shrna a 2a r  (Mirus Bio)

Journal: Aging Cell

Article Title: Amygdala neuronal dyshomeostasis via 5‐HT receptors mediates mood and cognitive defects in Alzheimer's disease

doi: 10.1111/acel.14187

Figure Lengend Snippet: Serotonin receptors are abnormally upregulated during early‐stage AD in the BLA. (a) A hierarchically clustered heatmap showed expression patterns of 13 emotion‐related genes in the human amygdala. (b) The mRNA expression levels of emotion‐related genes in the human amygdala ( n = 11–18 brain samples for each group). (c) Expression levels of 5‐HT 1A R, 5‐HT 2A R, 5‐HT 2B R, 5‐HT 2C R, 5‐HT 3A R, 5‐HT 4 R, 5‐HT 6 R and 5‐HT 7 R proteins in the amygdala from PW10 WT and APP/PS1 mice ( n = 3 animals for each group). (d, e) Representative images and summary data of 5‐HT 2A R immunofluorescence co‐localized with different types of neurons in WT and APP/PS1 mice ( n = 4 to 5 mice for each group). The white arrowheads denote co‐labeled 5‐HT 2A R + /TBR1 + , 5‐HT 2A R + /PV + or 5‐HT 2A R + /SOM + cells, and the white squares denote the enlarged view. Scale bar, 50 μm; 5 μm for magnified images. (f, g) Representative images and summary data of 5‐HT 1A R immunofluorescence co‐localized with different types of neurons in WT and APP/PS1 mice ( n = 6 mice for each group). The white arrowheads denote co‐labeled 5‐HT 1A R + /TBR1 + , 5‐HT 1A R + /PV + or 5‐HT 1A R + /SOM + cells, and the white squares denote the enlarged view. Scale bar, 50 μm; 5 μm for magnified images. Statistical significance was assessed by unpaired Student's t test in (c), (e), and (g), one‐way ANOVA with post hoc comparisons (Tukey test) between groups in (b). All data are presented as the mean ± SEM. * means the difference between normal brain and probably AD brain or normal brain and definite AD brain, # means the difference between probably AD brain and definite AD brain. * p < 0.05; ** p < 0.01; **** p < 0.0001; # p < 0.05; ## p < 0.01; ### p < 0.001; #### p < 0.0001.

Article Snippet: The following viruses were used: AAV‐hSyn‐GCaMP6s was purchased from Shanghai Taitool Bioscience Co. Ltd.; AAV‐DIO‐ChR2(H134R)‐EYFP, AAV‐CaMKIIα‐5‐HT 2A R‐shRNA‐mCherry (sequence AAAGCTGCAGAATGCCACCAACT) (Kim et al., ), AAV2/1‐hSyn‐Cre and AAV‐CaMKIIα‐mCherry were purchased from BrainVTA; AAV‐DIO‐5‐HT 1A R‐shRNA‐EGFP(sequence AAGAAGATCATCAAGTGCA), AAV‐DIO‐EGFP and AAV‐DIO‐mCherry were purchased from Obio Technology Co. Ltd. AAV‐hSyn‐5HT3.0 was purchased from WZ Biosciences.

Techniques: Expressing, Immunofluorescence, Labeling

Journal: Aging Cell

Article Title: Amygdala neuronal dyshomeostasis via 5‐HT receptors mediates mood and cognitive defects in Alzheimer's disease

