shrimp alkaline phosphatase  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 75
    Name:
    Shrimp Alkaline Phosphatase
    Description:
    Proven Performance – the Phosphatase benchmark •100% heat-inactivated in 5 min at 65°C •Significantly improved storage stability at lower temperatures (see Fig. 1 and 2)  •Very high specific activity (see Fig. 3) •Removes 5'-phosphates from DNA, RNA, dNTPs, and proteins  •Purified from a recombinant source •May be added directly to restriction enzyme digests  •No vector purification necessary  •Requires no supplemental zinc or other additives for activity  •Works direct in many different buffers  •Easy treatment of unincorporated dNTPs in PCR products prior to DNA sequencing or SNP analysis USB Shrimp Alkaline Phosphatase (SAP) Shrimp Alkaline Phosphatase (SAP) is a high specific activity, heat-labile alkaline phosphatase  purified from a recombinant source and originally isolated from Pandalus borealis (arctic shrimp).  SAP is useful in many molecular biology applications such as the dephosphorylation of phosphorylated ends of DNA or RNA for subsequent use in cloning or end-labeling of probes. In cloning, dephosphorylation prevents relegation of linearized plasmid DNA. SAP may also be used to treat unincorporated dNTPs in PCR reactions to prepare templates for DNA sequencing or SNP analysis. Shrimp Alkaline Phosphatase has approximately the same specific activity as Calf Intestinal Alkaline Phosphatase (CIAP), and like CIAP, is active in virtually all restriction enzyme reaction buffers. Unlike CIAP, Shrimp Alkaline Phosphatase is completely and irreversibly inactivated by heating reactions at 65°C for 15 min. Shrimp Alkaline Phosphatase is particularly useful in preparing PCR products for applications involving sequencing, SNP analysis or labeling methods. Typically, excess dNTPs remaining after PCR interfere with subsequent enzymatic reactions involving DNA synthesis. SAP dephosphorylates all of the remaining dNTPs from the PCR mixture in one easy step. We are pleased to be offering a recombinant version of our phosphatase benchmark. Recombinant SAP eliminates the dependence on animal sourcing and offers the added benefits of increased storage stability and batch to batch consistency while providing exceptional enzymatic activity and 100% heat inactivation. Properties: Molecular Weight: Homodimer. Monomer is 55 kDa as determined by amino acid sequence. Optimum pH: 10.4 in glycine buffer and pH 8.0 in Tris buffer. Optimum Temperature: 37°C Heat-Inactivation: 65°C for 15 min. Inhibitors: 10mM DTT, 0.1% β-ME Reaction Conditions: Active in NaCl, KCl. Requires Mg2+ for highest activity. Source: Recombinant Purity: Tested for contaminating endonucleases, exonucleases, and ribonucleases. Storage Buffer: 25mM Tris-HCl (pH 7.5), 1mM MgCl2, 50% glycerol. Assay Conditions: The reaction mixture contains 100mM glycine, pH 10.4, 1mM MgCl2, 1mM ZnCl2, 10mM p-nitrophenyl phosphate, and 0.001-0.1 units of Shrimp Alkaline Phosphatase (SAP). The change in absorbance at 405 nm is monitored (3050 µL reaction volume). Unit Definition: One unit is the amount of enzyme which catalyzes the hydrolysis of 1 µmol of p-nitrophenyl phosphate per min in glycine buffer (pH 10.4) at 37°C. Concentration: 1 unit/µL Functional Test: Dephosphorylation of restriction enzyme digested plasmids (5 – 20 pmol of 5'-ends, 0.1 -0.5 units/pmol 5'-ends). Reduces religation to < 0.5% compared to the untreated control. PROTOCOL FOR DEPHOSPHORYLATION OF NUCLEOTIDES AND DEGRADATION OF PRIMERS PRIOR TO SEQUENCING REACTIONS OR SNP ANALYSES: Please refer to the USB ExoSAP-IT protocol, the benchmark in PCR clean-up. The purchase of ExoSAP-IT provides a license to the methods of PCR clean up using Exonuclease I and SAP. Functionally Tested 10X SAP Reaction Buffer (Included, PN 70103): 200mM Tris-HCl (pH 8.0), 100mM MgCl2. Functionally Tested SAP Dilution Buffer (1 ml included, PN 72761): 50mM Tris-HCl (pH 8.0). References: 1. RUAN, C. C., SAMOLS, S. B. AND FULLER, C. W. (1990) Comments 17, (No.1), United States Biochemical Corporation, Cleveland, OH. 2. WERLE, E., SCNEIDER C., RENNER, M., VÖLKER, M. AND FIEHN, W. (1994) Nucleic Acids Res. 22, 4354-4355. 3. HANKE, M. AND WINK, M. (1994) BioTechniques17, 858-860.
    Catalog Number:
    783901000UN
    Price:
    None
    Applications:
    PCR|PCR & Real-Time PCR|Sequencing
    Size:
    1000 units
    Category:
    Proteins, Enzymes, & Peptides, PCR & Cloning Enzymes, DNA⁄RNA Modifying Enzymes
    Score:
    85
    Buy from Supplier


    Structured Review

    Thermo Fisher shrimp alkaline phosphatase
    Proven Performance – the Phosphatase benchmark •100% heat-inactivated in 5 min at 65°C •Significantly improved storage stability at lower temperatures (see Fig. 1 and 2)  •Very high specific activity (see Fig. 3) •Removes 5'-phosphates from DNA, RNA, dNTPs, and proteins  •Purified from a recombinant source •May be added directly to restriction enzyme digests  •No vector purification necessary  •Requires no supplemental zinc or other additives for activity  •Works direct in many different buffers  •Easy treatment of unincorporated dNTPs in PCR products prior to DNA sequencing or SNP analysis USB Shrimp Alkaline Phosphatase (SAP) Shrimp Alkaline Phosphatase (SAP) is a high specific activity, heat-labile alkaline phosphatase  purified from a recombinant source and originally isolated from Pandalus borealis (arctic shrimp).  SAP is useful in many molecular biology applications such as the dephosphorylation of phosphorylated ends of DNA or RNA for subsequent use in cloning or end-labeling of probes. In cloning, dephosphorylation prevents relegation of linearized plasmid DNA. SAP may also be used to treat unincorporated dNTPs in PCR reactions to prepare templates for DNA sequencing or SNP analysis. Shrimp Alkaline Phosphatase has approximately the same specific activity as Calf Intestinal Alkaline Phosphatase (CIAP), and like CIAP, is active in virtually all restriction enzyme reaction buffers. Unlike CIAP, Shrimp Alkaline Phosphatase is completely and irreversibly inactivated by heating reactions at 65°C for 15 min. Shrimp Alkaline Phosphatase is particularly useful in preparing PCR products for applications involving sequencing, SNP analysis or labeling methods. Typically, excess dNTPs remaining after PCR interfere with subsequent enzymatic reactions involving DNA synthesis. SAP dephosphorylates all of the remaining dNTPs from the PCR mixture in one easy step. We are pleased to be offering a recombinant version of our phosphatase benchmark. Recombinant SAP eliminates the dependence on animal sourcing and offers the added benefits of increased storage stability and batch to batch consistency while providing exceptional enzymatic activity and 100% heat inactivation. Properties: Molecular Weight: Homodimer. Monomer is 55 kDa as determined by amino acid sequence. Optimum pH: 10.4 in glycine buffer and pH 8.0 in Tris buffer. Optimum Temperature: 37°C Heat-Inactivation: 65°C for 15 min. Inhibitors: 10mM DTT, 0.1% β-ME Reaction Conditions: Active in NaCl, KCl. Requires Mg2+ for highest activity. Source: Recombinant Purity: Tested for contaminating endonucleases, exonucleases, and ribonucleases. Storage Buffer: 25mM Tris-HCl (pH 7.5), 1mM MgCl2, 50% glycerol. Assay Conditions: The reaction mixture contains 100mM glycine, pH 10.4, 1mM MgCl2, 1mM ZnCl2, 10mM p-nitrophenyl phosphate, and 0.001-0.1 units of Shrimp Alkaline Phosphatase (SAP). The change in absorbance at 405 nm is monitored (3050 µL reaction volume). Unit Definition: One unit is the amount of enzyme which catalyzes the hydrolysis of 1 µmol of p-nitrophenyl phosphate per min in glycine buffer (pH 10.4) at 37°C. Concentration: 1 unit/µL Functional Test: Dephosphorylation of restriction enzyme digested plasmids (5 – 20 pmol of 5'-ends, 0.1 -0.5 units/pmol 5'-ends). Reduces religation to < 0.5% compared to the untreated control. PROTOCOL FOR DEPHOSPHORYLATION OF NUCLEOTIDES AND DEGRADATION OF PRIMERS PRIOR TO SEQUENCING REACTIONS OR SNP ANALYSES: Please refer to the USB ExoSAP-IT protocol, the benchmark in PCR clean-up. The purchase of ExoSAP-IT provides a license to the methods of PCR clean up using Exonuclease I and SAP. Functionally Tested 10X SAP Reaction Buffer (Included, PN 70103): 200mM Tris-HCl (pH 8.0), 100mM MgCl2. Functionally Tested SAP Dilution Buffer (1 ml included, PN 72761): 50mM Tris-HCl (pH 8.0). References: 1. RUAN, C. C., SAMOLS, S. B. AND FULLER, C. W. (1990) Comments 17, (No.1), United States Biochemical Corporation, Cleveland, OH. 2. WERLE, E., SCNEIDER C., RENNER, M., VÖLKER, M. AND FIEHN, W. (1994) Nucleic Acids Res. 22, 4354-4355. 3. HANKE, M. AND WINK, M. (1994) BioTechniques17, 858-860.
    https://www.bioz.com/result/shrimp alkaline phosphatase/product/Thermo Fisher
    Average 75 stars, based on 0 article reviews
    Price from $9.99 to $1999.99
    shrimp alkaline phosphatase - by Bioz Stars, 2019-12
    75/100 stars

    Images

    Related Articles

    Methylation Sequencing:

    Article Title: Genetic and Epigenetic Regulation of TOX3 Expression in Breast Cancer
    Article Snippet: Paragraph title: Bisulfite sequencing ... After cleaning PCR products with Exonuclease I (New England BioLabsInc, Ipswich, MA) and Shrimp Alkaline Phosphatase (Affymetrix, Santa Clara, CA), Sanger sequencing was performed at the University of Chicago Comprehensive Cancer Center DNA Sequencing and Genotyping Facility.

