mL human GAS6 for 1 h. F) Immunoblots of 293T cells co-transfected with FLAG-AXL and ABL2-GFP wild-type (WT), R198K (SH2-dead) or K317M (kinase dead) mutants. Cells were serum-starved for 1 h prior to treatment with 500 ng/mL GAS6 for 1 h. G) Immunoblot of PC9 cells transduced with inducible active ABL2PP treated with dox for 24 h. H) Immunoblots of PC9-BrM3 cells treated ± 5 uM BGB324 for 24 h. I) Immunoblots of PC9-BrM3 cells transduced with shNTC or shAXL (n=3). WCL: whole cell lysate.
Figure Legend Snippet: The AXL and ABL2 tyrosine kinases engage in bidirectional signaling in lung cancer cells. A) Immunoblots of PC9-BrM3 cells treated with 500 ng/mL recombinant human GAS6 for 1 h prior to immunoprecipitation (IP) with anti-ABL2 antibody (n=3). B) Immunoblots of AXL and p-AXL Y702 in PC9 cells treated with GNF-5 for 24 h. C) Immunoblots of PC9 cells transduced with shRNAs for scramble (SCR), ABL1, ABL2, and ABL1/ABL2 double knockdown (AA) (n=3). D) Schematic of AXL and ABL2 protein structural domains. E) Co-IP of indicated proteins in 293T cells co-transfected with FLAG-AXL WT or phospho-mutants and WT ABL2-GFP plasmids as indicated. Cells were serum-starved for 1 hr prior to addition of 500 ng/mL human GAS6 for 1 h. F) Immunoblots of 293T cells co-transfected with FLAG-AXL and ABL2-GFP wild-type (WT), R198K (SH2-dead) or K317M (kinase dead) mutants. Cells were serum-starved for 1 h prior to treatment with 500 ng/mL GAS6 for 1 h. G) Immunoblot of PC9 cells transduced with inducible active ABL2PP treated with dox for 24 h. H) Immunoblots of PC9-BrM3 cells treated ± 5 uM BGB324 for 24 h. I) Immunoblots of PC9-BrM3 cells transduced with shNTC or shAXL (n=3). WCL: whole cell lysate.

Techniques Used: Western Blot, Recombinant, Immunoprecipitation, Transduction, Co-Immunoprecipitation Assay, Transfection

15) Product Images from "XBP1-KLF9 Axis Acts as a Molecular Rheostat to Control the Transition from Adaptive to Cytotoxic Unfolded Protein Response"

Article Title: XBP1-KLF9 Axis Acts as a Molecular Rheostat to Control the Transition from Adaptive to Cytotoxic Unfolded Protein Response

Journal: Cell reports

doi: 10.1016/j.celrep.2018.09.013

KLF9 Is Upregulated by ER Stress Independently from NRF2 (A and B) Cells were treated with indicated doses of (A) tunicamycin (Tun) or (B) thapsigargin (TG) for 24 hr and probed by qRT-PCR (upper panels, KLF9/β-actin signal ratios are shown) or immunoblotting (lower panels) with indicated antibodies. (C) Indicated cells were transduced with control (Cl) or NRF2 (Nsh1 or Nsh2) shRNAs followed by immunoblotting with the indicated antibodies.(D) Cells described in (C) were treated with indicated doses of Tun or TG for 24 hr and probed in qRT-PCR (KLF9/β-actin signal ratios are shown). Representative images shown. All data represent mean ± SEM of 2 or more biological replicates. Statistical significance was analyzed using two-tailed Student’s t test. A p
Figure Legend Snippet: KLF9 Is Upregulated by ER Stress Independently from NRF2 (A and B) Cells were treated with indicated doses of (A) tunicamycin (Tun) or (B) thapsigargin (TG) for 24 hr and probed by qRT-PCR (upper panels, KLF9/β-actin signal ratios are shown) or immunoblotting (lower panels) with indicated antibodies. (C) Indicated cells were transduced with control (Cl) or NRF2 (Nsh1 or Nsh2) shRNAs followed by immunoblotting with the indicated antibodies.(D) Cells described in (C) were treated with indicated doses of Tun or TG for 24 hr and probed in qRT-PCR (KLF9/β-actin signal ratios are shown). Representative images shown. All data represent mean ± SEM of 2 or more biological replicates. Statistical significance was analyzed using two-tailed Student’s t test. A p

Techniques Used: Quantitative RT-PCR, Transduction, Two Tailed Test

KLF9 Increases Intracellular Calcium Levels All experiments were performed in WI38 cells. (A) Cells expressing the indicated constructs were analyzed for ROS levels using FACS. (B) Cells described in (A) were probed in qRT-PCR with the indicated probes (shown are ratios of signal for an indicated gene and β-actin). (C) Cells transduced with V or KLF9 cDNA (KLF9) were probed in immunoblotting with indicated antibodies (left panel) or in qRT-PCR with the indicated probes (right panel; shown are ratios of signal for an indicated gene and β-actin). (D) DNA from cells overexpressing KLF9 cDNA was immunoprecipitated with control (IgG) or KLF9-specific (KLF9) antibodies. The precipitated material was probed in qPCR with primers for TMEM38B or ITPR1 promoters. (E) Cells transduced with control shRNA (Cl) or KLF9 shRNAs (sh1 and sh2) were probed in immunoblotting with indicated antibodies (left panel) or in qRT-PCR with the indicated probes (right panel; shown are ratios of signal for the indicated gene and β-actin). (F) Cells were treated with indicated doses of Tun for 24 hr followed by qRT-PCR with the indicated probes (shown are ratios of signals for an indicated gene and β-actin). (G) Cells expressing empty vector, KLF9 cDNA, TXNRD2 cDNA, or co-expressing these constructs (as in A) were probed for intracellular calcium content using Fluo-4 Direct Calcium Assay Kit. (H) Control and KLF9-depleted cells (described in E) were treated with indicated doses of Tun for 24 hr followed by qRT-PCR with the indicated probes (shown are signal ratios for an indicated gene and β-actin). (I) Cells described in (H) were probed for intracellular calcium content using Fluo-4 Direct Calcium Assay kit. (J) Cells were transduced with the control shRNA (Cl) or ITPR1 shRNAs (ITsh1 and ITsh5) or TMEM38B shRNAs (TMsh1 and TMsh3) followed by immunoblotting with indicated antibodies. (K) Cells expressing indicated constructs were probed for intracellular calcium content using Fluo-4 Direct Calcium Assay Kit. (L) Cells expressing indicated constructs were probed in qRT-PCR with the indicated probes (shown are ratios of signal for an indicated gene and β-actin). (M) Cells described in (K) were treated with indicated doses of Tun for 48 hr and analyzed by trypan blue viability assay. Representative images shown. All data represent mean ± SEM of 2 or more biological replicates. Statistical significance was analyzed using two-tailed Student’s t test. A p
Figure Legend Snippet: KLF9 Increases Intracellular Calcium Levels All experiments were performed in WI38 cells. (A) Cells expressing the indicated constructs were analyzed for ROS levels using FACS. (B) Cells described in (A) were probed in qRT-PCR with the indicated probes (shown are ratios of signal for an indicated gene and β-actin). (C) Cells transduced with V or KLF9 cDNA (KLF9) were probed in immunoblotting with indicated antibodies (left panel) or in qRT-PCR with the indicated probes (right panel; shown are ratios of signal for an indicated gene and β-actin). (D) DNA from cells overexpressing KLF9 cDNA was immunoprecipitated with control (IgG) or KLF9-specific (KLF9) antibodies. The precipitated material was probed in qPCR with primers for TMEM38B or ITPR1 promoters. (E) Cells transduced with control shRNA (Cl) or KLF9 shRNAs (sh1 and sh2) were probed in immunoblotting with indicated antibodies (left panel) or in qRT-PCR with the indicated probes (right panel; shown are ratios of signal for the indicated gene and β-actin). (F) Cells were treated with indicated doses of Tun for 24 hr followed by qRT-PCR with the indicated probes (shown are ratios of signals for an indicated gene and β-actin). (G) Cells expressing empty vector, KLF9 cDNA, TXNRD2 cDNA, or co-expressing these constructs (as in A) were probed for intracellular calcium content using Fluo-4 Direct Calcium Assay Kit. (H) Control and KLF9-depleted cells (described in E) were treated with indicated doses of Tun for 24 hr followed by qRT-PCR with the indicated probes (shown are signal ratios for an indicated gene and β-actin). (I) Cells described in (H) were probed for intracellular calcium content using Fluo-4 Direct Calcium Assay kit. (J) Cells were transduced with the control shRNA (Cl) or ITPR1 shRNAs (ITsh1 and ITsh5) or TMEM38B shRNAs (TMsh1 and TMsh3) followed by immunoblotting with indicated antibodies. (K) Cells expressing indicated constructs were probed for intracellular calcium content using Fluo-4 Direct Calcium Assay Kit. (L) Cells expressing indicated constructs were probed in qRT-PCR with the indicated probes (shown are ratios of signal for an indicated gene and β-actin). (M) Cells described in (K) were treated with indicated doses of Tun for 48 hr and analyzed by trypan blue viability assay. Representative images shown. All data represent mean ± SEM of 2 or more biological replicates. Statistical significance was analyzed using two-tailed Student’s t test. A p

Techniques Used: Expressing, Construct, FACS, Quantitative RT-PCR, Transduction, Immunoprecipitation, Real-time Polymerase Chain Reaction, shRNA, Plasmid Preparation, Calcium Assay, Viability Assay, Two Tailed Test

KLF9 Is Upregulated by Toxic Doses of Tunicamycin (A–D) Indicated cells treated with the indicated doses of Tun for 24 hr were probed in immunoblotting with the indicated antibodies (A and C) or in qRT-PCR (shown are ratios of signal for an indicated gene and β-actin; B and D). (E and F) Viability of cells treated as in (A) or (D) was assessed via trypan blue viability assay. (G) Cells transduced with control shRNA (Cl) or KLF9 shRNAs (sh1 and sh2) were probed in immunoblotting with indicated antibodies. Representative images are shown. (H and I) Cells described in (G) were treated with Tun for 48 hr and probed in trypan blue viability assay (H) or annexin V apoptosis assay (I). (J) Cells were treated with indicated doses of the drugs and analyzed for ROS levels using fluorescence-activated cell sorting (FACS). All data represent mean ± SEM of 2 or more biological replicates. Statistical significance was analyzed using two-tailed Student’s t test. A p
Figure Legend Snippet: KLF9 Is Upregulated by Toxic Doses of Tunicamycin (A–D) Indicated cells treated with the indicated doses of Tun for 24 hr were probed in immunoblotting with the indicated antibodies (A and C) or in qRT-PCR (shown are ratios of signal for an indicated gene and β-actin; B and D). (E and F) Viability of cells treated as in (A) or (D) was assessed via trypan blue viability assay. (G) Cells transduced with control shRNA (Cl) or KLF9 shRNAs (sh1 and sh2) were probed in immunoblotting with indicated antibodies. Representative images are shown. (H and I) Cells described in (G) were treated with Tun for 48 hr and probed in trypan blue viability assay (H) or annexin V apoptosis assay (I). (J) Cells were treated with indicated doses of the drugs and analyzed for ROS levels using fluorescence-activated cell sorting (FACS). All data represent mean ± SEM of 2 or more biological replicates. Statistical significance was analyzed using two-tailed Student’s t test. A p

Techniques Used: Quantitative RT-PCR, Viability Assay, Transduction, shRNA, Apoptosis Assay, Fluorescence, FACS, Two Tailed Test

XBP1s Transcriptionally Activates KLF9 (A) Lysates from cells transduced with the indicated shRNAs were probed in immunoblotting with the indicated antibodies (left panels) or treated with indicated doses of Tun followed by qRT-PCR (KLF9/β-actin signal ratios are shown). (B) Wild-type or Xbp1 knockout MEFs were probed in qRT-PCR (Klf9/β-actin signal ratios are shown).(C) Cells were transduced with empty vector (V) or XBP1s cDNA followed by immunoblotting with the indicated antibodies or probed in qRT-PCR (KLF9/β-actin signal ratios are shown).(D) DNA from indicated cells was immunoprecipitated with control (IgG) or XBP1s-specific (XBP1s) antibodies. The precipitated material was probed in qPCR with primers for KLF9 promoter.(E) HEK293FT cells were transfected with the pGL3-promoter-KLF9-WT or pGL3-promoter-KLF9 mutant promoter (lacking first 4 bp of XBP1s UPRE) and the pRLSV40 plasmid expressing the Renilla luciferase gene. Cells were co-transfected with empty vector or XBP1s cDNA. Luciferase activity was measured 24 hr post-treatment. Representative images shown. All data represent mean ± SEM of 2 or more biological replicates. Statistical significance was analyzed using two-tailed Student’s t test. A p
Figure Legend Snippet: XBP1s Transcriptionally Activates KLF9 (A) Lysates from cells transduced with the indicated shRNAs were probed in immunoblotting with the indicated antibodies (left panels) or treated with indicated doses of Tun followed by qRT-PCR (KLF9/β-actin signal ratios are shown). (B) Wild-type or Xbp1 knockout MEFs were probed in qRT-PCR (Klf9/β-actin signal ratios are shown).(C) Cells were transduced with empty vector (V) or XBP1s cDNA followed by immunoblotting with the indicated antibodies or probed in qRT-PCR (KLF9/β-actin signal ratios are shown).(D) DNA from indicated cells was immunoprecipitated with control (IgG) or XBP1s-specific (XBP1s) antibodies. The precipitated material was probed in qPCR with primers for KLF9 promoter.(E) HEK293FT cells were transfected with the pGL3-promoter-KLF9-WT or pGL3-promoter-KLF9 mutant promoter (lacking first 4 bp of XBP1s UPRE) and the pRLSV40 plasmid expressing the Renilla luciferase gene. Cells were co-transfected with empty vector or XBP1s cDNA. Luciferase activity was measured 24 hr post-treatment. Representative images shown. All data represent mean ± SEM of 2 or more biological replicates. Statistical significance was analyzed using two-tailed Student’s t test. A p

Techniques Used: Transduction, Quantitative RT-PCR, Knock-Out, Plasmid Preparation, Immunoprecipitation, Real-time Polymerase Chain Reaction, Transfection, Mutagenesis, Expressing, Luciferase, Activity Assay, Two Tailed Test

16) Product Images from "Multiplex shRNA Screening of Germ Cell Development by in Vivo Transfection of Mouse Testis"

Article Title: Multiplex shRNA Screening of Germ Cell Development by in Vivo Transfection of Mouse Testis

Journal: G3: Genes|Genomes|Genetics

doi: 10.1534/g3.116.036087

shRNA screening assays are highly reproducible and tissue-specific. We performed numerous biological replicates of the pilot library screening on testis ( n = 9) and the N2a neuronal cell line ( n = 15). (A) Comparison of two biological replicates within the testis. For each replicate, we summarize the frequency of all 119 shRNA constructs as the log2 ratio of testis frequency/input library frequency. Overall, the concordance of fold changes between these two replicates is high (Spearman R = 0.94). While 11% of negative control constructs show negative fold changes in both biological replicates, all of these correspond to genes expressed in testis. On the other hand, 35% of positive control constructs show negative fold changes. (B) Comparison of two biological replicates of the screen in N2a cells shows the screen is also highly reproducible in this cell population (Spearman R = 0.89). The variance in fold change among constructs is visibly smaller in the N2a experiments when compared to the testis; this is likely due to higher transfection efficiency in N2a cells. (C) As a broader summary of screen reproducibility, we calculated Spearman correlations between all pairs of biological replicates for testis (black line) and N2a cells (blue line), as well as all possible pairs of N2a and testis replicates (red). Biological replicates of the same source tissue were highly correlated (median Spearman R for N2a–N2a comparisons = 0.81, dashed blue line; testis–testis = 0.83, dashed black line). However, screen results from different sources showed substantially lower correlation (median Spearman R = 0.56, dashed red line). This anticorrelation was largely driven by “negative control” shRNAs showing depletion in N2a cells, as well as neutral behavior of positive controls in N2a cells. shRNA, short hairpin RNA.
Figure Legend Snippet: shRNA screening assays are highly reproducible and tissue-specific. We performed numerous biological replicates of the pilot library screening on testis ( n = 9) and the N2a neuronal cell line ( n = 15). (A) Comparison of two biological replicates within the testis. For each replicate, we summarize the frequency of all 119 shRNA constructs as the log2 ratio of testis frequency/input library frequency. Overall, the concordance of fold changes between these two replicates is high (Spearman R = 0.94). While 11% of negative control constructs show negative fold changes in both biological replicates, all of these correspond to genes expressed in testis. On the other hand, 35% of positive control constructs show negative fold changes. (B) Comparison of two biological replicates of the screen in N2a cells shows the screen is also highly reproducible in this cell population (Spearman R = 0.89). The variance in fold change among constructs is visibly smaller in the N2a experiments when compared to the testis; this is likely due to higher transfection efficiency in N2a cells. (C) As a broader summary of screen reproducibility, we calculated Spearman correlations between all pairs of biological replicates for testis (black line) and N2a cells (blue line), as well as all possible pairs of N2a and testis replicates (red). Biological replicates of the same source tissue were highly correlated (median Spearman R for N2a–N2a comparisons = 0.81, dashed blue line; testis–testis = 0.83, dashed black line). However, screen results from different sources showed substantially lower correlation (median Spearman R = 0.56, dashed red line). This anticorrelation was largely driven by “negative control” shRNAs showing depletion in N2a cells, as well as neutral behavior of positive controls in N2a cells. shRNA, short hairpin RNA.

Techniques Used: shRNA, Library Screening, Construct, Negative Control, Positive Control, Transfection

Influence of experimental design parameters on the power of the screen. We reanalyzed all of the sequencing data generated from our pilot screen to characterize the relationship between the number of biological replicates performed, the number of constructs screened, and the power to detect significant depletion of shRNAs against a typical positive control gene. (A) As the number of biological replicates increases, the minimum detectable shRNA fold change ( i.e. , effect size) decreases. The three lines indicate the median minimum log 2 fold change that was declared as significant at a threshold of P ≤ 0.1 (yellow), P ≤ 0.05 (red), and P ≤ 0.01 (blue). The shaded area around each line defines a 1 SD confidence interval. Note that the blue line starts at three biological replicates because there were no significant observations with two or fewer replicates. (B) Power to detect a positive control gene as significantly depleted increases with increasing average read coverage of each shRNA construct. The average coverage and power of the full pilot experiment is indicated with a red dot. shRNA, short hairpin RNA.
Figure Legend Snippet: Influence of experimental design parameters on the power of the screen. We reanalyzed all of the sequencing data generated from our pilot screen to characterize the relationship between the number of biological replicates performed, the number of constructs screened, and the power to detect significant depletion of shRNAs against a typical positive control gene. (A) As the number of biological replicates increases, the minimum detectable shRNA fold change ( i.e. , effect size) decreases. The three lines indicate the median minimum log 2 fold change that was declared as significant at a threshold of P ≤ 0.1 (yellow), P ≤ 0.05 (red), and P ≤ 0.01 (blue). The shaded area around each line defines a 1 SD confidence interval. Note that the blue line starts at three biological replicates because there were no significant observations with two or fewer replicates. (B) Power to detect a positive control gene as significantly depleted increases with increasing average read coverage of each shRNA construct. The average coverage and power of the full pilot experiment is indicated with a red dot. shRNA, short hairpin RNA.

Techniques Used: Sequencing, Generated, Construct, Positive Control, shRNA

17) Product Images from "Interleukin-6 upregulates SOX18 expression in osteosarcoma"

Article Title: Interleukin-6 upregulates SOX18 expression in osteosarcoma

Journal: OncoTargets and therapy

doi: 10.2147/OTT.S149905

IL-6 promoted osteosarcoma cell growth via SOX18. Notes: ( A ) U-2OS and MG63 cells were transduced with SOX18 shRNA (RNAi) or control shRNA (NC). At 48 h after transduction, expression of SOX18 protein (upper panel) and GAPDH (lower panel) was analyzed. ( B ) U-2OS and ( C ) MG63 cells seeded in 96-well plates were transduced with shRNAs and treated with or without 50 ng/mL IL-6. After incubating for 0, 24, 48 and 72 h, CCK-8 assay was performed to determine cell proliferation. * P
Figure Legend Snippet: IL-6 promoted osteosarcoma cell growth via SOX18. Notes: ( A ) U-2OS and MG63 cells were transduced with SOX18 shRNA (RNAi) or control shRNA (NC). At 48 h after transduction, expression of SOX18 protein (upper panel) and GAPDH (lower panel) was analyzed. ( B ) U-2OS and ( C ) MG63 cells seeded in 96-well plates were transduced with shRNAs and treated with or without 50 ng/mL IL-6. After incubating for 0, 24, 48 and 72 h, CCK-8 assay was performed to determine cell proliferation. * P

Techniques Used: Transduction, shRNA, Expressing, CCK-8 Assay

18) Product Images from "Induction of DISE in ovarian cancer cells in vivo"

Article Title: Induction of DISE in ovarian cancer cells in vivo

Journal: Oncotarget

doi: 10.18632/oncotarget.21471

Expression of a CD95L derived shRNA causes induction of DISE in vitro and in vivo A. Percent growth change over time of HeyA8 Venus-siL3-pFUL2T cells infected with either shScr or shL3 pLKO lentiviruses (MOI = 5) (with and without puromycin selection) at 250 cells/well. B. Small animal imaging of HeyA8 pFUL2T cells infected with either shScr or shL3 pLKO lentiviruses (MOI = 5) after i.p. injection into NSG mice (10 mice per group, 10 6 cells/mouse). Left: mice injected with cells infected with virus without puromycin selection; Center: Mice injected with HeyA8 cells infected with shRNAs and selected with puromycin for 24 hours. Right: Bioluminescence image of 5 mice 17 days after i.p. injection with HeyA8 cells infected with either shScr or shL3 virus. Two-way ANOVA was performed for pairwise comparisons of total flux over time between shScr and shL3 expressing cells. C. H E staining of representative tumors isolated from mice carrying HeyA8-shScr (a,b,c, top row) and HeyA8-shL3 tumors (a,b,c, bottom row and d). a, in shScr treated tumors, tumor mass showed two zones of viable (right) and necrotic (left) tumor regions with sharply demarcated boundary. The viable tumor cells were cohesive with dense basophilic and pale cytoplasm. In shL3 treated tumor, a zone of dying tumor cells were seen in between viable and necrotic zones. This zone had tumor cells that were loosely cohesive with mixed dying, dead and viable cells. b, Close view of tumor cells revealed the different cytologic features. In shScr treated tumors, cells were more cohesive with a solid growth pattern with centrally located large and high grade nuclei. In shL3 treated tumors, cells were loosely cohesive with eccentrically located nuclei and eosinophilic and hyaline cytoplasm. These findings suggest early degenerative or regressing changes. c, Tumor infiltrating into fat had minimal or no tumor cell necrosis. In shScr treated tumors, tumor mass in fat had large and high tumor volume (top panel). In shL3, infiltrating tumor cells were much smaller in size and volume and areas of regression change were seen (bottom panel). d, Tumor regression could be frequently seen in shL3 treated tumors, characterized by well demarked tumor nodules (left three images) with peripheral rim of viable tumor cells (right panel) and central regression of tumor bed which was replaced by histiocytes, lymphocytes and fibrotic stromal cells.
Figure Legend Snippet: Expression of a CD95L derived shRNA causes induction of DISE in vitro and in vivo A. Percent growth change over time of HeyA8 Venus-siL3-pFUL2T cells infected with either shScr or shL3 pLKO lentiviruses (MOI = 5) (with and without puromycin selection) at 250 cells/well. B. Small animal imaging of HeyA8 pFUL2T cells infected with either shScr or shL3 pLKO lentiviruses (MOI = 5) after i.p. injection into NSG mice (10 mice per group, 10 6 cells/mouse). Left: mice injected with cells infected with virus without puromycin selection; Center: Mice injected with HeyA8 cells infected with shRNAs and selected with puromycin for 24 hours. Right: Bioluminescence image of 5 mice 17 days after i.p. injection with HeyA8 cells infected with either shScr or shL3 virus. Two-way ANOVA was performed for pairwise comparisons of total flux over time between shScr and shL3 expressing cells. C. H E staining of representative tumors isolated from mice carrying HeyA8-shScr (a,b,c, top row) and HeyA8-shL3 tumors (a,b,c, bottom row and d). a, in shScr treated tumors, tumor mass showed two zones of viable (right) and necrotic (left) tumor regions with sharply demarcated boundary. The viable tumor cells were cohesive with dense basophilic and pale cytoplasm. In shL3 treated tumor, a zone of dying tumor cells were seen in between viable and necrotic zones. This zone had tumor cells that were loosely cohesive with mixed dying, dead and viable cells. b, Close view of tumor cells revealed the different cytologic features. In shScr treated tumors, cells were more cohesive with a solid growth pattern with centrally located large and high grade nuclei. In shL3 treated tumors, cells were loosely cohesive with eccentrically located nuclei and eosinophilic and hyaline cytoplasm. These findings suggest early degenerative or regressing changes. c, Tumor infiltrating into fat had minimal or no tumor cell necrosis. In shScr treated tumors, tumor mass in fat had large and high tumor volume (top panel). In shL3, infiltrating tumor cells were much smaller in size and volume and areas of regression change were seen (bottom panel). d, Tumor regression could be frequently seen in shL3 treated tumors, characterized by well demarked tumor nodules (left three images) with peripheral rim of viable tumor cells (right panel) and central regression of tumor bed which was replaced by histiocytes, lymphocytes and fibrotic stromal cells.