doi: 10.1111/acel.14187

Figure Lengend Snippet: Double knockdown of serotonin receptors rescues mood defeats in APP/PS1 mice. (a) The schematic illustrates combined knockdown 5‐HT 2A R in pyramidal neuron and 5‐HT 1A R in PV interneuron. (b) Left panel showed experimental scheme of virus injection in BLA and data analysis. Right panel showed histologically verified placements of viral injections in BLA. Scale bars, 200 μm; 125 μm for magnified images. (c) Knocking down 5‐HT 2A R in pyramidal neurons and 5‐HT 1A R in PV interneurons reduce the central time and total distance of APP/PS1 mice in OFT ( n = 8–10 animals for each group). (d) Knocking down 5‐HT 2A R in pyramidal neurons and 5‐HT 1A R in PV interneurons reduce the time in open arms of APP/PS1 mice in EPM ( n = 8–10 animals for each group). (e) Representative traces for action potential firing of WT + SCR‐shRNA, WT + D‐shRNA, APP/PS1 + SCR‐shRNA and APP/PS1 + D‐shRNA mice and statistical data for action potential firing recorded in four groups ( n = 12–14 cells from 3 to 4 mice for each group). (f) Sample traces of eEPSC from WT + SCR‐shRNA, WT + D‐shRNA, APP/PS1 + SCR‐shRNA and APP/PS1 + D‐shRNA mice and summary data for eEPSCs from the four groups ( n = 12–16 cells from 3 to 4 mice per group). (g) Sample traces of sEPSC from WT + SCR‐shRNA, WT + D‐shRNA, APP/PS1 + SCR‐shRNA and APP/PS1 + D‐shRNA mice and summary data for sEPSCs from the four groups ( n = 12–15 cells from 3 to 4 mice per group). (h) Sample traces of sIPSC from WT + SCR‐shRNA, WT + D‐shRNA, APP/PS1 + SCR‐shRNA and APP/PS1 + D‐shRNA mice and summary data for sIPSCs from the four groups ( n = 12–15 cells from 3 to 4 mice per group). Statistical significance was assessed by two‐way repeated measures ANOVA with post hoc comparisons (Tukey test) between groups in (c)–(h). All data are presented as mean ± SEM. * p < 0.05; ** p < 0.01; **** p < 0.0001.

Article Snippet: The following viruses were used: AAV‐hSyn‐GCaMP6s was purchased from Shanghai Taitool Bioscience Co. Ltd.; AAV‐DIO‐ChR2(H134R)‐EYFP, AAV‐CaMKIIα‐5‐HT 2A R‐shRNA‐mCherry (sequence AAAGCTGCAGAATGCCACCAACT) (Kim et al., ), AAV2/1‐hSyn‐Cre and AAV‐CaMKIIα‐mCherry were purchased from BrainVTA; AAV‐DIO‐5‐HT 1A R‐shRNA‐EGFP(sequence AAGAAGATCATCAAGTGCA), AAV‐DIO‐EGFP and AAV‐DIO‐mCherry were purchased from Obio Technology Co. Ltd. AAV‐hSyn‐5HT3.0 was purchased from WZ Biosciences.

Techniques: Knockdown, Virus, Injection, shRNA

Journal: Scientific Reports

Article Title: Adenosine A 2A receptors control synaptic remodeling in the adult brain

