Structured Review

TaKaRa shrimp alkaline phosphatase
Shrimp Alkaline Phosphatase, supplied by TaKaRa, used in various techniques. Bioz Stars score: 75/100, based on 0 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/shrimp alkaline phosphatase/product/TaKaRa
Average 75 stars, based on 0 article reviews
Price from $9.99 to $1999.99
shrimp alkaline phosphatase - by Bioz Stars, 2019-12
75/100 stars

Images

Related Articles

Methylation Sequencing:

Article Title: In vivo reprogramming drives Kras-induced cancer development
Article Snippet: Paragraph title: Bisulfite sequencing from pancreatic tissue ... After cleanup of the PCR products by exonuclease I (New England Biolabs) and shrimp alkaline phosphatase (Takara Bio), the sequence reaction was performed using M13 Rv primer (5′-CAGGAAACAGCTATGAC-3′) and was sequenced with ABI 3500 xL (Applied Biosystems).

Clone Assay:

Article Title: Satellite RNAs promote pancreatic oncogenic processes via the dysfunction of YBX1
Article Snippet: To examine the mutation rate in the mitochondrial DNA, a 431 bp fragment of the D-loop region was cloned using the InFusion HD cloning kit (Clontech) as follows. .. The pcDNA 3.1(−) vector was digested at the BamHI site and dephosphorylated with Shrimp Alkaline Phosphatase (TaKaRa) at 37 °C for 15 min. Amplified fragments and linearized vector were incubated with 5 × InFusion HD Enzyme premix at 50 °C for 15 min and subsequently transformed into ECOS Competent E. coli DH5α.

Article Title: RFamidergic neurons in the olfactory centers of the terrestrial slug Limax
Article Snippet: The amplicons were purified using the Wizard SV Gel and PCR clean-up system (Promega, Madison, WI, USA), and phosphorylated by T4 polynucleotide kinase (Takara, Ohtsu, Japan). .. The amplicons were ligated into a cloning vector pBluescriptII (KS) that had been digested with EcoRV followed by dephosphorylation by shrimp alkaline phosphatase (Takara). .. Competent E. coli. (Dh5α) was transformed with the ligated product, and the plasmids were obtained from the transformed E. coli .

Article Title: In vivo reprogramming drives Kras-induced cancer development
Article Snippet: The target sequence was cloned by Ex Taq HS (Takara Bio) and ligated into pCR4-Topo vector using Topo cloning technology (Invitrogen). .. After cleanup of the PCR products by exonuclease I (New England Biolabs) and shrimp alkaline phosphatase (Takara Bio), the sequence reaction was performed using M13 Rv primer (5′-CAGGAAACAGCTATGAC-3′) and was sequenced with ABI 3500 xL (Applied Biosystems).

Article Title: A retrovirus packages nascent host noncoding RNAs from a novel surveillance pathway
Article Snippet: For 3′ RACE, RNA was first incubated with 10 mM HCl for 4 h on ice followed by incubation with 5 U of shrimp alkaline phosphatase (Takara) to remove 3′ cyclic phosphates. .. After phenol-chloroform extraction, the RNA was ligated to RNA oligonucleotide L3, treated with DNase I, reverse-transcribed using SuperScript III and oligonucleotide P3, and amplified with oligonucleotides P3 and U6 (Supplemental Table S3).

Centrifugation:

Article Title: Triazole linking for preparation of a next-generation sequencing library from single-stranded DNA
Article Snippet: The spheroplasts were collected by centrifugation at 2000 × g for 5 min and resuspended in 1 ml of MNase digestion buffer (50 mM Tris–HCl, pH 7.6; 1 mM CaCl2 ; 0.2% (v/v) Triton X-100) containing 1 × protease inhibitor (Nacalai Tesque). .. Any contaminating RNA was digested with 250 units of RNase If (New England BioLabs) and the 3′-phosphate of the MNase-treated DNA was removed with 5 units of shrimp alkaline phosphatase (Takara Bio Inc.).

Amplification:

Article Title: Satellite RNAs promote pancreatic oncogenic processes via the dysfunction of YBX1
Article Snippet: The primers used were as follows: Fw: 5′-CTGGACTAGTGGATCCTCTTTTTATTTTGGCCTACTTT-3′, Rv: 5′-TACCGAGCTCGGATCCCATCTAAGCATTTTCAGTGC-3′ (ref. ). .. The pcDNA 3.1(−) vector was digested at the BamHI site and dephosphorylated with Shrimp Alkaline Phosphatase (TaKaRa) at 37 °C for 15 min. Amplified fragments and linearized vector were incubated with 5 × InFusion HD Enzyme premix at 50 °C for 15 min and subsequently transformed into ECOS Competent E. coli DH5α. .. After 16 h, at least twenty colonies from each sample were picked up, and cloned vectors were collected using the QIAprep 96 Turbo Miniprep Kit (Qiagen).

Article Title: Association study of MCP-1 promoter polymorphisms with the susceptibility and progression of sepsis
Article Snippet: Two MCP-1 polymorphisms rs1024611 (-2518 A > G) and rs2857656 (-362 G > C) were genotyped using the SNaPshot MultiplexKit (Applied Biosystems Co., Ltd., Foster City, CA, USA), and the primers used for amplification of PCR and extension of SNaPshot were designed with GenBank database and were as follows: rs1024611F, 5' CTCTCACGCCAGCACTGACCTC 3' ; rs1024611R, 5' CCAATTAGCCCATGGTCACAGA 3' ; rs2857656F, 5' TAAGCTGGCAGCGAGCCTGAC 3' ; rs2857656R, 5' GCCATTAAGCCCAGACTGACCA 3' . .. The products were purified by 1-h incubation with 1U of shrimp alkaline phosphatase (Takara: Otsu, shiga, Japan) at 37°C and 75°C for 15 minutes.

Article Title: A heavy metal P-type ATPase OsHMA4 prevents copper accumulation in rice grain
Article Snippet: The coding region of OsHMA4 linked with the nopaline synthase (NOS) terminator was amplified using the plasmid GFP-OsHMA4 (described below) as the template. .. The fragment was digested with Bam HI and Bgl II and then subcloned into the binary vector pTF101.1 (ref. ), which was digested with Bam HI and dephosphorylated with Shrimp Alkaline Phosphatase (Takara).

Article Title: An ADAM10 promoter polymorphism is a functional variant in severe sepsis patients and confers susceptibility to the development of sepsis
Article Snippet: The PCR reaction protocol was as follows: after denaturation at 95°C for 2 minutes, 11 cycles of DNA amplification were performed using Taq PCR for 20 s at 94°C (denaturation), 40 s at 65°C (annealing), and 90 s at 72°C (extension), followed by 24 cycles of DNA amplification for 20 s at 94°C (denaturation), 30 s at 59°C (annealing), and 90 s at 72°C (extension). .. The extension products were purified for 1 h at 37°C via incubation in 1 U of shrimp alkaline phosphatase (Takara, Otsu, Shiga, Japan), followed by incubation for 15 minutes at 75°C to inactivate this enzyme.

Article Title: A novel somatic mutation of SIN3A detected in breast cancer by whole-exome sequencing enhances cell proliferation through ERα expression
Article Snippet: Genome DNAs extracted from breast cancer tissues were amplified by PCR using primers 5′-TGCGTCCACAGTACCAACC-3′ and 5′-ATTTGTTCCCAAGCCGAACG-3′ for the region from 75684340 to 75684709 on chromosome 15 including the SIN3A mutation. .. The PCR products were incubated at 37 °C for 20 min in a mixture of 5 U of exonuclease I (NewEngland Biolabs) and shrimp alkaline phosphatase (TaKaRa Bio.