    Clone Assay:

    Article Title: Engineering Kluyveromyces marxianus as a Robust Synthetic Biology Platform Host
    Article Snippet: We identified and cloned an autonomous replicating sequence (ARS) from commercially available K. marxianus strain ATCC 36907 (Km11 [ ]) as follows. .. The plasmid was then linearized with EcoRI and treated with shrimp alkaline phosphatase (Affymetrix, 78390) to dephosphorylate the DNA ends and prevent religation of the vector.

    Amplification:

    Article Title: Proviruses with identical sequences comprise a large fraction of the replication-competent HIV reservoir
    Article Snippet: The nested PCR amplicon was ~1.5 kb spanning p6-PR-RT. .. The PCR product was treated with 20 U of Exonuclease I (Affymetrix) and 4 U of Shrimp Alkaline Phosphatase (Affymetrix).

    Article Title: Polymorphisms of Estrogen Metabolism-Related Genes and Prostate Cancer Risk in Two Populations of African Ancestry
    Article Snippet: Briefly, PCR was performed as follows: initial denaturation for 5 min at 95°C, followed by 35 cycles of 95°C for 1 min, 62°C for 45 seconds and 72°C for 45 seconds. .. PCR products were subjected to electrophoresis in a 2% agarose gel, and purified with exonuclease I and shrimp alkaline phosphatase (USB Corporation, High Wycombe, UK) treatment to remove unincorporated deoxynucleotides and primers from the amplified DNA. .. For primer extension with target complementary fluorescent dideoxyribonucleotides (ddNTPs), SNaPshot reactions were performed using the SNaPshot® Multiplex Kit (Applied Biosystems, Warrington, UK).

    Article Title: Reinvestigating the status of malaria parasite (Plasmodium sp.) in Indian non-human primates
    Article Snippet: Approximately 4μl of PCR product of each amplified DNA fragment for both the genes (18s rRNA andMSP-1 42 gene) was electrophoresed on a 2% agarose gel, utilizing a 100-bp ladder (BangloreGenei) to confirm amplicon size. .. Successfully amplified products were purified by incubation with Exonuclease-I and Shrimp Alkaline Phosphatase (Fermentas, Life Sciences) in a thermal cycler at 37°C for 120 min, followed by enzyme inactivation at 85°C for 15 min and subjected to sequencing from both the ends and identified using BLAST search. .. Parasite nuclear and mitochondrial markers sequenced from host M . radiata blood and tissue samples were subjected to phylogenetic analyses.

    Article Title: Exome sequencing of serous endometrial tumors identifies recurrent somatic mutations in chromatin-remodeling and ubiquitin ligase complex genes
    Article Snippet: Paragraph title: PCR amplification and Sanger sequencing ... PCR amplicons were purified using exonuclease I (Epicentre Biotechnologies) and shrimp alkaline phosphatase (USB Corporation) and bidirectionally sequenced using the Big Dye Terminator v.3.1 kit (Applied Biosystems) and M13 primers.

    Article Title: Truncating mutations of PPM1D are found in blood DNA samples of lung cancer patients
    Article Snippet: The exon 6 of PPM1D gene was amplified by PCR with AmpliTaq Gold polymerase (Life Technologies, Carlsbad, CA, USA) and the following primers: WIP-P11 TAGTGAATGCATACCCCGTT (forward), WIP-P12 CAAGCAAGTACAAGGCCAGGA (reverse). .. The PCR products were prepared for sequencing by treatment with exonuclease I and shrimp alkaline phosphatase (Affymetrix, Santa Clara, CA, USA).

    Article Title: Mutation analysis of the COL1A1 and COL1A2 genes in Vietnamese patients with osteogenesis imperfecta
    Article Snippet: The PCR touchdown program was used as follows for the reaction of amplification: 1 = 95.0°; 15:00 min 2 = 95.0°; 0:25 min 3 = 64.0°; 0:30 min 4 = 72.0°; 0:40 min 5 = go to 2.4 times 6 = 95.0°; 0:25 min 7 = 62.0°; 0:30 min 8 = 72.0°; 0:40 min 9 = go to 6.30 times 10 = 72.0°; 5:00 min 11 = 6.0°; forever Amplified PCR products were electrophoresed through a 1.5 % agarose gel, to control the quality of fragments. .. The PCR products then purified with exonuclease I and shrimp alkaline phosphatase (Thermo Fisher Scientific, USA).

    Article Title: Confirmation of the OVOL2 Promoter Mutation c.-307T > C in Posterior Polymorphous Corneal Dystrophy 1
    Article Snippet: For the OVOL2 coding region screening, reactions were cycled with the following program: denaturation at 95°C for 3 minutes; 38 cycles of annealing and extension at 95°C for 25 seconds, 52°C for 25 seconds, 72° for 30 seconds; and elongation at 72°C for 10 minutes. .. Prior to sequencing, 15–30 ng of each amplicon was purified by treatment with 5 units of Exonuclease I and 0.5 units of Shrimp Alkaline Phosphatase (USB Corp., Cleveland, OH), followed by incubation at 37°C for 15 minutes and inactivation at 80°C for 15 minutes. .. Sanger sequencing of the purified PCR template was performed by Laragen Sequencing & Genotyping (Laragen Inc., Culver City, CA).

    Article Title: Haplotypes of the D-Amino Acid Oxidase Gene Are Significantly Associated with Schizophrenia and Its Neurocognitive Deficits
    Article Snippet: The genomic regions of DAO selected using the above bioinformatics procedures were amplified by polymerase chain reaction (PCR). .. PCR products were purified with exonuclease I and shrimp alkaline phosphatase (USB Corporation, Cleveland, OH, USA) and sequenced from both ends.

    Article Title: Multi-color lineage tracing reveals clonal dynamics of squamous carcinoma evolution from initiation to metastasis
    Article Snippet: Hras locus containing codon 61 was PCR amplified using primer pair AAGCCTGTTGTTTTGCAGGA (forward) and GGTGGCTCACCTGTACTGATG (reverse). .. PCR product was purified using Exonuclease I (USB) and Shrimp Alkaline Phosphatase (Affymetrix), and Sanger sequencing was performed using the forward primer listed above by MCLAB.

    Blocking Assay:

    Article Title: Lagging strand replication shapes the mutational landscape of the genome
    Article Snippet: Terminal transferase (NEB) was then used to block any free 3′ ends with ddATP for 2 h at 37°C, with 20 U of TdT per μg of DNA. .. Shrimp Alkaline Phosphatase (Affymetrix; 5 U) was then used to remove 5′ phosphates at 37°C (1 h per μg of library).

    Article Title: ETS transcription factors induce a unique UV damage signature that drives recurrent mutagenesis in melanoma
    Article Snippet: To validate 3′ end blocking, 10% of DNA was separated, and denatured to ligate any remaining 3′ ends to the A adaptor. .. After removing 5′ phosphates with shrimp alkaline phosphatase (Affymetrix), DNA (~1 μg) was denatured and ligated to A adaptors at 16 ˚C overnight, using the NEBNext Quick Ligation Module.

    Electrophoresis:

    Article Title: Polymorphisms of Estrogen Metabolism-Related Genes and Prostate Cancer Risk in Two Populations of African Ancestry
    Article Snippet: Briefly, PCR was performed as follows: initial denaturation for 5 min at 95°C, followed by 35 cycles of 95°C for 1 min, 62°C for 45 seconds and 72°C for 45 seconds. .. PCR products were subjected to electrophoresis in a 2% agarose gel, and purified with exonuclease I and shrimp alkaline phosphatase (USB Corporation, High Wycombe, UK) treatment to remove unincorporated deoxynucleotides and primers from the amplified DNA. .. For primer extension with target complementary fluorescent dideoxyribonucleotides (ddNTPs), SNaPshot reactions were performed using the SNaPshot® Multiplex Kit (Applied Biosystems, Warrington, UK).

    Article Title: SNaPshot Assay for the Detection of the Most Common CFTR Mutations in Infertile Men
    Article Snippet: Paragraph title: PCR conditions and capillary electrophoresis ... The unincorporated ddNTPs were removed from the reaction mix by the use of 1 U shrimp alkaline phosphatase (Affymetrix, Inc., Santa Clara, California, USA) for 60 min on 37°C, followed by enzyme heat inactivation for 15 min on 65°C.

    Incubation:

    Article Title: Extensive transcriptional heterogeneity revealed by isoform profiling
    Article Snippet: The 5′ end of the non-capped RNA molecules was desphosphorylated by treatment with 6 units of Shrimp Alkaline Phosphatase (SAP, Fermentas) for 30 min at 37°C in the presence of RNase inhibitor (RNasin +, Promega). .. The RNA was then purified by a double phenol extraction and ethanol precipitation.