doi: 10.1038/s41598-022-18884-4

Figure Lengend Snippet: Pharmacological activation of A 2A Rs induces the formation of abnormal secondary axons in cultured hippocampal neurons. ( a ) Representative images of E18 rat-derived hippocampal neurons cultured in the absence and in the presence of the selective agonist of A 2A Rs, CGS21680 (30 nM), from DIV0, double immunolabeled with SMI31 (axonal marker; yellow) and βIII-tubulin (neuronal marker; blue) antibodies at DIV 3 (scale bar, 30 µm), showing that ( b ) the exposure to CGS21680 increased the number of axons per neuron (upper graph), reflecting an increased percentage of neurons with multiple axons (lower graph). The selective antagonist of A 2A Rs, SCH58261 (50 nM), did not modify the average number of axons per neuron, but prevented the ability of CGS21680 to modify the number of axons per neuron. ( c ) CGS21680 increased axonal length (in those cells displaying more than one axon, it was counted the longest axon), whereas SCH58261 was devoid of effects. In the presence of SCH58261, CGS21680 did not modify axonal length. Neither CGS21680 nor SCH58261 significantly modified axonal branching. Data are mean ± SEM quantified from 6 independent cultures, analyzing a minimum of 100 cells per culture and condition. ( d ) In cells electroporated at DIV0 with either shRNA-Control (shCTR) or shRNA-A 2A R (shA 2A R) (EGFP + ), CGS21680 increased the number of axons per neuron and axonal length in cells transfected with shCTR but not in cells transfected with shA 2A R. Scale bar, 10 μm. Data are mean ± SEM quantified from 7 independent cultures, analyzing a minimum of 25 transfected cells per culture and condition. ** P < 0.01 and *** P < 0.001. ( b upper ; c lower) one-way ANOVA with Dunnet’s post-hoc test; ( b lower ; d left ) two-way ANOVA with Sidak’s post-hoc test; ( c upper ; d right ) one-sample t -test vs. hypothetical value of 1. ( e ) Immunocytochemical analysis of A 2A R immunoreactivity (yellow) in a non-polarized neuron and in an axonal growth cone labelled with phalloidin (blue). Scale bar for upper and middle image, 10 μm; scale bar for the lower image, 5 μm.

Article Snippet: In vitro electroporation of dissociated cells with validated shRNA-A 2A R and a non-targeting control (shRNA-Control) encoding EGFP ( ; see Supplementary Figs. , ) was performed using Ingenio Electroporation kit (Mirus Biotech®; Cat#MIR 50118) and Nucleofector® IIb device (Amaxa Biosystems) as previously described .

Techniques: Activation Assay, Cell Culture, Derivative Assay, Immunolabeling, Marker, Modification, shRNA, Transfection

Journal: Scientific Reports

Article Title: Adenosine A 2A receptors control synaptic remodeling in the adult brain

doi: 10.1038/s41598-022-18884-4

Figure Lengend Snippet: Knockdown of A 2A Rs in dentate granule cells reduces status epilepticus-induced hippocampal mossy fiber sprouting. ( a ) Lentivirus encoding EGFP and shRNA-Control (shCTR) or shRNA-A 2A R (shA 2A R) were injected into the hippocampal dentate gyrus (DG) in the left or in the right hemisphere. After 10 days, rats were injected with saline (Control group) or pilocarpine (Status epilepticus group). All rats were administered with scopolamine methylbromide (2 mg/kg, i.p. ) 30 min before. Only animals reaching at least stage 4 seizures were considered. ( b ) After 55 days, mossy fiber (MF) sprouting was assessed by immunohistochemical analysis of synaptoporin (MF terminals marker). Representative images of the immunolabelling of synaptoporin and neuronal nuclei (NeuN) showing that in rats that experienced status epilepticus (SE) it was observed synaptoporin immunoreactivity in the inner molecular layer (IML) of the DG (white arrows), which was not observed in control rats. Scale bar, 300 μm. ( c ) Representative image showing a DG segment infected with lentivirus encoding shCTR from a rat that experienced SE, immunolabelled with synaptoporin and NeuN and displaying EGFP + -dentate granule cells. Scale bar, 100 µm. ( d ) Schematic illustration of the quantitative method used to analyse the extent of MF sprouting. A Δsprouting ratio for each acquired image with obviously different EGFP + -cell density in adjacent areas was calculated by measuring the incremental proportion of the synaptoporin (cyan) puncta density (PD2 to PD1) in the IML vs. the incremental proportion of EGFP + -neuron density (ED2 to ED1) in the granule cell layer (GCL), defined by NeuN immunoreactivity. ( e ) The brain sections from shCTR- or shRNA-A 2A R-injected DG from control animals displayed no synaptoporin staining (cyan) in the IML. In SE group, shA 2A R-injected DG sections displayed lower synaptoporin puncta densities in the IML region corresponding to the higher EGFP + -cell density region in GCL which was not observed in shCTR-injected DG. Scale bar, 25 μm. ( f ) Δsprouting ratio in shA 2A R-injected DG and shCTR-injected DG in each individual animal that had experienced SE ( left ), supporting a significant lower Δsprouting in shA 2A R-injected DG vs. shCTR-injected DG (right). The data are median and interquartile range ( left graph) or mean ± SEM ( right graph). * P < 0.05 and *** P < 0.001, paired t -test. H-Hilus.

