Review





Similar Products

96
Addgene inc lentiviral vector plko 1 shrna control shctrl
Lentiviral Vector Plko 1 Shrna Control Shctrl, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shrna+control+(shctrl)+vector/pLKO%2E1+-+TRC+control+(Plasmid+%2310879)/pm41596422-229-0-6
Average 96 stars, based on 1 article reviews
lentiviral vector plko 1 shrna control shctrl - by Bioz Stars, 2026-10
96/100 stars
  Buy from Supplier

90
Shanghai Genechem Ltd retroviral vectors containing short hairpin rnas (shrnas) targeting mif and a shrna control (shctrl)
Retroviral Vectors Containing Short Hairpin Rnas (Shrnas) Targeting Mif And A Shrna Control (Shctrl), supplied by Shanghai Genechem Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shrna+control+(shctrl)+vector/retroviral+vectors+containing+short+hairpin+rnas++shrnas++targeting+mif+and+a+shrna+control++shctrl+/10__3892_slash_ol__2025__14910-143-10-35
Average 90 stars, based on 1 article reviews
retroviral vectors containing short hairpin rnas (shrnas) targeting mif and a shrna control (shctrl) - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

86
Genechem control shrna vector shctrl
Control Shrna Vector Shctrl, supplied by Genechem, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shrna+control+(shctrl)+vector/control+shrna+vector++shctrl+/pm39218837-51-27-31
Average 86 stars, based on 1 article reviews
control shrna vector shctrl - by Bioz Stars, 2026-10
86/100 stars
  Buy from Supplier

96
OriGene shctrl constructs
Shctrl Constructs, supplied by OriGene, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shrna+control+(shctrl)+vector/Scrambled+shRNA+control+in+pGFP-C-shLenti+shRNA+Vector/pm38873940-270-3-8
Average 96 stars, based on 1 article reviews
shctrl constructs - by Bioz Stars, 2026-10
96/100 stars
  Buy from Supplier

90
Genechem shrna control (shctrl) vector
Shrna Control (Shctrl) Vector, supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shrna+control+(shctrl)+vector/shctrl/pmc07841132-33-9-17
Average 90 stars, based on 1 article reviews
shrna control (shctrl) vector - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

96
Addgene inc lentiviral vector shrna control shctrl
Lentiviral Vector Shrna Control Shctrl, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shrna+control+(shctrl)+vector/scramble+shRNA+(Plasmid+%231864)/pmc09283934-178-0-6
Average 96 stars, based on 1 article reviews
lentiviral vector shrna control shctrl - by Bioz Stars, 2026-10
96/100 stars
  Buy from Supplier

96
OriGene gtacatctctagcagtgctggagccaggt origene tl309181c pgfp c shlenti scramble shctrl
Gtacatctctagcagtgctggagccaggt Origene Tl309181c Pgfp C Shlenti Scramble Shctrl, supplied by OriGene, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shrna+control+(shctrl)+vector/Scrambled+shRNA+control+in+pGFP-C-shLenti+shRNA+Vector/pmc06538630__41467_2019_10275_MOESM1_ESM-55-80-81
Average 96 stars, based on 1 article reviews
gtacatctctagcagtgctggagccaggt origene tl309181c pgfp c shlenti scramble shctrl - by Bioz Stars, 2026-10
96/100 stars
  Buy from Supplier

93
OriGene control scrambled shrna plasmid shctrl
Figure 3. Tet2 knockdown decreases myoblast differentiation. (A) Knockdown of Tet2 by using <t>shRNA.</t> Upper: C2C12 cells were transfected with Tet2-specific shRNA plasmid (shTet2) or a control shRNA plasmid <t>(shCtrl)</t> and then selected with puromycin. The mRNA levels of Tet family genes or myoblast differentiation- associated genes in puromycin-selected cells were detected by qRT-PCR. Lower: the cells were induced to differentiation and the mRNA levels of Tets or myoblast differentiation-associated genes were detected 4 d after differentiation induction. Myog, myogenin; MyoM, myomaker. (B) Western blot confirmation of Tet2 protein decline in shRNA- or siRNA-mediated Tet2 knockdown cells. β-actin was used as an internal control. The expected Tet2 band (NW: 224 kDa) is shown. Full-length blots are presented in Supplementary Figure S6. (C) Evaluation of myotube formation of Tet2 knockdown C2C12 cells. Myotubes were visualized by immunostaining for MyHC 6 d after differentiation induction (left). Nuclei were stained with DAPI. Scale bar, 100 μm. The fusion index was calculated as the ratio of the number of nuclei in MyHC-positive cells to the total number of nuclei present in the observation field. The quantitative analysis revealed a significant decrease in the fusion index of shTet2 C2C12 as compared with shCtrl cells (right). Data are presented as means ± SEM (n = 3). *p < 0.05; **p < 0.01; ***p < 0.001.
Control Scrambled Shrna Plasmid Shctrl, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shrna+control+(shctrl)+vector/Scrambled+shRNA+control+in+pRFP-C-RS+shRNA+Vector/pm28272491-252-18-23
Average 93 stars, based on 1 article reviews
control scrambled shrna plasmid shctrl - by Bioz Stars, 2026-10
93/100 stars
  Buy from Supplier