    Article Title: Reinvestigating the status of malaria parasite (Plasmodium sp.) in Indian non-human primates
    Article Snippet: Approximately 4μl of PCR product of each amplified DNA fragment for both the genes (18s rRNA andMSP-1 42 gene) was electrophoresed on a 2% agarose gel, utilizing a 100-bp ladder (BangloreGenei) to confirm amplicon size. .. Successfully amplified products were purified by incubation with Exonuclease-I and Shrimp Alkaline Phosphatase (Fermentas, Life Sciences) in a thermal cycler at 37°C for 120 min, followed by enzyme inactivation at 85°C for 15 min and subjected to sequencing from both the ends and identified using BLAST search. .. Parasite nuclear and mitochondrial markers sequenced from host M . radiata blood and tissue samples were subjected to phylogenetic analyses.

    Article Title: Ontogeny of alkaline phosphatase activity in infant intestines and breast milk
    Article Snippet: Samples were incubated at room temperature for 5 min and then fluorescence was detected at 460 nM (excitation at 355 nM) using a FLUOstar Omega microplate reader (BMG Labtech, Cary, NC). .. To calculate ALP content, all ALP activity measurements were compared to a standard curve using shrimp alkaline phosphatase (Thermo Fisher Scientific Inc.).

    Article Title: Confirmation of the OVOL2 Promoter Mutation c.-307T > C in Posterior Polymorphous Corneal Dystrophy 1
    Article Snippet: For the OVOL2 coding region screening, reactions were cycled with the following program: denaturation at 95°C for 3 minutes; 38 cycles of annealing and extension at 95°C for 25 seconds, 52°C for 25 seconds, 72° for 30 seconds; and elongation at 72°C for 10 minutes. .. Prior to sequencing, 15–30 ng of each amplicon was purified by treatment with 5 units of Exonuclease I and 0.5 units of Shrimp Alkaline Phosphatase (USB Corp., Cleveland, OH), followed by incubation at 37°C for 15 minutes and inactivation at 80°C for 15 minutes. .. Sanger sequencing of the purified PCR template was performed by Laragen Sequencing & Genotyping (Laragen Inc., Culver City, CA).

    Article Title: ETS transcription factors induce a unique UV damage signature that drives recurrent mutagenesis in melanoma
    Article Snippet: The remaining DNA (i.e., 90%) was sequentially incubated with T4 endonuclease V and human apurinic/apyrimidinic (AP) endonuclease (APE1, NEB) to generate new ligatable 3′-OH groups at CPD sites. .. After removing 5′ phosphates with shrimp alkaline phosphatase (Affymetrix), DNA (~1 μg) was denatured and ligated to A adaptors at 16 ˚C overnight, using the NEBNext Quick Ligation Module.

    Article Title: Engineering Kluyveromyces marxianus as a Robust Synthetic Biology Platform Host
    Article Snippet: One microgram of genomic DNA was incubated with restriction enzyme EcoRI (NEB, R0101S) to fragment the DNA. .. The plasmid was then linearized with EcoRI and treated with shrimp alkaline phosphatase (Affymetrix, 78390) to dephosphorylate the DNA ends and prevent religation of the vector.

    Activity Assay:

    Article Title: Ontogeny of alkaline phosphatase activity in infant intestines and breast milk
    Article Snippet: Negative controls were sample wells with 4MUP and Tris alone and milk samples heated at 100 °C for 5 min to inactivate endogenous ALPs. .. To calculate ALP content, all ALP activity measurements were compared to a standard curve using shrimp alkaline phosphatase (Thermo Fisher Scientific Inc.). .. Sample data from one individual was removed from the data set as the first weeks measurement was three standard deviations away from the mean.

    Mass Spectrometry:

    Article Title: Identification of Genetic Risk Factors for Neonatal Hyperbilirubinemia in Fujian Province, Southeastern China: A Case-Control Study
    Article Snippet: The PCR products were treated with shrimp alkaline phosphatase (SAP; Thermo Fisher Scientific, Inc.; Waltham, MA, USA) to remove the free dNTPs. .. The PCR products were treated with shrimp alkaline phosphatase (SAP; Thermo Fisher Scientific, Inc.; Waltham, MA, USA) to remove the free dNTPs.

    Modification:

    Article Title: Ontogeny of alkaline phosphatase activity in infant intestines and breast milk
    Article Snippet: To assay for ALP activity in breast milk, we modified a fluorometric detection method already published [ , ]. .. To calculate ALP content, all ALP activity measurements were compared to a standard curve using shrimp alkaline phosphatase (Thermo Fisher Scientific Inc.).

    Article Title: Genetic and Epigenetic Regulation of TOX3 Expression in Breast Cancer
    Article Snippet: Bisulfite modification of 0.5μg of DNA from breast cancer cell lines was carried out with the EZ DNA Methylation-Gold™ kit (Zymo Research, Irvine, CA) according to the manufacturer’s protocol. .. After cleaning PCR products with Exonuclease I (New England BioLabsInc, Ipswich, MA) and Shrimp Alkaline Phosphatase (Affymetrix, Santa Clara, CA), Sanger sequencing was performed at the University of Chicago Comprehensive Cancer Center DNA Sequencing and Genotyping Facility.

    Transformation Assay:

    Article Title: Engineering Kluyveromyces marxianus as a Robust Synthetic Biology Platform Host
    Article Snippet: The plasmid was then linearized with EcoRI and treated with shrimp alkaline phosphatase (Affymetrix, 78390) to dephosphorylate the DNA ends and prevent religation of the vector. .. The plasmid was then linearized with EcoRI and treated with shrimp alkaline phosphatase (Affymetrix, 78390) to dephosphorylate the DNA ends and prevent religation of the vector.

    Ligation:

    Article Title: Lagging strand replication shapes the mutational landscape of the genome
    Article Snippet: The trP1 adapter (see below) was attached using NEBNext Quick Ligation with 120 pmol of adapter per μg of DNA for 14-18 h at 16°C. .. Shrimp Alkaline Phosphatase (Affymetrix; 5 U) was then used to remove 5′ phosphates at 37°C (1 h per μg of library).

    Article Title: Extensive transcriptional heterogeneity revealed by isoform profiling
    Article Snippet: The 5′ end of the non-capped RNA molecules was desphosphorylated by treatment with 6 units of Shrimp Alkaline Phosphatase (SAP, Fermentas) for 30 min at 37°C in the presence of RNase inhibitor (RNasin +, Promega). .. The 5′ end of the non-capped RNA molecules was desphosphorylated by treatment with 6 units of Shrimp Alkaline Phosphatase (SAP, Fermentas) for 30 min at 37°C in the presence of RNase inhibitor (RNasin +, Promega).

    Article Title: ETS transcription factors induce a unique UV damage signature that drives recurrent mutagenesis in melanoma
    Article Snippet: The remaining DNA (i.e., 90%) was sequentially incubated with T4 endonuclease V and human apurinic/apyrimidinic (AP) endonuclease (APE1, NEB) to generate new ligatable 3′-OH groups at CPD sites. .. After removing 5′ phosphates with shrimp alkaline phosphatase (Affymetrix), DNA (~1 μg) was denatured and ligated to A adaptors at 16 ˚C overnight, using the NEBNext Quick Ligation Module. .. Distinct barcodes were embedded in the A adaptors to make libraries for different samples and facilitate multiplexed DNA sequencing.

    DNA Sequencing:

    Article Title: Genetic and Epigenetic Regulation of TOX3 Expression in Breast Cancer
    Article Snippet: The PCR products were run on a gel to confirm specificity. .. After cleaning PCR products with Exonuclease I (New England BioLabsInc, Ipswich, MA) and Shrimp Alkaline Phosphatase (Affymetrix, Santa Clara, CA), Sanger sequencing was performed at the University of Chicago Comprehensive Cancer Center DNA Sequencing and Genotyping Facility. .. Chromatograms of DNA sequencing were read on Chromas Lite 2.1.1 (Technelysium, South Brisbane, Australia).

    Polymerase Chain Reaction:

    Article Title: Proviruses with identical sequences comprise a large fraction of the replication-competent HIV reservoir
    Article Snippet: The nested PCR amplicon was ~1.5 kb spanning p6-PR-RT. .. The PCR product was treated with 20 U of Exonuclease I (Affymetrix) and 4 U of Shrimp Alkaline Phosphatase (Affymetrix). .. Sequencing was performed using four sequencing primers: 5’-TGTTGGAAATGTGGAAAGGAAGGAC-3’, 5’-ATGGCCCAAAAGTTAAACAATGGC-3’, 5’-TTCTTCTGTCAATGGCCATTGTTTAAC-3’, 5’-TTGCCCAATTCAATTTTCCCACTAA-3’.

    Article Title: Polymorphisms of Estrogen Metabolism-Related Genes and Prostate Cancer Risk in Two Populations of African Ancestry
    Article Snippet: Briefly, PCR was performed as follows: initial denaturation for 5 min at 95°C, followed by 35 cycles of 95°C for 1 min, 62°C for 45 seconds and 72°C for 45 seconds. .. PCR products were subjected to electrophoresis in a 2% agarose gel, and purified with exonuclease I and shrimp alkaline phosphatase (USB Corporation, High Wycombe, UK) treatment to remove unincorporated deoxynucleotides and primers from the amplified DNA. .. For primer extension with target complementary fluorescent dideoxyribonucleotides (ddNTPs), SNaPshot reactions were performed using the SNaPshot® Multiplex Kit (Applied Biosystems, Warrington, UK).