Article Title: The association between apolipoprotein A1-C3-A5 gene cluster promoter polymorphisms and risk of ischemic stroke in the northern Chinese Han population
Article Snippet: The SNaPshot reaction procedures were as follows: initial denaturation at 96℃ for 1 min, then 28 cycles of denaturation at 96℃ for 10 s, annealing at 55℃ for 5 s, and extension at 60℃ for 30 s. Amplified samples were stored at 4℃. .. Extension products were purified over a 1-h incubation period with 1 U of shrimp alkaline phosphatase (Takara, Otsu, Shiga, Japan) at 37℃, followed by incubation at 75℃ for 15 min to inactivate the enzyme.

Article Title: A new genus and species of octocoral with aragonite calcium-carbonate skeleton ( Octocorallia, Helioporacea) from Okinawa, Japan
Article Snippet: Paragraph title: DNA extraction and PCR amplification ... Positive PCR products were cleaned up by Exonuclease I and Shrimp Alkaline Phosphatase (Takara, Shiga, Japan) before sequencing.

Article Title: Serotyping of Streptococcus pneumoniae Based on Capsular Genes Polymorphisms
Article Snippet: The amplification solution was composed of 1X Platinum Taq buffer, 0.2 µM dNTPs, 1.5 mM MgCl2, 1µl multiplex PCR primer mix, 0.5 units of Platinum Taq DNA polymerase (Invitrogen, Burlington, ON, Canada), and 2.5 µl of cDNA, in a final volume of 20 µl. .. Finally, the reaction was incubated at 72°C for 3 min. Then, 3 units of shrimp alkaline phosphatase (Clontech, Mountain View, CA), 7.5 units of exonuclease (Clontech) and 0.25 µl of 50X titanium DNA polymerase (Clontech) were added to the solution, which was incubated at 37°C for 20 min and at 94°C for 10 min.

Mass Spectrometry:

Article Title: Single Nucleotide Polymorphism (rs4932178) in the P1 Promoter of FURIN Is Not Prognostic to Colon Cancer
Article Snippet: Thermocycling was performed at 95°C for 15 min, followed by 45 cycles of 94°C for 20 s, 56°C for 30 s, and 72°C for 60 s, followed by a final extension of 72°C for 3 min. Unincorporated dNTPs were deactivated using 0.3 units of shrimp alkaline phosphatase (Clontech Laboratories, Inc., Mountain View, USA) at 37° for 40 min and primer extension was carried out using 7–14 μ M of each primer extension probe (depending on the mass), 1 unit of iPLEX termination mix, and 1 unit of iPLEX enzyme. .. Thermocycling was performed at 95°C for 15 min, followed by 45 cycles of 94°C for 20 s, 56°C for 30 s, and 72°C for 60 s, followed by a final extension of 72°C for 3 min. Unincorporated dNTPs were deactivated using 0.3 units of shrimp alkaline phosphatase (Clontech Laboratories, Inc., Mountain View, USA) at 37° for 40 min and primer extension was carried out using 7–14 μ M of each primer extension probe (depending on the mass), 1 unit of iPLEX termination mix, and 1 unit of iPLEX enzyme.

Quantitative RT-PCR:

Article Title: A retrovirus packages nascent host noncoding RNAs from a novel surveillance pathway
Article Snippet: Paragraph title: siRNA transfections, RT-qPCR, and 3′ RACE ... For 3′ RACE, RNA was first incubated with 10 mM HCl for 4 h on ice followed by incubation with 5 U of shrimp alkaline phosphatase (Takara) to remove 3′ cyclic phosphates.

SYBR Green Assay:

Article Title: A retrovirus packages nascent host noncoding RNAs from a novel surveillance pathway
Article Snippet: For experiments measuring ncRNAs, DNase-treated RNA was primed with random hexamers and extended with SuperScript III RT (Invitrogen) using an annealing temperature of 65°C. cDNAs were subjected to qPCR using a SYBR Green real-time PCR master mix (Bio-Rad). .. For 3′ RACE, RNA was first incubated with 10 mM HCl for 4 h on ice followed by incubation with 5 U of shrimp alkaline phosphatase (Takara) to remove 3′ cyclic phosphates.

Microarray:

Article Title: Serotyping of Streptococcus pneumoniae Based on Capsular Genes Polymorphisms
Article Snippet: Paragraph title: Microarray assay ... Finally, the reaction was incubated at 72°C for 3 min. Then, 3 units of shrimp alkaline phosphatase (Clontech, Mountain View, CA), 7.5 units of exonuclease (Clontech) and 0.25 µl of 50X titanium DNA polymerase (Clontech) were added to the solution, which was incubated at 37°C for 20 min and at 94°C for 10 min.

Incubation:

Article Title: Satellite RNAs promote pancreatic oncogenic processes via the dysfunction of YBX1
Article Snippet: The primers used were as follows: Fw: 5′-CTGGACTAGTGGATCCTCTTTTTATTTTGGCCTACTTT-3′, Rv: 5′-TACCGAGCTCGGATCCCATCTAAGCATTTTCAGTGC-3′ (ref. ). .. The pcDNA 3.1(−) vector was digested at the BamHI site and dephosphorylated with Shrimp Alkaline Phosphatase (TaKaRa) at 37 °C for 15 min. Amplified fragments and linearized vector were incubated with 5 × InFusion HD Enzyme premix at 50 °C for 15 min and subsequently transformed into ECOS Competent E. coli DH5α. .. After 16 h, at least twenty colonies from each sample were picked up, and cloned vectors were collected using the QIAprep 96 Turbo Miniprep Kit (Qiagen).

Article Title: Association study of MCP-1 promoter polymorphisms with the susceptibility and progression of sepsis
Article Snippet: The PCR reaction protocol was as follows: 96°C for 60s; 28 cycles of 96°C for 10s, 55°C for 5s, and 60°C for 30s; 4°C for 120s. .. The products were purified by 1-h incubation with 1U of shrimp alkaline phosphatase (Takara: Otsu, shiga, Japan) at 37°C and 75°C for 15 minutes. .. Then the purified products (0.5μL) were mixed with Lizl20 Size Standard (0.5μL) and HiDi formamide (9μL) and were incubated at 95°C for 5 minutes, and were analyzed using ABIPrism 3730XL genetic sequence analyzer (Applied Biosystems, Foster City, CA, USA) and GeneMapper 4.1 (Applied Biosystems, Carlsbad, CA, USA).

Article Title: Metagenomic Sequencing From Mosquitoes in China Reveals a Variety of Insect and Human Viruses
Article Snippet: Then 1 μL of Klenow fragment, 1 μL of 10 mM dNTPs, 2 μL of 10 × Klenow buffer, and 6 μL of dd H2 O were added. .. Subsequently, the samples were incubated at 37°C for 60 min, followed by 75°C for 10 min. To eliminate phosphates and free single-strand nucleic acid in the dscDNA reaction, 0.5 μL of Exonuclease I, 1 μL of shrimp alkaline phosphatase (SAP, Takara, Dalian, China), 5 μL of 10 × phosphatase buffer, and 24 μL of DEPC H2 O were added and incubated at 37°C for 60 min followed by 75°C for 10 min. .. To obtain large quantity of the viral nucleic acids, the dscDNA was amplified using SISPA.

Article Title: An ADAM10 promoter polymorphism is a functional variant in severe sepsis patients and confers susceptibility to the development of sepsis
Article Snippet: The PCR reaction protocol was as follows: after denaturation at 95°C for 2 minutes, 11 cycles of DNA amplification were performed using Taq PCR for 20 s at 94°C (denaturation), 40 s at 65°C (annealing), and 90 s at 72°C (extension), followed by 24 cycles of DNA amplification for 20 s at 94°C (denaturation), 30 s at 59°C (annealing), and 90 s at 72°C (extension). .. The extension products were purified for 1 h at 37°C via incubation in 1 U of shrimp alkaline phosphatase (Takara, Otsu, Shiga, Japan), followed by incubation for 15 minutes at 75°C to inactivate this enzyme. .. Additionally, 0.5 μL of the purified products was mixed with 9 μL of Hi-Di formamide and 0.5 μL of Liz120 Size Standard.

