Structured Review

TaKaRa shrimp alkaline phosphatase
Shrimp Alkaline Phosphatase, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 23 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/shrimp alkaline phosphatase/product/TaKaRa
Average 95 stars, based on 23 article reviews
Price from $9.99 to $1999.99
shrimp alkaline phosphatase - by Bioz Stars, 2020-01
95/100 stars

Images

Related Articles

Clone Assay:

Article Title: RFamidergic neurons in the olfactory centers of the terrestrial slug Limax
Article Snippet: .. The amplicons were ligated into a cloning vector pBluescriptII (KS) that had been digested with EcoRV followed by dephosphorylation by shrimp alkaline phosphatase (Takara). .. Competent E. coli. (Dh5α) was transformed with the ligated product, and the plasmids were obtained from the transformed E. coli .

Article Title: Satellite RNAs promote pancreatic oncogenic processes via the dysfunction of YBX1
Article Snippet: mtDNA mutation To examine the mutation rate in the mitochondrial DNA, a 431 bp fragment of the D-loop region was cloned using the InFusion HD cloning kit (Clontech) as follows. .. The pcDNA 3.1(−) vector was digested at the BamHI site and dephosphorylated with Shrimp Alkaline Phosphatase (TaKaRa) at 37 °C for 15 min. Amplified fragments and linearized vector were incubated with 5 × InFusion HD Enzyme premix at 50 °C for 15 min and subsequently transformed into ECOS Competent E. coli DH5α.

Centrifugation:

Article Title: Triazole linking for preparation of a next-generation sequencing library from single-stranded DNA
Article Snippet: The spheroplasts were collected by centrifugation at 2000 × g for 5 min and resuspended in 1 ml of MNase digestion buffer (50 mM Tris–HCl, pH 7.6; 1 mM CaCl2 ; 0.2% (v/v) Triton X-100) containing 1 × protease inhibitor (Nacalai Tesque). .. Any contaminating RNA was digested with 250 units of RNase If (New England BioLabs) and the 3′-phosphate of the MNase-treated DNA was removed with 5 units of shrimp alkaline phosphatase (Takara Bio Inc.).

Amplification:

Article Title: The association between apolipoprotein A1-C3-A5 gene cluster promoter polymorphisms and risk of ischemic stroke in the northern Chinese Han population
Article Snippet: The SNaPshot reaction procedures were as follows: initial denaturation at 96℃ for 1 min, then 28 cycles of denaturation at 96℃ for 10 s, annealing at 55℃ for 5 s, and extension at 60℃ for 30 s. Amplified samples were stored at 4℃. .. Extension products were purified over a 1-h incubation period with 1 U of shrimp alkaline phosphatase (Takara, Otsu, Shiga, Japan) at 37℃, followed by incubation at 75℃ for 15 min to inactivate the enzyme.

Article Title: An ADAM10 promoter polymorphism is a functional variant in severe sepsis patients and confers susceptibility to the development of sepsis
Article Snippet: The PCR reaction protocol was as follows: after denaturation at 95°C for 2 minutes, 11 cycles of DNA amplification were performed using Taq PCR for 20 s at 94°C (denaturation), 40 s at 65°C (annealing), and 90 s at 72°C (extension), followed by 24 cycles of DNA amplification for 20 s at 94°C (denaturation), 30 s at 59°C (annealing), and 90 s at 72°C (extension). .. The extension products were purified for 1 h at 37°C via incubation in 1 U of shrimp alkaline phosphatase (Takara, Otsu, Shiga, Japan), followed by incubation for 15 minutes at 75°C to inactivate this enzyme.

Article Title: Association study of MCP-1 promoter polymorphisms with the susceptibility and progression of sepsis
Article Snippet: Two MCP-1 polymorphisms rs1024611 (-2518 A > G) and rs2857656 (-362 G > C) were genotyped using the SNaPshot MultiplexKit (Applied Biosystems Co., Ltd., Foster City, CA, USA), and the primers used for amplification of PCR and extension of SNaPshot were designed with GenBank database and were as follows: rs1024611F, 5' CTCTCACGCCAGCACTGACCTC 3' ; rs1024611R, 5' CCAATTAGCCCATGGTCACAGA 3' ; rs2857656F, 5' TAAGCTGGCAGCGAGCCTGAC 3' ; rs2857656R, 5' GCCATTAAGCCCAGACTGACCA 3' . .. The products were purified by 1-h incubation with 1U of shrimp alkaline phosphatase (Takara: Otsu, shiga, Japan) at 37°C and 75°C for 15 minutes.

Article Title: Satellite RNAs promote pancreatic oncogenic processes via the dysfunction of YBX1
Article Snippet: .. The pcDNA 3.1(−) vector was digested at the BamHI site and dephosphorylated with Shrimp Alkaline Phosphatase (TaKaRa) at 37 °C for 15 min. Amplified fragments and linearized vector were incubated with 5 × InFusion HD Enzyme premix at 50 °C for 15 min and subsequently transformed into ECOS Competent E. coli DH5α. .. After 16 h, at least twenty colonies from each sample were picked up, and cloned vectors were collected using the QIAprep 96 Turbo Miniprep Kit (Qiagen).

Article Title: A heavy metal P-type ATPase OsHMA4 prevents copper accumulation in rice grain
Article Snippet: The coding region of OsHMA4 linked with the nopaline synthase (NOS) terminator was amplified using the plasmid GFP-OsHMA4 (described below) as the template. .. The fragment was digested with Bam HI and Bgl II and then subcloned into the binary vector pTF101.1 (ref. ), which was digested with Bam HI and dephosphorylated with Shrimp Alkaline Phosphatase (Takara).

Article Title: A novel somatic mutation of SIN3A detected in breast cancer by whole-exome sequencing enhances cell proliferation through ERα expression
Article Snippet: Genome DNAs extracted from breast cancer tissues were amplified by PCR using primers 5′-TGCGTCCACAGTACCAACC-3′ and 5′-ATTTGTTCCCAAGCCGAACG-3′ for the region from 75684340 to 75684709 on chromosome 15 including the SIN3A mutation. .. The PCR products were incubated at 37 °C for 20 min in a mixture of 5 U of exonuclease I (NewEngland Biolabs) and shrimp alkaline phosphatase (TaKaRa Bio.