    Article Title: Identification of Genetic Risk Factors for Neonatal Hyperbilirubinemia in Fujian Province, Southeastern China: A Case-Control Study
    Article Snippet: Briefly, the three SNP loci were subjected to PCR assay with the designed primers ( ) in a 5 μ l of the reaction system containing 4 μ l of PCR Master Mix (Thermo Fisher Scientific, Inc.; Waltham, MA, USA) and 1 μ l of DNA template under the following conditions: at 94°C for 5 min; followed by 45 cycles of at 94°C for 20 s, at 56°C for 30 s, and at 72°C for 1 min; and finally at 72°C for 3 min. .. The PCR products were treated with shrimp alkaline phosphatase (SAP; Thermo Fisher Scientific, Inc.; Waltham, MA, USA) to remove the free dNTPs. .. Then, a single-base extension reaction was performed with the primers ( ) under the following conditions: at 94°C for 30 s; followed by 40 cycles of at 94°C for 5 s and 5 cycles of at 52°C for 5 s, and at 80°C for 5 s; and finally at 72°C for 3 min.

    Article Title: Reinvestigating the status of malaria parasite (Plasmodium sp.) in Indian non-human primates
    Article Snippet: Approximately 4μl of PCR product of each amplified DNA fragment for both the genes (18s rRNA andMSP-1 42 gene) was electrophoresed on a 2% agarose gel, utilizing a 100-bp ladder (BangloreGenei) to confirm amplicon size. .. Successfully amplified products were purified by incubation with Exonuclease-I and Shrimp Alkaline Phosphatase (Fermentas, Life Sciences) in a thermal cycler at 37°C for 120 min, followed by enzyme inactivation at 85°C for 15 min and subjected to sequencing from both the ends and identified using BLAST search.

    Article Title: Exome sequencing of serous endometrial tumors identifies recurrent somatic mutations in chromatin-remodeling and ubiquitin ligase complex genes
    Article Snippet: PCR amplification was performed on a GeneAmp® PCR System 9700 (Applied Biosystems). .. PCR amplicons were purified using exonuclease I (Epicentre Biotechnologies) and shrimp alkaline phosphatase (USB Corporation) and bidirectionally sequenced using the Big Dye Terminator v.3.1 kit (Applied Biosystems) and M13 primers. .. Cycle sequencing products were run on an ABI-3730xl DNA analyzer (Applied Biosystems).

    Article Title: Truncating mutations of PPM1D are found in blood DNA samples of lung cancer patients
    Article Snippet: The exon 6 of PPM1D gene was amplified by PCR with AmpliTaq Gold polymerase (Life Technologies, Carlsbad, CA, USA) and the following primers: WIP-P11 TAGTGAATGCATACCCCGTT (forward), WIP-P12 CAAGCAAGTACAAGGCCAGGA (reverse). .. The PCR products were prepared for sequencing by treatment with exonuclease I and shrimp alkaline phosphatase (Affymetrix, Santa Clara, CA, USA). .. The sequencing reaction was performed using BigDye Terminator v.3.1 cycle sequencing kit (Life Technologies) and the forward primer (TCACATGCATAGATTTGTTGAGTTC) located in intron 5.

    Article Title: Mutation analysis of the COL1A1 and COL1A2 genes in Vietnamese patients with osteogenesis imperfecta
    Article Snippet: The PCR touchdown program was used as follows for the reaction of amplification: 1 = 95.0°; 15:00 min 2 = 95.0°; 0:25 min 3 = 64.0°; 0:30 min 4 = 72.0°; 0:40 min 5 = go to 2.4 times 6 = 95.0°; 0:25 min 7 = 62.0°; 0:30 min 8 = 72.0°; 0:40 min 9 = go to 6.30 times 10 = 72.0°; 5:00 min 11 = 6.0°; forever Amplified PCR products were electrophoresed through a 1.5 % agarose gel, to control the quality of fragments. .. The PCR products then purified with exonuclease I and shrimp alkaline phosphatase (Thermo Fisher Scientific, USA). .. Sanger sequencing reactions were performed on the purified PCR fragments using a BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, USA).

    Article Title: Confirmation of the OVOL2 Promoter Mutation c.-307T > C in Posterior Polymorphous Corneal Dystrophy 1
    Article Snippet: Paragraph title: OVOL2 —Polymerase chain reaction (PCR) and Sanger sequencing ... Prior to sequencing, 15–30 ng of each amplicon was purified by treatment with 5 units of Exonuclease I and 0.5 units of Shrimp Alkaline Phosphatase (USB Corp., Cleveland, OH), followed by incubation at 37°C for 15 minutes and inactivation at 80°C for 15 minutes.

    Article Title: ETS transcription factors induce a unique UV damage signature that drives recurrent mutagenesis in melanoma
    Article Snippet: The lack of free 3′-OHs was confirmed using PCR with 32 P-labeled primer A and cold primer trP1 . .. After removing 5′ phosphates with shrimp alkaline phosphatase (Affymetrix), DNA (~1 μg) was denatured and ligated to A adaptors at 16 ˚C overnight, using the NEBNext Quick Ligation Module.

    Article Title: Haplotypes of the D-Amino Acid Oxidase Gene Are Significantly Associated with Schizophrenia and Its Neurocognitive Deficits
    Article Snippet: The genomic regions of DAO selected using the above bioinformatics procedures were amplified by polymerase chain reaction (PCR). .. PCR products were purified with exonuclease I and shrimp alkaline phosphatase (USB Corporation, Cleveland, OH, USA) and sequenced from both ends. .. DNA sequencing reactions were performed with BigDye Terminator Cycle Sequencing Version 3.1 (Applied Biosystems, Foster City, CA, USA) followed by analysis on an ABI 3730xl DNA Analyzer (Applied Biosystems, CA, USA).

    Article Title: Biallelic mutations in SNX14 cause a syndromic form of cerebellar atrophy and lysosome-autophagosome dysfunction
    Article Snippet: Primers were designed using the Primer3 program and tested for specificity using NIH BLAST software. .. PCR products were treated with Exonuclease I (Fermentas) and Shrimp Alkaline Phosphatase (USB Corporation) and sequenced using BigDye terminator cycle sequencing Kit v.3.1 on an ABI 3100 DNA analyzer (Applied Biosystems). .. Sequence data was analyzed by Sequencher 4.9 (Gene Codes) to test segregation of the mutation with the disorder under a recessive mode of inheritance, taking advantage of all informative meioses in each family.

    Article Title: Genetic and Epigenetic Regulation of TOX3 Expression in Breast Cancer
    Article Snippet: The PCR products were run on a gel to confirm specificity. .. After cleaning PCR products with Exonuclease I (New England BioLabsInc, Ipswich, MA) and Shrimp Alkaline Phosphatase (Affymetrix, Santa Clara, CA), Sanger sequencing was performed at the University of Chicago Comprehensive Cancer Center DNA Sequencing and Genotyping Facility. .. Chromatograms of DNA sequencing were read on Chromas Lite 2.1.1 (Technelysium, South Brisbane, Australia).

    Article Title: SNaPshot Assay for the Detection of the Most Common CFTR Mutations in Infertile Men
    Article Snippet: Paragraph title: PCR conditions and capillary electrophoresis ... The unincorporated ddNTPs were removed from the reaction mix by the use of 1 U shrimp alkaline phosphatase (Affymetrix, Inc., Santa Clara, California, USA) for 60 min on 37°C, followed by enzyme heat inactivation for 15 min on 65°C.

    Article Title: Multi-color lineage tracing reveals clonal dynamics of squamous carcinoma evolution from initiation to metastasis
    Article Snippet: Hras locus containing codon 61 was PCR amplified using primer pair AAGCCTGTTGTTTTGCAGGA (forward) and GGTGGCTCACCTGTACTGATG (reverse). .. PCR product was purified using Exonuclease I (USB) and Shrimp Alkaline Phosphatase (Affymetrix), and Sanger sequencing was performed using the forward primer listed above by MCLAB. .. Images were taken using FinchTV.

    Sonication:

    Article Title: Proviruses with identical sequences comprise a large fraction of the replication-competent HIV reservoir
    Article Snippet: The PCR product was treated with 20 U of Exonuclease I (Affymetrix) and 4 U of Shrimp Alkaline Phosphatase (Affymetrix). .. The PCR product was treated with 20 U of Exonuclease I (Affymetrix) and 4 U of Shrimp Alkaline Phosphatase (Affymetrix).

    Recombinant:

    Article Title: Lagging strand replication shapes the mutational landscape of the genome
    Article Snippet: After Ampure XP purification, beads were removed and DNA nicked using recombinant RNase H2 (10 pmol per μg of library) or Nb.BtsI (NEB; 10 U per μg) for 2 h at 37°C. .. Shrimp Alkaline Phosphatase (Affymetrix; 5 U) was then used to remove 5′ phosphates at 37°C (1 h per μg of library).

    DNA Extraction:

    Article Title: Identification of Genetic Risk Factors for Neonatal Hyperbilirubinemia in Fujian Province, Southeastern China: A Case-Control Study
    Article Snippet: Genomic DNA was extracted from EDTA-anticoagulated blood samples using the High-pure Genomic DNA Isolation Kit (Guangzhou Hers Biotechnology Co., Ltd.; Guangzhou, China) and stored at −20°C for the subsequent experiments. .. The PCR products were treated with shrimp alkaline phosphatase (SAP; Thermo Fisher Scientific, Inc.; Waltham, MA, USA) to remove the free dNTPs.