Article Title: A novel somatic mutation of SIN3A detected in breast cancer by whole-exome sequencing enhances cell proliferation through ERα expression
Article Snippet: Genome DNAs extracted from breast cancer tissues were amplified by PCR using primers 5′-TGCGTCCACAGTACCAACC-3′ and 5′-ATTTGTTCCCAAGCCGAACG-3′ for the region from 75684340 to 75684709 on chromosome 15 including the SIN3A mutation. .. The PCR products were incubated at 37 °C for 20 min in a mixture of 5 U of exonuclease I (NewEngland Biolabs) and shrimp alkaline phosphatase (TaKaRa Bio. .. Inc.), and were purified using a BigDye® Xterminator™ purification kit (Thermo Fisher Scientific).

Article Title: Triazole linking for preparation of a next-generation sequencing library from single-stranded DNA
Article Snippet: The reaction mixture was then supplemented with 100 μl of 10% (w/v) SDS and 25 μl of 20 mg/ml Protease K (Qiagen), and incubated at 50°C for 1 h. Following phenol and phenol/chloroform extraction, nucleic acids were collected by isopropanol precipitation. .. Any contaminating RNA was digested with 250 units of RNase If (New England BioLabs) and the 3′-phosphate of the MNase-treated DNA was removed with 5 units of shrimp alkaline phosphatase (Takara Bio Inc.).

Article Title: Association of Apolipoprotein C3 Genetic Polymorphisms with the Risk of Ischemic Stroke in the Northern Chinese Han Population
Article Snippet: The SNaPshot reaction procedures were as follows: (1) initial denaturation at 96°C for 1 min; (2) denaturation at 96°C for 10 s; (3) annealing at 55°C for 5 s; and (4) extension at 60°C for 30 s, for a total of 28 cycles. .. The extension products were purified through a 1-h incubation with 1 U of shrimp alkaline phosphatase (Takara: Otsu, Shiga, Japan) at 37°C, followed by incubation at 75°C for 15 min to inactivate the enzyme. .. The purified products (0.5 μL) were mixed with 9 μL of Hi—Di and 0.5 μL of the Liz120 size standard (Applied Biosystems Co., Ltd.).

Article Title: The association between apolipoprotein A1-C3-A5 gene cluster promoter polymorphisms and risk of ischemic stroke in the northern Chinese Han population
Article Snippet: The SNaPshot reaction procedures were as follows: initial denaturation at 96℃ for 1 min, then 28 cycles of denaturation at 96℃ for 10 s, annealing at 55℃ for 5 s, and extension at 60℃ for 30 s. Amplified samples were stored at 4℃. .. Extension products were purified over a 1-h incubation period with 1 U of shrimp alkaline phosphatase (Takara, Otsu, Shiga, Japan) at 37℃, followed by incubation at 75℃ for 15 min to inactivate the enzyme. .. Purified products (0.5 µL) were mixed with 9 µL of Hi–Di and 0.5 µL of the Liz120 size standard (Applied Biosystems Co., Ltd.).

Article Title: A retrovirus packages nascent host noncoding RNAs from a novel surveillance pathway
Article Snippet: Primers used for RT-qPCR are listed in Supplemental Table S3. .. For 3′ RACE, RNA was first incubated with 10 mM HCl for 4 h on ice followed by incubation with 5 U of shrimp alkaline phosphatase (Takara) to remove 3′ cyclic phosphates. .. After phenol-chloroform extraction, the RNA was ligated to RNA oligonucleotide L3, treated with DNase I, reverse-transcribed using SuperScript III and oligonucleotide P3, and amplified with oligonucleotides P3 and U6 (Supplemental Table S3).

Article Title: Serotyping of Streptococcus pneumoniae Based on Capsular Genes Polymorphisms
Article Snippet: The PCR program consisted in the following steps: 60 s at 94°C followed by 39 cycles of 30 s at 94°C, 30 s at 55°C and 90 s at 72°C. .. Finally, the reaction was incubated at 72°C for 3 min. Then, 3 units of shrimp alkaline phosphatase (Clontech, Mountain View, CA), 7.5 units of exonuclease (Clontech) and 0.25 µl of 50X titanium DNA polymerase (Clontech) were added to the solution, which was incubated at 37°C for 20 min and at 94°C for 10 min. .. This step allows for the degradation of remaining dNTPs and PCR primers that were not used in the multiplex PCR.

Formalin-fixed Paraffin-Embedded:

Article Title: Mutation analysis of the EGFR pathway genes, EGFR, RAS, PIK3CA, BRAF, and AKT1, in salivary gland adenoid cystic carcinoma
Article Snippet: Formalin-fixed, paraffin-embedded tumor samples were cut at 4 μm, and tissue sections were deparaffinized and lightly stained with methyl green. .. The PCR products were treated with exonuclease I (Exo-I, Takara Bio, Kusatsu, Japan) and shrimp alkaline phosphatase (SAP, Takara Bio) to remove unincorporated primers and deoxynucleotide triphosphates.

Expressing:

Article Title: RFamidergic neurons in the olfactory centers of the terrestrial slug Limax
Article Snippet: Paragraph title: Molecular cloning and expression analysis of RFamide cDNAs ... The amplicons were ligated into a cloning vector pBluescriptII (KS) that had been digested with EcoRV followed by dephosphorylation by shrimp alkaline phosphatase (Takara).

Transformation Assay:

Article Title: Satellite RNAs promote pancreatic oncogenic processes via the dysfunction of YBX1
Article Snippet: The primers used were as follows: Fw: 5′-CTGGACTAGTGGATCCTCTTTTTATTTTGGCCTACTTT-3′, Rv: 5′-TACCGAGCTCGGATCCCATCTAAGCATTTTCAGTGC-3′ (ref. ). .. The pcDNA 3.1(−) vector was digested at the BamHI site and dephosphorylated with Shrimp Alkaline Phosphatase (TaKaRa) at 37 °C for 15 min. Amplified fragments and linearized vector were incubated with 5 × InFusion HD Enzyme premix at 50 °C for 15 min and subsequently transformed into ECOS Competent E. coli DH5α. .. After 16 h, at least twenty colonies from each sample were picked up, and cloned vectors were collected using the QIAprep 96 Turbo Miniprep Kit (Qiagen).

Article Title: A heavy metal P-type ATPase OsHMA4 prevents copper accumulation in rice grain
Article Snippet: For transgenic complementation experiment, oshma4 was transformed with OsHMA4 under the control of its own promoter. .. The fragment was digested with Bam HI and Bgl II and then subcloned into the binary vector pTF101.1 (ref. ), which was digested with Bam HI and dephosphorylated with Shrimp Alkaline Phosphatase (Takara).

Article Title: In vivo reprogramming drives Kras-induced cancer development
Article Snippet: These plasmids were transformed into DH5α at 37 °C, overnight. .. After cleanup of the PCR products by exonuclease I (New England Biolabs) and shrimp alkaline phosphatase (Takara Bio), the sequence reaction was performed using M13 Rv primer (5′-CAGGAAACAGCTATGAC-3′) and was sequenced with ABI 3500 xL (Applied Biosystems).

Derivative Assay:

Article Title: RFamidergic neurons in the olfactory centers of the terrestrial slug Limax
Article Snippet: Partial cDNAs of the RFamide genes were cloned by reverse transcription-PCR (RT-PCR) using RNAs derived from the CNS of Limax , as described previously [ ], except that RNAs were reverse-transcribed using oligo-dT primers. .. The amplicons were ligated into a cloning vector pBluescriptII (KS) that had been digested with EcoRV followed by dephosphorylation by shrimp alkaline phosphatase (Takara).

Transfection:

Article Title: A retrovirus packages nascent host noncoding RNAs from a novel surveillance pathway
Article Snippet: Paragraph title: siRNA transfections, RT-qPCR, and 3′ RACE ... For 3′ RACE, RNA was first incubated with 10 mM HCl for 4 h on ice followed by incubation with 5 U of shrimp alkaline phosphatase (Takara) to remove 3′ cyclic phosphates.