Article Snippet: In vitro electroporation of dissociated cells with validated shRNA-A 2A R and a non-targeting control (shRNA-Control) encoding EGFP ( ; see Supplementary Figs. , ) was performed using Ingenio Electroporation kit (Mirus Biotech®; Cat#MIR 50118) and Nucleofector® IIb device (Amaxa Biosystems) as previously described .

Techniques: shRNA, Injection, Saline, Immunohistochemistry, Marker, Infection, Staining

Journal: Scientific Reports

Article Title: Adenosine A 2A receptors control synaptic remodeling in the adult brain

doi: 10.1038/s41598-022-18884-4

Figure Lengend Snippet: Impact of the pharmacological blockade of A 2A Rs in status epilepticus-induced cell proliferation and migration of adult-born neurons. ( a ) Six/seven weeks old rats were injected either with saline (Control group) or with pilocarpine (Status Epilepticus group), 30 min after the administration of scopolamine methylbromide (2 mg/kg, i.p. ). Only animals reaching at least stage 4 seizures were considered. Convulsions were suppressed with diazepam (10 mg/kg, i.p. ) 2 h after the occurrence of the first stage 4 seizure. The rats from each group were assigned into two subgroups: one subgroup was daily injected with the selective antagonist of A 2A R, SCH58261 (0.1 mg/kg i.p. ), and the other with vehicle (0.2% Tween-20 in saline), starting 10 h after the onset of status epilepticus. All the animals were i.p. injected with BrdU at 24 h (200 mg/kg), 7 days (200 mg/kg) and 8 days (100 mg/kg) after status epilepticus. BrdU + -cells in the granule cell layer (GCL) per dentate gyrus (DG) was evaluated at 42 days post-status epilepticus by ( b ) immunohistochemical analysis of BrdU (green), NeuN (magenta) and GFAP (cyan). Scale bar, 300 μm. ( c ) Status epilepticus induced a significant increase in BrdU + -cells in the GCL per DG in vehicle-injected rats. SCH58261 significantly modified status epilepticus-induced increase in BrdU + -cells density (* P < 0.05 status epilepticus x SCH58261 interaction; two-way ANOVA). Post-hoc analysis revealed that status epilepticus did not significantly increase BrdU + -cells density in rats administered with SCH58261, but also there was no significant difference between status epilepticus-vehicle and status epilepticus-SCH58261. ( d ) Vehicle-injected rats that experienced status epilepticus displayed a higher relative percentage of BrdU + -cells in the outer two-thirds of the GCL in comparison with the Control group. No interaction was found between SCH58261 and status epilepticus factors (two-way ANOVA). The data are mean ± SEM of the number of the BrdU + -cells in GCL or the relative percentage of cells in the inner (1/3) and in the outer (2/3) parts of GCL. Control-Vehicle, n = 7; Control-SCH58261, n = 4; Status Epilepticus-Vehicle, n = 12; Status Epilepticus-SCH58261, n = 6. ML—molecular layer; GCL—granule cell layer; SGZ—subgranular zone. * P < 0.05, ** P < 0.01 and *** P < 0.001, two-way ANOVA with Sidak’s test.

Article Snippet: In vitro electroporation of dissociated cells with validated shRNA-A 2A R and a non-targeting control (shRNA-Control) encoding EGFP ( ; see Supplementary Figs. , ) was performed using Ingenio Electroporation kit (Mirus Biotech®; Cat#MIR 50118) and Nucleofector® IIb device (Amaxa Biosystems) as previously described .

Techniques: Migration, Injection, Saline, Immunohistochemistry, Modification, Comparison