Mass Spectrometry:

Article Title: Single Nucleotide Polymorphism (rs4932178) in the P1 Promoter of FURIN Is Not Prognostic to Colon Cancer
Article Snippet: Thermocycling was performed at 95°C for 15 min, followed by 45 cycles of 94°C for 20 s, 56°C for 30 s, and 72°C for 60 s, followed by a final extension of 72°C for 3 min. Unincorporated dNTPs were deactivated using 0.3 units of shrimp alkaline phosphatase (Clontech Laboratories, Inc., Mountain View, USA) at 37° for 40 min and primer extension was carried out using 7–14 μ M of each primer extension probe (depending on the mass), 1 unit of iPLEX termination mix, and 1 unit of iPLEX enzyme. .. After analyzing the SpectroCHIPs using a MALDI-TOF mass spectrometer, spectra were processed by the SpectroREADER software (Sequenom Inc.) and transferred to the MassARRAY Typer 4 Analyzer (Sequenom Inc.) for further analysis.

Electrophoresis:

Article Title: The association between apolipoprotein A1-C3-A5 gene cluster promoter polymorphisms and risk of ischemic stroke in the northern Chinese Han population
Article Snippet: Extension products were purified over a 1-h incubation period with 1 U of shrimp alkaline phosphatase (Takara, Otsu, Shiga, Japan) at 37℃, followed by incubation at 75℃ for 15 min to inactivate the enzyme. .. Samples were incubated at 95℃ for 5 min and then loaded onto an ABI 3130XL DNA sequence detector for capillary electrophoresis.

Article Title: Association of Apolipoprotein C3 Genetic Polymorphisms with the Risk of Ischemic Stroke in the Northern Chinese Han Population
Article Snippet: The extension products were purified through a 1-h incubation with 1 U of shrimp alkaline phosphatase (Takara: Otsu, Shiga, Japan) at 37°C, followed by incubation at 75°C for 15 min to inactivate the enzyme. .. The samples were incubated at 95°C for 5 min and then loaded onto an ABI 3130XL DNA sequence detector for capillary electrophoresis.

Incubation:

Article Title: The association between apolipoprotein A1-C3-A5 gene cluster promoter polymorphisms and risk of ischemic stroke in the northern Chinese Han population
Article Snippet: .. Extension products were purified over a 1-h incubation period with 1 U of shrimp alkaline phosphatase (Takara, Otsu, Shiga, Japan) at 37℃, followed by incubation at 75℃ for 15 min to inactivate the enzyme. .. Purified products (0.5 µL) were mixed with 9 µL of Hi–Di and 0.5 µL of the Liz120 size standard (Applied Biosystems Co., Ltd.).

Article Title: Rs2015 Polymorphism in miRNA Target Site of Sirtuin2 Gene Is Associated with the Risk of Parkinson's Disease in Chinese Han Population
Article Snippet: .. Then, the extension products were purified via incubation with 1 U of shrimp alkaline phosphatase (Takara, Japan) for 15 minutes at 37°C and subsequent incubation at 80°C for 15 minutes to inactivate the enzyme. .. Additionally, the purified products (0.5 μ l) were mixed with 9 μ l of Hi-Di formamide and 0.5 μ l of the Lizl20 Size Standard (Applied Biosystems, USA) and separated in the ABI Prism 3730XL Genetic Analyzer (Applied Biosystems, USA).

Article Title: An ADAM10 promoter polymorphism is a functional variant in severe sepsis patients and confers susceptibility to the development of sepsis
Article Snippet: .. The extension products were purified for 1 h at 37°C via incubation in 1 U of shrimp alkaline phosphatase (Takara, Otsu, Shiga, Japan), followed by incubation for 15 minutes at 75°C to inactivate this enzyme. .. Additionally, 0.5 μL of the purified products was mixed with 9 μL of Hi-Di formamide and 0.5 μL of Liz120 Size Standard.

Article Title: Association of Apolipoprotein C3 Genetic Polymorphisms with the Risk of Ischemic Stroke in the Northern Chinese Han Population
Article Snippet: .. The extension products were purified through a 1-h incubation with 1 U of shrimp alkaline phosphatase (Takara: Otsu, Shiga, Japan) at 37°C, followed by incubation at 75°C for 15 min to inactivate the enzyme. .. The purified products (0.5 μL) were mixed with 9 μL of Hi—Di and 0.5 μL of the Liz120 size standard (Applied Biosystems Co., Ltd.).

Article Title: Metagenomic Sequencing From Mosquitoes in China Reveals a Variety of Insect and Human Viruses
Article Snippet: .. Subsequently, the samples were incubated at 37°C for 60 min, followed by 75°C for 10 min. To eliminate phosphates and free single-strand nucleic acid in the dscDNA reaction, 0.5 μL of Exonuclease I, 1 μL of shrimp alkaline phosphatase (SAP, Takara, Dalian, China), 5 μL of 10 × phosphatase buffer, and 24 μL of DEPC H2 O were added and incubated at 37°C for 60 min followed by 75°C for 10 min. .. Sequence-independent single primer amplification (SISPA) and purification of PCR products To obtain large quantity of the viral nucleic acids, the dscDNA was amplified using SISPA.

Article Title: Triazole linking for preparation of a next-generation sequencing library from single-stranded DNA
Article Snippet: The reaction mixture was then supplemented with 100 μl of 10% (w/v) SDS and 25 μl of 20 mg/ml Protease K (Qiagen), and incubated at 50°C for 1 h. Following phenol and phenol/chloroform extraction, nucleic acids were collected by isopropanol precipitation. .. Any contaminating RNA was digested with 250 units of RNase If (New England BioLabs) and the 3′-phosphate of the MNase-treated DNA was removed with 5 units of shrimp alkaline phosphatase (Takara Bio Inc.).

Article Title: Association study of MCP-1 promoter polymorphisms with the susceptibility and progression of sepsis
Article Snippet: .. The products were purified by 1-h incubation with 1U of shrimp alkaline phosphatase (Takara: Otsu, shiga, Japan) at 37°C and 75°C for 15 minutes. .. Then the purified products (0.5μL) were mixed with Lizl20 Size Standard (0.5μL) and HiDi formamide (9μL) and were incubated at 95°C for 5 minutes, and were analyzed using ABIPrism 3730XL genetic sequence analyzer (Applied Biosystems, Foster City, CA, USA) and GeneMapper 4.1 (Applied Biosystems, Carlsbad, CA, USA).

Article Title: Satellite RNAs promote pancreatic oncogenic processes via the dysfunction of YBX1
Article Snippet: .. The pcDNA 3.1(−) vector was digested at the BamHI site and dephosphorylated with Shrimp Alkaline Phosphatase (TaKaRa) at 37 °C for 15 min. Amplified fragments and linearized vector were incubated with 5 × InFusion HD Enzyme premix at 50 °C for 15 min and subsequently transformed into ECOS Competent E. coli DH5α. .. After 16 h, at least twenty colonies from each sample were picked up, and cloned vectors were collected using the QIAprep 96 Turbo Miniprep Kit (Qiagen).