Sequencing:

Article Title: Satellite RNAs promote pancreatic oncogenic processes via the dysfunction of YBX1
Article Snippet: The pcDNA 3.1(−) vector was digested at the BamHI site and dephosphorylated with Shrimp Alkaline Phosphatase (TaKaRa) at 37 °C for 15 min. Amplified fragments and linearized vector were incubated with 5 × InFusion HD Enzyme premix at 50 °C for 15 min and subsequently transformed into ECOS Competent E. coli DH5α. .. After 16 h, at least twenty colonies from each sample were picked up, and cloned vectors were collected using the QIAprep 96 Turbo Miniprep Kit (Qiagen).

Article Title: RFamidergic neurons in the olfactory centers of the terrestrial slug Limax
Article Snippet: The amplicons were ligated into a cloning vector pBluescriptII (KS) that had been digested with EcoRV followed by dephosphorylation by shrimp alkaline phosphatase (Takara). .. Competent E. coli. (Dh5α) was transformed with the ligated product, and the plasmids were obtained from the transformed E. coli .

Article Title: An ADAM10 promoter polymorphism is a functional variant in severe sepsis patients and confers susceptibility to the development of sepsis
Article Snippet: The extension products were purified for 1 h at 37°C via incubation in 1 U of shrimp alkaline phosphatase (Takara, Otsu, Shiga, Japan), followed by incubation for 15 minutes at 75°C to inactivate this enzyme. .. Additionally, 0.5 μL of the purified products was mixed with 9 μL of Hi-Di formamide and 0.5 μL of Liz120 Size Standard.

Article Title: A novel somatic mutation of SIN3A detected in breast cancer by whole-exome sequencing enhances cell proliferation through ERα expression
Article Snippet: Paragraph title: Confirmation of a somatic mutation in SIN3A by Sanger sequencing ... The PCR products were incubated at 37 °C for 20 min in a mixture of 5 U of exonuclease I (NewEngland Biolabs) and shrimp alkaline phosphatase (TaKaRa Bio.

Article Title: Association of Apolipoprotein C3 Genetic Polymorphisms with the Risk of Ischemic Stroke in the Northern Chinese Han Population
Article Snippet: The extension products were purified through a 1-h incubation with 1 U of shrimp alkaline phosphatase (Takara: Otsu, Shiga, Japan) at 37°C, followed by incubation at 75°C for 15 min to inactivate the enzyme. .. The purified products (0.5 μL) were mixed with 9 μL of Hi—Di and 0.5 μL of the Liz120 size standard (Applied Biosystems Co., Ltd.).

Article Title: In vivo reprogramming drives Kras-induced cancer development
Article Snippet: Colony PCR was performed using Go taq Master Mix (Promega) and ascertained ligation of the cassettes. .. After cleanup of the PCR products by exonuclease I (New England Biolabs) and shrimp alkaline phosphatase (Takara Bio), the sequence reaction was performed using M13 Rv primer (5′-CAGGAAACAGCTATGAC-3′) and was sequenced with ABI 3500 xL (Applied Biosystems). .. Methylation rates were measured using Quantification tool for Methylation Analysis (QUMA) software (Riken).

Article Title: The association between apolipoprotein A1-C3-A5 gene cluster promoter polymorphisms and risk of ischemic stroke in the northern Chinese Han population
Article Snippet: Extension products were purified over a 1-h incubation period with 1 U of shrimp alkaline phosphatase (Takara, Otsu, Shiga, Japan) at 37℃, followed by incubation at 75℃ for 15 min to inactivate the enzyme. .. Purified products (0.5 µL) were mixed with 9 µL of Hi–Di and 0.5 µL of the Liz120 size standard (Applied Biosystems Co., Ltd.).

Article Title: A new genus and species of octocoral with aragonite calcium-carbonate skeleton ( Octocorallia, Helioporacea) from Okinawa, Japan
Article Snippet: Amplified products were visualized with 1.0% agarose gel electrophoresis. .. Positive PCR products were cleaned up by Exonuclease I and Shrimp Alkaline Phosphatase (Takara, Shiga, Japan) before sequencing. .. Sequencing was performed by Fasmac (Kanagawa, Japan).

Article Title: First evidence of asexual recruitment of Pocillopora acuta in Okinawa Island using genotypic identification
Article Snippet: Mitochondrial haplotypes were confirmed by sequencing the mtORF region. .. PCR products were cleaned with Exonuclease I (Takara) and Shrimp Alkaline Phosphatase (Takara).

Ligation:

Article Title: In vivo reprogramming drives Kras-induced cancer development
Article Snippet: Colony PCR was performed using Go taq Master Mix (Promega) and ascertained ligation of the cassettes. .. After cleanup of the PCR products by exonuclease I (New England Biolabs) and shrimp alkaline phosphatase (Takara Bio), the sequence reaction was performed using M13 Rv primer (5′-CAGGAAACAGCTATGAC-3′) and was sequenced with ABI 3500 xL (Applied Biosystems).

Protease Inhibitor:

Article Title: Triazole linking for preparation of a next-generation sequencing library from single-stranded DNA
Article Snippet: The spheroplasts were collected by centrifugation at 2000 × g for 5 min and resuspended in 1 ml of MNase digestion buffer (50 mM Tris–HCl, pH 7.6; 1 mM CaCl2 ; 0.2% (v/v) Triton X-100) containing 1 × protease inhibitor (Nacalai Tesque). .. Any contaminating RNA was digested with 250 units of RNase If (New England BioLabs) and the 3′-phosphate of the MNase-treated DNA was removed with 5 units of shrimp alkaline phosphatase (Takara Bio Inc.).

Generated:

Article Title: Single Nucleotide Polymorphism (rs4932178) in the P1 Promoter of FURIN Is Not Prognostic to Colon Cancer
Article Snippet: Thermocycling was performed at 95°C for 15 min, followed by 45 cycles of 94°C for 20 s, 56°C for 30 s, and 72°C for 60 s, followed by a final extension of 72°C for 3 min. Unincorporated dNTPs were deactivated using 0.3 units of shrimp alkaline phosphatase (Clontech Laboratories, Inc., Mountain View, USA) at 37° for 40 min and primer extension was carried out using 7–14 μ M of each primer extension probe (depending on the mass), 1 unit of iPLEX termination mix, and 1 unit of iPLEX enzyme. .. Thermocycling was performed at 95°C for 15 min, followed by 45 cycles of 94°C for 20 s, 56°C for 30 s, and 72°C for 60 s, followed by a final extension of 72°C for 3 min. Unincorporated dNTPs were deactivated using 0.3 units of shrimp alkaline phosphatase (Clontech Laboratories, Inc., Mountain View, USA) at 37° for 40 min and primer extension was carried out using 7–14 μ M of each primer extension probe (depending on the mass), 1 unit of iPLEX termination mix, and 1 unit of iPLEX enzyme.

DNA Sequencing:

Article Title: RFamidergic neurons in the olfactory centers of the terrestrial slug Limax
Article Snippet: The amplicons were ligated into a cloning vector pBluescriptII (KS) that had been digested with EcoRV followed by dephosphorylation by shrimp alkaline phosphatase (Takara). .. Competent E. coli. (Dh5α) was transformed with the ligated product, and the plasmids were obtained from the transformed E. coli .

Article Title: Triazole linking for preparation of a next-generation sequencing library from single-stranded DNA
Article Snippet: Any contaminating RNA was digested with 250 units of RNase If (New England BioLabs) and the 3′-phosphate of the MNase-treated DNA was removed with 5 units of shrimp alkaline phosphatase (Takara Bio Inc.). .. The library was prepared from 350 ng of the purified DNA using the same protocol as described above for the library preparation from the synthetic DNA.

Reverse Transcription Polymerase Chain Reaction:

Article Title: RFamidergic neurons in the olfactory centers of the terrestrial slug Limax
Article Snippet: Partial cDNAs of the RFamide genes were cloned by reverse transcription-PCR (RT-PCR) using RNAs derived from the CNS of Limax , as described previously [ ], except that RNAs were reverse-transcribed using oligo-dT primers. .. The amplicons were ligated into a cloning vector pBluescriptII (KS) that had been digested with EcoRV followed by dephosphorylation by shrimp alkaline phosphatase (Takara).