96
OriGene shctrl
Figure 3. Tet2 knockdown decreases myoblast differentiation. (A) Knockdown of Tet2 by using <t>shRNA.</t> Upper: C2C12 cells were transfected with Tet2-specific shRNA plasmid (shTet2) or a control shRNA plasmid <t>(shCtrl)</t> and then selected with puromycin. The mRNA levels of Tet family genes or myoblast differentiation- associated genes in puromycin-selected cells were detected by qRT-PCR. Lower: the cells were induced to differentiation and the mRNA levels of Tets or myoblast differentiation-associated genes were detected 4 d after differentiation induction. Myog, myogenin; MyoM, myomaker. (B) Western blot confirmation of Tet2 protein decline in shRNA- or siRNA-mediated Tet2 knockdown cells. β-actin was used as an internal control. The expected Tet2 band (NW: 224 kDa) is shown. Full-length blots are presented in Supplementary Figure S6. (C) Evaluation of myotube formation of Tet2 knockdown C2C12 cells. Myotubes were visualized by immunostaining for MyHC 6 d after differentiation induction (left). Nuclei were stained with DAPI. Scale bar, 100 μm. The fusion index was calculated as the ratio of the number of nuclei in MyHC-positive cells to the total number of nuclei present in the observation field. The quantitative analysis revealed a significant decrease in the fusion index of shTet2 C2C12 as compared with shCtrl cells (right). Data are presented as means ± SEM (n = 3). *p < 0.05; **p < 0.01; ***p < 0.001.
Shctrl, supplied by OriGene, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/shrna+control+(shctrl)+vector/Scrambled+shRNA+control+in+pGFP-C-shLenti+shRNA+Vector/pmc05861082-196-21-33
Average 96 stars, based on 1 article reviews
shctrl - by Bioz Stars, 2026-10
96/100 stars
  Buy from Supplier

Image Search Results


Figure 3. Tet2 knockdown decreases myoblast differentiation. (A) Knockdown of Tet2 by using shRNA. Upper: C2C12 cells were transfected with Tet2-specific shRNA plasmid (shTet2) or a control shRNA plasmid (shCtrl) and then selected with puromycin. The mRNA levels of Tet family genes or myoblast differentiation- associated genes in puromycin-selected cells were detected by qRT-PCR. Lower: the cells were induced to differentiation and the mRNA levels of Tets or myoblast differentiation-associated genes were detected 4 d after differentiation induction. Myog, myogenin; MyoM, myomaker. (B) Western blot confirmation of Tet2 protein decline in shRNA- or siRNA-mediated Tet2 knockdown cells. β-actin was used as an internal control. The expected Tet2 band (NW: 224 kDa) is shown. Full-length blots are presented in Supplementary Figure S6. (C) Evaluation of myotube formation of Tet2 knockdown C2C12 cells. Myotubes were visualized by immunostaining for MyHC 6 d after differentiation induction (left). Nuclei were stained with DAPI. Scale bar, 100 μm. The fusion index was calculated as the ratio of the number of nuclei in MyHC-positive cells to the total number of nuclei present in the observation field. The quantitative analysis revealed a significant decrease in the fusion index of shTet2 C2C12 as compared with shCtrl cells (right). Data are presented as means ± SEM (n = 3). *p < 0.05; **p < 0.01; ***p < 0.001.