Techniques Used: Expressing, Derivative Assay, shRNA, In Vitro, In Vivo, Infection, Selection, Imaging, Injection, Mouse Assay, Staining, Isolation

19) Product Images from "EIF2A-dependent translational arrest protects leukemia cells from the energetic stress induced by NAMPT inhibition"

Article Title: EIF2A-dependent translational arrest protects leukemia cells from the energetic stress induced by NAMPT inhibition

Journal: BMC Cancer

doi: 10.1186/s12885-015-1845-1

Protective role of EIF2A and FK866 induced UPR. a Expression level of LKB1 mRNA, evaluated in Jurkat cells after 120 h of lentiviral transduction with shRNAs expressing the control sequence (scramble) or two LKB1-silencing shRNAs (shLKB1- a and – b ), in the upper panel. Cells were transduced for 72 h and then treated with FK866 for 48 h. Viability was measured by MTT assay in comparison with Mock (DMSO) condition, in the lower panel. Mean and SD of a biological triplicate (*, p -value
Figure Legend Snippet: Protective role of EIF2A and FK866 induced UPR. a Expression level of LKB1 mRNA, evaluated in Jurkat cells after 120 h of lentiviral transduction with shRNAs expressing the control sequence (scramble) or two LKB1-silencing shRNAs (shLKB1- a and – b ), in the upper panel. Cells were transduced for 72 h and then treated with FK866 for 48 h. Viability was measured by MTT assay in comparison with Mock (DMSO) condition, in the lower panel. Mean and SD of a biological triplicate (*, p -value

Techniques Used: Expressing, Transduction, Sequencing, MTT Assay

20) Product Images from "Loss of Ccbe1 affects cardiac-specification and cardiomyocyte differentiation in mouse embryonic stem cells"

Article Title: Loss of Ccbe1 affects cardiac-specification and cardiomyocyte differentiation in mouse embryonic stem cells

Journal: PLoS ONE

doi: 10.1371/journal.pone.0205108

Expression of Ccbe1 during differentiation of Ccbe1 knockdown mouse ESC lines. Transgenic mouse ESC lines expressing control scrambled and Ccbe1-targeting shRNAs (Clone 1 and 2) were generated using commercially available shRNA control and two Ccbe1-targeted shRNA lentiviral plasmids. Selected clones of the transgenic Ccbe1KD ESC lines and the control mouse ESC line were allowed to differentiate. Samples were collected from undifferentiated cells (D0) and at days 2 (D2), 4 (D4), 6 (D6), 8 (D8) and 10 (D10) of differentiating clones. Expression is presented as fold change relative to the control of each day. Data presented as the mean + SEM of three biological replicates in technical qPCR triplicates.
Figure Legend Snippet: Expression of Ccbe1 during differentiation of Ccbe1 knockdown mouse ESC lines. Transgenic mouse ESC lines expressing control scrambled and Ccbe1-targeting shRNAs (Clone 1 and 2) were generated using commercially available shRNA control and two Ccbe1-targeted shRNA lentiviral plasmids. Selected clones of the transgenic Ccbe1KD ESC lines and the control mouse ESC line were allowed to differentiate. Samples were collected from undifferentiated cells (D0) and at days 2 (D2), 4 (D4), 6 (D6), 8 (D8) and 10 (D10) of differentiating clones. Expression is presented as fold change relative to the control of each day. Data presented as the mean + SEM of three biological replicates in technical qPCR triplicates.

Techniques Used: Expressing, Transgenic Assay, Generated, shRNA, Clone Assay, Real-time Polymerase Chain Reaction

21) Product Images from "The redox regulator sulfiredoxin forms a complex with thioredoxin domain–containing 5 protein in response to ER stress in lung cancer cells"

Article Title: The redox regulator sulfiredoxin forms a complex with thioredoxin domain–containing 5 protein in response to ER stress in lung cancer cells

Journal: The Journal of Biological Chemistry

doi: 10.1074/jbc.RA118.005804

Knockdown of TXNDC5 in lung cancer cells leads to more localization of Srx in the cytosol. A , two shRNAs targeting different coding regions of TXNDC5 were used to establish stable knockdown in A549 cells. Knockdown of TXNDC5 does not affect the endogenous expression of Srx or TXNDC7, a close member of TXNDC5 in the PDI family. B , subcellular fractionation of A549 control ( ShNT ) or TXNDC5 knockdown cells for the distribution of Srx in ER and cytosol. Results from three independent replicates were shown. The bar graph with a dot plot on the right indicates the quantitative results (*, p
Figure Legend Snippet: Knockdown of TXNDC5 in lung cancer cells leads to more localization of Srx in the cytosol. A , two shRNAs targeting different coding regions of TXNDC5 were used to establish stable knockdown in A549 cells. Knockdown of TXNDC5 does not affect the endogenous expression of Srx or TXNDC7, a close member of TXNDC5 in the PDI family. B , subcellular fractionation of A549 control ( ShNT ) or TXNDC5 knockdown cells for the distribution of Srx in ER and cytosol. Results from three independent replicates were shown. The bar graph with a dot plot on the right indicates the quantitative results (*, p

Techniques Used: Expressing, Fractionation

22) Product Images from "Single Cell Transcriptomics Reconstructs Fate Conversion from Fibroblast to Cardiomyocyte"

Article Title: Single Cell Transcriptomics Reconstructs Fate Conversion from Fibroblast to Cardiomyocyte

Journal: Nature

doi: 10.1038/nature24454

Inhibition of cell proliferation or cell cycle synchronization promotes iCM reprogramming Related to Fig. 1i-p . ( a ) Comparison of the ratio of CCA: CCI cells in the three treatment groups: uninfected, DsRed-infected, and M+G+T-infected. Chi-square test suggests that proliferation states were not significantly different among the treatment groups at day 3. ( b, c ) Knockdown (KD) efficiency of shRNAs ( b ) or overexpression (OE) levels ( c ) of cell cycle-related genes were determined by qRT-PCR on day 4 lentiviral transduced cells. shNT, non-targeting control shRNA. Average ± SD was shown. n = 3 samples. ( d-i ) Cell cycle staging of CF cells simultaneously transduced with reprogramming factors and shRNA ( e, g ) or OE ( f, h ) constructs by PI staining. ( e-f ) Flow cytometry histogram of PI staining intensity. ( g-i) Percentages of cells in G0/G1, S, or G2/M phases were calculated based on (e) and (f). ( i ) Summary of (g) and (h). ( j-m ) Measurement of DNA synthesis in CF cells simultaneously transduced with reprogramming factors and shRNA ( k ) or OE ( l ) constructs by EdU incorporation assay followed by flow cytometry. dMFI: delta median EdU fluorescence intensity between EdU+ cells and EdU− cells. ( m ) Summary of (k) and (l). Constructs that dramatically decreased or increased cell proliferation were labeled in red in (g-i) and (k-m) and were used for experiments in (n-s). ( n-s ) The impact of manipulation of cell proliferation through KD/OE of cell cycle-related genes on iCM reprogramming. Reprogramming factors were introduced by lentiviral vectors instead of retroviral vectors to avoid retroviral infection bias of proliferating cells. CF were simultaneously transduced with lentiviral M/G/T ( n-p ) or inducible MGT (iMGT, q-s ) and lentiviral KD/OE constructs that dramatically decreased ( o, r ) or increased ( p, s ) cell proliferation. Percentages of αMHC-GFP+ and cTnT+ cells were quantified by flow cytometry. ( t-z ) The impact of large T transduction on iCM reprogramming. CFs were simultaneously transduced with reprogramming factors and lentiviral large T. After 10 days, αActinin+/cTnT+ cells were immunostained, imaged, and quantified by counting randomly selected 20× fields from multiple repeated experiments ( u-x ). Both percentages of positive cells per field ( v, x ) and numbers of + cells per field ( w ) were quantified. Percentages of cells showing sarcomere structure in αActinin+ cells were also quantified ( y-z ). The percentage of αActinin+ cells that show sarcomere structures decreased from 50% to 0% upon large T transduction and accelerated proliferation. ( u, y ) Representative images under 40× with hoechst nuclear staining. Scale bar = 100 μm. ( o-z ) Average ± SEM was shown. ( o-s ) n = 4 samples. ( v, w, z ) n = 20 images. ( x ) n = 10 images. ( b, c, w-z ) Two-sided student’s t test. ( o-s ) One-way ANOVA followed by Bonferroni correction (two-sided). Significance: * p
Figure Legend Snippet: Inhibition of cell proliferation or cell cycle synchronization promotes iCM reprogramming Related to Fig. 1i-p . ( a ) Comparison of the ratio of CCA: CCI cells in the three treatment groups: uninfected, DsRed-infected, and M+G+T-infected. Chi-square test suggests that proliferation states were not significantly different among the treatment groups at day 3. ( b, c ) Knockdown (KD) efficiency of shRNAs ( b ) or overexpression (OE) levels ( c ) of cell cycle-related genes were determined by qRT-PCR on day 4 lentiviral transduced cells. shNT, non-targeting control shRNA. Average ± SD was shown. n = 3 samples. ( d-i ) Cell cycle staging of CF cells simultaneously transduced with reprogramming factors and shRNA ( e, g ) or OE ( f, h ) constructs by PI staining. ( e-f ) Flow cytometry histogram of PI staining intensity. ( g-i) Percentages of cells in G0/G1, S, or G2/M phases were calculated based on (e) and (f). ( i ) Summary of (g) and (h). ( j-m ) Measurement of DNA synthesis in CF cells simultaneously transduced with reprogramming factors and shRNA ( k ) or OE ( l ) constructs by EdU incorporation assay followed by flow cytometry. dMFI: delta median EdU fluorescence intensity between EdU+ cells and EdU− cells. ( m ) Summary of (k) and (l). Constructs that dramatically decreased or increased cell proliferation were labeled in red in (g-i) and (k-m) and were used for experiments in (n-s). ( n-s ) The impact of manipulation of cell proliferation through KD/OE of cell cycle-related genes on iCM reprogramming. Reprogramming factors were introduced by lentiviral vectors instead of retroviral vectors to avoid retroviral infection bias of proliferating cells. CF were simultaneously transduced with lentiviral M/G/T ( n-p ) or inducible MGT (iMGT, q-s ) and lentiviral KD/OE constructs that dramatically decreased ( o, r ) or increased ( p, s ) cell proliferation. Percentages of αMHC-GFP+ and cTnT+ cells were quantified by flow cytometry. ( t-z ) The impact of large T transduction on iCM reprogramming. CFs were simultaneously transduced with reprogramming factors and lentiviral large T. After 10 days, αActinin+/cTnT+ cells were immunostained, imaged, and quantified by counting randomly selected 20× fields from multiple repeated experiments ( u-x ). Both percentages of positive cells per field ( v, x ) and numbers of + cells per field ( w ) were quantified. Percentages of cells showing sarcomere structure in αActinin+ cells were also quantified ( y-z ). The percentage of αActinin+ cells that show sarcomere structures decreased from 50% to 0% upon large T transduction and accelerated proliferation. ( u, y ) Representative images under 40× with hoechst nuclear staining. Scale bar = 100 μm. ( o-z ) Average ± SEM was shown. ( o-s ) n = 4 samples. ( v, w, z ) n = 20 images. ( x ) n = 10 images. ( b, c, w-z ) Two-sided student’s t test. ( o-s ) One-way ANOVA followed by Bonferroni correction (two-sided). Significance: * p

Techniques Used: Inhibition, Infection, Over Expression, Quantitative RT-PCR, shRNA, Transduction, Construct, Staining, Flow Cytometry, Cytometry, DNA Synthesis, Fluorescence, Labeling

23) Product Images from "Deubiquitinase HAUSP Stabilizes REST and Promotes Maintenance of Neural Progenitor Cells"

Article Title: Deubiquitinase HAUSP Stabilizes REST and Promotes Maintenance of Neural Progenitor Cells

Journal: Nature cell biology

doi: 10.1038/ncb2153

HAUSP knockdown reduces REST protein levels in NPCs. ( a, b ) Immunoblotting showed that HAUSP knockdown by two distinct shRNAs (B2 and B5) decreased protein levels of REST but not CoREST in ENStemA ( a ) and 15167 ( b ) NPCs. NPCs were infected with lentiviruses expressing shHAUSP or non-targeting (NT) control shRNA for 48 hours, whole cell lysates were harvested for immunoblotting with the specific antibodies as indicated. ( c, d ) Immunofluorescent staining confirmed that HAUSP knockdown reduced REST levels in ENStemA ( c ) and 17231 ( d ) NPCs. Cells were cultured and attached on cover glasses coated with BD Matrigel hESC-qualified matrix, infected with lentiviruses expressing shHAUSP or control NT shRNA, treated without ( c ) or with ( d ) puromycin to select for infected cells, fixed and immunostained with anti-HAUSP and anti-REST specific antibodies. HAUSP was labeled in green, and REST was labeled in red. Nuclei were counterstained with DAPI (blue). Nuclei with reduced HAUSP and REST proteins are indicated by arrows in c . All Puromycin-selected cells infected with lentiviruses expressing HAUSP-targeting shRNA showed reduced HAUSP and REST protein levels in d . Lentiviral infection efficiency in NPCs with GFP-expressing lentiviruses is shown in Supplementary Information, Fig. S7 . Uncropped images of blots are shown in Supplementary Information, Fig. S8 .
Figure Legend Snippet: HAUSP knockdown reduces REST protein levels in NPCs. ( a, b ) Immunoblotting showed that HAUSP knockdown by two distinct shRNAs (B2 and B5) decreased protein levels of REST but not CoREST in ENStemA ( a ) and 15167 ( b ) NPCs. NPCs were infected with lentiviruses expressing shHAUSP or non-targeting (NT) control shRNA for 48 hours, whole cell lysates were harvested for immunoblotting with the specific antibodies as indicated. ( c, d ) Immunofluorescent staining confirmed that HAUSP knockdown reduced REST levels in ENStemA ( c ) and 17231 ( d ) NPCs. Cells were cultured and attached on cover glasses coated with BD Matrigel hESC-qualified matrix, infected with lentiviruses expressing shHAUSP or control NT shRNA, treated without ( c ) or with ( d ) puromycin to select for infected cells, fixed and immunostained with anti-HAUSP and anti-REST specific antibodies. HAUSP was labeled in green, and REST was labeled in red. Nuclei were counterstained with DAPI (blue). Nuclei with reduced HAUSP and REST proteins are indicated by arrows in c . All Puromycin-selected cells infected with lentiviruses expressing HAUSP-targeting shRNA showed reduced HAUSP and REST protein levels in d . Lentiviral infection efficiency in NPCs with GFP-expressing lentiviruses is shown in Supplementary Information, Fig. S7 . Uncropped images of blots are shown in Supplementary Information, Fig. S8 .

Techniques Used: Infection, Expressing, shRNA, Staining, Cell Culture, Labeling

24) Product Images from "Loss of expression of the recycling receptor, FcRn, promotes tumor cell growth by increasing albumin consumption"

Article Title: Loss of expression of the recycling receptor, FcRn, promotes tumor cell growth by increasing albumin consumption

Journal: Oncotarget

doi: 10.18632/oncotarget.13869

The expression level of FcRn controls the growth of tumor xenografts A . Mice (n = 6-8 mice/group) were implanted with HCC1419 cells transduced with shRNAs targeting FcRn (sh-5, sh-6) or empty vector (EV) and tumor size monitored (upper panel). Statistically significant differences between the EV group and knockdown (sh-5, sh-6) groups from days 18-31 are indicated by * (two-way ANOVA with Tukey post-hoc comparison; p
Figure Legend Snippet: The expression level of FcRn controls the growth of tumor xenografts A . Mice (n = 6-8 mice/group) were implanted with HCC1419 cells transduced with shRNAs targeting FcRn (sh-5, sh-6) or empty vector (EV) and tumor size monitored (upper panel). Statistically significant differences between the EV group and knockdown (sh-5, sh-6) groups from days 18-31 are indicated by * (two-way ANOVA with Tukey post-hoc comparison; p

Techniques Used: Expressing, Mouse Assay, Transduction, Plasmid Preparation

The level of FcRn expression regulates the intracellular levels of albumin in tumor cells A . HCC1419 cells transduced with empty vector (EV), scrambled shRNA (scramble) or shRNAs targeting FcRn (sh-5, sh-6) were pulsed with 1 μg/ml Alexa 647-labeled FcRn-specific nanobody for 40 minutes at 37°C in medium (pH 6.0). Alexa 647 levels (MFI) were determined using flow cytometry and mean values for triplicate samples are shown. Control indicates autofluorescence levels of cells. The right hand panel shows immunoblotting of cell lysates using antibodies specific for FcRn α-chain and β-actin. B . DU145 cell lines transduced with empty vector (EV) and FcRn expression constructs (WT-FcRn or H166A-FcRn) were analyzed as in panel (A). C, D . HCC1419 cell lines (same as in panel A) were pulsed with 1.5 μM (100 μg/ml) MSA (C) or 1.5 μM (100 μg/ml) HSA (D) for 0 h or 2 hrs at 37°C at pH 7.4. Cell lysates were used in immunoblotting with antibodies specific for albumin (MSA/HSA), FcRn α-chain and β-actin. Albumin levels were quantitated and normalized relative to HCC1419 cells. E, F . DU145 cell lines (same as in panel B) were treated with MSA (E) or HSA (F) as in panels (C) and (D), and albumin levels quantitated and normalized relative to DU145 cells. G . DU145 cell lines were pulsed with 1.5 μM Alexa 647-labeled MSA for 2 hrs. Cells were chased for the indicated times. Alexa 647 levels (MFI) were determined using flow cytometry and mean values for triplicate samples are shown (left panel). The right hand panel shows the MFI values normalized to the no chase (0 time point) MFI value for each cell line. H . HCC1419 cell lines transduced with scrambled shRNA (scramble), sh-5 or sh-5 plus shRNA resistant FcRn (Res-FcRn) were treated and albumin levels relative to ‘scramble’ analyzed as in panel (C). For panels (C-F) and (H), mean normalized signal levels derived from three independent immunoblotting experiments are shown. For the immunoblots, cropped images are shown with molecular weights (kDa) on the right. For panels (A-H), error bars represent S.D. Significant differences are indicated by * (one-way ANOVA, p
Figure Legend Snippet: The level of FcRn expression regulates the intracellular levels of albumin in tumor cells A . HCC1419 cells transduced with empty vector (EV), scrambled shRNA (scramble) or shRNAs targeting FcRn (sh-5, sh-6) were pulsed with 1 μg/ml Alexa 647-labeled FcRn-specific nanobody for 40 minutes at 37°C in medium (pH 6.0). Alexa 647 levels (MFI) were determined using flow cytometry and mean values for triplicate samples are shown. Control indicates autofluorescence levels of cells. The right hand panel shows immunoblotting of cell lysates using antibodies specific for FcRn α-chain and β-actin. B . DU145 cell lines transduced with empty vector (EV) and FcRn expression constructs (WT-FcRn or H166A-FcRn) were analyzed as in panel (A). C, D . HCC1419 cell lines (same as in panel A) were pulsed with 1.5 μM (100 μg/ml) MSA (C) or 1.5 μM (100 μg/ml) HSA (D) for 0 h or 2 hrs at 37°C at pH 7.4. Cell lysates were used in immunoblotting with antibodies specific for albumin (MSA/HSA), FcRn α-chain and β-actin. Albumin levels were quantitated and normalized relative to HCC1419 cells. E, F . DU145 cell lines (same as in panel B) were treated with MSA (E) or HSA (F) as in panels (C) and (D), and albumin levels quantitated and normalized relative to DU145 cells. G . DU145 cell lines were pulsed with 1.5 μM Alexa 647-labeled MSA for 2 hrs. Cells were chased for the indicated times. Alexa 647 levels (MFI) were determined using flow cytometry and mean values for triplicate samples are shown (left panel). The right hand panel shows the MFI values normalized to the no chase (0 time point) MFI value for each cell line. H . HCC1419 cell lines transduced with scrambled shRNA (scramble), sh-5 or sh-5 plus shRNA resistant FcRn (Res-FcRn) were treated and albumin levels relative to ‘scramble’ analyzed as in panel (C). For panels (C-F) and (H), mean normalized signal levels derived from three independent immunoblotting experiments are shown. For the immunoblots, cropped images are shown with molecular weights (kDa) on the right. For panels (A-H), error bars represent S.D. Significant differences are indicated by * (one-way ANOVA, p

Techniques Used: Expressing, Transduction, Plasmid Preparation, shRNA, Labeling, Flow Cytometry, Cytometry, Construct, Derivative Assay, Western Blot

Pinocytic uptake and recycling rates of tumor cells are not affected by lentiviral transduction or the level of FcRn expression A . HCC1419 cell lines transduced with empty vector (EV), scrambled shRNA (scramble) or shRNAs (sh-5, sh-6) were pulsed for 0-60 minutes with 1.5 μM tetramethylrhodamine-labeled 70 kDa dextran, or pulsed for 5 minutes with 20 μg/ml Alexa 647-labeled transferrin followed by chase periods of 0-60 minutes. B . DU145 cell lines transduced with empty vector (EV) or FcRn expression constructs (WT-FcRn or H166A-FcRn) were treated with Alexa 647-labeled dextran or Alexa 647-labeled transferrin as in panel (A). Flow cytometry was used to determine cell-associated fluorescence. The MFI values represent means derived from triplicate samples. Error bars represent S.D. Data are representative of two independent experiments.
Figure Legend Snippet: Pinocytic uptake and recycling rates of tumor cells are not affected by lentiviral transduction or the level of FcRn expression A . HCC1419 cell lines transduced with empty vector (EV), scrambled shRNA (scramble) or shRNAs (sh-5, sh-6) were pulsed for 0-60 minutes with 1.5 μM tetramethylrhodamine-labeled 70 kDa dextran, or pulsed for 5 minutes with 20 μg/ml Alexa 647-labeled transferrin followed by chase periods of 0-60 minutes. B . DU145 cell lines transduced with empty vector (EV) or FcRn expression constructs (WT-FcRn or H166A-FcRn) were treated with Alexa 647-labeled dextran or Alexa 647-labeled transferrin as in panel (A). Flow cytometry was used to determine cell-associated fluorescence. The MFI values represent means derived from triplicate samples. Error bars represent S.D. Data are representative of two independent experiments.