DNA Extraction:

Article Title: Association study of MCP-1 promoter polymorphisms with the susceptibility and progression of sepsis
Article Snippet: Paragraph title: DNA extraction and genotyping ... The products were purified by 1-h incubation with 1U of shrimp alkaline phosphatase (Takara: Otsu, shiga, Japan) at 37°C and 75°C for 15 minutes.

Article Title: An ADAM10 promoter polymorphism is a functional variant in severe sepsis patients and confers susceptibility to the development of sepsis
Article Snippet: Paragraph title: DNA isolation and genotyping ... The extension products were purified for 1 h at 37°C via incubation in 1 U of shrimp alkaline phosphatase (Takara, Otsu, Shiga, Japan), followed by incubation for 15 minutes at 75°C to inactivate this enzyme.

Article Title: Association of Apolipoprotein C3 Genetic Polymorphisms with the Risk of Ischemic Stroke in the Northern Chinese Han Population
Article Snippet: Paragraph title: DNA Extraction and Genotyping ... The extension products were purified through a 1-h incubation with 1 U of shrimp alkaline phosphatase (Takara: Otsu, Shiga, Japan) at 37°C, followed by incubation at 75°C for 15 min to inactivate the enzyme.

Article Title: The association between apolipoprotein A1-C3-A5 gene cluster promoter polymorphisms and risk of ischemic stroke in the northern Chinese Han population
Article Snippet: Paragraph title: DNA extraction and genotyping ... Extension products were purified over a 1-h incubation period with 1 U of shrimp alkaline phosphatase (Takara, Otsu, Shiga, Japan) at 37℃, followed by incubation at 75℃ for 15 min to inactivate the enzyme.

Article Title: A new genus and species of octocoral with aragonite calcium-carbonate skeleton ( Octocorallia, Helioporacea) from Okinawa, Japan
Article Snippet: Paragraph title: DNA extraction and PCR amplification ... Positive PCR products were cleaned up by Exonuclease I and Shrimp Alkaline Phosphatase (Takara, Shiga, Japan) before sequencing.

Molecular Cloning:

Article Title: RFamidergic neurons in the olfactory centers of the terrestrial slug Limax
Article Snippet: Paragraph title: Molecular cloning and expression analysis of RFamide cDNAs ... The amplicons were ligated into a cloning vector pBluescriptII (KS) that had been digested with EcoRV followed by dephosphorylation by shrimp alkaline phosphatase (Takara).

Real-time Polymerase Chain Reaction:

Article Title: A retrovirus packages nascent host noncoding RNAs from a novel surveillance pathway
Article Snippet: For experiments measuring ncRNAs, DNase-treated RNA was primed with random hexamers and extended with SuperScript III RT (Invitrogen) using an annealing temperature of 65°C. cDNAs were subjected to qPCR using a SYBR Green real-time PCR master mix (Bio-Rad). .. For 3′ RACE, RNA was first incubated with 10 mM HCl for 4 h on ice followed by incubation with 5 U of shrimp alkaline phosphatase (Takara) to remove 3′ cyclic phosphates.

Methylation:

Article Title: In vivo reprogramming drives Kras-induced cancer development
Article Snippet: Bisulfite treatment was performed using EZ DNA Methylation-Gold Kit (Zymo Research). .. After cleanup of the PCR products by exonuclease I (New England Biolabs) and shrimp alkaline phosphatase (Takara Bio), the sequence reaction was performed using M13 Rv primer (5′-CAGGAAACAGCTATGAC-3′) and was sequenced with ABI 3500 xL (Applied Biosystems).

Mutagenesis:

Article Title: Satellite RNAs promote pancreatic oncogenic processes via the dysfunction of YBX1
Article Snippet: Paragraph title: mtDNA mutation ... The pcDNA 3.1(−) vector was digested at the BamHI site and dephosphorylated with Shrimp Alkaline Phosphatase (TaKaRa) at 37 °C for 15 min. Amplified fragments and linearized vector were incubated with 5 × InFusion HD Enzyme premix at 50 °C for 15 min and subsequently transformed into ECOS Competent E. coli DH5α.

Article Title: A heavy metal P-type ATPase OsHMA4 prevents copper accumulation in rice grain
Article Snippet: The fragment was digested with Bam HI and Bgl II and then subcloned into the binary vector pTF101.1 (ref. ), which was digested with Bam HI and dephosphorylated with Shrimp Alkaline Phosphatase (Takara). .. The fragment was digested with Bam HI and Bgl II and then subcloned into the binary vector pTF101.1 (ref. ), which was digested with Bam HI and dephosphorylated with Shrimp Alkaline Phosphatase (Takara).

Article Title: A novel somatic mutation of SIN3A detected in breast cancer by whole-exome sequencing enhances cell proliferation through ERα expression
Article Snippet: Paragraph title: Confirmation of a somatic mutation in SIN3A by Sanger sequencing ... The PCR products were incubated at 37 °C for 20 min in a mixture of 5 U of exonuclease I (NewEngland Biolabs) and shrimp alkaline phosphatase (TaKaRa Bio.

Isolation:

Article Title: Satellite RNAs promote pancreatic oncogenic processes via the dysfunction of YBX1
Article Snippet: Total DNA templates including mtDNA were isolated from K512-vector and K512-EF1α-MajSAT cells using the QIAamp DNA Mini Kit (Qiagen), and PCR was performed with LA-Taq polymerase (TaKaRa) mixed with Pfu turbo DNA Polymerase (Stratagene). .. The pcDNA 3.1(−) vector was digested at the BamHI site and dephosphorylated with Shrimp Alkaline Phosphatase (TaKaRa) at 37 °C for 15 min. Amplified fragments and linearized vector were incubated with 5 × InFusion HD Enzyme premix at 50 °C for 15 min and subsequently transformed into ECOS Competent E. coli DH5α.

Size-exclusion Chromatography:

Article Title: Mutation analysis of the EGFR pathway genes, EGFR, RAS, PIK3CA, BRAF, and AKT1, in salivary gland adenoid cystic carcinoma
Article Snippet: The PCR products were treated with exonuclease I (Exo-I, Takara Bio, Kusatsu, Japan) and shrimp alkaline phosphatase (SAP, Takara Bio) to remove unincorporated primers and deoxynucleotide triphosphates. .. The final reaction mix (10 μl) contained 3 μl of the treated PCR product, 5 μl of SNaPshot ready reaction premix containing fluorescent dideoxynucleotides (A = ddR6G, green; C = ddTAMRA, black; G = ddR110, blue; and T = ddROX, red) and probe primers.

Microscopy:

Article Title: Mutation analysis of the EGFR pathway genes, EGFR, RAS, PIK3CA, BRAF, and AKT1, in salivary gland adenoid cystic carcinoma
Article Snippet: Tumor tissues only were scraped under a dissecting microscope using a serial hematoxylin and eosin-stained section as a guide. .. The PCR products were treated with exonuclease I (Exo-I, Takara Bio, Kusatsu, Japan) and shrimp alkaline phosphatase (SAP, Takara Bio) to remove unincorporated primers and deoxynucleotide triphosphates.

Purification:

Article Title: Association study of MCP-1 promoter polymorphisms with the susceptibility and progression of sepsis
Article Snippet: The PCR reaction protocol was as follows: 96°C for 60s; 28 cycles of 96°C for 10s, 55°C for 5s, and 60°C for 30s; 4°C for 120s. .. The products were purified by 1-h incubation with 1U of shrimp alkaline phosphatase (Takara: Otsu, shiga, Japan) at 37°C and 75°C for 15 minutes. .. Then the purified products (0.5μL) were mixed with Lizl20 Size Standard (0.5μL) and HiDi formamide (9μL) and were incubated at 95°C for 5 minutes, and were analyzed using ABIPrism 3730XL genetic sequence analyzer (Applied Biosystems, Foster City, CA, USA) and GeneMapper 4.1 (Applied Biosystems, Carlsbad, CA, USA).