Article Title: A novel somatic mutation of SIN3A detected in breast cancer by whole-exome sequencing enhances cell proliferation through ERα expression
Article Snippet: .. The PCR products were incubated at 37 °C for 20 min in a mixture of 5 U of exonuclease I (NewEngland Biolabs) and shrimp alkaline phosphatase (TaKaRa Bio. .. Inc.), and were purified using a BigDye® Xterminator™ purification kit (T hermo Fisher Scientific).

Expressing:

Article Title: RFamidergic neurons in the olfactory centers of the terrestrial slug Limax
Article Snippet: Paragraph title: Molecular cloning and expression analysis of RFamide cDNAs ... The amplicons were ligated into a cloning vector pBluescriptII (KS) that had been digested with EcoRV followed by dephosphorylation by shrimp alkaline phosphatase (Takara).

Transformation Assay:

Article Title: RFamidergic neurons in the olfactory centers of the terrestrial slug Limax
Article Snippet: The amplicons were ligated into a cloning vector pBluescriptII (KS) that had been digested with EcoRV followed by dephosphorylation by shrimp alkaline phosphatase (Takara). .. Competent E. coli. (Dh5α) was transformed with the ligated product, and the plasmids were obtained from the transformed E. coli .

Article Title: Satellite RNAs promote pancreatic oncogenic processes via the dysfunction of YBX1
Article Snippet: .. The pcDNA 3.1(−) vector was digested at the BamHI site and dephosphorylated with Shrimp Alkaline Phosphatase (TaKaRa) at 37 °C for 15 min. Amplified fragments and linearized vector were incubated with 5 × InFusion HD Enzyme premix at 50 °C for 15 min and subsequently transformed into ECOS Competent E. coli DH5α. .. After 16 h, at least twenty colonies from each sample were picked up, and cloned vectors were collected using the QIAprep 96 Turbo Miniprep Kit (Qiagen).

Article Title: A heavy metal P-type ATPase OsHMA4 prevents copper accumulation in rice grain
Article Snippet: Transgenic complementation test For transgenic complementation experiment, oshma4 was transformed with OsHMA4 under the control of its own promoter. .. The fragment was digested with Bam HI and Bgl II and then subcloned into the binary vector pTF101.1 (ref. ), which was digested with Bam HI and dephosphorylated with Shrimp Alkaline Phosphatase (Takara).

Derivative Assay:

Article Title: RFamidergic neurons in the olfactory centers of the terrestrial slug Limax
Article Snippet: Molecular cloning and expression analysis of RFamide cDNAs Partial cDNAs of the RFamide genes were cloned by reverse transcription-PCR (RT-PCR) using RNAs derived from the CNS of Limax , as described previously [ ], except that RNAs were reverse-transcribed using oligo-dT primers. .. The amplicons were ligated into a cloning vector pBluescriptII (KS) that had been digested with EcoRV followed by dephosphorylation by shrimp alkaline phosphatase (Takara).

Protease Inhibitor:

Article Title: Triazole linking for preparation of a next-generation sequencing library from single-stranded DNA
Article Snippet: The spheroplasts were collected by centrifugation at 2000 × g for 5 min and resuspended in 1 ml of MNase digestion buffer (50 mM Tris–HCl, pH 7.6; 1 mM CaCl2 ; 0.2% (v/v) Triton X-100) containing 1 × protease inhibitor (Nacalai Tesque). .. Any contaminating RNA was digested with 250 units of RNase If (New England BioLabs) and the 3′-phosphate of the MNase-treated DNA was removed with 5 units of shrimp alkaline phosphatase (Takara Bio Inc.).

Reverse Transcription Polymerase Chain Reaction:

Article Title: RFamidergic neurons in the olfactory centers of the terrestrial slug Limax
Article Snippet: Molecular cloning and expression analysis of RFamide cDNAs Partial cDNAs of the RFamide genes were cloned by reverse transcription-PCR (RT-PCR) using RNAs derived from the CNS of Limax , as described previously [ ], except that RNAs were reverse-transcribed using oligo-dT primers. .. The amplicons were ligated into a cloning vector pBluescriptII (KS) that had been digested with EcoRV followed by dephosphorylation by shrimp alkaline phosphatase (Takara).

DNA Sequencing:

Article Title: RFamidergic neurons in the olfactory centers of the terrestrial slug Limax
Article Snippet: The amplicons were ligated into a cloning vector pBluescriptII (KS) that had been digested with EcoRV followed by dephosphorylation by shrimp alkaline phosphatase (Takara). .. The direction and the nucleotide sequence of the insert cDNAs were determined by DNA sequencing.

Article Title: Triazole linking for preparation of a next-generation sequencing library from single-stranded DNA
Article Snippet: Any contaminating RNA was digested with 250 units of RNase If (New England BioLabs) and the 3′-phosphate of the MNase-treated DNA was removed with 5 units of shrimp alkaline phosphatase (Takara Bio Inc.). .. A conventional dsDNA library was prepared using a ThruPlex DNA-seq 6S Kit from Rubicon Genomics according to the manufacturer's instructions.

Sequencing:

Article Title: The association between apolipoprotein A1-C3-A5 gene cluster promoter polymorphisms and risk of ischemic stroke in the northern Chinese Han population
Article Snippet: Extension products were purified over a 1-h incubation period with 1 U of shrimp alkaline phosphatase (Takara, Otsu, Shiga, Japan) at 37℃, followed by incubation at 75℃ for 15 min to inactivate the enzyme. .. Samples were incubated at 95℃ for 5 min and then loaded onto an ABI 3130XL DNA sequence detector for capillary electrophoresis.

Article Title: RFamidergic neurons in the olfactory centers of the terrestrial slug Limax
Article Snippet: The amplicons were ligated into a cloning vector pBluescriptII (KS) that had been digested with EcoRV followed by dephosphorylation by shrimp alkaline phosphatase (Takara). .. The direction and the nucleotide sequence of the insert cDNAs were determined by DNA sequencing.

Article Title: An ADAM10 promoter polymorphism is a functional variant in severe sepsis patients and confers susceptibility to the development of sepsis
Article Snippet: The extension products were purified for 1 h at 37°C via incubation in 1 U of shrimp alkaline phosphatase (Takara, Otsu, Shiga, Japan), followed by incubation for 15 minutes at 75°C to inactivate this enzyme. .. Next, the samples were incubated for 5 minutes at 95°C and then inserted into the ABI Prism 3130XL genetic sequence analyzer.

Article Title: Association of Apolipoprotein C3 Genetic Polymorphisms with the Risk of Ischemic Stroke in the Northern Chinese Han Population
Article Snippet: The extension products were purified through a 1-h incubation with 1 U of shrimp alkaline phosphatase (Takara: Otsu, Shiga, Japan) at 37°C, followed by incubation at 75°C for 15 min to inactivate the enzyme. .. The samples were incubated at 95°C for 5 min and then loaded onto an ABI 3130XL DNA sequence detector for capillary electrophoresis.