Techniques Used: Transduction, Expressing, Plasmid Preparation, shRNA, Labeling, Construct, Flow Cytometry, Cytometry, Fluorescence, Derivative Assay

The expression level of FcRn regulates intracellular glutamate levels and cell proliferation A . HCC1419 cells transduced with empty vector (EV), scrambled shRNA (scramble) or shRNAs targeting FcRn (sh-5, sh-6) were cultured in base medium containing 100 μM glucose and 1.5 μM MSA or 2 mM glutamine for 24 hrs. Cells were lysed and glutamate levels determined. B . HCC1419 cell lines were cultured in the same medium as for panel A for 16 hours. BrdU levels in cells were determined following 4 hrs incubation with BrdU. C, D . DU145 cells transduced with empty vector (EV) or FcRn expression constructs (WT-FcRn or H166A-FcRn) were treated as in panels A and B to assess intracellular glutamate levels and proliferation, respectively. For panels A-D, mean values for triplicate samples are shown. Error bars represent S.D. Significant differences are indicated by * (one-way ANOVA, p
Figure Legend Snippet: The expression level of FcRn regulates intracellular glutamate levels and cell proliferation A . HCC1419 cells transduced with empty vector (EV), scrambled shRNA (scramble) or shRNAs targeting FcRn (sh-5, sh-6) were cultured in base medium containing 100 μM glucose and 1.5 μM MSA or 2 mM glutamine for 24 hrs. Cells were lysed and glutamate levels determined. B . HCC1419 cell lines were cultured in the same medium as for panel A for 16 hours. BrdU levels in cells were determined following 4 hrs incubation with BrdU. C, D . DU145 cells transduced with empty vector (EV) or FcRn expression constructs (WT-FcRn or H166A-FcRn) were treated as in panels A and B to assess intracellular glutamate levels and proliferation, respectively. For panels A-D, mean values for triplicate samples are shown. Error bars represent S.D. Significant differences are indicated by * (one-way ANOVA, p

Techniques Used: Expressing, Transduction, Plasmid Preparation, shRNA, Cell Culture, Incubation, Construct

25) Product Images from "Oncogenic PIK3CA mutations reprogram glutamine metabolism in colorectal cancer"

Article Title: Oncogenic PIK3CA mutations reprogram glutamine metabolism in colorectal cancer

Journal: Nature Communications

doi: 10.1038/ncomms11971

PIK3CA mutation upregulates GPT2 which renders CRC dependent on glutamine. ( a ) GPT2 mRNA levels are higher in PIK3CA mutant clones. RT–PCR analyses of the indicated genes in the HCT116 and DLD1 PIK3CA mutant and WT clones. ( b ) GPT2 protein levels are higher in cells with PIK3CA mutations. Cell lysates of WT and mutant clones were blotted with the indicated antibodies. SLC1A5: glutamine transporter. ( c , d ) GPT2 expression is upregulated in PIK3CA mutant CRC cell lines. qRT–PCR ( c ) and western blot of GPT2 protein in the indicated cell lines ( d ). ( e ) GPT2 mRNA levels are higher in PIK3CA mutant tumours. qRT–PCR analyses of GPT2 in tumours with no mutations in PIK3CA or in PTEN , PDK1 , AKT s and IRS ( n =10) versus tumours with PIK3CA mutations ( n =10). Data are plotted as whiskers (min to max). ( f – h ) GPT2 is needed for growth and for glutamine dependency in PIK3CA mutant cells. GPT2 was knocked down with two independent shRNAs in a HCT116 PIK3CA mutant clone (Mut 1). Stable pools were selected for further analysis. Western blot of GPT2 in control and GPT2 knockdown clones ( f ). Two thousand cells were seeded in 96-well plates and grown under normal culture conditions, and cell numbers were counted 5 consecutive days ( g ). Control and GPT2 knockdown clones were grown with or without glutamine for 72 h. Cell apoptosis was quantified ( h ). ( i – k ) GPT2 is sufficient for growth and for creating glutamine sensitivity in PIK3CA WT cells. A HCT116 PIK3CA WT clone (WT 1) was transfected with empty vector (control), or a FLAG-tagged WT GPT2 (GPT2) or a FLAG-tagged inactive GPT2 mutant (GPT2 K341H). Stable pools were selected for further analysis. Western blot analyses of transfected FLAG-GPT2 protein levels ( i ); cell proliferation under normal culture conditions ( j ); control and GPT2 overexpression (OE) cell pools were grown with or without glutamine for 72 h. Cell apoptosis was quantified ( k ). Data are presented as mean±s.e.m. of three independent cultures. * P
Figure Legend Snippet: PIK3CA mutation upregulates GPT2 which renders CRC dependent on glutamine. ( a ) GPT2 mRNA levels are higher in PIK3CA mutant clones. RT–PCR analyses of the indicated genes in the HCT116 and DLD1 PIK3CA mutant and WT clones. ( b ) GPT2 protein levels are higher in cells with PIK3CA mutations. Cell lysates of WT and mutant clones were blotted with the indicated antibodies. SLC1A5: glutamine transporter. ( c , d ) GPT2 expression is upregulated in PIK3CA mutant CRC cell lines. qRT–PCR ( c ) and western blot of GPT2 protein in the indicated cell lines ( d ). ( e ) GPT2 mRNA levels are higher in PIK3CA mutant tumours. qRT–PCR analyses of GPT2 in tumours with no mutations in PIK3CA or in PTEN , PDK1 , AKT s and IRS ( n =10) versus tumours with PIK3CA mutations ( n =10). Data are plotted as whiskers (min to max). ( f – h ) GPT2 is needed for growth and for glutamine dependency in PIK3CA mutant cells. GPT2 was knocked down with two independent shRNAs in a HCT116 PIK3CA mutant clone (Mut 1). Stable pools were selected for further analysis. Western blot of GPT2 in control and GPT2 knockdown clones ( f ). Two thousand cells were seeded in 96-well plates and grown under normal culture conditions, and cell numbers were counted 5 consecutive days ( g ). Control and GPT2 knockdown clones were grown with or without glutamine for 72 h. Cell apoptosis was quantified ( h ). ( i – k ) GPT2 is sufficient for growth and for creating glutamine sensitivity in PIK3CA WT cells. A HCT116 PIK3CA WT clone (WT 1) was transfected with empty vector (control), or a FLAG-tagged WT GPT2 (GPT2) or a FLAG-tagged inactive GPT2 mutant (GPT2 K341H). Stable pools were selected for further analysis. Western blot analyses of transfected FLAG-GPT2 protein levels ( i ); cell proliferation under normal culture conditions ( j ); control and GPT2 overexpression (OE) cell pools were grown with or without glutamine for 72 h. Cell apoptosis was quantified ( k ). Data are presented as mean±s.e.m. of three independent cultures. * P

Techniques Used: Mutagenesis, Clone Assay, Reverse Transcription Polymerase Chain Reaction, Expressing, Quantitative RT-PCR, Western Blot, Transfection, Plasmid Preparation, Over Expression

26) Product Images from "HGF-independent regulation of MET and GAB1 by nonreceptor tyrosine kinase FER potentiates metastasis in ovarian cancer"

Article Title: HGF-independent regulation of MET and GAB1 by nonreceptor tyrosine kinase FER potentiates metastasis in ovarian cancer

Journal: Genes & Development

doi: 10.1101/gad.284166.116

FER formed a complex with GAB1 via MET and phosphorylated GAB1 at Tyr627. 293T cells were transiently transfected with either wild-type FER or a kinase-dead FER-K592R mutant. ( A ) Tyrosine phosphorylation of GAB1 was examined by immunoprecipitation and blotting with anti-phosphotyrosine antibody 4G10. ( B ) The whole-cell lysates were immunoblotted as indicated to show the increased tyrosine phosphorylation of GAB1 and SHP2 and the impact on downstream signaling. ( C ) Tyrosine phosphorylation of GAB1 and SHP2 was compared in CAOV4 cells expressing either control or FER targeted shRNAs. ( D ) Cells were serum-starved and stimulated with hHGF for the indicated times, lysed, and immunoblotted with both pTyr627 and total GAB1 antibodies to demonstrate FER-regulated GAB1 phosphorylation. ( E ) Phosphorylation status of Tyr627 of GAB1 in Fer +/+ and Fer DR/DR MEF cells. ( F ) Control or GAB1 siRNAs were delivered into CAOV4 cells by electroporation. After 48 h, the expression levels of GAB1 and activation of PAK1 were measured by immunoblotting. ( G ) Endogenous FER was immunoprecipitated from CAOV4, CAOV3, and OVCAR5 ovarian cancer cells, and its association with GAB1 was examined by immunoblotting ( left ) and vice versa ( right ). ( H ) Endogenous GAB1 was immunoprecipitated from lysates of 293T cells transfected with FER and the MET mATP mutant alone or together. The association of FER and MET was assessed by immunoblotting.
Figure Legend Snippet: FER formed a complex with GAB1 via MET and phosphorylated GAB1 at Tyr627. 293T cells were transiently transfected with either wild-type FER or a kinase-dead FER-K592R mutant. ( A ) Tyrosine phosphorylation of GAB1 was examined by immunoprecipitation and blotting with anti-phosphotyrosine antibody 4G10. ( B ) The whole-cell lysates were immunoblotted as indicated to show the increased tyrosine phosphorylation of GAB1 and SHP2 and the impact on downstream signaling. ( C ) Tyrosine phosphorylation of GAB1 and SHP2 was compared in CAOV4 cells expressing either control or FER targeted shRNAs. ( D ) Cells were serum-starved and stimulated with hHGF for the indicated times, lysed, and immunoblotted with both pTyr627 and total GAB1 antibodies to demonstrate FER-regulated GAB1 phosphorylation. ( E ) Phosphorylation status of Tyr627 of GAB1 in Fer +/+ and Fer DR/DR MEF cells. ( F ) Control or GAB1 siRNAs were delivered into CAOV4 cells by electroporation. After 48 h, the expression levels of GAB1 and activation of PAK1 were measured by immunoblotting. ( G ) Endogenous FER was immunoprecipitated from CAOV4, CAOV3, and OVCAR5 ovarian cancer cells, and its association with GAB1 was examined by immunoblotting ( left ) and vice versa ( right ). ( H ) Endogenous GAB1 was immunoprecipitated from lysates of 293T cells transfected with FER and the MET mATP mutant alone or together. The association of FER and MET was assessed by immunoblotting.

Techniques Used: Transfection, Mutagenesis, Immunoprecipitation, Expressing, Electroporation, Activation Assay

27) Product Images from "The cohesin complex regulates immunoglobulin class switch recombination"

Article Title: The cohesin complex regulates immunoglobulin class switch recombination

Journal: The Journal of Experimental Medicine

doi: 10.1084/jem.20130166

Knockdown of cohesin affects NHEJ. (A) CH12 cells were transduced with a lentivirus expressing a GFP reporter and shRNAs specific for AID, Smc1, Smc3, Nipbl, Wapal, or a Non-Target control. 48 h after stimulation, GFP-expressing cells were sorted. Sμ-Sα switch junctions were amplified by PCR, cloned, and sequenced. Bar graphs show the percentage of switch junction sequences with indicated nucleotide overlap. Number of junctions analyzed (n), mean length of overlap (OL), and p-values relative to the Non-Target control (Mann-Whitney test) are indicated. White bars indicate the percentage of sequences with small (1–4 nucleotides) insertions. Overlap was determined by identifying the longest region of perfect uninterrupted donor/acceptor identity. Sequences with insertions were not included in the calculation of the mean length of overlap. Significant differences relative to the Non-Target control (χ2 test) are indicated: **, P ≤ 0.01; ***, P ≤ 0.0001. Data are from three independent experiments. (B) Cumulative percentage of sequences with a given length of microhomology (bp) and obtained from CH12 cells transduced with lentiviruses expressing shRNAs specific for Smc1 (red squares), Smc3 (green squares), Nipbl (blue squares), Wapal (gray squares), or a Non-Target negative control (black squares) and sorted for GFP expression. Data are from three independent experiments.
Figure Legend Snippet: Knockdown of cohesin affects NHEJ. (A) CH12 cells were transduced with a lentivirus expressing a GFP reporter and shRNAs specific for AID, Smc1, Smc3, Nipbl, Wapal, or a Non-Target control. 48 h after stimulation, GFP-expressing cells were sorted. Sμ-Sα switch junctions were amplified by PCR, cloned, and sequenced. Bar graphs show the percentage of switch junction sequences with indicated nucleotide overlap. Number of junctions analyzed (n), mean length of overlap (OL), and p-values relative to the Non-Target control (Mann-Whitney test) are indicated. White bars indicate the percentage of sequences with small (1–4 nucleotides) insertions. Overlap was determined by identifying the longest region of perfect uninterrupted donor/acceptor identity. Sequences with insertions were not included in the calculation of the mean length of overlap. Significant differences relative to the Non-Target control (χ2 test) are indicated: **, P ≤ 0.01; ***, P ≤ 0.0001. Data are from three independent experiments. (B) Cumulative percentage of sequences with a given length of microhomology (bp) and obtained from CH12 cells transduced with lentiviruses expressing shRNAs specific for Smc1 (red squares), Smc3 (green squares), Nipbl (blue squares), Wapal (gray squares), or a Non-Target negative control (black squares) and sorted for GFP expression. Data are from three independent experiments.

Techniques Used: Non-Homologous End Joining, Transduction, Expressing, Amplification, Polymerase Chain Reaction, Clone Assay, MANN-WHITNEY, Negative Control

CSR is impaired by the knockdown of cohesin subunits. (A) CH12 cells were transduced with a lentivirus expressing a GFP reporter and shRNAs specific for AID, Smc1, Smc3, Nipbl, Wapal, or a Non-Target control. Transduced cells were stimulated for 48 h and sorted for GFP expression. Protein extracts and cDNAs were prepared and knockdown was determined by Western blotting or qPCR. Western blot for β-actin, Smc1, Smc3, and Wapal and qRT-PCR for Nipbl transcripts are shown. Expression was normalized to Cd79b and is presented relative to the Non-Target control, set as 1. Mean of triplicate samples (+SD) is shown. Statistical significance versus the Non-Target control (two-tailed Student’s t test): P = 0.0023. Data are representative of three experiments. (B) CH12 cells treated as in A were analyzed for surface IgA and GFP expression by flow cytometry. Representative plots from four to eight independent experiments are shown. (C) CH12 cells treated as in A were gated on cells expressing GFP (GFP + ; white bars) or high levels of GFP (GFP High ; black bars). The percentage (+SD) of CSR relative to the Non-Target shRNA control from four to eight independent experiments is shown. CSR in cells expressing the Non-Target shRNA control was set to 100%. The difference in CSR efficiency relative to the Non-Target control (Δ) is indicated below. Statistical significance versus the Non-Target control (two-tailed Student’s t test) is indicated: ***, P ≤ 0.001. (D and E) cDNA was prepared from CH12 cells treated as in A and qRT-PCR for μ (D) and α (E) germline transcripts was performed. Expression was normalized to HPRT mRNA abundance and is presented relative to the Non-Target control, set as 1 (black line). Mean of triplicate samples (+SD) is shown. Statistical significance versus the Non-Target control (two-tailed Student’s t test) is indicated: *, P ≤ 0.05; **, P ≤ 0.01; ***, P ≤ 0.001. (F) Proteins extracts were prepared from CH12 cells treated as in A. Western blots for β-actin and AID are shown. Data are representative of three independent experiments. Theoretical molecular masses in kilodaltons are indicated.
Figure Legend Snippet: CSR is impaired by the knockdown of cohesin subunits. (A) CH12 cells were transduced with a lentivirus expressing a GFP reporter and shRNAs specific for AID, Smc1, Smc3, Nipbl, Wapal, or a Non-Target control. Transduced cells were stimulated for 48 h and sorted for GFP expression. Protein extracts and cDNAs were prepared and knockdown was determined by Western blotting or qPCR. Western blot for β-actin, Smc1, Smc3, and Wapal and qRT-PCR for Nipbl transcripts are shown. Expression was normalized to Cd79b and is presented relative to the Non-Target control, set as 1. Mean of triplicate samples (+SD) is shown. Statistical significance versus the Non-Target control (two-tailed Student’s t test): P = 0.0023. Data are representative of three experiments. (B) CH12 cells treated as in A were analyzed for surface IgA and GFP expression by flow cytometry. Representative plots from four to eight independent experiments are shown. (C) CH12 cells treated as in A were gated on cells expressing GFP (GFP + ; white bars) or high levels of GFP (GFP High ; black bars). The percentage (+SD) of CSR relative to the Non-Target shRNA control from four to eight independent experiments is shown. CSR in cells expressing the Non-Target shRNA control was set to 100%. The difference in CSR efficiency relative to the Non-Target control (Δ) is indicated below. Statistical significance versus the Non-Target control (two-tailed Student’s t test) is indicated: ***, P ≤ 0.001. (D and E) cDNA was prepared from CH12 cells treated as in A and qRT-PCR for μ (D) and α (E) germline transcripts was performed. Expression was normalized to HPRT mRNA abundance and is presented relative to the Non-Target control, set as 1 (black line). Mean of triplicate samples (+SD) is shown. Statistical significance versus the Non-Target control (two-tailed Student’s t test) is indicated: *, P ≤ 0.05; **, P ≤ 0.01; ***, P ≤ 0.001. (F) Proteins extracts were prepared from CH12 cells treated as in A. Western blots for β-actin and AID are shown. Data are representative of three independent experiments. Theoretical molecular masses in kilodaltons are indicated.

Techniques Used: Transduction, Expressing, Western Blot, Real-time Polymerase Chain Reaction, Quantitative RT-PCR, Two Tailed Test, Flow Cytometry, Cytometry, shRNA

28) Product Images from "cMyc-mediated activation of serine biosynthesis pathway is critical for cancer progression under nutrient deprivation conditions"

Article Title: cMyc-mediated activation of serine biosynthesis pathway is critical for cancer progression under nutrient deprivation conditions

Journal: Cell Research

doi: 10.1038/cr.2015.33

cMyc and PSPH are critical for cancer cell growth under nutrient deprivation conditions. (A) Growth curves were determined by trypan blue counting in Hep3B cells expressing shRNAs against cMyc or PSPH starved of glucose (top) or glutamine (bottom). Data
Figure Legend Snippet: cMyc and PSPH are critical for cancer cell growth under nutrient deprivation conditions. (A) Growth curves were determined by trypan blue counting in Hep3B cells expressing shRNAs against cMyc or PSPH starved of glucose (top) or glutamine (bottom). Data

Techniques Used: Expressing

cMyc transactivates the expression of enzymes involved in serine biosynthesis. (A , B) qRT-PCR (A) and western blot (B) analyzed the expression of SSP enzymes in Hep3B cells expressing cMyc or shRNAs against cMyc. β-actin serves as loading control.
Figure Legend Snippet: cMyc transactivates the expression of enzymes involved in serine biosynthesis. (A , B) qRT-PCR (A) and western blot (B) analyzed the expression of SSP enzymes in Hep3B cells expressing cMyc or shRNAs against cMyc. β-actin serves as loading control.

Techniques Used: Expressing, Quantitative RT-PCR, Western Blot

cMyc-mediated PSPH expression and SSP activation are critical for cancer cell proliferation by regulating GSH, ROS, apoptosis and nucleotide synthesis. (A - C) GSH level and the GSH/GSSG ratio were determined in Hep3B cells expressing shRNAs targeting cMyc
Figure Legend Snippet: cMyc-mediated PSPH expression and SSP activation are critical for cancer cell proliferation by regulating GSH, ROS, apoptosis and nucleotide synthesis. (A - C) GSH level and the GSH/GSSG ratio were determined in Hep3B cells expressing shRNAs targeting cMyc

Techniques Used: Expressing, Activation Assay

29) Product Images from "Loss of Ccbe1 affects cardiac-specification and cardiomyocyte differentiation in mouse embryonic stem cells"

Article Title: Loss of Ccbe1 affects cardiac-specification and cardiomyocyte differentiation in mouse embryonic stem cells

Journal: PLoS ONE

doi: 10.1371/journal.pone.0205108

Expression of Ccbe1 during differentiation of Ccbe1 knockdown mouse ESC lines. Transgenic mouse ESC lines expressing control scrambled and Ccbe1-targeting shRNAs (Clone 1 and 2) were generated using commercially available shRNA control and two Ccbe1-targeted shRNA lentiviral plasmids. Selected clones of the transgenic Ccbe1KD ESC lines and the control mouse ESC line were allowed to differentiate. Samples were collected from undifferentiated cells (D0) and at days 2 (D2), 4 (D4), 6 (D6), 8 (D8) and 10 (D10) of differentiating clones. Expression is presented as fold change relative to the control of each day. Data presented as the mean + SEM of three biological replicates in technical qPCR triplicates.
Figure Legend Snippet: Expression of Ccbe1 during differentiation of Ccbe1 knockdown mouse ESC lines. Transgenic mouse ESC lines expressing control scrambled and Ccbe1-targeting shRNAs (Clone 1 and 2) were generated using commercially available shRNA control and two Ccbe1-targeted shRNA lentiviral plasmids. Selected clones of the transgenic Ccbe1KD ESC lines and the control mouse ESC line were allowed to differentiate. Samples were collected from undifferentiated cells (D0) and at days 2 (D2), 4 (D4), 6 (D6), 8 (D8) and 10 (D10) of differentiating clones. Expression is presented as fold change relative to the control of each day. Data presented as the mean + SEM of three biological replicates in technical qPCR triplicates.