    Article Title: Engineering Kluyveromyces marxianus as a Robust Synthetic Biology Platform Host
    Article Snippet: Using a YeaStar genomic DNA extraction kit (Zymo Research, D2002), genomic DNA was extracted from K. marxianus ATCC 36907. .. The plasmid was then linearized with EcoRI and treated with shrimp alkaline phosphatase (Affymetrix, 78390) to dephosphorylate the DNA ends and prevent religation of the vector.

    Fluorescence:

    Article Title: Ontogeny of alkaline phosphatase activity in infant intestines and breast milk
    Article Snippet: Samples were incubated at room temperature for 5 min and then fluorescence was detected at 460 nM (excitation at 355 nM) using a FLUOstar Omega microplate reader (BMG Labtech, Cary, NC). .. To calculate ALP content, all ALP activity measurements were compared to a standard curve using shrimp alkaline phosphatase (Thermo Fisher Scientific Inc.).

    Methylation:

    Article Title: Genetic and Epigenetic Regulation of TOX3 Expression in Breast Cancer
    Article Snippet: Bisulfite modification of 0.5μg of DNA from breast cancer cell lines was carried out with the EZ DNA Methylation-Gold™ kit (Zymo Research, Irvine, CA) according to the manufacturer’s protocol. .. After cleaning PCR products with Exonuclease I (New England BioLabsInc, Ipswich, MA) and Shrimp Alkaline Phosphatase (Affymetrix, Santa Clara, CA), Sanger sequencing was performed at the University of Chicago Comprehensive Cancer Center DNA Sequencing and Genotyping Facility.

    Mutagenesis:

    Article Title: Truncating mutations of PPM1D are found in blood DNA samples of lung cancer patients
    Article Snippet: The PCR products were prepared for sequencing by treatment with exonuclease I and shrimp alkaline phosphatase (Affymetrix, Santa Clara, CA, USA). .. The sequencing reaction was performed using BigDye Terminator v.3.1 cycle sequencing kit (Life Technologies) and the forward primer (TCACATGCATAGATTTGTTGAGTTC) located in intron 5.

    Size-exclusion Chromatography:

    Article Title: SNaPshot Assay for the Detection of the Most Common CFTR Mutations in Infertile Men
    Article Snippet: The unincorporated ddNTPs were removed from the reaction mix by the use of 1 U shrimp alkaline phosphatase (Affymetrix, Inc., Santa Clara, California, USA) for 60 min on 37°C, followed by enzyme heat inactivation for 15 min on 65°C. .. The unincorporated ddNTPs were removed from the reaction mix by the use of 1 U shrimp alkaline phosphatase (Affymetrix, Inc., Santa Clara, California, USA) for 60 min on 37°C, followed by enzyme heat inactivation for 15 min on 65°C.

    Labeling:

    Article Title: Polymorphisms of Estrogen Metabolism-Related Genes and Prostate Cancer Risk in Two Populations of African Ancestry
    Article Snippet: PCR products were subjected to electrophoresis in a 2% agarose gel, and purified with exonuclease I and shrimp alkaline phosphatase (USB Corporation, High Wycombe, UK) treatment to remove unincorporated deoxynucleotides and primers from the amplified DNA. .. For primer extension with target complementary fluorescent dideoxyribonucleotides (ddNTPs), SNaPshot reactions were performed using the SNaPshot® Multiplex Kit (Applied Biosystems, Warrington, UK).

    Article Title: ETS transcription factors induce a unique UV damage signature that drives recurrent mutagenesis in melanoma
    Article Snippet: After removing 5′ phosphates with shrimp alkaline phosphatase (Affymetrix), DNA (~1 μg) was denatured and ligated to A adaptors at 16 ˚C overnight, using the NEBNext Quick Ligation Module. .. Distinct barcodes were embedded in the A adaptors to make libraries for different samples and facilitate multiplexed DNA sequencing.

    Purification:

    Article Title: Lagging strand replication shapes the mutational landscape of the genome
    Article Snippet: Enzymes were inactivated by heating at 80°C for 20 min, and DNA was purified using 1.8 volumes of Ampure XP. .. Shrimp Alkaline Phosphatase (Affymetrix; 5 U) was then used to remove 5′ phosphates at 37°C (1 h per μg of library).

    Article Title: Extensive transcriptional heterogeneity revealed by isoform profiling
    Article Snippet: The 5′ end of the non-capped RNA molecules was desphosphorylated by treatment with 6 units of Shrimp Alkaline Phosphatase (SAP, Fermentas) for 30 min at 37°C in the presence of RNase inhibitor (RNasin +, Promega). .. CAP was removed by a 1-hour incubation at 37°C with 5 units of Tobacco Acid Pyrophosphatase (TAP, Epicentre) in the presence of RNase inhibitor.

    Article Title: Polymorphisms of Estrogen Metabolism-Related Genes and Prostate Cancer Risk in Two Populations of African Ancestry
    Article Snippet: Briefly, PCR was performed as follows: initial denaturation for 5 min at 95°C, followed by 35 cycles of 95°C for 1 min, 62°C for 45 seconds and 72°C for 45 seconds. .. PCR products were subjected to electrophoresis in a 2% agarose gel, and purified with exonuclease I and shrimp alkaline phosphatase (USB Corporation, High Wycombe, UK) treatment to remove unincorporated deoxynucleotides and primers from the amplified DNA. .. For primer extension with target complementary fluorescent dideoxyribonucleotides (ddNTPs), SNaPshot reactions were performed using the SNaPshot® Multiplex Kit (Applied Biosystems, Warrington, UK).

    Article Title: Identification of Genetic Risk Factors for Neonatal Hyperbilirubinemia in Fujian Province, Southeastern China: A Case-Control Study
    Article Snippet: The PCR products were treated with shrimp alkaline phosphatase (SAP; Thermo Fisher Scientific, Inc.; Waltham, MA, USA) to remove the free dNTPs. .. The PCR products were treated with shrimp alkaline phosphatase (SAP; Thermo Fisher Scientific, Inc.; Waltham, MA, USA) to remove the free dNTPs.

    Article Title: Reinvestigating the status of malaria parasite (Plasmodium sp.) in Indian non-human primates
    Article Snippet: Approximately 4μl of PCR product of each amplified DNA fragment for both the genes (18s rRNA andMSP-1 42 gene) was electrophoresed on a 2% agarose gel, utilizing a 100-bp ladder (BangloreGenei) to confirm amplicon size. .. Successfully amplified products were purified by incubation with Exonuclease-I and Shrimp Alkaline Phosphatase (Fermentas, Life Sciences) in a thermal cycler at 37°C for 120 min, followed by enzyme inactivation at 85°C for 15 min and subjected to sequencing from both the ends and identified using BLAST search. .. Parasite nuclear and mitochondrial markers sequenced from host M . radiata blood and tissue samples were subjected to phylogenetic analyses.

    Article Title: Exome sequencing of serous endometrial tumors identifies recurrent somatic mutations in chromatin-remodeling and ubiquitin ligase complex genes
    Article Snippet: PCR amplification was performed on a GeneAmp® PCR System 9700 (Applied Biosystems). .. PCR amplicons were purified using exonuclease I (Epicentre Biotechnologies) and shrimp alkaline phosphatase (USB Corporation) and bidirectionally sequenced using the Big Dye Terminator v.3.1 kit (Applied Biosystems) and M13 primers. .. Cycle sequencing products were run on an ABI-3730xl DNA analyzer (Applied Biosystems).

    Article Title: Truncating mutations of PPM1D are found in blood DNA samples of lung cancer patients
    Article Snippet: The whole blood DNA samples were purified using Genomic Maxi AX column purification kit (A & A Biotechnology, Gdynia, Poland). .. The PCR products were prepared for sequencing by treatment with exonuclease I and shrimp alkaline phosphatase (Affymetrix, Santa Clara, CA, USA).

    Article Title: Mutation analysis of the COL1A1 and COL1A2 genes in Vietnamese patients with osteogenesis imperfecta
    Article Snippet: The PCR touchdown program was used as follows for the reaction of amplification: 1 = 95.0°; 15:00 min 2 = 95.0°; 0:25 min 3 = 64.0°; 0:30 min 4 = 72.0°; 0:40 min 5 = go to 2.4 times 6 = 95.0°; 0:25 min 7 = 62.0°; 0:30 min 8 = 72.0°; 0:40 min 9 = go to 6.30 times 10 = 72.0°; 5:00 min 11 = 6.0°; forever Amplified PCR products were electrophoresed through a 1.5 % agarose gel, to control the quality of fragments. .. The PCR products then purified with exonuclease I and shrimp alkaline phosphatase (Thermo Fisher Scientific, USA). .. Sanger sequencing reactions were performed on the purified PCR fragments using a BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, USA).

    Article Title: Confirmation of the OVOL2 Promoter Mutation c.-307T > C in Posterior Polymorphous Corneal Dystrophy 1
    Article Snippet: For the OVOL2 coding region screening, reactions were cycled with the following program: denaturation at 95°C for 3 minutes; 38 cycles of annealing and extension at 95°C for 25 seconds, 52°C for 25 seconds, 72° for 30 seconds; and elongation at 72°C for 10 minutes. .. Prior to sequencing, 15–30 ng of each amplicon was purified by treatment with 5 units of Exonuclease I and 0.5 units of Shrimp Alkaline Phosphatase (USB Corp., Cleveland, OH), followed by incubation at 37°C for 15 minutes and inactivation at 80°C for 15 minutes. .. Sanger sequencing of the purified PCR template was performed by Laragen Sequencing & Genotyping (Laragen Inc., Culver City, CA).