Article Title: Association study of MCP-1 promoter polymorphisms with the susceptibility and progression of sepsis
Article Snippet: The products were purified by 1-h incubation with 1U of shrimp alkaline phosphatase (Takara: Otsu, shiga, Japan) at 37°C and 75°C for 15 minutes. .. Then the purified products (0.5μL) were mixed with Lizl20 Size Standard (0.5μL) and HiDi formamide (9μL) and were incubated at 95°C for 5 minutes, and were analyzed using ABIPrism 3730XL genetic sequence analyzer (Applied Biosystems, Foster City, CA, USA) and GeneMapper 4.1 (Applied Biosystems, Carlsbad, CA, USA).

Article Title: Satellite RNAs promote pancreatic oncogenic processes via the dysfunction of YBX1
Article Snippet: The pcDNA 3.1(−) vector was digested at the BamHI site and dephosphorylated with Shrimp Alkaline Phosphatase (TaKaRa) at 37 °C for 15 min. Amplified fragments and linearized vector were incubated with 5 × InFusion HD Enzyme premix at 50 °C for 15 min and subsequently transformed into ECOS Competent E. coli DH5α. .. The inserted D-loop sequences of the cloned libraries were determined using a T7 sequence primer (5′-TAA TAC GAC TCA CTA TAG GG-3′).

Article Title: A novel somatic mutation of SIN3A detected in breast cancer by whole-exome sequencing enhances cell proliferation through ERα expression
Article Snippet: Paragraph title: Confirmation of a somatic mutation in SIN3A by Sanger sequencing ... The PCR products were incubated at 37 °C for 20 min in a mixture of 5 U of exonuclease I (NewEngland Biolabs) and shrimp alkaline phosphatase (TaKaRa Bio.

DNA Extraction:

Article Title: The association between apolipoprotein A1-C3-A5 gene cluster promoter polymorphisms and risk of ischemic stroke in the northern Chinese Han population
Article Snippet: Paragraph title: DNA extraction and genotyping ... Extension products were purified over a 1-h incubation period with 1 U of shrimp alkaline phosphatase (Takara, Otsu, Shiga, Japan) at 37℃, followed by incubation at 75℃ for 15 min to inactivate the enzyme.

Article Title: Rs2015 Polymorphism in miRNA Target Site of Sirtuin2 Gene Is Associated with the Risk of Parkinson's Disease in Chinese Han Population
Article Snippet: Genomic DNA was extracted from 2 ml peripheral blood samples collected from each participant using a Blood Genomic DNA Extraction Kit (Tiangen, China). .. Then, the extension products were purified via incubation with 1 U of shrimp alkaline phosphatase (Takara, Japan) for 15 minutes at 37°C and subsequent incubation at 80°C for 15 minutes to inactivate the enzyme.

Article Title: An ADAM10 promoter polymorphism is a functional variant in severe sepsis patients and confers susceptibility to the development of sepsis
Article Snippet: Paragraph title: DNA isolation and genotyping ... The extension products were purified for 1 h at 37°C via incubation in 1 U of shrimp alkaline phosphatase (Takara, Otsu, Shiga, Japan), followed by incubation for 15 minutes at 75°C to inactivate this enzyme.

Article Title: Association of Apolipoprotein C3 Genetic Polymorphisms with the Risk of Ischemic Stroke in the Northern Chinese Han Population
Article Snippet: Paragraph title: DNA Extraction and Genotyping ... The extension products were purified through a 1-h incubation with 1 U of shrimp alkaline phosphatase (Takara: Otsu, Shiga, Japan) at 37°C, followed by incubation at 75°C for 15 min to inactivate the enzyme.

Article Title: Association study of MCP-1 promoter polymorphisms with the susceptibility and progression of sepsis
Article Snippet: Paragraph title: DNA extraction and genotyping ... The products were purified by 1-h incubation with 1U of shrimp alkaline phosphatase (Takara: Otsu, shiga, Japan) at 37°C and 75°C for 15 minutes.

Molecular Cloning:

Article Title: RFamidergic neurons in the olfactory centers of the terrestrial slug Limax
Article Snippet: Paragraph title: Molecular cloning and expression analysis of RFamide cDNAs ... The amplicons were ligated into a cloning vector pBluescriptII (KS) that had been digested with EcoRV followed by dephosphorylation by shrimp alkaline phosphatase (Takara).

Mutagenesis:

Article Title: Satellite RNAs promote pancreatic oncogenic processes via the dysfunction of YBX1
Article Snippet: Paragraph title: mtDNA mutation ... The pcDNA 3.1(−) vector was digested at the BamHI site and dephosphorylated with Shrimp Alkaline Phosphatase (TaKaRa) at 37 °C for 15 min. Amplified fragments and linearized vector were incubated with 5 × InFusion HD Enzyme premix at 50 °C for 15 min and subsequently transformed into ECOS Competent E. coli DH5α.

Article Title: A novel somatic mutation of SIN3A detected in breast cancer by whole-exome sequencing enhances cell proliferation through ERα expression
Article Snippet: Paragraph title: Confirmation of a somatic mutation in SIN3A by Sanger sequencing ... The PCR products were incubated at 37 °C for 20 min in a mixture of 5 U of exonuclease I (NewEngland Biolabs) and shrimp alkaline phosphatase (TaKaRa Bio.

Isolation:

Article Title: Satellite RNAs promote pancreatic oncogenic processes via the dysfunction of YBX1
Article Snippet: Total DNA templates including mtDNA were isolated from K512-vector and K512-EF1α-MajSAT cells using the QIAamp DNA Mini Kit (Qiagen), and PCR was performed with LA-Taq polymerase (TaKaRa) mixed with Pfu turbo DNA Polymerase (Stratagene). .. The pcDNA 3.1(−) vector was digested at the BamHI site and dephosphorylated with Shrimp Alkaline Phosphatase (TaKaRa) at 37 °C for 15 min. Amplified fragments and linearized vector were incubated with 5 × InFusion HD Enzyme premix at 50 °C for 15 min and subsequently transformed into ECOS Competent E. coli DH5α.

Purification:

Article Title: The association between apolipoprotein A1-C3-A5 gene cluster promoter polymorphisms and risk of ischemic stroke in the northern Chinese Han population
Article Snippet: .. Extension products were purified over a 1-h incubation period with 1 U of shrimp alkaline phosphatase (Takara, Otsu, Shiga, Japan) at 37℃, followed by incubation at 75℃ for 15 min to inactivate the enzyme. .. Purified products (0.5 µL) were mixed with 9 µL of Hi–Di and 0.5 µL of the Liz120 size standard (Applied Biosystems Co., Ltd.).