Techniques Used: Expressing, Transgenic Assay, Generated, shRNA, Clone Assay, Real-time Polymerase Chain Reaction

30) Product Images from "Ubiquitin Regulates GGA3-mediated Degradation of BACE1 *"

Article Title: Ubiquitin Regulates GGA3-mediated Degradation of BACE1 *

Journal: The Journal of Biological Chemistry

doi: 10.1074/jbc.M109.092742

Depletion and overexpression of GGA3 inversely regulates BACE1 levels. A , levels of endogenous GGA3 were analyzed in H4 neuroglioma cells stably expressing GGA3 ( H4-shGGA3 ) or negative control ( H4-NC ) shRNAs. Western blot analysis was performed using anti-GGA3 antibody. GAPDH was used as loading control. B , graph represents mean ± S.E. of at least six GGA3 level measurements. Densitometry was performed using a Versadoc Imager and Quantity One software (Bio-Rad). GGA3 densitometry values were normalized against GAPDH values. C , H4-NC and H4-shGGA3 cells were transiently transfected with the indicated expression vectors. Cells were collected at 6 days post-transfection. Levels of BACE1, GGA3, and GAPDH were analyzed by WB using anti-Myc, anti-HA, and anti-GAPDH antibody, respectively. D , graph represents mean ± S.E. of at least eight BACE1 level measurements. Densitometry was performed as described above. BACE1 accumulates by ∼2-fold in H4-shGGA3 cells compared with H4-NC (vector H4shGGA3 versus vector H4-NC unpaired t test with Welch correction **, p = 0.004). BACE1 accumulation was rescued by the expression of RNAi-resistant GGA3 mutant in H4-shGGA3 cells (vector versus HA-GGA3 RNAiRes unpaired t test with Welch correction **, p = 0.001). Moreover, the overexpression of GGA3 in H4-NC cells reduced the levels of BACE1 (vector versus HA-GGA3 unpaired t test with Welch correction *, p = 0.03). E , H4-NC cells stably expressing vector or GGA3 were transiently transfected with BACE1 expression vector. Media were conditioned for ∼12 h at 6 days post-transfection. The graph represents mean ± S.E. of at least six Aβ1–40 measurements by ELISA. Aβ concentration (pg/μl) was normalized against the protein concentration (μg/ml) in the cell lysates. Levels of Aβ1–40 were significantly decreased in the conditioned media from cells expressing GGA3 and BACE1 compared with that from cells expressing empty vector and BACE1 (vector versus HA-GGA3 unpaired t test with Welch correction *, p = 0.02).
Figure Legend Snippet: Depletion and overexpression of GGA3 inversely regulates BACE1 levels. A , levels of endogenous GGA3 were analyzed in H4 neuroglioma cells stably expressing GGA3 ( H4-shGGA3 ) or negative control ( H4-NC ) shRNAs. Western blot analysis was performed using anti-GGA3 antibody. GAPDH was used as loading control. B , graph represents mean ± S.E. of at least six GGA3 level measurements. Densitometry was performed using a Versadoc Imager and Quantity One software (Bio-Rad). GGA3 densitometry values were normalized against GAPDH values. C , H4-NC and H4-shGGA3 cells were transiently transfected with the indicated expression vectors. Cells were collected at 6 days post-transfection. Levels of BACE1, GGA3, and GAPDH were analyzed by WB using anti-Myc, anti-HA, and anti-GAPDH antibody, respectively. D , graph represents mean ± S.E. of at least eight BACE1 level measurements. Densitometry was performed as described above. BACE1 accumulates by ∼2-fold in H4-shGGA3 cells compared with H4-NC (vector H4shGGA3 versus vector H4-NC unpaired t test with Welch correction **, p = 0.004). BACE1 accumulation was rescued by the expression of RNAi-resistant GGA3 mutant in H4-shGGA3 cells (vector versus HA-GGA3 RNAiRes unpaired t test with Welch correction **, p = 0.001). Moreover, the overexpression of GGA3 in H4-NC cells reduced the levels of BACE1 (vector versus HA-GGA3 unpaired t test with Welch correction *, p = 0.03). E , H4-NC cells stably expressing vector or GGA3 were transiently transfected with BACE1 expression vector. Media were conditioned for ∼12 h at 6 days post-transfection. The graph represents mean ± S.E. of at least six Aβ1–40 measurements by ELISA. Aβ concentration (pg/μl) was normalized against the protein concentration (μg/ml) in the cell lysates. Levels of Aβ1–40 were significantly decreased in the conditioned media from cells expressing GGA3 and BACE1 compared with that from cells expressing empty vector and BACE1 (vector versus HA-GGA3 unpaired t test with Welch correction *, p = 0.02).

Techniques Used: Over Expression, Stable Transfection, Expressing, Negative Control, Western Blot, Software, Transfection, Plasmid Preparation, Mutagenesis, Enzyme-linked Immunosorbent Assay, Concentration Assay, Protein Concentration

31) Product Images from "Hepatocellular carcinoma redirects to ketolysis for progression under nutrition deprivation stress"

Article Title: Hepatocellular carcinoma redirects to ketolysis for progression under nutrition deprivation stress

Journal: Cell Research

doi: 10.1038/cr.2016.109

OXCT1 is critical for induction of ketolysis in nutrition-starved HCC cells. (A) HepG2 cells stably expressing OXCT1 shRNAs or non-targeting control (NTC) were cultured under normal (Nor) or SS conditions for 48 h followed by incubating with 5mM of [2, 4- 13 C 2 ] β-HB for 24 h and subsequent isotope tracing of 13 C-labeled metabolites by GC-MS. OXCT1 expression was determined by western blot. Data were presented as mean ± SD. * P
Figure Legend Snippet: OXCT1 is critical for induction of ketolysis in nutrition-starved HCC cells. (A) HepG2 cells stably expressing OXCT1 shRNAs or non-targeting control (NTC) were cultured under normal (Nor) or SS conditions for 48 h followed by incubating with 5mM of [2, 4- 13 C 2 ] β-HB for 24 h and subsequent isotope tracing of 13 C-labeled metabolites by GC-MS. OXCT1 expression was determined by western blot. Data were presented as mean ± SD. * P

Techniques Used: Stable Transfection, Expressing, Cell Culture, Labeling, Gas Chromatography-Mass Spectrometry, Western Blot

32) Product Images from "Pals1 Is a Major Regulator of the Epithelial-Like Polarization and the Extension of the Myelin Sheath in Peripheral Nerves"

Article Title: Pals1 Is a Major Regulator of the Epithelial-Like Polarization and the Extension of the Myelin Sheath in Peripheral Nerves

Journal: The Journal of Neuroscience

doi: 10.1523/JNEUROSCI.5185-09.2010

Pals1 silencing reduces the amount of PMP22, MAG, and E-cadherin but not integrin β1 at the plasma membrane. A , The efficiency of three pals1 shRNAs (pals1 sh) in silencing pals1 in rat epithelial cells WB-F344 was analyzed by Western blotting. Pals1 shRNA 1 and 3 are the most efficient, while 2 is not active. Cont sh, Control sh. B , Immunostaining of PMP22 and integrin β1 on WB-F344 cells under permeabilized or nonpermeabilized conditions. Cells were not infected (NI) or infected with lentivirus expressing pals1 shRNA 1, 2, or 3 (pals1 sh), and selected with puromycin before immunostaining. Cells expressing the effective pals1 sh1 or 3 show reduced PMP22 but not reduced integrin β1 staining at their membranes. Note that cells silenced for pals1 are larger and less numerous at confluency; thus, the overall integrin β1 staining appears stronger in noninfected than in pals1 silenced cells, but no change can be seen when looking at cells individually. All pictures have the same scale. Scale bar, 50 μm. C , D , Noninfected (NI) WB-F344 cells or cells infected with pals1 shRNA 1 and 2 (pals1 sh) or control shRNA (cont sh) were subjected to cell surface biotinylation. The total amount and the amount of biotinylated (biot.) PMP22 ( C ) and MAG ( D ) were then analyzed by Western blotting. Two bands corresponding to L-MAG and S-MAG were observed. E , Western blot results were quantified by densitometry, and the relative amount of PMP22, MAG, E-cadherin and integrin β1 at the cell surface in cells silenced for pals1 (pals1 sh1) or not silenced (cont sh) is plotted. The fraction of protein at the cell surface is the ratio of cell surface protein/total protein. Values obtained in silenced cells were normalized to values obtained in nonsilenced cells to obtain the relative amount of protein at the cell surface. In case of MAG, both bands were included in the quantification. AU, Arbitrary unit. Error bars show SEM. n = number of experiments. ns, Not significant.
Figure Legend Snippet: Pals1 silencing reduces the amount of PMP22, MAG, and E-cadherin but not integrin β1 at the plasma membrane. A , The efficiency of three pals1 shRNAs (pals1 sh) in silencing pals1 in rat epithelial cells WB-F344 was analyzed by Western blotting. Pals1 shRNA 1 and 3 are the most efficient, while 2 is not active. Cont sh, Control sh. B , Immunostaining of PMP22 and integrin β1 on WB-F344 cells under permeabilized or nonpermeabilized conditions. Cells were not infected (NI) or infected with lentivirus expressing pals1 shRNA 1, 2, or 3 (pals1 sh), and selected with puromycin before immunostaining. Cells expressing the effective pals1 sh1 or 3 show reduced PMP22 but not reduced integrin β1 staining at their membranes. Note that cells silenced for pals1 are larger and less numerous at confluency; thus, the overall integrin β1 staining appears stronger in noninfected than in pals1 silenced cells, but no change can be seen when looking at cells individually. All pictures have the same scale. Scale bar, 50 μm. C , D , Noninfected (NI) WB-F344 cells or cells infected with pals1 shRNA 1 and 2 (pals1 sh) or control shRNA (cont sh) were subjected to cell surface biotinylation. The total amount and the amount of biotinylated (biot.) PMP22 ( C ) and MAG ( D ) were then analyzed by Western blotting. Two bands corresponding to L-MAG and S-MAG were observed. E , Western blot results were quantified by densitometry, and the relative amount of PMP22, MAG, E-cadherin and integrin β1 at the cell surface in cells silenced for pals1 (pals1 sh1) or not silenced (cont sh) is plotted. The fraction of protein at the cell surface is the ratio of cell surface protein/total protein. Values obtained in silenced cells were normalized to values obtained in nonsilenced cells to obtain the relative amount of protein at the cell surface. In case of MAG, both bands were included in the quantification. AU, Arbitrary unit. Error bars show SEM. n = number of experiments. ns, Not significant.

Techniques Used: Western Blot, shRNA, Immunostaining, Infection, Expressing, Staining

33) Product Images from "Cdk1-Mediated Phosphorylation of Human ATF7 at Thr-51 and Thr-53 Promotes Cell-Cycle Progression into M Phase"

Article Title: Cdk1-Mediated Phosphorylation of Human ATF7 at Thr-51 and Thr-53 Promotes Cell-Cycle Progression into M Phase

Journal: PLoS ONE

doi: 10.1371/journal.pone.0116048

Involvement of ATF7 phosphorylation in Aurora signaling. ( A ) Schematic depiction of our knockdown-rescue experiments. Parental HeLa S3/TR, HeLa S3/TR/ATF7-wt (cl. 2), or HeLa S3/TR/ATF7-TA (cl.1) cells were treated with 1 µg/ml Dox for 12 h and then transfected with shRNAs. Knockdown cells selected using 600 µg/ml G418 in the presence of 1 µg/ml Dox were synchronized by (i) DTB or (ii) thymidine→RO-3306. ( B–D ) Knockdown cells were synchronized as described in (a)-(i) and collected 12 h after release from DTB. ( B ) Whole cell lysates were analyzed by WB. Full-length blots are presented in S12B Fig . ( C ) Cells were stained with PI for analyzing cell-cycle progression by flow cytometry (panels) and for quantitating G1-phase cells (graph). Values are means ± SD, n = 4 independent experiments. Asterisks indicate the significant differences (*P
Figure Legend Snippet: Involvement of ATF7 phosphorylation in Aurora signaling. ( A ) Schematic depiction of our knockdown-rescue experiments. Parental HeLa S3/TR, HeLa S3/TR/ATF7-wt (cl. 2), or HeLa S3/TR/ATF7-TA (cl.1) cells were treated with 1 µg/ml Dox for 12 h and then transfected with shRNAs. Knockdown cells selected using 600 µg/ml G418 in the presence of 1 µg/ml Dox were synchronized by (i) DTB or (ii) thymidine→RO-3306. ( B–D ) Knockdown cells were synchronized as described in (a)-(i) and collected 12 h after release from DTB. ( B ) Whole cell lysates were analyzed by WB. Full-length blots are presented in S12B Fig . ( C ) Cells were stained with PI for analyzing cell-cycle progression by flow cytometry (panels) and for quantitating G1-phase cells (graph). Values are means ± SD, n = 4 independent experiments. Asterisks indicate the significant differences (*P

Techniques Used: Transfection, Western Blot, Staining, Flow Cytometry, Cytometry

34) Product Images from "Mitochondrial thioredoxin reductase regulates major cytotoxicity pathways of proteasome inhibitors in multiple myeloma cells"

Article Title: Mitochondrial thioredoxin reductase regulates major cytotoxicity pathways of proteasome inhibitors in multiple myeloma cells

Journal: Leukemia

doi: 10.1038/leu.2015.190

KLF9 depletion decreases PI-induced oxidative stress A , Cells were infected with control shRNAs (CL), KLF9 shRNA-1 (K9 1 ), or KLF9 shRNAs2 (K9 2 ) followed by immunoblot analysis with the indicated antibodies or B , QRT-PCR analysis with TXNRD2 and β-actin-specific primers 48hrs post-infection. TXNRD2-specific signals were normalized to the corresponding β-actin signals. C , Cells infected as in (A) were treated with the indicated amounts of BTZ or CFZ for 24hrs and stained with H 2 DCFDA followed by FACS analysis to determine intracellular ROS levels. The mean fluorescence intensities are indicated in each histogram. D , Cells infected as in (A) were treated with the indicated amounts of BTZ or CFZ for 48hrs and subjected to trypan blue exclusion assay. The data are presented as the mean values of triplicates ± SEM. p values were determined by Student’s t test. *p
Figure Legend Snippet: KLF9 depletion decreases PI-induced oxidative stress A , Cells were infected with control shRNAs (CL), KLF9 shRNA-1 (K9 1 ), or KLF9 shRNAs2 (K9 2 ) followed by immunoblot analysis with the indicated antibodies or B , QRT-PCR analysis with TXNRD2 and β-actin-specific primers 48hrs post-infection. TXNRD2-specific signals were normalized to the corresponding β-actin signals. C , Cells infected as in (A) were treated with the indicated amounts of BTZ or CFZ for 24hrs and stained with H 2 DCFDA followed by FACS analysis to determine intracellular ROS levels. The mean fluorescence intensities are indicated in each histogram. D , Cells infected as in (A) were treated with the indicated amounts of BTZ or CFZ for 48hrs and subjected to trypan blue exclusion assay. The data are presented as the mean values of triplicates ± SEM. p values were determined by Student’s t test. *p

Techniques Used: Infection, shRNA, Quantitative RT-PCR, Staining, FACS, Fluorescence, Trypan Blue Exclusion Assay

TXNRD2 depletion partially recapitulates cytotoxic effects of PIs in MM cells A , Cells were infected with control shRNAs (CL), TXNRD2 shRNA-1 (Tx2 1 ), or TXNRD2 shRNAs2 (Tx2 2 ) followed by immunoblot analysis with the indicated antibodies 48hrs post-infection. In parallel indicated cells were treated with 5nM BTZ or 2.5nM CFZ for 24hrs followed by immunoblot analysis with the indicated antibodies. B , Cells infected as in (A) were stained with H 2 DCFDA followed by FACS analysis to determine intracellular ROS levels 48hrs post-infection. The mean fluorescence intensities are indicated in each histogram. C , Cells infected and treated as in (A) were probed in QRT-PCR with primers corresponding to indicated genes, and with β-actin-specific primers. All signals were normalized to the corresponding β-actin signals. D , Cells infected as in (A) were subjected to trypan blue exclusion assay at indicated days post-infection. E, Cells infected as in (A) were incubated with NAC and subjected to trypan blue exclusion assay at day 5 post-infection. The data are presented as the mean values of triplicates ± SEM. p values were determined by Student’s t test. *p
Figure Legend Snippet: TXNRD2 depletion partially recapitulates cytotoxic effects of PIs in MM cells A , Cells were infected with control shRNAs (CL), TXNRD2 shRNA-1 (Tx2 1 ), or TXNRD2 shRNAs2 (Tx2 2 ) followed by immunoblot analysis with the indicated antibodies 48hrs post-infection. In parallel indicated cells were treated with 5nM BTZ or 2.5nM CFZ for 24hrs followed by immunoblot analysis with the indicated antibodies. B , Cells infected as in (A) were stained with H 2 DCFDA followed by FACS analysis to determine intracellular ROS levels 48hrs post-infection. The mean fluorescence intensities are indicated in each histogram. C , Cells infected and treated as in (A) were probed in QRT-PCR with primers corresponding to indicated genes, and with β-actin-specific primers. All signals were normalized to the corresponding β-actin signals. D , Cells infected as in (A) were subjected to trypan blue exclusion assay at indicated days post-infection. E, Cells infected as in (A) were incubated with NAC and subjected to trypan blue exclusion assay at day 5 post-infection. The data are presented as the mean values of triplicates ± SEM. p values were determined by Student’s t test. *p

Techniques Used: Infection, shRNA, Staining, FACS, Fluorescence, Quantitative RT-PCR, Trypan Blue Exclusion Assay, Incubation

35) Product Images from "The Werner Syndrome Protein Functions in Repair of Cr(VI)-Induced Replication-Associated DNA Damage"

Article Title: The Werner Syndrome Protein Functions in Repair of Cr(VI)-Induced Replication-Associated DNA Damage

Journal: Toxicological Sciences

doi: 10.1093/toxsci/kfp104

WRN-deficient cells are hypersensitive to Cr(VI) toxicity and exhibit delayed recovery from Cr(VI)-induced DNA damage. (A)Western blot showing WRN expression levels in U2OS cells stably expressing either the control or WRN shRNAs. (B) Cellular toxicity
Figure Legend Snippet: WRN-deficient cells are hypersensitive to Cr(VI) toxicity and exhibit delayed recovery from Cr(VI)-induced DNA damage. (A)Western blot showing WRN expression levels in U2OS cells stably expressing either the control or WRN shRNAs. (B) Cellular toxicity

Techniques Used: Expressing, Stable Transfection

36) Product Images from "Identification of a Mitochondrial Defect Gene Signature Reveals NUPR1 as a Key Regulator of Liver Cancer Progression"

Article Title: Identification of a Mitochondrial Defect Gene Signature Reveals NUPR1 as a Key Regulator of Liver Cancer Progression

Journal: Hepatology (Baltimore, Md.)

doi: 10.1002/hep.27976

GRN is a key downstream effector molecule of NUPR1 . (A) SNU354 cells were transfected with siRNA for NUPR1 for 2 and 3 days, followed by cDNA microarray analysis. A heatmap of commonly deregulated genes is shown. Twenty-six genes were down-regulated and 14 genes were up-regulated. (B) A network for the 26 commonly down-regulated genes was constructed using GeneMania software, showing genetic interaction, coexpression link, physical interaction, and pathway link. By removing the genes not connected to the network, 19 out of the 26 genes are included in the network (blue and yellow circles). Of the first neighbor genes connected directly to NUPR1, the four genes harboring the largest interaction partners are indicated as potential targets for NUPR1 (yellow circle). (C) Correlation between the expressions of GRN and NUPR1 was shown in cohort 1 (upper panel) and cohort 2 (lower panel), respectively. (D,E) SNU354 cells were infected with recombinant lentiviruses harboring shRNAs for NUPR1, and clones stably expressing the shRNAs were isolated. (D) Messenger RNA levels of GRN and NUPR1 were examined by qRT-PCR. ** P
Figure Legend Snippet: GRN is a key downstream effector molecule of NUPR1 . (A) SNU354 cells were transfected with siRNA for NUPR1 for 2 and 3 days, followed by cDNA microarray analysis. A heatmap of commonly deregulated genes is shown. Twenty-six genes were down-regulated and 14 genes were up-regulated. (B) A network for the 26 commonly down-regulated genes was constructed using GeneMania software, showing genetic interaction, coexpression link, physical interaction, and pathway link. By removing the genes not connected to the network, 19 out of the 26 genes are included in the network (blue and yellow circles). Of the first neighbor genes connected directly to NUPR1, the four genes harboring the largest interaction partners are indicated as potential targets for NUPR1 (yellow circle). (C) Correlation between the expressions of GRN and NUPR1 was shown in cohort 1 (upper panel) and cohort 2 (lower panel), respectively. (D,E) SNU354 cells were infected with recombinant lentiviruses harboring shRNAs for NUPR1, and clones stably expressing the shRNAs were isolated. (D) Messenger RNA levels of GRN and NUPR1 were examined by qRT-PCR. ** P

Techniques Used: Transfection, Microarray, Construct, Software, Infection, Recombinant, Clone Assay, Stable Transfection, Expressing, Isolation, Quantitative RT-PCR

37) Product Images from "A Paradoxical Tumor-Suppressor Role for the Rac1 Exchange Factor Vav1 in T Cell Acute Lymphoblastic Leukemia"

Article Title: A Paradoxical Tumor-Suppressor Role for the Rac1 Exchange Factor Vav1 in T Cell Acute Lymphoblastic Leukemia

Journal: Cancer Cell

doi: 10.1016/j.ccell.2017.10.004

Vav1 Regulates ICN1 Degradation (A) Abundance of Vav1, ICN1, and tubulin α in total cellular lysates (TCL) from indicated cells. Rescued, a stable pool of VAV1 −/− Jurkat cells in which Vav1 WT was re-expressed. (B) Abundance of selected mRNAs in indicated Jurkat cells (n = 3). (C) Activity of RBPJκ-responsive (left) and HES1 (right) promoters in indicated cells. Values are given relative to WT cells (n = 3). (D) Abundance of endogenous and ectopic ICN1 in TCLs from cells used in (C) (upper panel). Endogenous tubulin α was used as loading control (bottom panel). (E) Abundance of ICN1 (top) and tubulin α (bottom) in TCLs from indicated cells and conditions (n = 3). (F) Quantification of ICN1 abundance according to the data gathered in (E) (n = 3). (G) Cellular extracts from Jurkat cells coexpressing HA-ubiquitin and ICN1 were immunoprecipitated (IP) with antibodies to HA to determine the amount of ubiquitinylation of ectopic ICN1 (top) and endogenous proteins (middle) by immunoblot. Equal amounts of ICN1 expression in cells were confirmed by WB analysis using TCLs (bottom) (n = 3). Top and bottom panels were blotted with antibodies to ICN1. Middle panel was blotted with antibodies to the HA epitope. Ub, ubiquitinylated. (H) Presenilin activity in indicated Jurkat cells (bottom) and assay conditions (inset) (n = 3). (I) Abundance of endogenous ICN1 in TCLs from CEM (top panels) and Molt4 (bottom panels) cells expressing a control (Ctl.) or two independent (sh1 and sh3) VAV1 shRNAs (n = 3). In (B), (C), (F), and (H), data represent mean ± SEM. ∗∗ p ≤ 0.01, ∗∗∗ p ≤ 0.001 using Student's t test (B, C, and F) and Mann-Whitney test (H). See also Figure S4 .
Figure Legend Snippet: Vav1 Regulates ICN1 Degradation (A) Abundance of Vav1, ICN1, and tubulin α in total cellular lysates (TCL) from indicated cells. Rescued, a stable pool of VAV1 −/− Jurkat cells in which Vav1 WT was re-expressed. (B) Abundance of selected mRNAs in indicated Jurkat cells (n = 3). (C) Activity of RBPJκ-responsive (left) and HES1 (right) promoters in indicated cells. Values are given relative to WT cells (n = 3). (D) Abundance of endogenous and ectopic ICN1 in TCLs from cells used in (C) (upper panel). Endogenous tubulin α was used as loading control (bottom panel). (E) Abundance of ICN1 (top) and tubulin α (bottom) in TCLs from indicated cells and conditions (n = 3). (F) Quantification of ICN1 abundance according to the data gathered in (E) (n = 3). (G) Cellular extracts from Jurkat cells coexpressing HA-ubiquitin and ICN1 were immunoprecipitated (IP) with antibodies to HA to determine the amount of ubiquitinylation of ectopic ICN1 (top) and endogenous proteins (middle) by immunoblot. Equal amounts of ICN1 expression in cells were confirmed by WB analysis using TCLs (bottom) (n = 3). Top and bottom panels were blotted with antibodies to ICN1. Middle panel was blotted with antibodies to the HA epitope. Ub, ubiquitinylated. (H) Presenilin activity in indicated Jurkat cells (bottom) and assay conditions (inset) (n = 3). (I) Abundance of endogenous ICN1 in TCLs from CEM (top panels) and Molt4 (bottom panels) cells expressing a control (Ctl.) or two independent (sh1 and sh3) VAV1 shRNAs (n = 3). In (B), (C), (F), and (H), data represent mean ± SEM. ∗∗ p ≤ 0.01, ∗∗∗ p ≤ 0.001 using Student's t test (B, C, and F) and Mann-Whitney test (H). See also Figure S4 .