Article Title: RFamidergic neurons in the olfactory centers of the terrestrial slug Limax
Article Snippet: The amplicons were purified using the Wizard SV Gel and PCR clean-up system (Promega, Madison, WI, USA), and phosphorylated by T4 polynucleotide kinase (Takara, Ohtsu, Japan). .. The amplicons were ligated into a cloning vector pBluescriptII (KS) that had been digested with EcoRV followed by dephosphorylation by shrimp alkaline phosphatase (Takara).

Article Title: An ADAM10 promoter polymorphism is a functional variant in severe sepsis patients and confers susceptibility to the development of sepsis
Article Snippet: The PCR reaction protocol was as follows: after denaturation at 95°C for 2 minutes, 11 cycles of DNA amplification were performed using Taq PCR for 20 s at 94°C (denaturation), 40 s at 65°C (annealing), and 90 s at 72°C (extension), followed by 24 cycles of DNA amplification for 20 s at 94°C (denaturation), 30 s at 59°C (annealing), and 90 s at 72°C (extension). .. The extension products were purified for 1 h at 37°C via incubation in 1 U of shrimp alkaline phosphatase (Takara, Otsu, Shiga, Japan), followed by incubation for 15 minutes at 75°C to inactivate this enzyme. .. Additionally, 0.5 μL of the purified products was mixed with 9 μL of Hi-Di formamide and 0.5 μL of Liz120 Size Standard.

Article Title: A novel somatic mutation of SIN3A detected in breast cancer by whole-exome sequencing enhances cell proliferation through ERα expression
Article Snippet: The PCR products were incubated at 37 °C for 20 min in a mixture of 5 U of exonuclease I (NewEngland Biolabs) and shrimp alkaline phosphatase (TaKaRa Bio. .. Inc.), and were purified using a BigDye® Xterminator™ purification kit (Thermo Fisher Scientific).

Article Title: Triazole linking for preparation of a next-generation sequencing library from single-stranded DNA
Article Snippet: Any contaminating RNA was digested with 250 units of RNase If (New England BioLabs) and the 3′-phosphate of the MNase-treated DNA was removed with 5 units of shrimp alkaline phosphatase (Takara Bio Inc.). .. The final DNA purification was accomplished using a QIAQuick PCR purification kit (Qiagen) according to the manufacturer's instructions.

Article Title: Association of Apolipoprotein C3 Genetic Polymorphisms with the Risk of Ischemic Stroke in the Northern Chinese Han Population
Article Snippet: The SNaPshot reaction procedures were as follows: (1) initial denaturation at 96°C for 1 min; (2) denaturation at 96°C for 10 s; (3) annealing at 55°C for 5 s; and (4) extension at 60°C for 30 s, for a total of 28 cycles. .. The extension products were purified through a 1-h incubation with 1 U of shrimp alkaline phosphatase (Takara: Otsu, Shiga, Japan) at 37°C, followed by incubation at 75°C for 15 min to inactivate the enzyme. .. The purified products (0.5 μL) were mixed with 9 μL of Hi—Di and 0.5 μL of the Liz120 size standard (Applied Biosystems Co., Ltd.).

Article Title: The association between apolipoprotein A1-C3-A5 gene cluster promoter polymorphisms and risk of ischemic stroke in the northern Chinese Han population
Article Snippet: The SNaPshot reaction procedures were as follows: initial denaturation at 96℃ for 1 min, then 28 cycles of denaturation at 96℃ for 10 s, annealing at 55℃ for 5 s, and extension at 60℃ for 30 s. Amplified samples were stored at 4℃. .. Extension products were purified over a 1-h incubation period with 1 U of shrimp alkaline phosphatase (Takara, Otsu, Shiga, Japan) at 37℃, followed by incubation at 75℃ for 15 min to inactivate the enzyme. .. Purified products (0.5 µL) were mixed with 9 µL of Hi–Di and 0.5 µL of the Liz120 size standard (Applied Biosystems Co., Ltd.).

Polymerase Chain Reaction:

Article Title: Satellite RNAs promote pancreatic oncogenic processes via the dysfunction of YBX1
Article Snippet: Total DNA templates including mtDNA were isolated from K512-vector and K512-EF1α-MajSAT cells using the QIAamp DNA Mini Kit (Qiagen), and PCR was performed with LA-Taq polymerase (TaKaRa) mixed with Pfu turbo DNA Polymerase (Stratagene). .. The pcDNA 3.1(−) vector was digested at the BamHI site and dephosphorylated with Shrimp Alkaline Phosphatase (TaKaRa) at 37 °C for 15 min. Amplified fragments and linearized vector were incubated with 5 × InFusion HD Enzyme premix at 50 °C for 15 min and subsequently transformed into ECOS Competent E. coli DH5α.

Article Title: Association study of MCP-1 promoter polymorphisms with the susceptibility and progression of sepsis
Article Snippet: The PCR reaction protocol was as follows: 96°C for 60s; 28 cycles of 96°C for 10s, 55°C for 5s, and 60°C for 30s; 4°C for 120s. .. The products were purified by 1-h incubation with 1U of shrimp alkaline phosphatase (Takara: Otsu, shiga, Japan) at 37°C and 75°C for 15 minutes.

Article Title: RFamidergic neurons in the olfactory centers of the terrestrial slug Limax
Article Snippet: The amplicons were purified using the Wizard SV Gel and PCR clean-up system (Promega, Madison, WI, USA), and phosphorylated by T4 polynucleotide kinase (Takara, Ohtsu, Japan). .. The amplicons were ligated into a cloning vector pBluescriptII (KS) that had been digested with EcoRV followed by dephosphorylation by shrimp alkaline phosphatase (Takara).

Article Title: Single Nucleotide Polymorphism (rs4932178) in the P1 Promoter of FURIN Is Not Prognostic to Colon Cancer
Article Snippet: Multiplex PCR was performed in a 5 μ L volume containing MegaMix Gold (Cambio), 5–10 ng of genomic DNA, and 100 nM of each PCR primer. .. Thermocycling was performed at 95°C for 15 min, followed by 45 cycles of 94°C for 20 s, 56°C for 30 s, and 72°C for 60 s, followed by a final extension of 72°C for 3 min. Unincorporated dNTPs were deactivated using 0.3 units of shrimp alkaline phosphatase (Clontech Laboratories, Inc., Mountain View, USA) at 37° for 40 min and primer extension was carried out using 7–14 μ M of each primer extension probe (depending on the mass), 1 unit of iPLEX termination mix, and 1 unit of iPLEX enzyme.

Article Title: An ADAM10 promoter polymorphism is a functional variant in severe sepsis patients and confers susceptibility to the development of sepsis
Article Snippet: The PCR reaction protocol was as follows: after denaturation at 95°C for 2 minutes, 11 cycles of DNA amplification were performed using Taq PCR for 20 s at 94°C (denaturation), 40 s at 65°C (annealing), and 90 s at 72°C (extension), followed by 24 cycles of DNA amplification for 20 s at 94°C (denaturation), 30 s at 59°C (annealing), and 90 s at 72°C (extension). .. The extension products were purified for 1 h at 37°C via incubation in 1 U of shrimp alkaline phosphatase (Takara, Otsu, Shiga, Japan), followed by incubation for 15 minutes at 75°C to inactivate this enzyme.

Article Title: A novel somatic mutation of SIN3A detected in breast cancer by whole-exome sequencing enhances cell proliferation through ERα expression
Article Snippet: Genome DNAs extracted from breast cancer tissues were amplified by PCR using primers 5′-TGCGTCCACAGTACCAACC-3′ and 5′-ATTTGTTCCCAAGCCGAACG-3′ for the region from 75684340 to 75684709 on chromosome 15 including the SIN3A mutation. .. The PCR products were incubated at 37 °C for 20 min in a mixture of 5 U of exonuclease I (NewEngland Biolabs) and shrimp alkaline phosphatase (TaKaRa Bio. .. Inc.), and were purified using a BigDye® Xterminator™ purification kit (Thermo Fisher Scientific).