Article Title: RFamidergic neurons in the olfactory centers of the terrestrial slug Limax
Article Snippet: The amplicons were purified using the Wizard SV Gel and PCR clean-up system (Promega, Madison, WI, USA), and phosphorylated by T4 polynucleotide kinase (Takara, Ohtsu, Japan). .. The amplicons were ligated into a cloning vector pBluescriptII (KS) that had been digested with EcoRV followed by dephosphorylation by shrimp alkaline phosphatase (Takara).

Article Title: Rs2015 Polymorphism in miRNA Target Site of Sirtuin2 Gene Is Associated with the Risk of Parkinson's Disease in Chinese Han Population
Article Snippet: .. Then, the extension products were purified via incubation with 1 U of shrimp alkaline phosphatase (Takara, Japan) for 15 minutes at 37°C and subsequent incubation at 80°C for 15 minutes to inactivate the enzyme. .. Additionally, the purified products (0.5 μ l) were mixed with 9 μ l of Hi-Di formamide and 0.5 μ l of the Lizl20 Size Standard (Applied Biosystems, USA) and separated in the ABI Prism 3730XL Genetic Analyzer (Applied Biosystems, USA).

Article Title: An ADAM10 promoter polymorphism is a functional variant in severe sepsis patients and confers susceptibility to the development of sepsis
Article Snippet: .. The extension products were purified for 1 h at 37°C via incubation in 1 U of shrimp alkaline phosphatase (Takara, Otsu, Shiga, Japan), followed by incubation for 15 minutes at 75°C to inactivate this enzyme. .. Additionally, 0.5 μL of the purified products was mixed with 9 μL of Hi-Di formamide and 0.5 μL of Liz120 Size Standard.

Article Title: Association of Apolipoprotein C3 Genetic Polymorphisms with the Risk of Ischemic Stroke in the Northern Chinese Han Population
Article Snippet: .. The extension products were purified through a 1-h incubation with 1 U of shrimp alkaline phosphatase (Takara: Otsu, Shiga, Japan) at 37°C, followed by incubation at 75°C for 15 min to inactivate the enzyme. .. The purified products (0.5 μL) were mixed with 9 μL of Hi—Di and 0.5 μL of the Liz120 size standard (Applied Biosystems Co., Ltd.).

Article Title: Triazole linking for preparation of a next-generation sequencing library from single-stranded DNA
Article Snippet: Any contaminating RNA was digested with 250 units of RNase If (New England BioLabs) and the 3′-phosphate of the MNase-treated DNA was removed with 5 units of shrimp alkaline phosphatase (Takara Bio Inc.). .. The final DNA purification was accomplished using a QIAQuick PCR purification kit (Qiagen) according to the manufacturer's instructions.

Article Title: Association study of MCP-1 promoter polymorphisms with the susceptibility and progression of sepsis
Article Snippet: .. The products were purified by 1-h incubation with 1U of shrimp alkaline phosphatase (Takara: Otsu, shiga, Japan) at 37°C and 75°C for 15 minutes. .. Then the purified products (0.5μL) were mixed with Lizl20 Size Standard (0.5μL) and HiDi formamide (9μL) and were incubated at 95°C for 5 minutes, and were analyzed using ABIPrism 3730XL genetic sequence analyzer (Applied Biosystems, Foster City, CA, USA) and GeneMapper 4.1 (Applied Biosystems, Carlsbad, CA, USA).

Article Title: A novel somatic mutation of SIN3A detected in breast cancer by whole-exome sequencing enhances cell proliferation through ERα expression
Article Snippet: The PCR products were incubated at 37 °C for 20 min in a mixture of 5 U of exonuclease I (NewEngland Biolabs) and shrimp alkaline phosphatase (TaKaRa Bio. .. Inc.), and were purified using a BigDye® Xterminator™ purification kit (T hermo Fisher Scientific).

Polymerase Chain Reaction:

Article Title: The association between apolipoprotein A1-C3-A5 gene cluster promoter polymorphisms and risk of ischemic stroke in the northern Chinese Han population
Article Snippet: SNaPshot reactions were performed in a final volume of 10 µL, including 5 µL of the SNaPshot Multiplex Kit (ABI), 1 µL of primer mix, 2 µL of water, and 2 µL of templates, which consisted of the multiplex PCR products for the different genes. .. Extension products were purified over a 1-h incubation period with 1 U of shrimp alkaline phosphatase (Takara, Otsu, Shiga, Japan) at 37℃, followed by incubation at 75℃ for 15 min to inactivate the enzyme.

Article Title: RFamidergic neurons in the olfactory centers of the terrestrial slug Limax
Article Snippet: The amplicons were purified using the Wizard SV Gel and PCR clean-up system (Promega, Madison, WI, USA), and phosphorylated by T4 polynucleotide kinase (Takara, Ohtsu, Japan). .. The amplicons were ligated into a cloning vector pBluescriptII (KS) that had been digested with EcoRV followed by dephosphorylation by shrimp alkaline phosphatase (Takara).

Article Title: An ADAM10 promoter polymorphism is a functional variant in severe sepsis patients and confers susceptibility to the development of sepsis
Article Snippet: The PCR reaction protocol was as follows: after denaturation at 95°C for 2 minutes, 11 cycles of DNA amplification were performed using Taq PCR for 20 s at 94°C (denaturation), 40 s at 65°C (annealing), and 90 s at 72°C (extension), followed by 24 cycles of DNA amplification for 20 s at 94°C (denaturation), 30 s at 59°C (annealing), and 90 s at 72°C (extension). .. The extension products were purified for 1 h at 37°C via incubation in 1 U of shrimp alkaline phosphatase (Takara, Otsu, Shiga, Japan), followed by incubation for 15 minutes at 75°C to inactivate this enzyme.

Article Title: Association of Apolipoprotein C3 Genetic Polymorphisms with the Risk of Ischemic Stroke in the Northern Chinese Han Population
Article Snippet: The SNaPshot reactions were executed in a final volume of 10 μL, including 5 μL of the SNaPshot Multiplex Kit (ABI), 1 μL primer mix, 2 μL water, and 2 μL templates, which consisted of the multiplex PCR products for the different genes. .. The extension products were purified through a 1-h incubation with 1 U of shrimp alkaline phosphatase (Takara: Otsu, Shiga, Japan) at 37°C, followed by incubation at 75°C for 15 min to inactivate the enzyme.

Article Title: Triazole linking for preparation of a next-generation sequencing library from single-stranded DNA
Article Snippet: Any contaminating RNA was digested with 250 units of RNase If (New England BioLabs) and the 3′-phosphate of the MNase-treated DNA was removed with 5 units of shrimp alkaline phosphatase (Takara Bio Inc.). .. The final DNA purification was accomplished using a QIAQuick PCR purification kit (Qiagen) according to the manufacturer's instructions.