Techniques Used: Activity Assay, Immunoprecipitation, Expressing, Western Blot, CTL Assay, MANN-WHITNEY

Vav1 Modulates ICN1 in a Cbl-b-Dependent Manner (A) Vav1 mutants used (point mutations depicted as open circles). The minimal region for the Vav1-dependent regulation of the Notch1 route is shaded in blue. (B) HES1 promoter activity of VAV1 −/− Jurkat cells expressing the indicated EGFPs (bottom) (n = 5). (C) HES1 promoter activity in nonstimulated (−α-CD3) and stimulated (+α-CD3) WT and TCR mut Jurkat cells expressing the indicated EGFPs (bottom) (n = 3). (D) Abundance of ICN1, tubulin α, and Cbl-b in Jurkat cells expressing a control (Ctl.) and four independent (sh1 to sh4) CBLB shRNAs. Determinations were done by WB using either TCLs (ICN1, tubulin α) or immunoprecipitated Cbl-b. +Cbl-b, WT Jurkat cells ectopically expressing Cbl-b WT (n = 3). (E) Abundance of indicated transcripts in cells used in these experiments (n = 3). Cells are designated as in (D). (F) Structure of Cbl-b and localization of the Y363F mutation. TKB, tyrosine kinase binding domain; RING, RING domain; UBA, ubiquitin-associated region. (G) HES1 promoter activity in indicated cells upon transfection with an empty vector (None) or plasmids expressing indicated Cbl-b proteins (n = 3). Cells are designated as in (D). (H) ICN1 ubiquitinylation in indicated cells following the approach described in Figure 4 G (n = 3). KD, knockdown. (I) Detection of endogenous Vav1 (top panel) and Cbl-b (middle panel) in immunoprecipitates of ICN1 (bottom panel) in indicated Jurkat cells. In (B), (C), (E), and (G), data represent mean ± SEM. ∗∗ p ≤ 0.01 (Student’s t test). See also Figure S5 .
Figure Legend Snippet: Vav1 Modulates ICN1 in a Cbl-b-Dependent Manner (A) Vav1 mutants used (point mutations depicted as open circles). The minimal region for the Vav1-dependent regulation of the Notch1 route is shaded in blue. (B) HES1 promoter activity of VAV1 −/− Jurkat cells expressing the indicated EGFPs (bottom) (n = 5). (C) HES1 promoter activity in nonstimulated (−α-CD3) and stimulated (+α-CD3) WT and TCR mut Jurkat cells expressing the indicated EGFPs (bottom) (n = 3). (D) Abundance of ICN1, tubulin α, and Cbl-b in Jurkat cells expressing a control (Ctl.) and four independent (sh1 to sh4) CBLB shRNAs. Determinations were done by WB using either TCLs (ICN1, tubulin α) or immunoprecipitated Cbl-b. +Cbl-b, WT Jurkat cells ectopically expressing Cbl-b WT (n = 3). (E) Abundance of indicated transcripts in cells used in these experiments (n = 3). Cells are designated as in (D). (F) Structure of Cbl-b and localization of the Y363F mutation. TKB, tyrosine kinase binding domain; RING, RING domain; UBA, ubiquitin-associated region. (G) HES1 promoter activity in indicated cells upon transfection with an empty vector (None) or plasmids expressing indicated Cbl-b proteins (n = 3). Cells are designated as in (D). (H) ICN1 ubiquitinylation in indicated cells following the approach described in Figure 4 G (n = 3). KD, knockdown. (I) Detection of endogenous Vav1 (top panel) and Cbl-b (middle panel) in immunoprecipitates of ICN1 (bottom panel) in indicated Jurkat cells. In (B), (C), (E), and (G), data represent mean ± SEM. ∗∗ p ≤ 0.01 (Student’s t test). See also Figure S5 .

Techniques Used: Activity Assay, Expressing, CTL Assay, Western Blot, Immunoprecipitation, Mutagenesis, Binding Assay, Transfection, Plasmid Preparation

38) Product Images from "Severe NDE1-mediated microcephaly results from neural progenitor cell cycle arrests at multiple specific stages"

Article Title: Severe NDE1-mediated microcephaly results from neural progenitor cell cycle arrests at multiple specific stages

Journal: Nature Communications

doi: 10.1038/ncomms12551

Double knockdown of NDE1/NDEL1 arrests cells at the G1-to-S transition. E16 rat embryonic brains were electroporated with shRNAs for the various conditions and examined at E19. CyclinD1 staining was used to mark G1 cells, a 30 min pulse of BrdU used to mark S-phase cells, and BrdU pulses of varying length were used to distinguish RGPs that are arrested during the cell cycle from those actively cycling. The CyclinD1 and BrdU indices used in quantification were calculated as the amount of electroporated radial glia progenitors (RGPs) positive for either marker divided by the total number of electroporated RGP cells. ( a ) NDE1 knockdown caused a small but significant increase in CyclinD1-positive RGP cells, and the NDE1/NDEL1 double knockdown caused an even more substantial doubling of CyclinD1-positive RGP cells. There was no apparent difference between NDEL1 knockdown and control conditions. CylinD1-positive RGP cells tended to have soma located further away from the ventricular surface. Arrowheads mark electroporated RGP nuclei positive for CyclinD1. ( b ) NDE1 and NDE1/NDEL1 double knockdown caused a reciprocal and severe decrease in BrdU-labelled RGP cells. Again there was no significant difference between NDEL1 knockdown and control conditions. Arrowheads mark electroporated RGP nuclei positive for BrdU. ( c ) BrdU pulses of varying length revealed an increase in BrdU incorporation among control RGPs and NDEL1 knockdown RGPs, in contrast to the very minimal increase in BrdU incorporation over 24 h in the NDE1 and NDE1/NDEL1 knockdown conditions. Unpaired t -tests comparing knockdown conditions at each hour revealed no significant difference between control and NDEL1 knockdown, or NDE1 and NDE1/NDEL1 knockdown, while those two pairings were significantly different at every time point observed. Asterisks mark electroporated RGP cells positive for BrdU. Data are presented as mean±s.e.m. Unpaired t -tests used to compare conditions, * P
Figure Legend Snippet: Double knockdown of NDE1/NDEL1 arrests cells at the G1-to-S transition. E16 rat embryonic brains were electroporated with shRNAs for the various conditions and examined at E19. CyclinD1 staining was used to mark G1 cells, a 30 min pulse of BrdU used to mark S-phase cells, and BrdU pulses of varying length were used to distinguish RGPs that are arrested during the cell cycle from those actively cycling. The CyclinD1 and BrdU indices used in quantification were calculated as the amount of electroporated radial glia progenitors (RGPs) positive for either marker divided by the total number of electroporated RGP cells. ( a ) NDE1 knockdown caused a small but significant increase in CyclinD1-positive RGP cells, and the NDE1/NDEL1 double knockdown caused an even more substantial doubling of CyclinD1-positive RGP cells. There was no apparent difference between NDEL1 knockdown and control conditions. CylinD1-positive RGP cells tended to have soma located further away from the ventricular surface. Arrowheads mark electroporated RGP nuclei positive for CyclinD1. ( b ) NDE1 and NDE1/NDEL1 double knockdown caused a reciprocal and severe decrease in BrdU-labelled RGP cells. Again there was no significant difference between NDEL1 knockdown and control conditions. Arrowheads mark electroporated RGP nuclei positive for BrdU. ( c ) BrdU pulses of varying length revealed an increase in BrdU incorporation among control RGPs and NDEL1 knockdown RGPs, in contrast to the very minimal increase in BrdU incorporation over 24 h in the NDE1 and NDE1/NDEL1 knockdown conditions. Unpaired t -tests comparing knockdown conditions at each hour revealed no significant difference between control and NDEL1 knockdown, or NDE1 and NDE1/NDEL1 knockdown, while those two pairings were significantly different at every time point observed. Asterisks mark electroporated RGP cells positive for BrdU. Data are presented as mean±s.e.m. Unpaired t -tests used to compare conditions, * P

Techniques Used: Staining, Marker, BrdU Incorporation Assay

BicD2 overexpression rescues apical nuclear migration but not entry into mitosis in radial glia progenitors depleted of NDE1. cDNA for full-length BicD2 was co-electroporated into embryonic rat brains with a GFP control empty vector or along with NDE1 shRNA or NDE1 and NDEL1 shRNAs at E16, and analysed at E20. ( a ) The overexpression of BicD2 in radial glia progenitors (RGPs) lacking NDE1 restores apical migration, though the soma accumulate at the ventricle for hours without any evidence of mitosis. Montage panels are shown at 30 min intervals. Full movie can be found in Supplementary Movie 8 . ( b ) Representative images of BicD2 overexpression on both a wild-type and NDE1 knockdown background with staining for PH3. Arrowheads mark mitoses in electroporated cells. Dashed line indicates ventricular surface. ( c ) BicD2 overexpression did not alter the somal distribution of control RGP cells but caused the vast majority of NDE1 knockdown RGP soma to accumulate at the ventricular surface. ( d ) Despite the accumulation of RGP soma at the ventricle in NDE1 knockdown with BicD2 overexpression, the mitotic index remained reduced. ( e ) Representative image of RGP cells with BicD2 overexpression along with double NDE1/NDEL1 knockdown, stained for PH3. Dashed line indicates ventricle. ( f , g ) Overexpression of BicD2 with NDE1/NDEL1 double knockdown fails to rescue the somal distribution pattern or mitotic index of double NDE1/NDEL1 knockdown RGP cells. ( h , i ) The same ratio of RGP nuclei were positive for CyclinD1 whether or not BicD2 was overexpressed along with the double NDE1/NDEL1 knockdown, indicating the prominence of the G1-to-S block in the double knockdown, and the G2 specificity of the BicD2 rescue strategy. Arrowheads mark electroporated RGP nuclei positive for CyclinD1. Dashed line indicates ventricle surface. Data are presented as scatterplot in c and f with bars representing the median±the interquartile range, and as mean±s.e.m. in d , g and i . Kolmogorov–Smirnov test for non-parametric distributions used in c and f (* P
Figure Legend Snippet: BicD2 overexpression rescues apical nuclear migration but not entry into mitosis in radial glia progenitors depleted of NDE1. cDNA for full-length BicD2 was co-electroporated into embryonic rat brains with a GFP control empty vector or along with NDE1 shRNA or NDE1 and NDEL1 shRNAs at E16, and analysed at E20. ( a ) The overexpression of BicD2 in radial glia progenitors (RGPs) lacking NDE1 restores apical migration, though the soma accumulate at the ventricle for hours without any evidence of mitosis. Montage panels are shown at 30 min intervals. Full movie can be found in Supplementary Movie 8 . ( b ) Representative images of BicD2 overexpression on both a wild-type and NDE1 knockdown background with staining for PH3. Arrowheads mark mitoses in electroporated cells. Dashed line indicates ventricular surface. ( c ) BicD2 overexpression did not alter the somal distribution of control RGP cells but caused the vast majority of NDE1 knockdown RGP soma to accumulate at the ventricular surface. ( d ) Despite the accumulation of RGP soma at the ventricle in NDE1 knockdown with BicD2 overexpression, the mitotic index remained reduced. ( e ) Representative image of RGP cells with BicD2 overexpression along with double NDE1/NDEL1 knockdown, stained for PH3. Dashed line indicates ventricle. ( f , g ) Overexpression of BicD2 with NDE1/NDEL1 double knockdown fails to rescue the somal distribution pattern or mitotic index of double NDE1/NDEL1 knockdown RGP cells. ( h , i ) The same ratio of RGP nuclei were positive for CyclinD1 whether or not BicD2 was overexpressed along with the double NDE1/NDEL1 knockdown, indicating the prominence of the G1-to-S block in the double knockdown, and the G2 specificity of the BicD2 rescue strategy. Arrowheads mark electroporated RGP nuclei positive for CyclinD1. Dashed line indicates ventricle surface. Data are presented as scatterplot in c and f with bars representing the median±the interquartile range, and as mean±s.e.m. in d , g and i . Kolmogorov–Smirnov test for non-parametric distributions used in c and f (* P

Techniques Used: Over Expression, Migration, Plasmid Preparation, shRNA, Staining, Blocking Assay

NDE1 knockdown blocks apical nuclear migration and potently reduces the mitotic index. ( a ) Live-imaging montage of GFP-expressing RGP cells at E19 with a control empty vector expressing GFP alone, or shRNAs to NDE1, NDEL1 or both genes along with a GFP reporter. Representative tracings from multiple RGP cells for each condition are shown at right. Montage panels are shown at 30 min intervals ( Supplementary Movies 1–4 ). ( b ) Representative images of the VZ from the electroporated brains stained for the mitotic marker phosphohistone-H3 (PH3). Arrowheads mark soma of PH3+/GFP+ RGP cells. Dashed line represents the ventricular surface. ( c , d ) Measurements of the distance between the bottom of the nucleus and the ventricular surface, corresponding to the apical process length, across the various conditions. NDE1 knockdown shifted the apical process length distribution towards shorter distances, with a significant accumulation of RGPs with an apical process of 0–15 μm. NDE1/NDEL1 double knockdown, however, shifted the apical process length distribution to larger distances, with a significant accumulation of RGPs with an apical process of 30–45 μm. Each dot represents an individual apical process length measurement for one electroporated RGP cell. ( e ) Effect of RNAi on RGP cell mitotic index, measured as the number of electroporated RGP cells positive for PH3 divided by the total number of electroporated RGP cells. All mitotic figures of RGP cells were located at the ventricular surface, and NDE1 knockdown, as well as NDE1/NDEL1 double knockdown, caused a strong reduction in the mitotic index. Data presented as scatterplot in c with bars representing the median±the interquartile range, and as mean±s.e.m. in d and e . Kolmogorov–Smirnov test for non-parametric distributions used in c (* P
Figure Legend Snippet: NDE1 knockdown blocks apical nuclear migration and potently reduces the mitotic index. ( a ) Live-imaging montage of GFP-expressing RGP cells at E19 with a control empty vector expressing GFP alone, or shRNAs to NDE1, NDEL1 or both genes along with a GFP reporter. Representative tracings from multiple RGP cells for each condition are shown at right. Montage panels are shown at 30 min intervals ( Supplementary Movies 1–4 ). ( b ) Representative images of the VZ from the electroporated brains stained for the mitotic marker phosphohistone-H3 (PH3). Arrowheads mark soma of PH3+/GFP+ RGP cells. Dashed line represents the ventricular surface. ( c , d ) Measurements of the distance between the bottom of the nucleus and the ventricular surface, corresponding to the apical process length, across the various conditions. NDE1 knockdown shifted the apical process length distribution towards shorter distances, with a significant accumulation of RGPs with an apical process of 0–15 μm. NDE1/NDEL1 double knockdown, however, shifted the apical process length distribution to larger distances, with a significant accumulation of RGPs with an apical process of 30–45 μm. Each dot represents an individual apical process length measurement for one electroporated RGP cell. ( e ) Effect of RNAi on RGP cell mitotic index, measured as the number of electroporated RGP cells positive for PH3 divided by the total number of electroporated RGP cells. All mitotic figures of RGP cells were located at the ventricular surface, and NDE1 knockdown, as well as NDE1/NDEL1 double knockdown, caused a strong reduction in the mitotic index. Data presented as scatterplot in c with bars representing the median±the interquartile range, and as mean±s.e.m. in d and e . Kolmogorov–Smirnov test for non-parametric distributions used in c (* P

Techniques Used: Migration, Imaging, Expressing, Plasmid Preparation, Staining, Marker

The G1-to-S arrest of radial glia progenitors in the NDE1/NDEL1 double knockdowns disrupts the regulation of primary cilia length. E16 rat embryonic brains were electroporated with the ciliary membrane marker Arl13B and shRNAs to the various conditions described below. All analyses were done at E19. ( a , b ) NDE1 knockdown resulted in a significant increase in primary cilia length among electroporated radial glia progenitors (RGPs), though the NDE1/NDEL1 knockdown caused an even greater doubling of primary cilia length. NDEL1 knockdown resulted in no change from control RGP cilia length. ( c – e ) Inhibition of primary cilia assembly by knockdown of the intraflagellar transport protein IFT172 rescued the CyclinD1 accumulation seen in the NDE1/NDEL1 double knockdown ( e ). The distribution of apical process lengths of the NDE1/NDEL1/IFT172 triple knockdown more closely mirrored the NDE1 knockdown alone ( Fig. 2c ). Arrowheads mark electroporated RGP cells positive for CyclinD1. Dashed line indicates ventricle surface. Data are presented as mean±s.e.m. Unpaired t -tests used to compare conditions in b and e , Kolmogorov–Smirnov test used for non-parametric distributions in d , * P
Figure Legend Snippet: The G1-to-S arrest of radial glia progenitors in the NDE1/NDEL1 double knockdowns disrupts the regulation of primary cilia length. E16 rat embryonic brains were electroporated with the ciliary membrane marker Arl13B and shRNAs to the various conditions described below. All analyses were done at E19. ( a , b ) NDE1 knockdown resulted in a significant increase in primary cilia length among electroporated radial glia progenitors (RGPs), though the NDE1/NDEL1 knockdown caused an even greater doubling of primary cilia length. NDEL1 knockdown resulted in no change from control RGP cilia length. ( c – e ) Inhibition of primary cilia assembly by knockdown of the intraflagellar transport protein IFT172 rescued the CyclinD1 accumulation seen in the NDE1/NDEL1 double knockdown ( e ). The distribution of apical process lengths of the NDE1/NDEL1/IFT172 triple knockdown more closely mirrored the NDE1 knockdown alone ( Fig. 2c ). Arrowheads mark electroporated RGP cells positive for CyclinD1. Dashed line indicates ventricle surface. Data are presented as mean±s.e.m. Unpaired t -tests used to compare conditions in b and e , Kolmogorov–Smirnov test used for non-parametric distributions in d , * P

Techniques Used: Marker, Inhibition

RNAi-resistant NDE1 overexpression rescues all defects seen in radial glia progenitors across knockdown conditions. RNAi-resistant NDE1 was co-electroporated into embryonic rat brains with a GFP control empty vector or along with NDE1 shRNA or NDE1 and NDEL1 shRNAs at E16, and analysed at E20. ( a ) Restoration of apical interkinetic nuclear migration, mitosis and subsequent basal migration of progeny measured by live imaging. Arrowheads marks the radial glia progenitor (RGP) of interest. Montage panels are shown at 30 min intervals. Full movie can be found in Supplementary Material (see Supplementary Movie 5 ), as well as an additional movie that more clearly displays the two-daughter cell progeny ( Supplementary Movie 6 ). ( b ) Representative images of RGPs stained for PH3 within the VZ in various specified co-expression conditions. Arrowheads mark mitotic electroporated RGPs. Dashed line indicates ventricular surface. ( c ) Soma position of RGPs with RNAi-resistant NDE1 overexpressed during NDE1 knockdown indicates that the somal positioning distribution is rescued. ( d ) Overexpression of RNAi-resistant NDE1 with NDE1 knockdown also rescues the mitotic index. ( e ) Representative image of NDE1/NDEL1 double knockdown with overexpression of RNAi-NDE1, stained for PH3. Arrowheads mark mitotic electroporated RGPs. Dashed line indicates the ventricular surface. ( f , g ) Overexpression of RNAi-resistant NDE1 with double NDE1/NDEL1 knockdown rescues the distribution of RGP nuclei in the VZ and restores the mitotic index of RGP cells. Data are presented as scatterplot in c and f with bars representing the median±the interquartile range, and as mean±s.e.m. in d and g ). Kolmogorov–Smirnov test for non-parametric distributions used in c and f (* P
Figure Legend Snippet: RNAi-resistant NDE1 overexpression rescues all defects seen in radial glia progenitors across knockdown conditions. RNAi-resistant NDE1 was co-electroporated into embryonic rat brains with a GFP control empty vector or along with NDE1 shRNA or NDE1 and NDEL1 shRNAs at E16, and analysed at E20. ( a ) Restoration of apical interkinetic nuclear migration, mitosis and subsequent basal migration of progeny measured by live imaging. Arrowheads marks the radial glia progenitor (RGP) of interest. Montage panels are shown at 30 min intervals. Full movie can be found in Supplementary Material (see Supplementary Movie 5 ), as well as an additional movie that more clearly displays the two-daughter cell progeny ( Supplementary Movie 6 ). ( b ) Representative images of RGPs stained for PH3 within the VZ in various specified co-expression conditions. Arrowheads mark mitotic electroporated RGPs. Dashed line indicates ventricular surface. ( c ) Soma position of RGPs with RNAi-resistant NDE1 overexpressed during NDE1 knockdown indicates that the somal positioning distribution is rescued. ( d ) Overexpression of RNAi-resistant NDE1 with NDE1 knockdown also rescues the mitotic index. ( e ) Representative image of NDE1/NDEL1 double knockdown with overexpression of RNAi-NDE1, stained for PH3. Arrowheads mark mitotic electroporated RGPs. Dashed line indicates the ventricular surface. ( f , g ) Overexpression of RNAi-resistant NDE1 with double NDE1/NDEL1 knockdown rescues the distribution of RGP nuclei in the VZ and restores the mitotic index of RGP cells. Data are presented as scatterplot in c and f with bars representing the median±the interquartile range, and as mean±s.e.m. in d and g ). Kolmogorov–Smirnov test for non-parametric distributions used in c and f (* P

Techniques Used: Over Expression, Plasmid Preparation, shRNA, Migration, Imaging, Staining, Expressing

Effects of NDE1 and NDEL1 RNAi on neuronal migration into the cortical plate. ( a ) Representative images of embryonic day 20 (E20) rat neocortex with a control vector expressing GFP alone, or shRNAs to NDE1, NDEL1, or both genes along with a GFP reporter. Sections were stained for Tbr1 to mark neurons in the cortical plate (CP). Scale bar, 50 μm. ( b ) Quantification of the fraction of electroporated cells in the CP across NDE1, NDEL1 or combined RNAi conditions 4 days post electroporation at E16. All knockdown conditions nearly eliminated any cells from reaching the CP, in comparison with control neurons. Data are presented as mean±s.e.m., unpaired t-tests used for all comparisons. * P
Figure Legend Snippet: Effects of NDE1 and NDEL1 RNAi on neuronal migration into the cortical plate. ( a ) Representative images of embryonic day 20 (E20) rat neocortex with a control vector expressing GFP alone, or shRNAs to NDE1, NDEL1, or both genes along with a GFP reporter. Sections were stained for Tbr1 to mark neurons in the cortical plate (CP). Scale bar, 50 μm. ( b ) Quantification of the fraction of electroporated cells in the CP across NDE1, NDEL1 or combined RNAi conditions 4 days post electroporation at E16. All knockdown conditions nearly eliminated any cells from reaching the CP, in comparison with control neurons. Data are presented as mean±s.e.m., unpaired t-tests used for all comparisons. * P