    Article Title: ETS transcription factors induce a unique UV damage signature that drives recurrent mutagenesis in melanoma
    Article Snippet: After removing 5′ phosphates with shrimp alkaline phosphatase (Affymetrix), DNA (~1 μg) was denatured and ligated to A adaptors at 16 ˚C overnight, using the NEBNext Quick Ligation Module. .. Distinct barcodes were embedded in the A adaptors to make libraries for different samples and facilitate multiplexed DNA sequencing.

    Article Title: Haplotypes of the D-Amino Acid Oxidase Gene Are Significantly Associated with Schizophrenia and Its Neurocognitive Deficits
    Article Snippet: The genomic regions of DAO selected using the above bioinformatics procedures were amplified by polymerase chain reaction (PCR). .. PCR products were purified with exonuclease I and shrimp alkaline phosphatase (USB Corporation, Cleveland, OH, USA) and sequenced from both ends. .. DNA sequencing reactions were performed with BigDye Terminator Cycle Sequencing Version 3.1 (Applied Biosystems, Foster City, CA, USA) followed by analysis on an ABI 3730xl DNA Analyzer (Applied Biosystems, CA, USA).

    Article Title: SNaPshot Assay for the Detection of the Most Common CFTR Mutations in Infertile Men
    Article Snippet: Subsequently, 2 ul of purified PCR multiplex mix was combined with 1 ul extension primer mix and 1 ul of SNaPshot Multiplex Ready Reaction Mix (Life Technologies, Carlsbad, California, USA). .. The unincorporated ddNTPs were removed from the reaction mix by the use of 1 U shrimp alkaline phosphatase (Affymetrix, Inc., Santa Clara, California, USA) for 60 min on 37°C, followed by enzyme heat inactivation for 15 min on 65°C.

    Article Title: Multi-color lineage tracing reveals clonal dynamics of squamous carcinoma evolution from initiation to metastasis
    Article Snippet: Hras locus containing codon 61 was PCR amplified using primer pair AAGCCTGTTGTTTTGCAGGA (forward) and GGTGGCTCACCTGTACTGATG (reverse). .. PCR product was purified using Exonuclease I (USB) and Shrimp Alkaline Phosphatase (Affymetrix), and Sanger sequencing was performed using the forward primer listed above by MCLAB. .. Images were taken using FinchTV.

    Sequencing:

    Article Title: Lagging strand replication shapes the mutational landscape of the genome
    Article Snippet: Paragraph title: EmRiboSeq library preparation and sequencing ... Shrimp Alkaline Phosphatase (Affymetrix; 5 U) was then used to remove 5′ phosphates at 37°C (1 h per μg of library).

    Article Title: Proviruses with identical sequences comprise a large fraction of the replication-competent HIV reservoir
    Article Snippet: Paragraph title: Single-genome sequencing (SGS) of p6-PR-RT from p24-positive VOA wells and from HIV DNA and cell-associated RNA in uncultured blood mononuclear cells ... The PCR product was treated with 20 U of Exonuclease I (Affymetrix) and 4 U of Shrimp Alkaline Phosphatase (Affymetrix).

    Article Title: Identification of Genetic Risk Factors for Neonatal Hyperbilirubinemia in Fujian Province, Southeastern China: A Case-Control Study
    Article Snippet: The PCR products were treated with shrimp alkaline phosphatase (SAP; Thermo Fisher Scientific, Inc.; Waltham, MA, USA) to remove the free dNTPs. .. The MALDI-TOF data were processed using the software TYPER version 4.0.

    Article Title: Reinvestigating the status of malaria parasite (Plasmodium sp.) in Indian non-human primates
    Article Snippet: Approximately 4μl of PCR product of each amplified DNA fragment for both the genes (18s rRNA andMSP-1 42 gene) was electrophoresed on a 2% agarose gel, utilizing a 100-bp ladder (BangloreGenei) to confirm amplicon size. .. Successfully amplified products were purified by incubation with Exonuclease-I and Shrimp Alkaline Phosphatase (Fermentas, Life Sciences) in a thermal cycler at 37°C for 120 min, followed by enzyme inactivation at 85°C for 15 min and subjected to sequencing from both the ends and identified using BLAST search. .. Parasite nuclear and mitochondrial markers sequenced from host M . radiata blood and tissue samples were subjected to phylogenetic analyses.

    Article Title: Exome sequencing of serous endometrial tumors identifies recurrent somatic mutations in chromatin-remodeling and ubiquitin ligase complex genes
    Article Snippet: Paragraph title: PCR amplification and Sanger sequencing ... PCR amplicons were purified using exonuclease I (Epicentre Biotechnologies) and shrimp alkaline phosphatase (USB Corporation) and bidirectionally sequenced using the Big Dye Terminator v.3.1 kit (Applied Biosystems) and M13 primers.

    Article Title: Truncating mutations of PPM1D are found in blood DNA samples of lung cancer patients
    Article Snippet: The exon 6 of PPM1D gene was amplified by PCR with AmpliTaq Gold polymerase (Life Technologies, Carlsbad, CA, USA) and the following primers: WIP-P11 TAGTGAATGCATACCCCGTT (forward), WIP-P12 CAAGCAAGTACAAGGCCAGGA (reverse). .. The PCR products were prepared for sequencing by treatment with exonuclease I and shrimp alkaline phosphatase (Affymetrix, Santa Clara, CA, USA). .. The sequencing reaction was performed using BigDye Terminator v.3.1 cycle sequencing kit (Life Technologies) and the forward primer (TCACATGCATAGATTTGTTGAGTTC) located in intron 5.

    Article Title: Mutation analysis of the COL1A1 and COL1A2 genes in Vietnamese patients with osteogenesis imperfecta
    Article Snippet: The PCR products then purified with exonuclease I and shrimp alkaline phosphatase (Thermo Fisher Scientific, USA). .. The PCR products then purified with exonuclease I and shrimp alkaline phosphatase (Thermo Fisher Scientific, USA).

    Article Title: Confirmation of the OVOL2 Promoter Mutation c.-307T > C in Posterior Polymorphous Corneal Dystrophy 1
    Article Snippet: For the OVOL2 coding region screening, reactions were cycled with the following program: denaturation at 95°C for 3 minutes; 38 cycles of annealing and extension at 95°C for 25 seconds, 52°C for 25 seconds, 72° for 30 seconds; and elongation at 72°C for 10 minutes. .. Prior to sequencing, 15–30 ng of each amplicon was purified by treatment with 5 units of Exonuclease I and 0.5 units of Shrimp Alkaline Phosphatase (USB Corp., Cleveland, OH), followed by incubation at 37°C for 15 minutes and inactivation at 80°C for 15 minutes. .. Sanger sequencing of the purified PCR template was performed by Laragen Sequencing & Genotyping (Laragen Inc., Culver City, CA).

    Article Title: ETS transcription factors induce a unique UV damage signature that drives recurrent mutagenesis in melanoma
    Article Snippet: Paragraph title: CPD-seq library preparation and sequencing ... After removing 5′ phosphates with shrimp alkaline phosphatase (Affymetrix), DNA (~1 μg) was denatured and ligated to A adaptors at 16 ˚C overnight, using the NEBNext Quick Ligation Module.

    Article Title: Haplotypes of the D-Amino Acid Oxidase Gene Are Significantly Associated with Schizophrenia and Its Neurocognitive Deficits
    Article Snippet: Paragraph title: Direct sequencing ... PCR products were purified with exonuclease I and shrimp alkaline phosphatase (USB Corporation, Cleveland, OH, USA) and sequenced from both ends.

    Article Title: Biallelic mutations in SNX14 cause a syndromic form of cerebellar atrophy and lysosome-autophagosome dysfunction
    Article Snippet: Primers were designed using the Primer3 program and tested for specificity using NIH BLAST software. .. PCR products were treated with Exonuclease I (Fermentas) and Shrimp Alkaline Phosphatase (USB Corporation) and sequenced using BigDye terminator cycle sequencing Kit v.3.1 on an ABI 3100 DNA analyzer (Applied Biosystems). .. Sequence data was analyzed by Sequencher 4.9 (Gene Codes) to test segregation of the mutation with the disorder under a recessive mode of inheritance, taking advantage of all informative meioses in each family.

    Article Title: Genetic and Epigenetic Regulation of TOX3 Expression in Breast Cancer
    Article Snippet: The PCR products were run on a gel to confirm specificity. .. After cleaning PCR products with Exonuclease I (New England BioLabsInc, Ipswich, MA) and Shrimp Alkaline Phosphatase (Affymetrix, Santa Clara, CA), Sanger sequencing was performed at the University of Chicago Comprehensive Cancer Center DNA Sequencing and Genotyping Facility. .. Chromatograms of DNA sequencing were read on Chromas Lite 2.1.1 (Technelysium, South Brisbane, Australia).

    Article Title: Multi-color lineage tracing reveals clonal dynamics of squamous carcinoma evolution from initiation to metastasis
    Article Snippet: Hras locus containing codon 61 was PCR amplified using primer pair AAGCCTGTTGTTTTGCAGGA (forward) and GGTGGCTCACCTGTACTGATG (reverse). .. PCR product was purified using Exonuclease I (USB) and Shrimp Alkaline Phosphatase (Affymetrix), and Sanger sequencing was performed using the forward primer listed above by MCLAB. .. Images were taken using FinchTV.