Article Title: Satellite RNAs promote pancreatic oncogenic processes via the dysfunction of YBX1
Article Snippet: Total DNA templates including mtDNA were isolated from K512-vector and K512-EF1α-MajSAT cells using the QIAamp DNA Mini Kit (Qiagen), and PCR was performed with LA-Taq polymerase (TaKaRa) mixed with Pfu turbo DNA Polymerase (Stratagene). .. The pcDNA 3.1(−) vector was digested at the BamHI site and dephosphorylated with Shrimp Alkaline Phosphatase (TaKaRa) at 37 °C for 15 min. Amplified fragments and linearized vector were incubated with 5 × InFusion HD Enzyme premix at 50 °C for 15 min and subsequently transformed into ECOS Competent E. coli DH5α.

Article Title: A heavy metal P-type ATPase OsHMA4 prevents copper accumulation in rice grain
Article Snippet: The fragment was digested with Bam HI and Bgl II and then subcloned into the binary vector pTF101.1 (ref. ), which was digested with Bam HI and dephosphorylated with Shrimp Alkaline Phosphatase (Takara). .. The 3,016 bp region upstream of the initiation codon of OsHMA4 was amplified by PCR from the genomic DNA.

Article Title: A novel somatic mutation of SIN3A detected in breast cancer by whole-exome sequencing enhances cell proliferation through ERα expression
Article Snippet: .. The PCR products were incubated at 37 °C for 20 min in a mixture of 5 U of exonuclease I (NewEngland Biolabs) and shrimp alkaline phosphatase (TaKaRa Bio. .. Inc.), and were purified using a BigDye® Xterminator™ purification kit (T hermo Fisher Scientific).

Article Title: Single Nucleotide Polymorphism (rs4932178) in the P1 Promoter of FURIN Is Not Prognostic to Colon Cancer
Article Snippet: SNP Analysis Multiplex PCR was performed in a 5 μ L volume containing MegaMix Gold (Cambio), 5–10 ng of genomic DNA, and 100 nM of each PCR primer. .. Thermocycling was performed at 95°C for 15 min, followed by 45 cycles of 94°C for 20 s, 56°C for 30 s, and 72°C for 60 s, followed by a final extension of 72°C for 3 min. Unincorporated dNTPs were deactivated using 0.3 units of shrimp alkaline phosphatase (Clontech Laboratories, Inc., Mountain View, USA) at 37° for 40 min and primer extension was carried out using 7–14 μ M of each primer extension probe (depending on the mass), 1 unit of iPLEX termination mix, and 1 unit of iPLEX enzyme.

De-Phosphorylation Assay:

Article Title: RFamidergic neurons in the olfactory centers of the terrestrial slug Limax
Article Snippet: .. The amplicons were ligated into a cloning vector pBluescriptII (KS) that had been digested with EcoRV followed by dephosphorylation by shrimp alkaline phosphatase (Takara). .. Competent E. coli. (Dh5α) was transformed with the ligated product, and the plasmids were obtained from the transformed E. coli .

Plasmid Preparation:

Article Title: RFamidergic neurons in the olfactory centers of the terrestrial slug Limax
Article Snippet: .. The amplicons were ligated into a cloning vector pBluescriptII (KS) that had been digested with EcoRV followed by dephosphorylation by shrimp alkaline phosphatase (Takara). .. Competent E. coli. (Dh5α) was transformed with the ligated product, and the plasmids were obtained from the transformed E. coli .

Article Title: Satellite RNAs promote pancreatic oncogenic processes via the dysfunction of YBX1
Article Snippet: .. The pcDNA 3.1(−) vector was digested at the BamHI site and dephosphorylated with Shrimp Alkaline Phosphatase (TaKaRa) at 37 °C for 15 min. Amplified fragments and linearized vector were incubated with 5 × InFusion HD Enzyme premix at 50 °C for 15 min and subsequently transformed into ECOS Competent E. coli DH5α. .. After 16 h, at least twenty colonies from each sample were picked up, and cloned vectors were collected using the QIAprep 96 Turbo Miniprep Kit (Qiagen).

Article Title: A heavy metal P-type ATPase OsHMA4 prevents copper accumulation in rice grain
Article Snippet: .. The fragment was digested with Bam HI and Bgl II and then subcloned into the binary vector pTF101.1 (ref. ), which was digested with Bam HI and dephosphorylated with Shrimp Alkaline Phosphatase (Takara). .. The 3,016 bp region upstream of the initiation codon of OsHMA4 was amplified by PCR from the genomic DNA.

Software:

Article Title: Single Nucleotide Polymorphism (rs4932178) in the P1 Promoter of FURIN Is Not Prognostic to Colon Cancer
Article Snippet: Thermocycling was performed at 95°C for 15 min, followed by 45 cycles of 94°C for 20 s, 56°C for 30 s, and 72°C for 60 s, followed by a final extension of 72°C for 3 min. Unincorporated dNTPs were deactivated using 0.3 units of shrimp alkaline phosphatase (Clontech Laboratories, Inc., Mountain View, USA) at 37° for 40 min and primer extension was carried out using 7–14 μ M of each primer extension probe (depending on the mass), 1 unit of iPLEX termination mix, and 1 unit of iPLEX enzyme. .. After analyzing the SpectroCHIPs using a MALDI-TOF mass spectrometer, spectra were processed by the SpectroREADER software (Sequenom Inc.) and transferred to the MassARRAY Typer 4 Analyzer (Sequenom Inc.) for further analysis.

Multiplex Assay:

Article Title: The association between apolipoprotein A1-C3-A5 gene cluster promoter polymorphisms and risk of ischemic stroke in the northern Chinese Han population
Article Snippet: SNaPshot reactions were performed in a final volume of 10 µL, including 5 µL of the SNaPshot Multiplex Kit (ABI), 1 µL of primer mix, 2 µL of water, and 2 µL of templates, which consisted of the multiplex PCR products for the different genes. .. Extension products were purified over a 1-h incubation period with 1 U of shrimp alkaline phosphatase (Takara, Otsu, Shiga, Japan) at 37℃, followed by incubation at 75℃ for 15 min to inactivate the enzyme.

Article Title: Rs2015 Polymorphism in miRNA Target Site of Sirtuin2 Gene Is Associated with the Risk of Parkinson's Disease in Chinese Han Population
Article Snippet: The reaction system consisted of 5 μ l SNaPshot Multiplex Kit (ABI, Shanghai), 2 μ l template DNA, 2 μ l ddH2 O, and 1 μ l primer mix. .. Then, the extension products were purified via incubation with 1 U of shrimp alkaline phosphatase (Takara, Japan) for 15 minutes at 37°C and subsequent incubation at 80°C for 15 minutes to inactivate the enzyme.