Techniques Used: Migration, Plasmid Preparation, Expressing, Staining, Electroporation

NDEL1 overexpression rescues apical nuclear migration but not mitotic entry in NDE1 deficient radial glia progenitors. cDNA for NDEL1 was co-electroporated into embryonic rat brains with a GFP control empty vector or along with NDE1 shRNA or NDE1 and NDEL1 shRNAs at E16, and analysed at E20. ( a ) NDEL1 overexpression rescues apical interkinetic nuclear migration (INM) in radial glia progenitors (RGPs) where NDE1 has been knocked down, but these cells accumulate at the ventricular surface after apical INM, where they remain for hours without any evidence of mitosis. Montage panels are shown at 30 min intervals. Full movie can be found in Supplementary Movie 7 ). ( b ) Representative images of NDEL1 overexpression on both a wild-type and NDE1 RNAi background reveals an accumulation of the majority of RGP nuclei at the ventricular surface in a PH3 negative state. Arrowheads mark electroporated cells in mitosis. Dashed line represents the ventricular surface. ( c ) NDEL1 overexpression causes nearly all RGP soma to accumulate at the ventricular surface regardless of whether NDEL1 is overexpressed on a wild-type or NDE1 RNAi background. ( d ) Even though NDEL1 overexpression caused an accumulation of RGP soma at the ventricular surface, the mitotic index remained reduced to a level similar to NDE1 knockdown alone. ( e ) Representative image of RNAi-resistant NDEL1 overexpression with NDE1/NDEL1 double knockdown in RGP cells stained for PH3. Dashed line represents the ventricular surface. ( f , g ) RNAi-resistant NDEL1 overexpression with NDE1/NDEL1 double knockdown caused an accumulation of RGP soma at the ventricular surface similar to overexpression of NDEL1 on a wild-type or NDE1-deficient background, and once again failed to rescue the mitotic index. Data are presented as scatterplot in c and f with bars representing the median±the interquartile range, and as mean±s.e.m. in d and g . Kolmogorov–Smirnov test for non-parametric distributions used in c and f (* P
Figure Legend Snippet: NDEL1 overexpression rescues apical nuclear migration but not mitotic entry in NDE1 deficient radial glia progenitors. cDNA for NDEL1 was co-electroporated into embryonic rat brains with a GFP control empty vector or along with NDE1 shRNA or NDE1 and NDEL1 shRNAs at E16, and analysed at E20. ( a ) NDEL1 overexpression rescues apical interkinetic nuclear migration (INM) in radial glia progenitors (RGPs) where NDE1 has been knocked down, but these cells accumulate at the ventricular surface after apical INM, where they remain for hours without any evidence of mitosis. Montage panels are shown at 30 min intervals. Full movie can be found in Supplementary Movie 7 ). ( b ) Representative images of NDEL1 overexpression on both a wild-type and NDE1 RNAi background reveals an accumulation of the majority of RGP nuclei at the ventricular surface in a PH3 negative state. Arrowheads mark electroporated cells in mitosis. Dashed line represents the ventricular surface. ( c ) NDEL1 overexpression causes nearly all RGP soma to accumulate at the ventricular surface regardless of whether NDEL1 is overexpressed on a wild-type or NDE1 RNAi background. ( d ) Even though NDEL1 overexpression caused an accumulation of RGP soma at the ventricular surface, the mitotic index remained reduced to a level similar to NDE1 knockdown alone. ( e ) Representative image of RNAi-resistant NDEL1 overexpression with NDE1/NDEL1 double knockdown in RGP cells stained for PH3. Dashed line represents the ventricular surface. ( f , g ) RNAi-resistant NDEL1 overexpression with NDE1/NDEL1 double knockdown caused an accumulation of RGP soma at the ventricular surface similar to overexpression of NDEL1 on a wild-type or NDE1-deficient background, and once again failed to rescue the mitotic index. Data are presented as scatterplot in c and f with bars representing the median±the interquartile range, and as mean±s.e.m. in d and g . Kolmogorov–Smirnov test for non-parametric distributions used in c and f (* P

Techniques Used: Over Expression, Migration, Plasmid Preparation, shRNA, Staining

39) Product Images from "Hedgehog/GLI Signaling Activates Suppressor of Cytokine Signaling 1 (SOCS1) in Epidermal and Neural Tumor Cells"

Article Title: Hedgehog/GLI Signaling Activates Suppressor of Cytokine Signaling 1 (SOCS1) in Epidermal and Neural Tumor Cells

Journal: PLoS ONE

doi: 10.1371/journal.pone.0075317

SOCS1 knock down restores IFN-у/STAT1 signaling in cells with activated Hh signaling. A ) Western blot analysis of SOCS1, GLI2, and ACTB in GLI2act-HaCaT cells transduced with two shRNAs directed against human SOCS1 (shSOCS1_1, shSOCS1_2) and control shRNA (shCTRL) expressing GLI2 for the time indicated (left panel). SOCS1 mRNA levels were also analyzed by qRT-PCR in cells expressing GLI2 for 48h. B ) qRT-PCR of IFN-у target genes (CXCL10, CDKN1A, and ICAM1) measured in GLI2act-HaCaT cells after expressing GLI2 for 48h (+ DOX) with subsequent exposure to 1ng/ml recombinant IFN-у for 6h. C ) qRT-PCR of IFN-у target gene activation (HLA-DRA, ICAM1, IFIT1, TRIM22 and IRF1) in DAOY cell lines stably expressing either shSOCS1_1 and shSOCS1_2 or unspecific control shRNA (shCTRL). Cells were pretreated with 200 nM SAG for 120h to activate the Hh pathway and subsequently incubated with 1ng/ml recombinant IFN-у for 6h. mRNA levels are shown as ratio of IFN-у treated to untreated samples. Data are given as mean ± SD of biological triplicates.
Figure Legend Snippet: SOCS1 knock down restores IFN-у/STAT1 signaling in cells with activated Hh signaling. A ) Western blot analysis of SOCS1, GLI2, and ACTB in GLI2act-HaCaT cells transduced with two shRNAs directed against human SOCS1 (shSOCS1_1, shSOCS1_2) and control shRNA (shCTRL) expressing GLI2 for the time indicated (left panel). SOCS1 mRNA levels were also analyzed by qRT-PCR in cells expressing GLI2 for 48h. B ) qRT-PCR of IFN-у target genes (CXCL10, CDKN1A, and ICAM1) measured in GLI2act-HaCaT cells after expressing GLI2 for 48h (+ DOX) with subsequent exposure to 1ng/ml recombinant IFN-у for 6h. C ) qRT-PCR of IFN-у target gene activation (HLA-DRA, ICAM1, IFIT1, TRIM22 and IRF1) in DAOY cell lines stably expressing either shSOCS1_1 and shSOCS1_2 or unspecific control shRNA (shCTRL). Cells were pretreated with 200 nM SAG for 120h to activate the Hh pathway and subsequently incubated with 1ng/ml recombinant IFN-у for 6h. mRNA levels are shown as ratio of IFN-у treated to untreated samples. Data are given as mean ± SD of biological triplicates.

Techniques Used: Western Blot, Transduction, shRNA, Expressing, Quantitative RT-PCR, Recombinant, Activation Assay, Stable Transfection, Incubation

40) Product Images from "Control of Translation and miRNA-Dependent Repression by a Novel Poly(A) Binding Protein, hnRNP-Q"

Article Title: Control of Translation and miRNA-Dependent Repression by a Novel Poly(A) Binding Protein, hnRNP-Q

Journal: PLoS Biology

doi: 10.1371/journal.pbio.1001564

HnRNP-Q2 silencing stimulates global protein synthesis. L929 cells were infected with lentiviruses expressing the nontarget control shRNA or shRNAs (1 and 2) against hnRNP-Q. (A) Cytoplasmic extracts of control and hnRNP-Q knockdown cells equalized for protein content were subjected to Western blotting for hnRNP-Q2, PABP, eIF4GI, eIF4A, eIF4E, and β-actin, as indicated. (B) Quantitative analysis of hnRNP-Q2 bands in panel A using NIH ImageJ software. The values were normalized by those of β-actin. The value in control was set as 100%. The data are means with standard deviations from three experiments. (C) Protein synthesis in control and hnRNP-Q2-knockdown L929 cells as analyzed by [ 35 S]methionine/cysteine labeling. The mean values for 35 S incorporation into proteins from three independent assays with standard deviations are shown as percentages of the value in control (* p
Figure Legend Snippet: HnRNP-Q2 silencing stimulates global protein synthesis. L929 cells were infected with lentiviruses expressing the nontarget control shRNA or shRNAs (1 and 2) against hnRNP-Q. (A) Cytoplasmic extracts of control and hnRNP-Q knockdown cells equalized for protein content were subjected to Western blotting for hnRNP-Q2, PABP, eIF4GI, eIF4A, eIF4E, and β-actin, as indicated. (B) Quantitative analysis of hnRNP-Q2 bands in panel A using NIH ImageJ software. The values were normalized by those of β-actin. The value in control was set as 100%. The data are means with standard deviations from three experiments. (C) Protein synthesis in control and hnRNP-Q2-knockdown L929 cells as analyzed by [ 35 S]methionine/cysteine labeling. The mean values for 35 S incorporation into proteins from three independent assays with standard deviations are shown as percentages of the value in control (* p

Techniques Used: Infection, Expressing, shRNA, Western Blot, Software, Labeling

Related Articles

Clone Assay:

Article Title: Loss of the vitamin D receptor in human breast and prostate cancers strongly induces cell apoptosis through downregulation of Wnt/β-catenin signaling
Article Snippet: .. The clones selected were VDR (referred as “VDR-KD”, transfected with shRNA, TRCN000019506, Sigma) and non-target control (referred as “NT”, transfected with non-target RNA, SHC002V, Sigma). .. VDR-KD and NT cells from both MDA-MB-231 and PC3 cells were selected using 2 μg·mL−1 puromycin (Sigma, USA) for two weeks.

Transfection:

Article Title: Disrupted Membrane Structure and Intracellular Ca2+ Signaling in Adult Skeletal Muscle with Acute Knockdown of Bin1
Article Snippet: .. Enzymatic dissociation of individual FDB fibers FDB muscles transfected with either shRNA-control or shRNA-Bin1 were surgically removed in 0 Ca2+ Tyrode buffer, (in mM) 140 NaCl, 5 KCl, 10 HEPES, 2 MgCl2 (pH 7.2), and incubated in Tyrode buffer containing 2 mg/mL type I collagenase (Sigma C-5138) for 90 minutes at 37°C. ..

Article Title: Loss of the vitamin D receptor in human breast and prostate cancers strongly induces cell apoptosis through downregulation of Wnt/β-catenin signaling
Article Snippet: .. The clones selected were VDR (referred as “VDR-KD”, transfected with shRNA, TRCN000019506, Sigma) and non-target control (referred as “NT”, transfected with non-target RNA, SHC002V, Sigma). .. VDR-KD and NT cells from both MDA-MB-231 and PC3 cells were selected using 2 μg·mL−1 puromycin (Sigma, USA) for two weeks.

shRNA:

Article Title: Disrupted Membrane Structure and Intracellular Ca2+ Signaling in Adult Skeletal Muscle with Acute Knockdown of Bin1
Article Snippet: .. Enzymatic dissociation of individual FDB fibers FDB muscles transfected with either shRNA-control or shRNA-Bin1 were surgically removed in 0 Ca2+ Tyrode buffer, (in mM) 140 NaCl, 5 KCl, 10 HEPES, 2 MgCl2 (pH 7.2), and incubated in Tyrode buffer containing 2 mg/mL type I collagenase (Sigma C-5138) for 90 minutes at 37°C. ..

Article Title: Loss of the vitamin D receptor in human breast and prostate cancers strongly induces cell apoptosis through downregulation of Wnt/β-catenin signaling
Article Snippet: .. The clones selected were VDR (referred as “VDR-KD”, transfected with shRNA, TRCN000019506, Sigma) and non-target control (referred as “NT”, transfected with non-target RNA, SHC002V, Sigma). .. VDR-KD and NT cells from both MDA-MB-231 and PC3 cells were selected using 2 μg·mL−1 puromycin (Sigma, USA) for two weeks.

Article Title: Constitutive phosphorylation of the FOXO1 transcription factor in gastric cancer cells correlates with microvessel area and the expressions of angiogenesis-related molecules
Article Snippet: .. Lentivirus-mediated shRNA silencing of FOXO1 FOXO1 shRNA lentiviral particles and non-targeting shRNA control particles were purchased (Sigma, St Louis, MO, USA). .. The sequence of the shRNA targeting FOXO1 used in the present study is the following: CCGGGCCTGTTATCAATCTGCTAAACTCGAGTTTAGCAGATTGATAACAGGCTTTTTG.

Article Title: Api5 a new cofactor of estrogen receptor alpha involved in breast cancer outcome
Article Snippet: .. MCF7, T47D and MDA-MB-231 cell lines with stable silencing of Api5 were generated with lentiviral particles produced in HEK293FT (Invitrogen#R70007) with the two helper plasmids pLvVSVg and pLvPack (Sigma Aldrich) plus the desired lentiviral plasmid. shRNA against Api5 originate from lentiviral plasmids MISSIONH pLKO.1-puro (Sigma-Aldrich) exhibiting respectively the target sequences CCGGGCAGCTCAATTTATTC CGAAACTCGAGTTTCGGAATAAATTGAGCTGCTT TTTG (Clone ID: NM_006595.2-278s1c1) and CCGGGC CTATCAAGTGATATTGGATCTCGAGATCCAATATCA CTTGATAGGCTTTTTG (Clone ID:NM_006595.2-224s1c1) for shApi5 and shApi5′ transductions. .. The sh0 originates from a lentiviral plasmid MISSIONH pLKO.1-puro Non-Target shRNA Control Plasmid DNA (ref:SHC016-1EA) containing the sequence CCGGCAACAAGATGAAGAGCACCAACTCGAGTTG GTGCTCTTCATCTTGTTGTTTTTG, both from the Sigma Aldrich Company.

Article Title: Synergistic lethality between PARP-trapping and alantolactone-induced oxidative DNA damage in homologous recombination-proficient cancer cells
Article Snippet: .. The human PARP1 and OGG1-specific shRNA sequences were synthesized based on information validated by Sigma-Aldrich (PARP1: TRCN0000007929, TRCN0000007932; OGG1: TRCN0000314672, TRCN0000314739). .. These sequences were inserted into the pTet-pLKO-puro plasmid (Addgene, #21915) and lentiviral particles were produced in 293T cells transfected with the Tet-pLKO1-puro vector and the packaging vectors pMD2.G (Addgene, #12259) and psPAX2 (Addgene, #12260).

Article Title: The HER2- and Heregulin ?1 (HRG)-inducible TNFR Superfamily Member Fn14 Promotes HRG-driven Cell Migration, Invasion and MMP9 Expression
Article Snippet: .. Fn14 shRNA-448 cells expressing myc epitope-tagged Fn14 were additionally maintained in 1 μg/ml blasticidine (Sigma, St. Louis, MO, USA). ..

Article Title: Nerve growth factor-mediated inhibition of apoptosis post-caspase activation is due to removal of active caspase-3 in a lysosome-dependent manner
Article Snippet: .. Stable cell lines containing LAMP2a and Hsc70 shRNA constructs were selected with 0.5 μ g/ml puromycin (Sigma-Aldrich) for 1 week. .. The transduction efficiency was > 70% as judged by fluorescence microscopy using GFP as a marker for transduced cells.

Article Title: PCAF regulates the stability of the transcriptional regulator and cyclin-dependent kinase inhibitor p27Kip1
Article Snippet: .. The shRNA corresponding to PCAF (pLKO-1, puro-PCAF) and the shRNA random (pLKO-1, puro) used as a control were from Sigma-Aldrich. .. The siRNA corresponding to Skp2 and to GFP were from Dharmacon.

Stable Transfection:

Article Title: Nerve growth factor-mediated inhibition of apoptosis post-caspase activation is due to removal of active caspase-3 in a lysosome-dependent manner
Article Snippet: .. Stable cell lines containing LAMP2a and Hsc70 shRNA constructs were selected with 0.5 μ g/ml puromycin (Sigma-Aldrich) for 1 week. .. The transduction efficiency was > 70% as judged by fluorescence microscopy using GFP as a marker for transduced cells.

Synthesized:

Article Title: Synergistic lethality between PARP-trapping and alantolactone-induced oxidative DNA damage in homologous recombination-proficient cancer cells
Article Snippet: .. The human PARP1 and OGG1-specific shRNA sequences were synthesized based on information validated by Sigma-Aldrich (PARP1: TRCN0000007929, TRCN0000007932; OGG1: TRCN0000314672, TRCN0000314739). .. These sequences were inserted into the pTet-pLKO-puro plasmid (Addgene, #21915) and lentiviral particles were produced in 293T cells transfected with the Tet-pLKO1-puro vector and the packaging vectors pMD2.G (Addgene, #12259) and psPAX2 (Addgene, #12260).

Multiple Displacement Amplification:

Article Title: Api5 a new cofactor of estrogen receptor alpha involved in breast cancer outcome
Article Snippet: .. MCF7, T47D and MDA-MB-231 cell lines with stable silencing of Api5 were generated with lentiviral particles produced in HEK293FT (Invitrogen#R70007) with the two helper plasmids pLvVSVg and pLvPack (Sigma Aldrich) plus the desired lentiviral plasmid. shRNA against Api5 originate from lentiviral plasmids MISSIONH pLKO.1-puro (Sigma-Aldrich) exhibiting respectively the target sequences CCGGGCAGCTCAATTTATTC CGAAACTCGAGTTTCGGAATAAATTGAGCTGCTT TTTG (Clone ID: NM_006595.2-278s1c1) and CCGGGC CTATCAAGTGATATTGGATCTCGAGATCCAATATCA CTTGATAGGCTTTTTG (Clone ID:NM_006595.2-224s1c1) for shApi5 and shApi5′ transductions. .. The sh0 originates from a lentiviral plasmid MISSIONH pLKO.1-puro Non-Target shRNA Control Plasmid DNA (ref:SHC016-1EA) containing the sequence CCGGCAACAAGATGAAGAGCACCAACTCGAGTTG GTGCTCTTCATCTTGTTGTTTTTG, both from the Sigma Aldrich Company.

Incubation:

Article Title: Disrupted Membrane Structure and Intracellular Ca2+ Signaling in Adult Skeletal Muscle with Acute Knockdown of Bin1
Article Snippet: .. Enzymatic dissociation of individual FDB fibers FDB muscles transfected with either shRNA-control or shRNA-Bin1 were surgically removed in 0 Ca2+ Tyrode buffer, (in mM) 140 NaCl, 5 KCl, 10 HEPES, 2 MgCl2 (pH 7.2), and incubated in Tyrode buffer containing 2 mg/mL type I collagenase (Sigma C-5138) for 90 minutes at 37°C. ..

Construct:

Article Title: Nerve growth factor-mediated inhibition of apoptosis post-caspase activation is due to removal of active caspase-3 in a lysosome-dependent manner
Article Snippet: .. Stable cell lines containing LAMP2a and Hsc70 shRNA constructs were selected with 0.5 μ g/ml puromycin (Sigma-Aldrich) for 1 week. .. The transduction efficiency was > 70% as judged by fluorescence microscopy using GFP as a marker for transduced cells.

Produced:

Article Title: Api5 a new cofactor of estrogen receptor alpha involved in breast cancer outcome
Article Snippet: .. MCF7, T47D and MDA-MB-231 cell lines with stable silencing of Api5 were generated with lentiviral particles produced in HEK293FT (Invitrogen#R70007) with the two helper plasmids pLvVSVg and pLvPack (Sigma Aldrich) plus the desired lentiviral plasmid. shRNA against Api5 originate from lentiviral plasmids MISSIONH pLKO.1-puro (Sigma-Aldrich) exhibiting respectively the target sequences CCGGGCAGCTCAATTTATTC CGAAACTCGAGTTTCGGAATAAATTGAGCTGCTT TTTG (Clone ID: NM_006595.2-278s1c1) and CCGGGC CTATCAAGTGATATTGGATCTCGAGATCCAATATCA CTTGATAGGCTTTTTG (Clone ID:NM_006595.2-224s1c1) for shApi5 and shApi5′ transductions. .. The sh0 originates from a lentiviral plasmid MISSIONH pLKO.1-puro Non-Target shRNA Control Plasmid DNA (ref:SHC016-1EA) containing the sequence CCGGCAACAAGATGAAGAGCACCAACTCGAGTTG GTGCTCTTCATCTTGTTGTTTTTG, both from the Sigma Aldrich Company.

Generated:

Article Title: Api5 a new cofactor of estrogen receptor alpha involved in breast cancer outcome
Article Snippet: .. MCF7, T47D and MDA-MB-231 cell lines with stable silencing of Api5 were generated with lentiviral particles produced in HEK293FT (Invitrogen#R70007) with the two helper plasmids pLvVSVg and pLvPack (Sigma Aldrich) plus the desired lentiviral plasmid. shRNA against Api5 originate from lentiviral plasmids MISSIONH pLKO.1-puro (Sigma-Aldrich) exhibiting respectively the target sequences CCGGGCAGCTCAATTTATTC CGAAACTCGAGTTTCGGAATAAATTGAGCTGCTT TTTG (Clone ID: NM_006595.2-278s1c1) and CCGGGC CTATCAAGTGATATTGGATCTCGAGATCCAATATCA CTTGATAGGCTTTTTG (Clone ID:NM_006595.2-224s1c1) for shApi5 and shApi5′ transductions. .. The sh0 originates from a lentiviral plasmid MISSIONH pLKO.1-puro Non-Target shRNA Control Plasmid DNA (ref:SHC016-1EA) containing the sequence CCGGCAACAAGATGAAGAGCACCAACTCGAGTTG GTGCTCTTCATCTTGTTGTTTTTG, both from the Sigma Aldrich Company.

Expressing:

Article Title: The HER2- and Heregulin ?1 (HRG)-inducible TNFR Superfamily Member Fn14 Promotes HRG-driven Cell Migration, Invasion and MMP9 Expression
Article Snippet: .. Fn14 shRNA-448 cells expressing myc epitope-tagged Fn14 were additionally maintained in 1 μg/ml blasticidine (Sigma, St. Louis, MO, USA). ..