    Article Title: Engineering Kluyveromyces marxianus as a Robust Synthetic Biology Platform Host
    Article Snippet: We identified and cloned an autonomous replicating sequence (ARS) from commercially available K. marxianus strain ATCC 36907 (Km11 [ ]) as follows. .. The plasmid was then linearized with EcoRI and treated with shrimp alkaline phosphatase (Affymetrix, 78390) to dephosphorylate the DNA ends and prevent religation of the vector.

    Nested PCR:

    Article Title: Proviruses with identical sequences comprise a large fraction of the replication-competent HIV reservoir
    Article Snippet: The nested PCR amplicon was ~1.5 kb spanning p6-PR-RT. .. The PCR product was treated with 20 U of Exonuclease I (Affymetrix) and 4 U of Shrimp Alkaline Phosphatase (Affymetrix).

    Plasmid Preparation:

    Article Title: Engineering Kluyveromyces marxianus as a Robust Synthetic Biology Platform Host
    Article Snippet: In parallel, the S. cerevisiae 2μ origin of replication was replaced with an EcoRI digestion site in pOR1.1. .. The plasmid was then linearized with EcoRI and treated with shrimp alkaline phosphatase (Affymetrix, 78390) to dephosphorylate the DNA ends and prevent religation of the vector. .. The genomic DNA fragment pool was ligated with the linearized plasmid using T4 DNA ligase (Invitrogen, 15224017), transformed into One Shot TOP10 competent E. coli (C404003), and plated on kanamycin selection plates.

    Software:

    Article Title: Identification of Genetic Risk Factors for Neonatal Hyperbilirubinemia in Fujian Province, Southeastern China: A Case-Control Study
    Article Snippet: The PCR products were treated with shrimp alkaline phosphatase (SAP; Thermo Fisher Scientific, Inc.; Waltham, MA, USA) to remove the free dNTPs. .. The extension products were purified with resin, and then subjected to matrix-assisted laser desorption/ionization time of flight mass spectrometry (MALDI-TOF).

    Article Title: Exome sequencing of serous endometrial tumors identifies recurrent somatic mutations in chromatin-remodeling and ubiquitin ligase complex genes
    Article Snippet: PCR amplicons were purified using exonuclease I (Epicentre Biotechnologies) and shrimp alkaline phosphatase (USB Corporation) and bidirectionally sequenced using the Big Dye Terminator v.3.1 kit (Applied Biosystems) and M13 primers. .. PCR amplicons were purified using exonuclease I (Epicentre Biotechnologies) and shrimp alkaline phosphatase (USB Corporation) and bidirectionally sequenced using the Big Dye Terminator v.3.1 kit (Applied Biosystems) and M13 primers.

    Article Title: Biallelic mutations in SNX14 cause a syndromic form of cerebellar atrophy and lysosome-autophagosome dysfunction
    Article Snippet: Primers were designed using the Primer3 program and tested for specificity using NIH BLAST software. .. PCR products were treated with Exonuclease I (Fermentas) and Shrimp Alkaline Phosphatase (USB Corporation) and sequenced using BigDye terminator cycle sequencing Kit v.3.1 on an ABI 3100 DNA analyzer (Applied Biosystems).

    Article Title: SNaPshot Assay for the Detection of the Most Common CFTR Mutations in Infertile Men
    Article Snippet: The unincorporated ddNTPs were removed from the reaction mix by the use of 1 U shrimp alkaline phosphatase (Affymetrix, Inc., Santa Clara, California, USA) for 60 min on 37°C, followed by enzyme heat inactivation for 15 min on 65°C. .. Capillary electrophoresis was conducted following manufacturer instructions on a 36 cm length capillary and POP-4 polymer.

    Irradiation:

    Article Title: Truncating mutations of PPM1D are found in blood DNA samples of lung cancer patients
    Article Snippet: The PCR products were prepared for sequencing by treatment with exonuclease I and shrimp alkaline phosphatase (Affymetrix, Santa Clara, CA, USA). .. The PCR products were prepared for sequencing by treatment with exonuclease I and shrimp alkaline phosphatase (Affymetrix, Santa Clara, CA, USA).

    Multiplex Assay:

    Article Title: Polymorphisms of Estrogen Metabolism-Related Genes and Prostate Cancer Risk in Two Populations of African Ancestry
    Article Snippet: Single-nucleotide polymorphisms of the CYP17 , CYP1B1 and COMT genes were screened by multiplex PCR amplifications followed by SNaPshot single-nucleotide primer extension. .. PCR products were subjected to electrophoresis in a 2% agarose gel, and purified with exonuclease I and shrimp alkaline phosphatase (USB Corporation, High Wycombe, UK) treatment to remove unincorporated deoxynucleotides and primers from the amplified DNA.

    Article Title: SNaPshot Assay for the Detection of the Most Common CFTR Mutations in Infertile Men
    Article Snippet: Subsequently, 2 ul of purified PCR multiplex mix was combined with 1 ul extension primer mix and 1 ul of SNaPshot Multiplex Ready Reaction Mix (Life Technologies, Carlsbad, California, USA). .. The unincorporated ddNTPs were removed from the reaction mix by the use of 1 U shrimp alkaline phosphatase (Affymetrix, Inc., Santa Clara, California, USA) for 60 min on 37°C, followed by enzyme heat inactivation for 15 min on 65°C.

    Selection:

    Article Title: Engineering Kluyveromyces marxianus as a Robust Synthetic Biology Platform Host
    Article Snippet: The plasmid was then linearized with EcoRI and treated with shrimp alkaline phosphatase (Affymetrix, 78390) to dephosphorylate the DNA ends and prevent religation of the vector. .. The plasmid was then linearized with EcoRI and treated with shrimp alkaline phosphatase (Affymetrix, 78390) to dephosphorylate the DNA ends and prevent religation of the vector.

    Agarose Gel Electrophoresis:

    Article Title: Polymorphisms of Estrogen Metabolism-Related Genes and Prostate Cancer Risk in Two Populations of African Ancestry
    Article Snippet: Briefly, PCR was performed as follows: initial denaturation for 5 min at 95°C, followed by 35 cycles of 95°C for 1 min, 62°C for 45 seconds and 72°C for 45 seconds. .. PCR products were subjected to electrophoresis in a 2% agarose gel, and purified with exonuclease I and shrimp alkaline phosphatase (USB Corporation, High Wycombe, UK) treatment to remove unincorporated deoxynucleotides and primers from the amplified DNA. .. For primer extension with target complementary fluorescent dideoxyribonucleotides (ddNTPs), SNaPshot reactions were performed using the SNaPshot® Multiplex Kit (Applied Biosystems, Warrington, UK).

    Article Title: Reinvestigating the status of malaria parasite (Plasmodium sp.) in Indian non-human primates
    Article Snippet: Approximately 4μl of PCR product of each amplified DNA fragment for both the genes (18s rRNA andMSP-1 42 gene) was electrophoresed on a 2% agarose gel, utilizing a 100-bp ladder (BangloreGenei) to confirm amplicon size. .. Successfully amplified products were purified by incubation with Exonuclease-I and Shrimp Alkaline Phosphatase (Fermentas, Life Sciences) in a thermal cycler at 37°C for 120 min, followed by enzyme inactivation at 85°C for 15 min and subjected to sequencing from both the ends and identified using BLAST search.

    Article Title: Mutation analysis of the COL1A1 and COL1A2 genes in Vietnamese patients with osteogenesis imperfecta
    Article Snippet: The PCR touchdown program was used as follows for the reaction of amplification: 1 = 95.0°; 15:00 min 2 = 95.0°; 0:25 min 3 = 64.0°; 0:30 min 4 = 72.0°; 0:40 min 5 = go to 2.4 times 6 = 95.0°; 0:25 min 7 = 62.0°; 0:30 min 8 = 72.0°; 0:40 min 9 = go to 6.30 times 10 = 72.0°; 5:00 min 11 = 6.0°; forever Amplified PCR products were electrophoresed through a 1.5 % agarose gel, to control the quality of fragments. .. The PCR products then purified with exonuclease I and shrimp alkaline phosphatase (Thermo Fisher Scientific, USA).

    In Vitro:

    Article Title: Extensive transcriptional heterogeneity revealed by isoform profiling
    Article Snippet: As an internal control, we added capped and polyadenylated in vitro transcripts (ATCC 87482, 87483 and 87484). .. The 5′ end of the non-capped RNA molecules was desphosphorylated by treatment with 6 units of Shrimp Alkaline Phosphatase (SAP, Fermentas) for 30 min at 37°C in the presence of RNase inhibitor (RNasin +, Promega).

    ALP Assay:

    Article Title: Ontogeny of alkaline phosphatase activity in infant intestines and breast milk
    Article Snippet: Negative controls were sample wells with 4MUP and Tris alone and milk samples heated at 100 °C for 5 min to inactivate endogenous ALPs. .. To calculate ALP content, all ALP activity measurements were compared to a standard curve using shrimp alkaline phosphatase (Thermo Fisher Scientific Inc.). .. Sample data from one individual was removed from the data set as the first weeks measurement was three standard deviations away from the mean.

    Ethanol Precipitation:

    Article Title: Lagging strand replication shapes the mutational landscape of the genome
    Article Snippet: Shrimp Alkaline Phosphatase (Affymetrix; 5 U) was then used to remove 5′ phosphates at 37°C (1 h per μg of library). .. Shrimp Alkaline Phosphatase (Affymetrix; 5 U) was then used to remove 5′ phosphates at 37°C (1 h per μg of library).