Journal: Scientific reports

Article Title: Ten-Eleven Translocation-2 (Tet2) Is Involved in Myogenic Differentiation of Skeletal Myoblast Cells in Vitro.

doi: 10.1038/srep43539

Figure Lengend Snippet: Figure 3. Tet2 knockdown decreases myoblast differentiation. (A) Knockdown of Tet2 by using shRNA. Upper: C2C12 cells were transfected with Tet2-specific shRNA plasmid (shTet2) or a control shRNA plasmid (shCtrl) and then selected with puromycin. The mRNA levels of Tet family genes or myoblast differentiation- associated genes in puromycin-selected cells were detected by qRT-PCR. Lower: the cells were induced to differentiation and the mRNA levels of Tets or myoblast differentiation-associated genes were detected 4 d after differentiation induction. Myog, myogenin; MyoM, myomaker. (B) Western blot confirmation of Tet2 protein decline in shRNA- or siRNA-mediated Tet2 knockdown cells. β-actin was used as an internal control. The expected Tet2 band (NW: 224 kDa) is shown. Full-length blots are presented in Supplementary Figure S6. (C) Evaluation of myotube formation of Tet2 knockdown C2C12 cells. Myotubes were visualized by immunostaining for MyHC 6 d after differentiation induction (left). Nuclei were stained with DAPI. Scale bar, 100 μm. The fusion index was calculated as the ratio of the number of nuclei in MyHC-positive cells to the total number of nuclei present in the observation field. The quantitative analysis revealed a significant decrease in the fusion index of shTet2 C2C12 as compared with shCtrl cells (right). Data are presented as means ± SEM (n = 3). *p < 0.05; **p < 0.01; ***p < 0.001.

Article Snippet: To achieve persistent knockdown of Tet2, C2C12 cells was transfected with a Tet2 shRNA plasmid (shTet2) or a control scrambled shRNA plasmid (shCtrl) (Origene Technologies).

Techniques: Knockdown, shRNA, Transfection, Plasmid Preparation, Control, Quantitative RT-PCR, Western Blot, Immunostaining, Staining

Figure 4. Promoter methylation status of myoblast differentiation-associated genes in Tet2 knockdown C2C12. C2C12 cells transfected with Tet2 shRNA (shTet2) or control shRNA (shCtrl) were cultured in growth medium. Methylation status of promoters of myogenin (A), Myf6 (B) or myomaker (C) was analyzed by using bisulfite sequencing. Numbers with a minus sign indicate the position of CpG relative to the transcription starting site. Each row represents an individual clone sequenced; black and white circles represent methylated and unmethylated CpGs, respectively. Percentage of methylation indicates the proportion of methylated CpG sites relative to the whole CpG sites examined.

Journal: Scientific reports

Article Title: Ten-Eleven Translocation-2 (Tet2) Is Involved in Myogenic Differentiation of Skeletal Myoblast Cells in Vitro.

doi: 10.1038/srep43539

Figure Lengend Snippet: Figure 4. Promoter methylation status of myoblast differentiation-associated genes in Tet2 knockdown C2C12. C2C12 cells transfected with Tet2 shRNA (shTet2) or control shRNA (shCtrl) were cultured in growth medium. Methylation status of promoters of myogenin (A), Myf6 (B) or myomaker (C) was analyzed by using bisulfite sequencing. Numbers with a minus sign indicate the position of CpG relative to the transcription starting site. Each row represents an individual clone sequenced; black and white circles represent methylated and unmethylated CpGs, respectively. Percentage of methylation indicates the proportion of methylated CpG sites relative to the whole CpG sites examined.

Article Snippet: To achieve persistent knockdown of Tet2, C2C12 cells was transfected with a Tet2 shRNA plasmid (shTet2) or a control scrambled shRNA plasmid (shCtrl) (Origene Technologies).

Techniques: Methylation, Knockdown, Transfection, shRNA, Control, Cell Culture, Methylation Sequencing

Figure 5. Knockdown of Tet2 decreases the ability of vitamin C to enhance 5hmC formation and to promote the expression of myoblast differentiation-associated genes. C2C12 cells transfected with Tet2 shRNA (shTet2) or control shRNA (shCtrl) were cultured in growth medium with or without vitamin C (VC; 500 μM). (A) Immunostaining for 5hmC in shTet2 vs shCtrl C2C12 cells with or without VC treatment. Nuclei were stained with DAPI. Scale bar, 50 μm. (B) Quantification of fluorescence intensities of 5hmC. The quantitative analysis revealed that Tet2 knockdown decreased the ability of VC to enhance 5hmC formation. (C) qRT-PCR analysis for the expression of myogenin, Myf6 and myomaker in shTet2 vs shCtrl C2C12 cells with or without VC treatment. Gapdh was used as an internal control. Data are presented as means ± SEM (n = 3). Asterisks above columns represent significant difference among groups (p < 0.05).