Article Title: An ADAM10 promoter polymorphism is a functional variant in severe sepsis patients and confers susceptibility to the development of sepsis
Article Snippet: Polymerase chain reaction (PCR) was conducted in a final volume of 10 μL, which contained 5 μL of the SNaPshot Multiplex Kit reagent (ABI), 2 μL of the templates containing the multiplex PCR products, 1 μL of the primer mix and 2 μL of water. .. The extension products were purified for 1 h at 37°C via incubation in 1 U of shrimp alkaline phosphatase (Takara, Otsu, Shiga, Japan), followed by incubation for 15 minutes at 75°C to inactivate this enzyme.

Article Title: Association of Apolipoprotein C3 Genetic Polymorphisms with the Risk of Ischemic Stroke in the Northern Chinese Han Population
Article Snippet: The SNaPshot reactions were executed in a final volume of 10 μL, including 5 μL of the SNaPshot Multiplex Kit (ABI), 1 μL primer mix, 2 μL water, and 2 μL templates, which consisted of the multiplex PCR products for the different genes. .. The extension products were purified through a 1-h incubation with 1 U of shrimp alkaline phosphatase (Takara: Otsu, Shiga, Japan) at 37°C, followed by incubation at 75°C for 15 min to inactivate the enzyme.

Article Title: Association study of MCP-1 promoter polymorphisms with the susceptibility and progression of sepsis
Article Snippet: The SNaPshot PCR reaction consisted of SNaPshot Multiplex Kitreagent (5μL), templates (4μL) and primer mix (4μl). .. The products were purified by 1-h incubation with 1U of shrimp alkaline phosphatase (Takara: Otsu, shiga, Japan) at 37°C and 75°C for 15 minutes.

Article Title: Single Nucleotide Polymorphism (rs4932178) in the P1 Promoter of FURIN Is Not Prognostic to Colon Cancer
Article Snippet: SNP Analysis Multiplex PCR was performed in a 5 μ L volume containing MegaMix Gold (Cambio), 5–10 ng of genomic DNA, and 100 nM of each PCR primer. .. Thermocycling was performed at 95°C for 15 min, followed by 45 cycles of 94°C for 20 s, 56°C for 30 s, and 72°C for 60 s, followed by a final extension of 72°C for 3 min. Unincorporated dNTPs were deactivated using 0.3 units of shrimp alkaline phosphatase (Clontech Laboratories, Inc., Mountain View, USA) at 37° for 40 min and primer extension was carried out using 7–14 μ M of each primer extension probe (depending on the mass), 1 unit of iPLEX termination mix, and 1 unit of iPLEX enzyme.

Transgenic Assay:

Article Title: A heavy metal P-type ATPase OsHMA4 prevents copper accumulation in rice grain
Article Snippet: Paragraph title: Transgenic complementation test ... The fragment was digested with Bam HI and Bgl II and then subcloned into the binary vector pTF101.1 (ref. ), which was digested with Bam HI and dephosphorylated with Shrimp Alkaline Phosphatase (Takara).

Spectrophotometry:

Article Title: The association between apolipoprotein A1-C3-A5 gene cluster promoter polymorphisms and risk of ischemic stroke in the northern Chinese Han population
Article Snippet: DNA purity was measured via spectrophotometry, and DNA samples were stored at −80℃. .. Extension products were purified over a 1-h incubation period with 1 U of shrimp alkaline phosphatase (Takara, Otsu, Shiga, Japan) at 37℃, followed by incubation at 75℃ for 15 min to inactivate the enzyme.

Article Title: Association of Apolipoprotein C3 Genetic Polymorphisms with the Risk of Ischemic Stroke in the Northern Chinese Han Population
Article Snippet: The DNA purity was measured with spectrophotometry, and the DNA samples were stored at −80°C. .. The extension products were purified through a 1-h incubation with 1 U of shrimp alkaline phosphatase (Takara: Otsu, Shiga, Japan) at 37°C, followed by incubation at 75°C for 15 min to inactivate the enzyme.

DNA Purification:

Article Title: Association of Apolipoprotein C3 Genetic Polymorphisms with the Risk of Ischemic Stroke in the Northern Chinese Han Population
Article Snippet: DNA Extraction and Genotyping Genomic DNA was extracted from 200 μL of EDTA-anticoagulated peripheral blood using a DNA Purification Kit (Promega, Madison, USA). .. The extension products were purified through a 1-h incubation with 1 U of shrimp alkaline phosphatase (Takara: Otsu, Shiga, Japan) at 37°C, followed by incubation at 75°C for 15 min to inactivate the enzyme.

Article Title: Triazole linking for preparation of a next-generation sequencing library from single-stranded DNA
Article Snippet: Any contaminating RNA was digested with 250 units of RNase If (New England BioLabs) and the 3′-phosphate of the MNase-treated DNA was removed with 5 units of shrimp alkaline phosphatase (Takara Bio Inc.). .. The final DNA purification was accomplished using a QIAQuick PCR purification kit (Qiagen) according to the manufacturer's instructions.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    TaKaRa alkaline phosphatase
    Alkaline Phosphatase, supplied by TaKaRa, used in various techniques. Bioz Stars score: 90/100, based on 65 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/alkaline phosphatase/product/TaKaRa
    Average 90 stars, based on 65 article reviews
    Price from $9.99 to $1999.99
    alkaline phosphatase - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    89
    TaKaRa shrimp alkaline phosphatase sap
    Identification of phosphorylation sites of mouse HP1α. (A) The phosphorylation patterns of mouse HP1α analyzed by phos-tag Western blotting (phos-tag WB). Whole-cell lysates (WCLs) of NIH 3T3 cells were resolved on an SDS-PAGE gel containing phos-tag acrylamide (phos-tag) or on a standard SDS-PAGE gel (mock). As an unphosphorylated control, <t>SAP-treated</t> <t>WCL</t> was loaded on the same gel. HP1α was detected using an anti-HP1α antibody. (B) Phosphorylation patterns of mouse HP1α in cells arrested at different cell cycle stages. WCLs were prepared from NIH 3T3 cells grown under the indicated conditions and analyzed by phos-tag WB. The arrowhead indicates an HP1α with basal band shift. The asterisk represents an HP1α species with metaphase-associated phosphorylation. The same membrane was immunoblotted with anti-α-tubulin and anti-TIF1β antibodies for loading controls. (C) Amino acid sequence of mouse HP1α. Light- and dark-shaded boxes indicate the CD and CSD, respectively. The sites of serine (S)-to-alanine (A) substitutions introduced in the following experiments are shown in boldface. (D) Phos-tag and standard WB analysis of wild-type and mutant HP1αs. WCLs were prepared from NIH 3T3 cells transiently expressing FLAG-tagged wild-type HP1α or HP1α with N-terminal (N-term: S11-14A) mutations, hinge (Hinge: S92, 93, 95, 97A) mutations, or both (N-term + hinge). Each FLAG-HP1α with an SAP-treated control was analyzed by phos-tag WB using an anti-FLAG antibody. The phosphorylation state of HP1α represented by each protein band was deduced from the distance of migration level of each band (Rf) and is indicated to the right of the phos-tag WB panel. (E) Phosphorylation state of FLAG-HP1α with each single amino acid substitution in the N-terminal region. The phosphorylation patterns of the indicated FLAG-HP1α species were analyzed by phos-tag WB using a higher concentration (80 μM) of phos-tag acrylamide. (F) Phosphorylation state of FLAG-HP1α with each single amino acid substitution in the hinge region. (G) The numbers of phosphorylated peptides identified by liquid chromatography (LC)-MS/MS analysis of affinity-purified HP1α. (H) Summary of the phosphorylation sites of mouse HP1α deduced from the experiments described above.
    Shrimp Alkaline Phosphatase Sap, supplied by TaKaRa, used in various techniques. Bioz Stars score: 89/100, based on 30 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/shrimp alkaline phosphatase sap/product/TaKaRa
    Average 89 stars, based on 30 article reviews
    Price from $9.99 to $1999.99
    shrimp alkaline phosphatase sap - by Bioz Stars, 2020-01
    89/100 stars
      Buy from Supplier