    Genotyping Assay:

    Article Title: Identification of Genetic Risk Factors for Neonatal Hyperbilirubinemia in Fujian Province, Southeastern China: A Case-Control Study
    Article Snippet: The loci of rs4148323 (c.G211A, p.Gly71Arg), rs2306283 (Asn130Asp/N130D, A388G/388A > G), and rs4149056 (c.521T > C, Val174Ala, or V174A) were genotyped using the Sequenom® MassARRAY® and iPLEX™ Gold genotyping assay (Sequenom Laboratories; San Diego, CA, USA). .. The PCR products were treated with shrimp alkaline phosphatase (SAP; Thermo Fisher Scientific, Inc.; Waltham, MA, USA) to remove the free dNTPs.

    Marker:

    Article Title: Reinvestigating the status of malaria parasite (Plasmodium sp.) in Indian non-human primates
    Article Snippet: Paragraph title: Nuclear marker data from parasite ... Successfully amplified products were purified by incubation with Exonuclease-I and Shrimp Alkaline Phosphatase (Fermentas, Life Sciences) in a thermal cycler at 37°C for 120 min, followed by enzyme inactivation at 85°C for 15 min and subjected to sequencing from both the ends and identified using BLAST search.

    Variant Assay:

    Article Title: Exome sequencing of serous endometrial tumors identifies recurrent somatic mutations in chromatin-remodeling and ubiquitin ligase complex genes
    Article Snippet: PCR amplicons were purified using exonuclease I (Epicentre Biotechnologies) and shrimp alkaline phosphatase (USB Corporation) and bidirectionally sequenced using the Big Dye Terminator v.3.1 kit (Applied Biosystems) and M13 primers. .. Cycle sequencing products were run on an ABI-3730xl DNA analyzer (Applied Biosystems).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher shrimp alkaline phosphatase sap
    Effect of <t>14-3-3γ</t> on TH phosphorylation and dephosphorylation. A , binding of TH phosphorylated on Ser19 by PRAK to immobilized 14-3-3γ. TH was phosphorylated to a stoichiometry of 0.17 (red) or 1.0 (blue) before preparation for injections at subunit concentrations of 5, 25, and 50 nM. Sensorgrams were scaled for illustration of kinetics. B , TH was [ 32 P]-labeled on Ser19 to different stoichiometries using PRAK before incubation with the PRAK inhibitor epigallocatechin gallate and 14-3-3γ (7.5 μM, TH-pS19:14-3-3 mixing ratio of 1:1.5). The complex was then diluted 1/10 in buffer containing high levels of shrimp alkaline phosphatase <t>(SAP)</t> (145 U/ml), and the temporal decay of 32 P-Ser19 was monitored as described under “Experimental Procedures.” Controls without 14-3-3 and without SAP were also measured (dotted lines). Exponential decay functions were fitted to each curve, and the corresponding rate constants were 0.089, 0.125, and 0.157 min −1 for TH-pS19 phosphorylated to 51% (○), 33% (▵), and 18.5% (□), respectively. Insignificant change in phosphorylation stoichiometry was observed in the absence of SAP (horizontal dotted lines), and a high rate of dephosphorylation was measured in the absence of 14-3-3γ (lower dotted lines). C , the phosphorylation of TH-pS19 (2.5 μM, pre-phosphorylated on Ser19 by PRAK) by PKA in the absence (○) or presence (●) of 14-3-3γ (10 μM).
    Shrimp Alkaline Phosphatase Sap, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 24 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/shrimp alkaline phosphatase sap/product/Thermo Fisher
    Average 99 stars, based on 24 article reviews
    Price from $9.99 to $1999.99
    shrimp alkaline phosphatase sap - by Bioz Stars, 2019-12
    99/100 stars
      Buy from Supplier

    86
    Thermo Fisher enzymatic mixture exo sap
    Effect of <t>14-3-3γ</t> on TH phosphorylation and dephosphorylation. A , binding of TH phosphorylated on Ser19 by PRAK to immobilized 14-3-3γ. TH was phosphorylated to a stoichiometry of 0.17 (red) or 1.0 (blue) before preparation for injections at subunit concentrations of 5, 25, and 50 nM. Sensorgrams were scaled for illustration of kinetics. B , TH was [ 32 P]-labeled on Ser19 to different stoichiometries using PRAK before incubation with the PRAK inhibitor epigallocatechin gallate and 14-3-3γ (7.5 μM, TH-pS19:14-3-3 mixing ratio of 1:1.5). The complex was then diluted 1/10 in buffer containing high levels of shrimp alkaline phosphatase <t>(SAP)</t> (145 U/ml), and the temporal decay of 32 P-Ser19 was monitored as described under “Experimental Procedures.” Controls without 14-3-3 and without SAP were also measured (dotted lines). Exponential decay functions were fitted to each curve, and the corresponding rate constants were 0.089, 0.125, and 0.157 min −1 for TH-pS19 phosphorylated to 51% (○), 33% (▵), and 18.5% (□), respectively. Insignificant change in phosphorylation stoichiometry was observed in the absence of SAP (horizontal dotted lines), and a high rate of dephosphorylation was measured in the absence of 14-3-3γ (lower dotted lines). C , the phosphorylation of TH-pS19 (2.5 μM, pre-phosphorylated on Ser19 by PRAK) by PKA in the absence (○) or presence (●) of 14-3-3γ (10 μM).
    Enzymatic Mixture Exo Sap, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/enzymatic mixture exo sap/product/Thermo Fisher
    Average 86 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    enzymatic mixture exo sap - by Bioz Stars, 2019-12
    86/100 stars
      Buy from Supplier

    Image Search Results


    Effect of 14-3-3γ on TH phosphorylation and dephosphorylation. A , binding of TH phosphorylated on Ser19 by PRAK to immobilized 14-3-3γ. TH was phosphorylated to a stoichiometry of 0.17 (red) or 1.0 (blue) before preparation for injections at subunit concentrations of 5, 25, and 50 nM. Sensorgrams were scaled for illustration of kinetics. B , TH was [ 32 P]-labeled on Ser19 to different stoichiometries using PRAK before incubation with the PRAK inhibitor epigallocatechin gallate and 14-3-3γ (7.5 μM, TH-pS19:14-3-3 mixing ratio of 1:1.5). The complex was then diluted 1/10 in buffer containing high levels of shrimp alkaline phosphatase (SAP) (145 U/ml), and the temporal decay of 32 P-Ser19 was monitored as described under “Experimental Procedures.” Controls without 14-3-3 and without SAP were also measured (dotted lines). Exponential decay functions were fitted to each curve, and the corresponding rate constants were 0.089, 0.125, and 0.157 min −1 for TH-pS19 phosphorylated to 51% (○), 33% (▵), and 18.5% (□), respectively. Insignificant change in phosphorylation stoichiometry was observed in the absence of SAP (horizontal dotted lines), and a high rate of dephosphorylation was measured in the absence of 14-3-3γ (lower dotted lines). C , the phosphorylation of TH-pS19 (2.5 μM, pre-phosphorylated on Ser19 by PRAK) by PKA in the absence (○) or presence (●) of 14-3-3γ (10 μM).

    Journal: Molecular & Cellular Proteomics : MCP

    Article Title:

    doi: 10.1074/mcp.M113.035709

    Figure Lengend Snippet: Effect of 14-3-3γ on TH phosphorylation and dephosphorylation. A , binding of TH phosphorylated on Ser19 by PRAK to immobilized 14-3-3γ. TH was phosphorylated to a stoichiometry of 0.17 (red) or 1.0 (blue) before preparation for injections at subunit concentrations of 5, 25, and 50 nM. Sensorgrams were scaled for illustration of kinetics. B , TH was [ 32 P]-labeled on Ser19 to different stoichiometries using PRAK before incubation with the PRAK inhibitor epigallocatechin gallate and 14-3-3γ (7.5 μM, TH-pS19:14-3-3 mixing ratio of 1:1.5). The complex was then diluted 1/10 in buffer containing high levels of shrimp alkaline phosphatase (SAP) (145 U/ml), and the temporal decay of 32 P-Ser19 was monitored as described under “Experimental Procedures.” Controls without 14-3-3 and without SAP were also measured (dotted lines). Exponential decay functions were fitted to each curve, and the corresponding rate constants were 0.089, 0.125, and 0.157 min −1 for TH-pS19 phosphorylated to 51% (○), 33% (▵), and 18.5% (□), respectively. Insignificant change in phosphorylation stoichiometry was observed in the absence of SAP (horizontal dotted lines), and a high rate of dephosphorylation was measured in the absence of 14-3-3γ (lower dotted lines). C , the phosphorylation of TH-pS19 (2.5 μM, pre-phosphorylated on Ser19 by PRAK) by PKA in the absence (○) or presence (●) of 14-3-3γ (10 μM).

    Article Snippet: TH (5 μM) was then preincubated for 10 min on ice with or without 14-3-3γ (7.5 μM) prior to 5-fold dilution in dephosphorylation assay using shrimp alkaline phosphatase (SAP) (0.14 U/μl, Thermo Fisher Scientific), 25 mM Hepes, pH 7.2, 130 mM KCl, 2 mM MgCl2 , 1 mM DTT, at 15 °C or 25 °C.

    Techniques: De-Phosphorylation Assay, Binding Assay, Labeling, Incubation