Journal: Scientific reports

Article Title: Ten-Eleven Translocation-2 (Tet2) Is Involved in Myogenic Differentiation of Skeletal Myoblast Cells in Vitro.

doi: 10.1038/srep43539

Figure Lengend Snippet: Figure 5. Knockdown of Tet2 decreases the ability of vitamin C to enhance 5hmC formation and to promote the expression of myoblast differentiation-associated genes. C2C12 cells transfected with Tet2 shRNA (shTet2) or control shRNA (shCtrl) were cultured in growth medium with or without vitamin C (VC; 500 μM). (A) Immunostaining for 5hmC in shTet2 vs shCtrl C2C12 cells with or without VC treatment. Nuclei were stained with DAPI. Scale bar, 50 μm. (B) Quantification of fluorescence intensities of 5hmC. The quantitative analysis revealed that Tet2 knockdown decreased the ability of VC to enhance 5hmC formation. (C) qRT-PCR analysis for the expression of myogenin, Myf6 and myomaker in shTet2 vs shCtrl C2C12 cells with or without VC treatment. Gapdh was used as an internal control. Data are presented as means ± SEM (n = 3). Asterisks above columns represent significant difference among groups (p < 0.05).

Article Snippet: To achieve persistent knockdown of Tet2, C2C12 cells was transfected with a Tet2 shRNA plasmid (shTet2) or a control scrambled shRNA plasmid (shCtrl) (Origene Technologies).

Techniques: Knockdown, Expressing, Transfection, shRNA, Control, Cell Culture, Immunostaining, Staining, Fluorescence, Quantitative RT-PCR

Figure 6. Knockdown of Tet2 decreases the ability of vitamin C to promote myoblast differentiation. C2C12 cells transfected with Tet2 shRNA (shTet2) or control shRNA (shCtrl) were subdivided into two experimental groups: non-vitamin C treatment group (indicated as VC−), in which VC was absent in both growth medium and differentiation medium, and VC-treatment group (indicated as VC+), in which the cells were first cultured for 48 h in growth medium containing 500 μM VC, and then were shifted to differentiated medium containing 500 μM VC. (A) Evaluation of myoblast differentiation in different treatment groups. Cells after 6 d of differentiation induction were immunostained with anti-MyHC antibodies to mark the myotubes. Nuclei were stained with DAPI. Scale bar, 100 μm. (B) Quantification analysis for differentiation efficiency in different treatment groups. The fusion index was calculated as the ratio of the number of nuclei in MyHC- positive cells to the total number of nuclei present in the observation field. (C) qRT-PCR analysis for the expression of myogenin, Myf6 and myomaker in C2C12 cells after 4 d of differentiation induction in different treatment groups. Gapdh was used as an internal control. Data are presented as means ± SEM (n = 3). Asterisks above columns represent significant difference among groups (p < 0.05).

Journal: Scientific reports

Article Title: Ten-Eleven Translocation-2 (Tet2) Is Involved in Myogenic Differentiation of Skeletal Myoblast Cells in Vitro.

doi: 10.1038/srep43539

Figure Lengend Snippet: Figure 6. Knockdown of Tet2 decreases the ability of vitamin C to promote myoblast differentiation. C2C12 cells transfected with Tet2 shRNA (shTet2) or control shRNA (shCtrl) were subdivided into two experimental groups: non-vitamin C treatment group (indicated as VC−), in which VC was absent in both growth medium and differentiation medium, and VC-treatment group (indicated as VC+), in which the cells were first cultured for 48 h in growth medium containing 500 μM VC, and then were shifted to differentiated medium containing 500 μM VC. (A) Evaluation of myoblast differentiation in different treatment groups. Cells after 6 d of differentiation induction were immunostained with anti-MyHC antibodies to mark the myotubes. Nuclei were stained with DAPI. Scale bar, 100 μm. (B) Quantification analysis for differentiation efficiency in different treatment groups. The fusion index was calculated as the ratio of the number of nuclei in MyHC- positive cells to the total number of nuclei present in the observation field. (C) qRT-PCR analysis for the expression of myogenin, Myf6 and myomaker in C2C12 cells after 4 d of differentiation induction in different treatment groups. Gapdh was used as an internal control. Data are presented as means ± SEM (n = 3). Asterisks above columns represent significant difference among groups (p < 0.05).

Article Snippet: To achieve persistent knockdown of Tet2, C2C12 cells was transfected with a Tet2 shRNA plasmid (shTet2) or a control scrambled shRNA plasmid (shCtrl) (Origene Technologies).

Techniques: Knockdown, Transfection, shRNA, Control, Cell Culture, Staining, Quantitative RT-PCR, Expressing