    Image Search Results


    Identification of phosphorylation sites of mouse HP1α. (A) The phosphorylation patterns of mouse HP1α analyzed by phos-tag Western blotting (phos-tag WB). Whole-cell lysates (WCLs) of NIH 3T3 cells were resolved on an SDS-PAGE gel containing phos-tag acrylamide (phos-tag) or on a standard SDS-PAGE gel (mock). As an unphosphorylated control, SAP-treated WCL was loaded on the same gel. HP1α was detected using an anti-HP1α antibody. (B) Phosphorylation patterns of mouse HP1α in cells arrested at different cell cycle stages. WCLs were prepared from NIH 3T3 cells grown under the indicated conditions and analyzed by phos-tag WB. The arrowhead indicates an HP1α with basal band shift. The asterisk represents an HP1α species with metaphase-associated phosphorylation. The same membrane was immunoblotted with anti-α-tubulin and anti-TIF1β antibodies for loading controls. (C) Amino acid sequence of mouse HP1α. Light- and dark-shaded boxes indicate the CD and CSD, respectively. The sites of serine (S)-to-alanine (A) substitutions introduced in the following experiments are shown in boldface. (D) Phos-tag and standard WB analysis of wild-type and mutant HP1αs. WCLs were prepared from NIH 3T3 cells transiently expressing FLAG-tagged wild-type HP1α or HP1α with N-terminal (N-term: S11-14A) mutations, hinge (Hinge: S92, 93, 95, 97A) mutations, or both (N-term + hinge). Each FLAG-HP1α with an SAP-treated control was analyzed by phos-tag WB using an anti-FLAG antibody. The phosphorylation state of HP1α represented by each protein band was deduced from the distance of migration level of each band (Rf) and is indicated to the right of the phos-tag WB panel. (E) Phosphorylation state of FLAG-HP1α with each single amino acid substitution in the N-terminal region. The phosphorylation patterns of the indicated FLAG-HP1α species were analyzed by phos-tag WB using a higher concentration (80 μM) of phos-tag acrylamide. (F) Phosphorylation state of FLAG-HP1α with each single amino acid substitution in the hinge region. (G) The numbers of phosphorylated peptides identified by liquid chromatography (LC)-MS/MS analysis of affinity-purified HP1α. (H) Summary of the phosphorylation sites of mouse HP1α deduced from the experiments described above.

    Journal: Molecular and Cellular Biology

    Article Title: N-Terminal Phosphorylation of HP1? Promotes Its Chromatin Binding ▿

    doi: 10.1128/MCB.01012-10

    Figure Lengend Snippet: Identification of phosphorylation sites of mouse HP1α. (A) The phosphorylation patterns of mouse HP1α analyzed by phos-tag Western blotting (phos-tag WB). Whole-cell lysates (WCLs) of NIH 3T3 cells were resolved on an SDS-PAGE gel containing phos-tag acrylamide (phos-tag) or on a standard SDS-PAGE gel (mock). As an unphosphorylated control, SAP-treated WCL was loaded on the same gel. HP1α was detected using an anti-HP1α antibody. (B) Phosphorylation patterns of mouse HP1α in cells arrested at different cell cycle stages. WCLs were prepared from NIH 3T3 cells grown under the indicated conditions and analyzed by phos-tag WB. The arrowhead indicates an HP1α with basal band shift. The asterisk represents an HP1α species with metaphase-associated phosphorylation. The same membrane was immunoblotted with anti-α-tubulin and anti-TIF1β antibodies for loading controls. (C) Amino acid sequence of mouse HP1α. Light- and dark-shaded boxes indicate the CD and CSD, respectively. The sites of serine (S)-to-alanine (A) substitutions introduced in the following experiments are shown in boldface. (D) Phos-tag and standard WB analysis of wild-type and mutant HP1αs. WCLs were prepared from NIH 3T3 cells transiently expressing FLAG-tagged wild-type HP1α or HP1α with N-terminal (N-term: S11-14A) mutations, hinge (Hinge: S92, 93, 95, 97A) mutations, or both (N-term + hinge). Each FLAG-HP1α with an SAP-treated control was analyzed by phos-tag WB using an anti-FLAG antibody. The phosphorylation state of HP1α represented by each protein band was deduced from the distance of migration level of each band (Rf) and is indicated to the right of the phos-tag WB panel. (E) Phosphorylation state of FLAG-HP1α with each single amino acid substitution in the N-terminal region. The phosphorylation patterns of the indicated FLAG-HP1α species were analyzed by phos-tag WB using a higher concentration (80 μM) of phos-tag acrylamide. (F) Phosphorylation state of FLAG-HP1α with each single amino acid substitution in the hinge region. (G) The numbers of phosphorylated peptides identified by liquid chromatography (LC)-MS/MS analysis of affinity-purified HP1α. (H) Summary of the phosphorylation sites of mouse HP1α deduced from the experiments described above.

    Article Snippet: For dephosphorylation, an aliquot of whole-cell lysate (WCL) was incubated with 0.08 U/ml shrimp alkaline phosphatase (SAP) (TaKaRa) for 3 to 6 h at 37°C.

    Techniques: Western Blot, SDS Page, Electrophoretic Mobility Shift Assay, Sequencing, Mutagenesis, Expressing, Migration, Concentration Assay, Liquid Chromatography, Liquid Chromatography with Mass Spectroscopy, Mass Spectrometry, Affinity Purification