Plasmid Preparation:

Article Title: Api5 a new cofactor of estrogen receptor alpha involved in breast cancer outcome
Article Snippet: .. MCF7, T47D and MDA-MB-231 cell lines with stable silencing of Api5 were generated with lentiviral particles produced in HEK293FT (Invitrogen#R70007) with the two helper plasmids pLvVSVg and pLvPack (Sigma Aldrich) plus the desired lentiviral plasmid. shRNA against Api5 originate from lentiviral plasmids MISSIONH pLKO.1-puro (Sigma-Aldrich) exhibiting respectively the target sequences CCGGGCAGCTCAATTTATTC CGAAACTCGAGTTTCGGAATAAATTGAGCTGCTT TTTG (Clone ID: NM_006595.2-278s1c1) and CCGGGC CTATCAAGTGATATTGGATCTCGAGATCCAATATCA CTTGATAGGCTTTTTG (Clone ID:NM_006595.2-224s1c1) for shApi5 and shApi5′ transductions. .. The sh0 originates from a lentiviral plasmid MISSIONH pLKO.1-puro Non-Target shRNA Control Plasmid DNA (ref:SHC016-1EA) containing the sequence CCGGCAACAAGATGAAGAGCACCAACTCGAGTTG GTGCTCTTCATCTTGTTGTTTTTG, both from the Sigma Aldrich Company.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Millipore ln shrna egr 1
    Knockdown of <t>Egr-1</t> blocks NMDA-induced AMPAR endocytosis in mouse hippocampal neurons in culture. Neurons infected with <t>Ln-shRNA-ctl</t> or Ln-shRNA-Egr-1 were treated with NMDA or vehicle and subjected to antibody feeding protocol to analyze GluA2 endocytosis
    Ln Shrna Egr 1, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ln shrna egr 1/product/Millipore
    Average 99 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    ln shrna egr 1 - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    91
    Millipore lentiviral shrna
    Minocycline inhibits PDGF-BB-induced NF-κB and AP-1 activation. A, PDGF-BB induces time-dependent NF-κB activation. Quiescent SMC were incubated with PDGF-BB (10 ng/ml). At the indicated time periods, activation of NF-κB was analyzed by immunoblotting using antibodies that specifically detect phosphorylated p65 at Ser 536 . B, PDGF-BB induces time-dependent AP-1 activation. Quiescent SMC incubated as in A were analyzed for AP-1 activation by immunoblotting using antibodies that specifically detect phosphorylated c-Jun at Ser 73 . C, Silencing IKKβ or pre-treatment with minocycline inhibit PDGF-BB-induced NF-κB activation. SMC incubated with <t>lentiviral</t> IKKβ <t>shRNA</t> (moi0.5 for 48 h) were made quiescent and treated with PDGF-BB (10 ng/ml for 30 min). In a subset of experiments, quiescent SMC were incubated with minocycline (10 μM for 15 min) and then treated with PDGF-BB (10 ng/ml for 30 min). Activation of NF-κB was analyzed as in A. D, Silencing JNK2 or pre-treatment with minocycline inhibits PDGF-BB-induced AP-1 activation. SMC incubated with lentiviral JNK2 shRNA (moi 0.5 for 48 h) were made quiescent and treated with PDGF-BB (10 ng/ml for 30 min). In a subset of experiments, quiescent SMC were incubated with minocycline (10 mM for 15 min) and then treated with PDGF-BB (10 ng/ml for 30 min). Activation of AP-1 was analyzed as in B. Silencing IKKβ and JNK2 was confirmed by immunoblotting. JNK2 and IKKβ served as off-targets in IKKβ and JNK2 silenced cells, respectively (right hand panels in C and D). Tubulin served as a loading control. Bar graphs at the bottom of panels in A-D represent densitometric analyses from three independent experiments. * P
    Lentiviral Shrna, supplied by Millipore, used in various techniques. Bioz Stars score: 91/100, based on 48 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentiviral shrna/product/Millipore
    Average 91 stars, based on 48 article reviews
    Price from $9.99 to $1999.99
    lentiviral shrna - by Bioz Stars, 2020-09
    91/100 stars
      Buy from Supplier

    Image Search Results


    Knockdown of Egr-1 blocks NMDA-induced AMPAR endocytosis in mouse hippocampal neurons in culture. Neurons infected with Ln-shRNA-ctl or Ln-shRNA-Egr-1 were treated with NMDA or vehicle and subjected to antibody feeding protocol to analyze GluA2 endocytosis

    Journal: The Journal of Biological Chemistry

    Article Title: Early Growth Response 1 (Egr-1) Regulates N-Methyl-d-aspartate Receptor (NMDAR)-dependent Transcription of PSD-95 and α-Amino-3-hydroxy-5-methyl-4-isoxazole Propionic Acid Receptor (AMPAR) Trafficking in Hippocampal Primary Neurons *

    doi: 10.1074/jbc.M115.668889

    Figure Lengend Snippet: Knockdown of Egr-1 blocks NMDA-induced AMPAR endocytosis in mouse hippocampal neurons in culture. Neurons infected with Ln-shRNA-ctl or Ln-shRNA-Egr-1 were treated with NMDA or vehicle and subjected to antibody feeding protocol to analyze GluA2 endocytosis

    Article Snippet: Neurons were infected with Ln-shRNA-Egr-1 or Ln-shRNA control (Ln-shRNA-ctl) for 48 h. Surface GluA2 receptor was labeled with anti-mouse GluA2 antibody on living neurons (Millipore MAB397; 1:200) at 37 °C for 30 min. Neurons were treated with 20 μ m of NMDA for 3 min to induce AMPAR endocytosis ( ).

    Techniques: Infection, shRNA, CTL Assay

    Knockdown of Egr-1 inhibits NMDA-induced down-regulation of PSD-95 and surface expression of AMPARs in mouse hippocampal cultured neurons. Hippocampal primary neurons were infected with Ln-shRNA-Egr-1 or Ln-shRNA-ctl. Infected cultures were treated with

    Journal: The Journal of Biological Chemistry

    Article Title: Early Growth Response 1 (Egr-1) Regulates N-Methyl-d-aspartate Receptor (NMDAR)-dependent Transcription of PSD-95 and α-Amino-3-hydroxy-5-methyl-4-isoxazole Propionic Acid Receptor (AMPAR) Trafficking in Hippocampal Primary Neurons *

    doi: 10.1074/jbc.M115.668889

    Figure Lengend Snippet: Knockdown of Egr-1 inhibits NMDA-induced down-regulation of PSD-95 and surface expression of AMPARs in mouse hippocampal cultured neurons. Hippocampal primary neurons were infected with Ln-shRNA-Egr-1 or Ln-shRNA-ctl. Infected cultures were treated with

    Article Snippet: Neurons were infected with Ln-shRNA-Egr-1 or Ln-shRNA control (Ln-shRNA-ctl) for 48 h. Surface GluA2 receptor was labeled with anti-mouse GluA2 antibody on living neurons (Millipore MAB397; 1:200) at 37 °C for 30 min. Neurons were treated with 20 μ m of NMDA for 3 min to induce AMPAR endocytosis ( ).

    Techniques: Expressing, Cell Culture, Infection, shRNA, CTL Assay

    Suppression of Eed or Suz12 impairs leukemia progression in vivo (A) Schematic of two-color competition assay measuring impact of LMN-shRNAs on leukemia expansion in vivo. MLL-AF9;Nras G12D leukemia cultures were transduced with either experimental shRNAs from the LMN vector, or with a Ren.713 control shRNA expressed from LMN-mCherry. Experimental and control cultures were mixed at 1:1 GFP:mCherry ratio followed by transplantation of 1 × 10 6 cells into secondary recipients on day 2 post-infection, prior to any depletion of GFP+ cells in vitro. Upon reaching terminal disease state (~15 days), as indicated by moribund appearance and whole-body bioluminescent signal, mice were sacrificed and bone marrow was collected for flow cytometry evaluation. Gating was performed on donor-derived leukemia populations (CD45.2+) and the ratio of GFP:mCherry was measured using a LSRII flow cytometer. (B) Percentage of GFP and mCherry positivity within donor-derived leukemia cells (CD45.2+) derived from bone marrow at the terminal disease endpoint (~15 days following transplant). Each shRNA group included 5 mice. (C–D) Tet-on competent MLL-AF9;Nras G12D leukemia cultures were retrovirally transduced with TRPMV-Neo constructs (pSIN-TRE-dsRed-miR30-shRNA-PGK-Venus-IRES-NeoR) followed by G418 selection (1 mg/ml for 6 days). Transduced cells were then transplanted into secondary recipient animals, followed by initiation of doxycycline administration after 1–2 days. Mice were monitored thereafter by bioluminescent imaging (IVIS Spectrum system; Caliper LifeSciences) and for differences in overall survival. Bone marrow from leukemic mice at terminal disease stage, was analyzed by flow cytometry for the percentage of dsRed+/shRNA+ cells in donor-derived (CD45.2+) leukemia populations. Each shRNA group contained 8–10 mice. (C) Kaplan-Meier survival curves of mice transplanted with Tet-On competent MLL-AF9;Nras G12D ). Statistical significance was calculated by using log-rank test comparing to shRen control group; *, P

    Journal: Oncogene

    Article Title: The Polycomb complex PRC2 supports aberrant self-renewal in a mouse model of MLL-AF9;NrasG12D acute myeloid leukemia

    doi: 10.1038/onc.2012.110

    Figure Lengend Snippet: Suppression of Eed or Suz12 impairs leukemia progression in vivo (A) Schematic of two-color competition assay measuring impact of LMN-shRNAs on leukemia expansion in vivo. MLL-AF9;Nras G12D leukemia cultures were transduced with either experimental shRNAs from the LMN vector, or with a Ren.713 control shRNA expressed from LMN-mCherry. Experimental and control cultures were mixed at 1:1 GFP:mCherry ratio followed by transplantation of 1 × 10 6 cells into secondary recipients on day 2 post-infection, prior to any depletion of GFP+ cells in vitro. Upon reaching terminal disease state (~15 days), as indicated by moribund appearance and whole-body bioluminescent signal, mice were sacrificed and bone marrow was collected for flow cytometry evaluation. Gating was performed on donor-derived leukemia populations (CD45.2+) and the ratio of GFP:mCherry was measured using a LSRII flow cytometer. (B) Percentage of GFP and mCherry positivity within donor-derived leukemia cells (CD45.2+) derived from bone marrow at the terminal disease endpoint (~15 days following transplant). Each shRNA group included 5 mice. (C–D) Tet-on competent MLL-AF9;Nras G12D leukemia cultures were retrovirally transduced with TRPMV-Neo constructs (pSIN-TRE-dsRed-miR30-shRNA-PGK-Venus-IRES-NeoR) followed by G418 selection (1 mg/ml for 6 days). Transduced cells were then transplanted into secondary recipient animals, followed by initiation of doxycycline administration after 1–2 days. Mice were monitored thereafter by bioluminescent imaging (IVIS Spectrum system; Caliper LifeSciences) and for differences in overall survival. Bone marrow from leukemic mice at terminal disease stage, was analyzed by flow cytometry for the percentage of dsRed+/shRNA+ cells in donor-derived (CD45.2+) leukemia populations. Each shRNA group contained 8–10 mice. (C) Kaplan-Meier survival curves of mice transplanted with Tet-On competent MLL-AF9;Nras G12D ). Statistical significance was calculated by using log-rank test comparing to shRen control group; *, P

    Article Snippet: All shRNAs evaluated were identified from a pooled negative-selection shRNA screen reported previously ( leukemia or 32D myeloblasts were transduced with individual LMN-shRNA vectors (MSCV-miR30-shRNA-PGK-NeoR-IRES-GFP), followed by measurement of the GFP-percentage at day 2 and day 12 post-infection using a Guava Easycyte (Millipore).

    Techniques: In Vivo, Competitive Binding Assay, Transduction, Plasmid Preparation, shRNA, Transplantation Assay, Infection, In Vitro, Mouse Assay, Flow Cytometry, Cytometry, Derivative Assay, Construct, Selection, Imaging

    RNAi screen identifies Eed and Suz12 as unique requirements for growth of MLL-AF9;Nras G12D leukemia (A) Scatter-plot comparison of the relative growth inhibition conferred by LMN-shRNAs in MLL-AF9;Nras G12D ). MLL-AF9;Nras G12D ), relative GFP-depletion is a suitable assay for comparing growth effects in each line. Control shRNAs are indicated with white circles. Box indicates shRNAs with leukemia-specific growth inhibition. (B–F) Relative growth inhibition conferred by indicated LMN-shRNAs in EML, G1E, leukemia, and 32D cell lines, calculated as in (A) (n = 3). (G–I) Quantitative reverse transcription PCR measuring knockdown efficiency in 32D myeloblasts cells following transduction with LMN-shRNAs and selection with G418. Measurements were normalized to Gapdh, with the relative mRNA level in the cells with control Ren shRNA set to 1 (n = 3). (J) Relative change double-transduced cell percentage following co-transduction with indicated LMN-shRNAs linked to either GFP or mCherry reporters. The results were normalized to the GFP+/mCherry+ percentage measured at day 1, set to 1 (n = 3). (K, L ) H3K27me3 Western blotting of acid extracted histones prepared from 32D cells transduced with the indicated LMN-shRNA following G418 selection. The levels of total histone H3 serve as a loading control. A representative experiment of three replicates is shown. All error bars represent s.e.m.

    Journal: Oncogene

    Article Title: The Polycomb complex PRC2 supports aberrant self-renewal in a mouse model of MLL-AF9;NrasG12D acute myeloid leukemia

    doi: 10.1038/onc.2012.110

    Figure Lengend Snippet: RNAi screen identifies Eed and Suz12 as unique requirements for growth of MLL-AF9;Nras G12D leukemia (A) Scatter-plot comparison of the relative growth inhibition conferred by LMN-shRNAs in MLL-AF9;Nras G12D ). MLL-AF9;Nras G12D ), relative GFP-depletion is a suitable assay for comparing growth effects in each line. Control shRNAs are indicated with white circles. Box indicates shRNAs with leukemia-specific growth inhibition. (B–F) Relative growth inhibition conferred by indicated LMN-shRNAs in EML, G1E, leukemia, and 32D cell lines, calculated as in (A) (n = 3). (G–I) Quantitative reverse transcription PCR measuring knockdown efficiency in 32D myeloblasts cells following transduction with LMN-shRNAs and selection with G418. Measurements were normalized to Gapdh, with the relative mRNA level in the cells with control Ren shRNA set to 1 (n = 3). (J) Relative change double-transduced cell percentage following co-transduction with indicated LMN-shRNAs linked to either GFP or mCherry reporters. The results were normalized to the GFP+/mCherry+ percentage measured at day 1, set to 1 (n = 3). (K, L ) H3K27me3 Western blotting of acid extracted histones prepared from 32D cells transduced with the indicated LMN-shRNA following G418 selection. The levels of total histone H3 serve as a loading control. A representative experiment of three replicates is shown. All error bars represent s.e.m.

    Article Snippet: All shRNAs evaluated were identified from a pooled negative-selection shRNA screen reported previously ( leukemia or 32D myeloblasts were transduced with individual LMN-shRNA vectors (MSCV-miR30-shRNA-PGK-NeoR-IRES-GFP), followed by measurement of the GFP-percentage at day 2 and day 12 post-infection using a Guava Easycyte (Millipore).

    Techniques: Inhibition, Polymerase Chain Reaction, Transduction, Selection, shRNA, Western Blot

    Suppression of Eed or Suz12 results in differentiation of MLL-AF9;Nras G12D leukemia cells (A, B) ), following 5 days of 1 ug/ml doxycycline treatment. Untreated TET-off leukemia cells were used a negative control. Men1, Eed, and Suz12 LMN-shRNAs were transduced into MLL-AF9;Nras G12D leukemia cultures, with cell-surface staining and flow-cytometry analysis performed on day 7 post-infection. Since the average infection efficiency was ~ 20%, shRNA+/GFP+ cells were compared to shRNA-/GFP- within each culture as an internal negative control. (C) Light microscopy of May–Grunwald/Giemsa-stained MLL-AF9;Nras G12D leukemia cells under the same experimental condition used in (A, B), except G418 was administered to LMN-transduced cells following infection to select for shRNA+/GFP+ cells. Imaging was performed using X40 objective. Representative images of three biological replicates are shown. (D) GSEA of microarray data obtained from leukemia cells transduced with Eed and Suz12 LMN-shRNAs, 5 days post-infection/G418 selection. NES, normalized enrichment score; FDR q-val, false discovery rate q-value. All error bars shown represent s.e.m.

    Journal: Oncogene

    Article Title: The Polycomb complex PRC2 supports aberrant self-renewal in a mouse model of MLL-AF9;NrasG12D acute myeloid leukemia

    doi: 10.1038/onc.2012.110

    Figure Lengend Snippet: Suppression of Eed or Suz12 results in differentiation of MLL-AF9;Nras G12D leukemia cells (A, B) ), following 5 days of 1 ug/ml doxycycline treatment. Untreated TET-off leukemia cells were used a negative control. Men1, Eed, and Suz12 LMN-shRNAs were transduced into MLL-AF9;Nras G12D leukemia cultures, with cell-surface staining and flow-cytometry analysis performed on day 7 post-infection. Since the average infection efficiency was ~ 20%, shRNA+/GFP+ cells were compared to shRNA-/GFP- within each culture as an internal negative control. (C) Light microscopy of May–Grunwald/Giemsa-stained MLL-AF9;Nras G12D leukemia cells under the same experimental condition used in (A, B), except G418 was administered to LMN-transduced cells following infection to select for shRNA+/GFP+ cells. Imaging was performed using X40 objective. Representative images of three biological replicates are shown. (D) GSEA of microarray data obtained from leukemia cells transduced with Eed and Suz12 LMN-shRNAs, 5 days post-infection/G418 selection. NES, normalized enrichment score; FDR q-val, false discovery rate q-value. All error bars shown represent s.e.m.

    Article Snippet: All shRNAs evaluated were identified from a pooled negative-selection shRNA screen reported previously ( leukemia or 32D myeloblasts were transduced with individual LMN-shRNA vectors (MSCV-miR30-shRNA-PGK-NeoR-IRES-GFP), followed by measurement of the GFP-percentage at day 2 and day 12 post-infection using a Guava Easycyte (Millipore).

    Techniques: Negative Control, Staining, Flow Cytometry, Cytometry, Infection, shRNA, Light Microscopy, Imaging, Microarray, Transduction, Selection

    GIV directly and constitutively binds IRS1. (A) Immunoprecipitation was carried out on lysates (right) of starved or insulin-treated Cos7 cells expressing IRS1-HA. Lysates and bound immune complexes (left) were analyzed for activated GIV (pY1764-GIV), total (t)GIV, IRS1 (HA), p85α, SHP2, and Grb2 by IB. (B) Pull-down assays were carried out with recombinant His-GIV-CT and GST-tagged domains of IRS1 (see the Supplemental Material) immobilized on glutathione beads. Bound (top) and input (bottom) proteins were analyzed for His-GIV-CT by IB with His mAb. (C) Schematic summarizing how the presence or absence of GIV affects localization and phosphoactivation of IRS1.

    Journal: Molecular Biology of the Cell

    Article Title: Activation of G proteins by GIV-GEF is a pivot point for insulin resistance and sensitivity

    doi: 10.1091/mbc.E15-08-0553

    Figure Lengend Snippet: GIV directly and constitutively binds IRS1. (A) Immunoprecipitation was carried out on lysates (right) of starved or insulin-treated Cos7 cells expressing IRS1-HA. Lysates and bound immune complexes (left) were analyzed for activated GIV (pY1764-GIV), total (t)GIV, IRS1 (HA), p85α, SHP2, and Grb2 by IB. (B) Pull-down assays were carried out with recombinant His-GIV-CT and GST-tagged domains of IRS1 (see the Supplemental Material) immobilized on glutathione beads. Bound (top) and input (bottom) proteins were analyzed for His-GIV-CT by IB with His mAb. (C) Schematic summarizing how the presence or absence of GIV affects localization and phosphoactivation of IRS1.

    Article Snippet: Control short hairpin RNA (shRNA) and GIV shRNA Cos7 stable cells were starved and stimulated with 100 nM insulin and stained with anti-Gαi3 (1:30; Calbiochem, San Diego, CA) and phosho-InRβ antibodies (1:100; Santa Cruz Biotechnologies, Dallas, TX).

    Techniques: Immunoprecipitation, Expressing, Recombinant

    Activation of Gαi by GIV-GEF is essential for glucose uptake in skeletal muscles. (A) Left, lysates of L6 myotubes treated either with control (Scr) or with GIV siRNA were analyzed for GIV and tubulin by IB. Right, bar graph displays efficiency of GIV depletion. (B) Control (Scr siRNA) and GIV-depleted (GIV siRNA) L6 myotubes were analyzed for glucose uptake after insulin stimulation by fluorometric assay. Bar graphs display fold change in uptake compared with starved controls ( y -axis). Error bars represent mean ± SD; n = 3. (C) Control L6 myotubes or those stably expressing siRNA-resistant GIV-WT, GIV-FA, or GIV-SD were treated (+) or not (−) with either control (Scr) or GIV siRNA before lysis. Equal aliquots of whole-cell lysates were analyzed for GIV-FLAG expression by IB for GIV and tubulin. (D) L6 myotubes stably expressing siRNA-resistant GIV-WT, GIV-FA, or GIV-SD were depleted of endogenous GIV by siRNA as in C and analyzed for glucose uptake after insulin stimulation by fluorometric assay. Bar graphs display fold change in uptake compared with starved controls ( y -axis). Error bars represent mean ± SD; n = 3. (E and F) L6 myotubes stably expressing Gαi3-WT and Gαi3-WF were analyzed for Gαi3 and tubulin by IB (E) and for glucose uptake (F). Bar graphs display fold change in uptake compared with starved controls ( y -axis). Error bars represent mean ± SD; n = 3.

    Journal: Molecular Biology of the Cell

    Article Title: Activation of G proteins by GIV-GEF is a pivot point for insulin resistance and sensitivity

    doi: 10.1091/mbc.E15-08-0553

    Figure Lengend Snippet: Activation of Gαi by GIV-GEF is essential for glucose uptake in skeletal muscles. (A) Left, lysates of L6 myotubes treated either with control (Scr) or with GIV siRNA were analyzed for GIV and tubulin by IB. Right, bar graph displays efficiency of GIV depletion. (B) Control (Scr siRNA) and GIV-depleted (GIV siRNA) L6 myotubes were analyzed for glucose uptake after insulin stimulation by fluorometric assay. Bar graphs display fold change in uptake compared with starved controls ( y -axis). Error bars represent mean ± SD; n = 3. (C) Control L6 myotubes or those stably expressing siRNA-resistant GIV-WT, GIV-FA, or GIV-SD were treated (+) or not (−) with either control (Scr) or GIV siRNA before lysis. Equal aliquots of whole-cell lysates were analyzed for GIV-FLAG expression by IB for GIV and tubulin. (D) L6 myotubes stably expressing siRNA-resistant GIV-WT, GIV-FA, or GIV-SD were depleted of endogenous GIV by siRNA as in C and analyzed for glucose uptake after insulin stimulation by fluorometric assay. Bar graphs display fold change in uptake compared with starved controls ( y -axis). Error bars represent mean ± SD; n = 3. (E and F) L6 myotubes stably expressing Gαi3-WT and Gαi3-WF were analyzed for Gαi3 and tubulin by IB (E) and for glucose uptake (F). Bar graphs display fold change in uptake compared with starved controls ( y -axis). Error bars represent mean ± SD; n = 3.

    Article Snippet: Control short hairpin RNA (shRNA) and GIV shRNA Cos7 stable cells were starved and stimulated with 100 nM insulin and stained with anti-Gαi3 (1:30; Calbiochem, San Diego, CA) and phosho-InRβ antibodies (1:100; Santa Cruz Biotechnologies, Dallas, TX).