Article Title: In vivo reprogramming drives Kras-induced cancer development
Article Snippet: Colony PCR was performed using Go taq Master Mix (Promega) and ascertained ligation of the cassettes. .. After cleanup of the PCR products by exonuclease I (New England Biolabs) and shrimp alkaline phosphatase (Takara Bio), the sequence reaction was performed using M13 Rv primer (5′-CAGGAAACAGCTATGAC-3′) and was sequenced with ABI 3500 xL (Applied Biosystems). .. Methylation rates were measured using Quantification tool for Methylation Analysis (QUMA) software (Riken).

Article Title: The association between apolipoprotein A1-C3-A5 gene cluster promoter polymorphisms and risk of ischemic stroke in the northern Chinese Han population
Article Snippet: SNaPshot reactions were performed in a final volume of 10 µL, including 5 µL of the SNaPshot Multiplex Kit (ABI), 1 µL of primer mix, 2 µL of water, and 2 µL of templates, which consisted of the multiplex PCR products for the different genes. .. Extension products were purified over a 1-h incubation period with 1 U of shrimp alkaline phosphatase (Takara, Otsu, Shiga, Japan) at 37℃, followed by incubation at 75℃ for 15 min to inactivate the enzyme.

Article Title: Mutation analysis of the EGFR pathway genes, EGFR, RAS, PIK3CA, BRAF, and AKT1, in salivary gland adenoid cystic carcinoma
Article Snippet: Primers were designed to amplify DNA fragments containing codons 746–750 and 858 for EGFR ; codons 12, 13, and 61 for KRAS and HRAS ; codons 12 and 61 for NRAS ; codons 542, 545, and 1047 for PIK3CA; codon 600 for BRAF; and codon 17 for AKT1 ( ). .. The PCR products were treated with exonuclease I (Exo-I, Takara Bio, Kusatsu, Japan) and shrimp alkaline phosphatase (SAP, Takara Bio) to remove unincorporated primers and deoxynucleotide triphosphates. .. A single-base extension multiplex assay was performed using a SNaPshot Multiplex Kit (Applied Biosystems, Foster City, CA, USA) according to the manufacturer's instructions.

Article Title: A new genus and species of octocoral with aragonite calcium-carbonate skeleton ( Octocorallia, Helioporacea) from Okinawa, Japan
Article Snippet: Amplified products were visualized with 1.0% agarose gel electrophoresis. .. Positive PCR products were cleaned up by Exonuclease I and Shrimp Alkaline Phosphatase (Takara, Shiga, Japan) before sequencing. .. Sequencing was performed by Fasmac (Kanagawa, Japan).

Article Title: A retrovirus packages nascent host noncoding RNAs from a novel surveillance pathway
Article Snippet: For 3′ RACE, RNA was first incubated with 10 mM HCl for 4 h on ice followed by incubation with 5 U of shrimp alkaline phosphatase (Takara) to remove 3′ cyclic phosphates. .. After phenol-chloroform extraction, the RNA was ligated to RNA oligonucleotide L3, treated with DNase I, reverse-transcribed using SuperScript III and oligonucleotide P3, and amplified with oligonucleotides P3 and U6 (Supplemental Table S3).

Article Title: Serotyping of Streptococcus pneumoniae Based on Capsular Genes Polymorphisms
Article Snippet: The PCR program consisted in the following steps: 60 s at 94°C followed by 39 cycles of 30 s at 94°C, 30 s at 55°C and 90 s at 72°C. .. Finally, the reaction was incubated at 72°C for 3 min. Then, 3 units of shrimp alkaline phosphatase (Clontech, Mountain View, CA), 7.5 units of exonuclease (Clontech) and 0.25 µl of 50X titanium DNA polymerase (Clontech) were added to the solution, which was incubated at 37°C for 20 min and at 94°C for 10 min.

Article Title: First evidence of asexual recruitment of Pocillopora acuta in Okinawa Island using genotypic identification
Article Snippet: The PCR protocol consisted of 94 °C for 1 min, followed by 40 cycles at 94 °C for 30 s, 53 °C for 30 s, and 72 °C for 75 s, with a final extension at 72 °C for 5 min using thermal cycler, Thermal Cycler Dice Touch TP350 (Takara, Kusatsu, Japan). .. PCR products were cleaned with Exonuclease I (Takara) and Shrimp Alkaline Phosphatase (Takara). .. Sequencing was performed by Macrogen Japan, and sequences obtained were aligned with mtORF sequences reported in and to identify the genetic species of Pocillopora and Stylophora , respectively.

De-Phosphorylation Assay:

Article Title: RFamidergic neurons in the olfactory centers of the terrestrial slug Limax
Article Snippet: The amplicons were purified using the Wizard SV Gel and PCR clean-up system (Promega, Madison, WI, USA), and phosphorylated by T4 polynucleotide kinase (Takara, Ohtsu, Japan). .. The amplicons were ligated into a cloning vector pBluescriptII (KS) that had been digested with EcoRV followed by dephosphorylation by shrimp alkaline phosphatase (Takara). .. Competent E. coli. (Dh5α) was transformed with the ligated product, and the plasmids were obtained from the transformed E. coli .

Plasmid Preparation:

Article Title: Satellite RNAs promote pancreatic oncogenic processes via the dysfunction of YBX1
Article Snippet: The primers used were as follows: Fw: 5′-CTGGACTAGTGGATCCTCTTTTTATTTTGGCCTACTTT-3′, Rv: 5′-TACCGAGCTCGGATCCCATCTAAGCATTTTCAGTGC-3′ (ref. ). .. The pcDNA 3.1(−) vector was digested at the BamHI site and dephosphorylated with Shrimp Alkaline Phosphatase (TaKaRa) at 37 °C for 15 min. Amplified fragments and linearized vector were incubated with 5 × InFusion HD Enzyme premix at 50 °C for 15 min and subsequently transformed into ECOS Competent E. coli DH5α. .. After 16 h, at least twenty colonies from each sample were picked up, and cloned vectors were collected using the QIAprep 96 Turbo Miniprep Kit (Qiagen).

Article Title: RFamidergic neurons in the olfactory centers of the terrestrial slug Limax
Article Snippet: The amplicons were purified using the Wizard SV Gel and PCR clean-up system (Promega, Madison, WI, USA), and phosphorylated by T4 polynucleotide kinase (Takara, Ohtsu, Japan). .. The amplicons were ligated into a cloning vector pBluescriptII (KS) that had been digested with EcoRV followed by dephosphorylation by shrimp alkaline phosphatase (Takara). .. Competent E. coli. (Dh5α) was transformed with the ligated product, and the plasmids were obtained from the transformed E. coli .

Article Title: A heavy metal P-type ATPase OsHMA4 prevents copper accumulation in rice grain
Article Snippet: The coding region of OsHMA4 linked with the nopaline synthase (NOS) terminator was amplified using the plasmid GFP-OsHMA4 (described below) as the template. .. The fragment was digested with Bam HI and Bgl II and then subcloned into the binary vector pTF101.1 (ref. ), which was digested with Bam HI and dephosphorylated with Shrimp Alkaline Phosphatase (Takara). .. The 3,016 bp region upstream of the initiation codon of OsHMA4 was amplified by PCR from the genomic DNA.

Article Title: In vivo reprogramming drives Kras-induced cancer development
Article Snippet: The target sequence was cloned by Ex Taq HS (Takara Bio) and ligated into pCR4-Topo vector using Topo cloning technology (Invitrogen). .. After cleanup of the PCR products by exonuclease I (New England Biolabs) and shrimp alkaline phosphatase (Takara Bio), the sequence reaction was performed using M13 Rv primer (5′-CAGGAAACAGCTATGAC-3′) and was sequenced with ABI 3500 xL (Applied Biosystems).