    Techniques: Activation Assay, Stable Transfection, Expressing, Lysis

    GIV-GEF directly binds and regulates the localization and activation of IRS1. (A) Schematic for the biosensor phocus-2nes is shown. Energy transfer from CFP to YFP occurs only when Y941 is phosphorylated and the N-SH2 domain of p85α binds the phosphotyrosine ligand. (B and C) Serum-starved Cos7 cells coexpressing phocus-2nes with either GIV-WT-FLAG or GIV-SD-FLAG were stimulated with insulin, fixed, stained for FLAG (far red), and analyzed for FRET using confocal microscopy. Images panels display (from left to right, B) CFP, YFP, FLAG (GIV), and intensities of acceptor emission due to FRET in each pixel 5 min after insulin stimulation. Image panels of serum-starved (0 min) cells are shown in Supplemental Figure S3A. Bar graph (C) displays the FRET efficiency observed in GIV-WT versus GIV-SD cells at 0 and 5 min. The analysis represents five regions of interest from 4 to 6 cells/experiment (three independent experiments). Error bars = mean ± SD. (D) Serum-starved control (sh Control) or GIV-depleted (sh GIV) Cos7 cells expressing IRS1-HA were stimulated with insulin, fixed, stained for HA (green) and DAPI/DNA (blue), and analyzed by confocal microscopy. Insets show the magnification of the boxed regions. Scale bar: 10 μm. Arrowheads denote PM. (E) Serum-starved control (sh Control) or GIV-depleted (sh GIV) Cos7 cells were stimulated with insulin, fixed, stained for endogenous pY632-IRS1 (red) and DAPI/DNA (blue), and analyzed by confocal microscopy. Insets show the magnification of the boxed regions. Scale bar: 10 μm. (F) Immunoprecipitation was carried out on lysates of starved or insulin-stimulated control (sh Control) or GIV-depleted (sh GIV) Cos7 cells expressing InsRβ-FLAG. Bound immune complexes were analyzed for IRS1, InsRβ (FLAG), and IgG by IB. IRS1 coimmunoprecipitated with InsRβ in control cells but not in GIV-depleted cells. (G) GIV-depleted HeLa cells stably expressing GIV-WT or GIV-SD were transiently transfected with InsR-HA, starved, and stimulated with 100 nM insulin for 5 min before lysis. InsR and receptor-bound complexes were immunoprecipitated by incubating equal aliquots of lysates with anti-HA mAb or contro IgG, followed by protein G beads. Immune complexes were analyzed for GIV, InsR (HA), ligand-activated InsR (pY1150, 1151 InsR), pY632 IRS1, and Gαi3 by IB. Equal loading of lysates was confirmed by analyzing GIV, Gαi3, and tubulin by IB. Maximal autophosphorylation of InsR and recruitment of GIV, IRS1, and Gαi3 to the receptor was observed in cells expressing GIV-WT exclusively after insulin stimulation, but not in cells expressing GIV-SD.

    Journal: Molecular Biology of the Cell

    Article Title: Activation of G proteins by GIV-GEF is a pivot point for insulin resistance and sensitivity

    doi: 10.1091/mbc.E15-08-0553

    Figure Lengend Snippet: GIV-GEF directly binds and regulates the localization and activation of IRS1. (A) Schematic for the biosensor phocus-2nes is shown. Energy transfer from CFP to YFP occurs only when Y941 is phosphorylated and the N-SH2 domain of p85α binds the phosphotyrosine ligand. (B and C) Serum-starved Cos7 cells coexpressing phocus-2nes with either GIV-WT-FLAG or GIV-SD-FLAG were stimulated with insulin, fixed, stained for FLAG (far red), and analyzed for FRET using confocal microscopy. Images panels display (from left to right, B) CFP, YFP, FLAG (GIV), and intensities of acceptor emission due to FRET in each pixel 5 min after insulin stimulation. Image panels of serum-starved (0 min) cells are shown in Supplemental Figure S3A. Bar graph (C) displays the FRET efficiency observed in GIV-WT versus GIV-SD cells at 0 and 5 min. The analysis represents five regions of interest from 4 to 6 cells/experiment (three independent experiments). Error bars = mean ± SD. (D) Serum-starved control (sh Control) or GIV-depleted (sh GIV) Cos7 cells expressing IRS1-HA were stimulated with insulin, fixed, stained for HA (green) and DAPI/DNA (blue), and analyzed by confocal microscopy. Insets show the magnification of the boxed regions. Scale bar: 10 μm. Arrowheads denote PM. (E) Serum-starved control (sh Control) or GIV-depleted (sh GIV) Cos7 cells were stimulated with insulin, fixed, stained for endogenous pY632-IRS1 (red) and DAPI/DNA (blue), and analyzed by confocal microscopy. Insets show the magnification of the boxed regions. Scale bar: 10 μm. (F) Immunoprecipitation was carried out on lysates of starved or insulin-stimulated control (sh Control) or GIV-depleted (sh GIV) Cos7 cells expressing InsRβ-FLAG. Bound immune complexes were analyzed for IRS1, InsRβ (FLAG), and IgG by IB. IRS1 coimmunoprecipitated with InsRβ in control cells but not in GIV-depleted cells. (G) GIV-depleted HeLa cells stably expressing GIV-WT or GIV-SD were transiently transfected with InsR-HA, starved, and stimulated with 100 nM insulin for 5 min before lysis. InsR and receptor-bound complexes were immunoprecipitated by incubating equal aliquots of lysates with anti-HA mAb or contro IgG, followed by protein G beads. Immune complexes were analyzed for GIV, InsR (HA), ligand-activated InsR (pY1150, 1151 InsR), pY632 IRS1, and Gαi3 by IB. Equal loading of lysates was confirmed by analyzing GIV, Gαi3, and tubulin by IB. Maximal autophosphorylation of InsR and recruitment of GIV, IRS1, and Gαi3 to the receptor was observed in cells expressing GIV-WT exclusively after insulin stimulation, but not in cells expressing GIV-SD.

    Article Snippet: Control short hairpin RNA (shRNA) and GIV shRNA Cos7 stable cells were starved and stimulated with 100 nM insulin and stained with anti-Gαi3 (1:30; Calbiochem, San Diego, CA) and phosho-InRβ antibodies (1:100; Santa Cruz Biotechnologies, Dallas, TX).

    Techniques: Activation Assay, Staining, Confocal Microscopy, Expressing, Immunoprecipitation, Stable Transfection, Transfection, Lysis

    Phosphoinhibition of GIV-GEF by PKCθ is required for PA-induced IR and dephosphorylation of GIV-GEF is essential for the action of Pio. (A) Lysates of L6 myotubes treated (+) or not (−) with PA alone or a combination of PA and Pio were analyzed for phosphorylation of GIV at S1689 and Y1764 and total (t)GIV by IB. (B) Lysates of L6 myotubes treated (+) or not (−) with PA alone or a combination of PA and a pseudosubstrate PKCθ inhibitor were analyzed for phosphorylation of GIV at S1689 (pS1689 GIV), total (t)GIV, and tubulin by IB. (C) L6 myotubes stably expressing siRNA-resistant GIV-WT or GIV-SA were depleted of endogenous GIV by siRNA, treated with PA (+) or vehicle control (−), and subsequently analyzed for insulin-stimulated glucose uptake by fluorometric assay. Bar graph displays fold change in glucose uptake compared with starved controls ( y -axis). Error bars represent mean ± SD; n = 3. (D) L6 myotubes stably expressing siRNA-resistant GIV-WT or GIV-SD were depleted of endogenous GIV by siRNA, treated (+) or not (−) with Pio, and subsequently stimulated with insulin before lysis. Lysates were analyzed for activation of GIV (pY1764 GIV) and Akt (pS473Akt) by IB. (E) L6 myotubes stably expressing siRNA-resistant GIV-WT or GIV-SD were depleted of endogenous GIV by siRNA, treated (+) or not (−) with Pio, and subsequently analyzed for insulin-stimulated glucose uptake by fluorometric assay. Bar graph displays fold change compared with starved controls ( y -axis). Error bars represent mean ± SD; n = 3. (F) Equal aliquots of lysates of vastus lateralis muscle biopsies from obese T2DM subjects, obtained before (basal) or after 6 mo of Pio therapy, were analyzed for phosphoinhibition of GIV-GEF (pS1689 GIV) and phospho Akt (pS473 Akt) by IB. Representative samples are shown ( n = 8). (G and H) Equal aliquots of lysates of vastus lateralis muscle biopsies from patients with PCOS, obtained before (basal) and after Pio therapy, were analyzed for pS1689GIV by IB. (G) A representative immunoblot of biopsies obtained from “responder” and “nonresponder” patients are shown ( n = 8). Bar graph displays fold change in GIV phosphorylation at S1689 observed in normal and PCOS patients before and after Pio treatment ( y -axis) (H). B, basal; Pio, pioglitazone treatment. Error bars represent mean ± SD. (I) Schematic illustrates our proposed model for GIV's role as a pivot for the antagonistic actions of fatty acids like palmitate that trigger IR (red arrow) and insulin sensitizers like Pio that reverse IR (green). Phosphorylation at S1689 is essential for PA to induce IR, whereas dephosphorylation is required for Pio to enhance tyrosine phosphorylation of IRS1 and GIV, restore Akt signaling, and reinstate insulin sensitivity.

    Journal: Molecular Biology of the Cell

    Article Title: Activation of G proteins by GIV-GEF is a pivot point for insulin resistance and sensitivity

    doi: 10.1091/mbc.E15-08-0553

    Figure Lengend Snippet: Phosphoinhibition of GIV-GEF by PKCθ is required for PA-induced IR and dephosphorylation of GIV-GEF is essential for the action of Pio. (A) Lysates of L6 myotubes treated (+) or not (−) with PA alone or a combination of PA and Pio were analyzed for phosphorylation of GIV at S1689 and Y1764 and total (t)GIV by IB. (B) Lysates of L6 myotubes treated (+) or not (−) with PA alone or a combination of PA and a pseudosubstrate PKCθ inhibitor were analyzed for phosphorylation of GIV at S1689 (pS1689 GIV), total (t)GIV, and tubulin by IB. (C) L6 myotubes stably expressing siRNA-resistant GIV-WT or GIV-SA were depleted of endogenous GIV by siRNA, treated with PA (+) or vehicle control (−), and subsequently analyzed for insulin-stimulated glucose uptake by fluorometric assay. Bar graph displays fold change in glucose uptake compared with starved controls ( y -axis). Error bars represent mean ± SD; n = 3. (D) L6 myotubes stably expressing siRNA-resistant GIV-WT or GIV-SD were depleted of endogenous GIV by siRNA, treated (+) or not (−) with Pio, and subsequently stimulated with insulin before lysis. Lysates were analyzed for activation of GIV (pY1764 GIV) and Akt (pS473Akt) by IB. (E) L6 myotubes stably expressing siRNA-resistant GIV-WT or GIV-SD were depleted of endogenous GIV by siRNA, treated (+) or not (−) with Pio, and subsequently analyzed for insulin-stimulated glucose uptake by fluorometric assay. Bar graph displays fold change compared with starved controls ( y -axis). Error bars represent mean ± SD; n = 3. (F) Equal aliquots of lysates of vastus lateralis muscle biopsies from obese T2DM subjects, obtained before (basal) or after 6 mo of Pio therapy, were analyzed for phosphoinhibition of GIV-GEF (pS1689 GIV) and phospho Akt (pS473 Akt) by IB. Representative samples are shown ( n = 8). (G and H) Equal aliquots of lysates of vastus lateralis muscle biopsies from patients with PCOS, obtained before (basal) and after Pio therapy, were analyzed for pS1689GIV by IB. (G) A representative immunoblot of biopsies obtained from “responder” and “nonresponder” patients are shown ( n = 8). Bar graph displays fold change in GIV phosphorylation at S1689 observed in normal and PCOS patients before and after Pio treatment ( y -axis) (H). B, basal; Pio, pioglitazone treatment. Error bars represent mean ± SD. (I) Schematic illustrates our proposed model for GIV's role as a pivot for the antagonistic actions of fatty acids like palmitate that trigger IR (red arrow) and insulin sensitizers like Pio that reverse IR (green). Phosphorylation at S1689 is essential for PA to induce IR, whereas dephosphorylation is required for Pio to enhance tyrosine phosphorylation of IRS1 and GIV, restore Akt signaling, and reinstate insulin sensitivity.

    Article Snippet: Control short hairpin RNA (shRNA) and GIV shRNA Cos7 stable cells were starved and stimulated with 100 nM insulin and stained with anti-Gαi3 (1:30; Calbiochem, San Diego, CA) and phosho-InRβ antibodies (1:100; Santa Cruz Biotechnologies, Dallas, TX).

    Techniques: De-Phosphorylation Assay, Stable Transfection, Expressing, Lysis, Activation Assay

    GIV-GEF binds and enhances autophosphorylation of InsRβ and downstream metabolic insulin response. (A) Lysates of serum-starved L6 myotubes stimulated with insulin were analyzed for various components of metabolic insulin signaling by IB. (B) Lysates of serum-starved or insulin-stimulated L6 myotubes stably expressing GIV-WT or GIV-SD were analyzed for activation of GIV, IRS1, InsRβ, and Akt by IB. (C) Immunoprecipitation was carried out on lysates (right) of insulin-treated L6 myotubes with anti-pInsRβ or control immunoglobulin G (IgG). Bound immune complexes (left) were analyzed for activated GIV, IRS1, and InsRβ by IB. (D and E) Serum-starved Cos7 cells were stimulated with insulin, fixed, and subsequently stained for active GIV (pY1764-GIV; red, D), active IRS1 (pY632-IRS1; red, E), active InsRβ (pY1150/51-InsRβ; green), and 4′,6-diamidino-2-phenylindole (DAPI)/DNA (blue). Scale bar: 10 μm. (F) Serum-starved control (Scr shRNA) or GIV-depleted (GIV shRNA) Cos7 cells were stimulated with insulin, fixed, and stained for active InsRβ (pY1150/51-InsRβ; green) and Gαi3 (red) and analyzed by dSTORM microscopy. A high degree of colocalization was observed, as determined by the presence of yellow pixels in the merged images. (G) Lysates of starved and insulin-stimulated L6 myotubes stably expressing GIV-WT or GIV-SD were analyzed for activation of IRS1, AS160, Akt, and tubulin by IB. (H) Schematic illustrating how the presence or absence of a functional GIV-GEF, via which GIV links and activates Gi in the vicinity of InsRβ, dictates the intensity of metabolic insulin signaling, beginning with the activation and autophosphorylation of InsRβ.

    Journal: Molecular Biology of the Cell

    Article Title: Activation of G proteins by GIV-GEF is a pivot point for insulin resistance and sensitivity

    doi: 10.1091/mbc.E15-08-0553

    Figure Lengend Snippet: GIV-GEF binds and enhances autophosphorylation of InsRβ and downstream metabolic insulin response. (A) Lysates of serum-starved L6 myotubes stimulated with insulin were analyzed for various components of metabolic insulin signaling by IB. (B) Lysates of serum-starved or insulin-stimulated L6 myotubes stably expressing GIV-WT or GIV-SD were analyzed for activation of GIV, IRS1, InsRβ, and Akt by IB. (C) Immunoprecipitation was carried out on lysates (right) of insulin-treated L6 myotubes with anti-pInsRβ or control immunoglobulin G (IgG). Bound immune complexes (left) were analyzed for activated GIV, IRS1, and InsRβ by IB. (D and E) Serum-starved Cos7 cells were stimulated with insulin, fixed, and subsequently stained for active GIV (pY1764-GIV; red, D), active IRS1 (pY632-IRS1; red, E), active InsRβ (pY1150/51-InsRβ; green), and 4′,6-diamidino-2-phenylindole (DAPI)/DNA (blue). Scale bar: 10 μm. (F) Serum-starved control (Scr shRNA) or GIV-depleted (GIV shRNA) Cos7 cells were stimulated with insulin, fixed, and stained for active InsRβ (pY1150/51-InsRβ; green) and Gαi3 (red) and analyzed by dSTORM microscopy. A high degree of colocalization was observed, as determined by the presence of yellow pixels in the merged images. (G) Lysates of starved and insulin-stimulated L6 myotubes stably expressing GIV-WT or GIV-SD were analyzed for activation of IRS1, AS160, Akt, and tubulin by IB. (H) Schematic illustrating how the presence or absence of a functional GIV-GEF, via which GIV links and activates Gi in the vicinity of InsRβ, dictates the intensity of metabolic insulin signaling, beginning with the activation and autophosphorylation of InsRβ.

    Article Snippet: Control short hairpin RNA (shRNA) and GIV shRNA Cos7 stable cells were starved and stimulated with 100 nM insulin and stained with anti-Gαi3 (1:30; Calbiochem, San Diego, CA) and phosho-InRβ antibodies (1:100; Santa Cruz Biotechnologies, Dallas, TX).

    Techniques: Stable Transfection, Expressing, Activation Assay, Immunoprecipitation, Staining, shRNA, Microscopy, Functional Assay

    Minocycline inhibits PDGF-BB-induced NF-κB and AP-1 activation. A, PDGF-BB induces time-dependent NF-κB activation. Quiescent SMC were incubated with PDGF-BB (10 ng/ml). At the indicated time periods, activation of NF-κB was analyzed by immunoblotting using antibodies that specifically detect phosphorylated p65 at Ser 536 . B, PDGF-BB induces time-dependent AP-1 activation. Quiescent SMC incubated as in A were analyzed for AP-1 activation by immunoblotting using antibodies that specifically detect phosphorylated c-Jun at Ser 73 . C, Silencing IKKβ or pre-treatment with minocycline inhibit PDGF-BB-induced NF-κB activation. SMC incubated with lentiviral IKKβ shRNA (moi0.5 for 48 h) were made quiescent and treated with PDGF-BB (10 ng/ml for 30 min). In a subset of experiments, quiescent SMC were incubated with minocycline (10 μM for 15 min) and then treated with PDGF-BB (10 ng/ml for 30 min). Activation of NF-κB was analyzed as in A. D, Silencing JNK2 or pre-treatment with minocycline inhibits PDGF-BB-induced AP-1 activation. SMC incubated with lentiviral JNK2 shRNA (moi 0.5 for 48 h) were made quiescent and treated with PDGF-BB (10 ng/ml for 30 min). In a subset of experiments, quiescent SMC were incubated with minocycline (10 mM for 15 min) and then treated with PDGF-BB (10 ng/ml for 30 min). Activation of AP-1 was analyzed as in B. Silencing IKKβ and JNK2 was confirmed by immunoblotting. JNK2 and IKKβ served as off-targets in IKKβ and JNK2 silenced cells, respectively (right hand panels in C and D). Tubulin served as a loading control. Bar graphs at the bottom of panels in A-D represent densitometric analyses from three independent experiments. * P

    Journal: Cellular signalling

    Article Title: Minocycline Inhibits PDGF-BB-induced Human Aortic Smooth Muscle Cell Proliferation and Migration by reversing miR-221- and -222-mediated RECK suppression

    doi: 10.1016/j.cellsig.2019.01.014

    Figure Lengend Snippet: Minocycline inhibits PDGF-BB-induced NF-κB and AP-1 activation. A, PDGF-BB induces time-dependent NF-κB activation. Quiescent SMC were incubated with PDGF-BB (10 ng/ml). At the indicated time periods, activation of NF-κB was analyzed by immunoblotting using antibodies that specifically detect phosphorylated p65 at Ser 536 . B, PDGF-BB induces time-dependent AP-1 activation. Quiescent SMC incubated as in A were analyzed for AP-1 activation by immunoblotting using antibodies that specifically detect phosphorylated c-Jun at Ser 73 . C, Silencing IKKβ or pre-treatment with minocycline inhibit PDGF-BB-induced NF-κB activation. SMC incubated with lentiviral IKKβ shRNA (moi0.5 for 48 h) were made quiescent and treated with PDGF-BB (10 ng/ml for 30 min). In a subset of experiments, quiescent SMC were incubated with minocycline (10 μM for 15 min) and then treated with PDGF-BB (10 ng/ml for 30 min). Activation of NF-κB was analyzed as in A. D, Silencing JNK2 or pre-treatment with minocycline inhibits PDGF-BB-induced AP-1 activation. SMC incubated with lentiviral JNK2 shRNA (moi 0.5 for 48 h) were made quiescent and treated with PDGF-BB (10 ng/ml for 30 min). In a subset of experiments, quiescent SMC were incubated with minocycline (10 mM for 15 min) and then treated with PDGF-BB (10 ng/ml for 30 min). Activation of AP-1 was analyzed as in B. Silencing IKKβ and JNK2 was confirmed by immunoblotting. JNK2 and IKKβ served as off-targets in IKKβ and JNK2 silenced cells, respectively (right hand panels in C and D). Tubulin served as a loading control. Bar graphs at the bottom of panels in A-D represent densitometric analyses from three independent experiments. * P

    Article Snippet: For lentiviral infection, SMC at 50–60% confluency were infected with the indicated lentiviral shRNA at a multiplicity of infection (moi) of 0.5 for 48 h in complete media.

    Techniques: Activation Assay, Incubation, shRNA

    PDGF-BB induces SMC proliferation in part via miR-221 and miR-222. A, B, PDGF-BB induces miR-221 (A) and miR-222 (B) expression via IKKβ, NF-κB, JNK and AP-1. Quiescent SMC incubated with PDGF-BB (10 ng/ml) for lh were analyzed for miR-221 (A) and miR-222 (B) expression by TaqMan® Advanced miRNA assays. The results were normalized to corresponding U6 expression. In a subset of experiments, SMC were incubated with lentiviral IKKβ, p65, JNK2 or c-Jun shRNA (moi0.5 for 48 h), made quiescent and then treated with PDGF-BB addition. C, D, miR-221 and miR-222 mediate PDGF-induced SMC migration (C) and proliferation (D), without affecting cell viability (E). SMC were transduced with miR-221 or miR-222 inhibitors prior to the addition of PDGF-BB (10 ng/ml). Cell migration was analyzed after 18 h using transwell migration assays (C). Cell proliferation was analyzed after 48h by CyQUANT® Cell Proliferation Assay (D). Cleaved caspase-3 levels, indicative of cells undergoing apoptosis, was analyzed after 8 h by immunoblotting using antibodies that detect both total and cleaved caspase-3 levels (E). Hydrogen peroxide (H 2 O 2 , 100 μM) served as a positive control. * P

    Journal: Cellular signalling

    Article Title: Minocycline Inhibits PDGF-BB-induced Human Aortic Smooth Muscle Cell Proliferation and Migration by reversing miR-221- and -222-mediated RECK suppression

    doi: 10.1016/j.cellsig.2019.01.014

    Figure Lengend Snippet: PDGF-BB induces SMC proliferation in part via miR-221 and miR-222. A, B, PDGF-BB induces miR-221 (A) and miR-222 (B) expression via IKKβ, NF-κB, JNK and AP-1. Quiescent SMC incubated with PDGF-BB (10 ng/ml) for lh were analyzed for miR-221 (A) and miR-222 (B) expression by TaqMan® Advanced miRNA assays. The results were normalized to corresponding U6 expression. In a subset of experiments, SMC were incubated with lentiviral IKKβ, p65, JNK2 or c-Jun shRNA (moi0.5 for 48 h), made quiescent and then treated with PDGF-BB addition. C, D, miR-221 and miR-222 mediate PDGF-induced SMC migration (C) and proliferation (D), without affecting cell viability (E). SMC were transduced with miR-221 or miR-222 inhibitors prior to the addition of PDGF-BB (10 ng/ml). Cell migration was analyzed after 18 h using transwell migration assays (C). Cell proliferation was analyzed after 48h by CyQUANT® Cell Proliferation Assay (D). Cleaved caspase-3 levels, indicative of cells undergoing apoptosis, was analyzed after 8 h by immunoblotting using antibodies that detect both total and cleaved caspase-3 levels (E). Hydrogen peroxide (H 2 O 2 , 100 μM) served as a positive control. * P

    Article Snippet: For lentiviral infection, SMC at 50–60% confluency were infected with the indicated lentiviral shRNA at a multiplicity of infection (moi) of 0.5 for 48 h in complete media.

    Techniques: Expressing, Incubation, shRNA, Migration, Transduction, CyQUANT Assay, Proliferation Assay, Positive Control