Software:

Article Title: Single Nucleotide Polymorphism (rs4932178) in the P1 Promoter of FURIN Is Not Prognostic to Colon Cancer
Article Snippet: Thermocycling was performed at 95°C for 15 min, followed by 45 cycles of 94°C for 20 s, 56°C for 30 s, and 72°C for 60 s, followed by a final extension of 72°C for 3 min. Unincorporated dNTPs were deactivated using 0.3 units of shrimp alkaline phosphatase (Clontech Laboratories, Inc., Mountain View, USA) at 37° for 40 min and primer extension was carried out using 7–14 μ M of each primer extension probe (depending on the mass), 1 unit of iPLEX termination mix, and 1 unit of iPLEX enzyme. .. Thermocycling was performed at 95°C for 15 min, followed by 45 cycles of 94°C for 20 s, 56°C for 30 s, and 72°C for 60 s, followed by a final extension of 72°C for 3 min. Unincorporated dNTPs were deactivated using 0.3 units of shrimp alkaline phosphatase (Clontech Laboratories, Inc., Mountain View, USA) at 37° for 40 min and primer extension was carried out using 7–14 μ M of each primer extension probe (depending on the mass), 1 unit of iPLEX termination mix, and 1 unit of iPLEX enzyme.

Electrophoresis:

Article Title: Association of Apolipoprotein C3 Genetic Polymorphisms with the Risk of Ischemic Stroke in the Northern Chinese Han Population
Article Snippet: The extension products were purified through a 1-h incubation with 1 U of shrimp alkaline phosphatase (Takara: Otsu, Shiga, Japan) at 37°C, followed by incubation at 75°C for 15 min to inactivate the enzyme. .. The purified products (0.5 μL) were mixed with 9 μL of Hi—Di and 0.5 μL of the Liz120 size standard (Applied Biosystems Co., Ltd.).

Article Title: The association between apolipoprotein A1-C3-A5 gene cluster promoter polymorphisms and risk of ischemic stroke in the northern Chinese Han population
Article Snippet: Extension products were purified over a 1-h incubation period with 1 U of shrimp alkaline phosphatase (Takara, Otsu, Shiga, Japan) at 37℃, followed by incubation at 75℃ for 15 min to inactivate the enzyme. .. Purified products (0.5 µL) were mixed with 9 µL of Hi–Di and 0.5 µL of the Liz120 size standard (Applied Biosystems Co., Ltd.).

Multiplex Assay:

Article Title: Association study of MCP-1 promoter polymorphisms with the susceptibility and progression of sepsis
Article Snippet: The SNaPshot PCR reaction consisted of SNaPshot Multiplex Kitreagent (5μL), templates (4μL) and primer mix (4μl). .. The products were purified by 1-h incubation with 1U of shrimp alkaline phosphatase (Takara: Otsu, shiga, Japan) at 37°C and 75°C for 15 minutes.

Article Title: Single Nucleotide Polymorphism (rs4932178) in the P1 Promoter of FURIN Is Not Prognostic to Colon Cancer
Article Snippet: Multiplex PCR was performed in a 5 μ L volume containing MegaMix Gold (Cambio), 5–10 ng of genomic DNA, and 100 nM of each PCR primer. .. Thermocycling was performed at 95°C for 15 min, followed by 45 cycles of 94°C for 20 s, 56°C for 30 s, and 72°C for 60 s, followed by a final extension of 72°C for 3 min. Unincorporated dNTPs were deactivated using 0.3 units of shrimp alkaline phosphatase (Clontech Laboratories, Inc., Mountain View, USA) at 37° for 40 min and primer extension was carried out using 7–14 μ M of each primer extension probe (depending on the mass), 1 unit of iPLEX termination mix, and 1 unit of iPLEX enzyme.

Article Title: An ADAM10 promoter polymorphism is a functional variant in severe sepsis patients and confers susceptibility to the development of sepsis
Article Snippet: Polymerase chain reaction (PCR) was conducted in a final volume of 10 μL, which contained 5 μL of the SNaPshot Multiplex Kit reagent (ABI), 2 μL of the templates containing the multiplex PCR products, 1 μL of the primer mix and 2 μL of water. .. The extension products were purified for 1 h at 37°C via incubation in 1 U of shrimp alkaline phosphatase (Takara, Otsu, Shiga, Japan), followed by incubation for 15 minutes at 75°C to inactivate this enzyme.

Article Title: Association of Apolipoprotein C3 Genetic Polymorphisms with the Risk of Ischemic Stroke in the Northern Chinese Han Population
Article Snippet: The SNaPshot reactions were executed in a final volume of 10 μL, including 5 μL of the SNaPshot Multiplex Kit (ABI), 1 μL primer mix, 2 μL water, and 2 μL templates, which consisted of the multiplex PCR products for the different genes. .. The extension products were purified through a 1-h incubation with 1 U of shrimp alkaline phosphatase (Takara: Otsu, Shiga, Japan) at 37°C, followed by incubation at 75°C for 15 min to inactivate the enzyme.

Article Title: The association between apolipoprotein A1-C3-A5 gene cluster promoter polymorphisms and risk of ischemic stroke in the northern Chinese Han population
Article Snippet: SNaPshot reactions were performed in a final volume of 10 µL, including 5 µL of the SNaPshot Multiplex Kit (ABI), 1 µL of primer mix, 2 µL of water, and 2 µL of templates, which consisted of the multiplex PCR products for the different genes. .. Extension products were purified over a 1-h incubation period with 1 U of shrimp alkaline phosphatase (Takara, Otsu, Shiga, Japan) at 37℃, followed by incubation at 75℃ for 15 min to inactivate the enzyme.

Article Title: Mutation analysis of the EGFR pathway genes, EGFR, RAS, PIK3CA, BRAF, and AKT1, in salivary gland adenoid cystic carcinoma
Article Snippet: Paragraph title: SNaPshot multiplex assay for point mutations ... The PCR products were treated with exonuclease I (Exo-I, Takara Bio, Kusatsu, Japan) and shrimp alkaline phosphatase (SAP, Takara Bio) to remove unincorporated primers and deoxynucleotide triphosphates.

Article Title: Serotyping of Streptococcus pneumoniae Based on Capsular Genes Polymorphisms
Article Snippet: The amplification solution was composed of 1X Platinum Taq buffer, 0.2 µM dNTPs, 1.5 mM MgCl2, 1µl multiplex PCR primer mix, 0.5 units of Platinum Taq DNA polymerase (Invitrogen, Burlington, ON, Canada), and 2.5 µl of cDNA, in a final volume of 20 µl. .. Finally, the reaction was incubated at 72°C for 3 min. Then, 3 units of shrimp alkaline phosphatase (Clontech, Mountain View, CA), 7.5 units of exonuclease (Clontech) and 0.25 µl of 50X titanium DNA polymerase (Clontech) were added to the solution, which was incubated at 37°C for 20 min and at 94°C for 10 min.

Agarose Gel Electrophoresis:

Article Title: A new genus and species of octocoral with aragonite calcium-carbonate skeleton ( Octocorallia, Helioporacea) from Okinawa, Japan
Article Snippet: Positive PCR products were cleaned up by Exonuclease I and Shrimp Alkaline Phosphatase (Takara, Shiga, Japan) before sequencing. .. Positive PCR products were cleaned up by Exonuclease I and Shrimp Alkaline Phosphatase (Takara, Shiga, Japan) before sequencing.

Transgenic Assay:

Article Title: A heavy metal P-type ATPase OsHMA4 prevents copper accumulation in rice grain
Article Snippet: Paragraph title: Transgenic complementation test ... The fragment was digested with Bam HI and Bgl II and then subcloned into the binary vector pTF101.1 (ref. ), which was digested with Bam HI and dephosphorylated with Shrimp Alkaline Phosphatase (Takara).

Spectrophotometry:

Article Title: An ADAM10 promoter polymorphism is a functional variant in severe sepsis patients and confers susceptibility to the development of sepsis
Article Snippet: The purified DNA was quantified in a spectrophotometer and was stored at −80°C until analysis. .. The extension products were purified for 1 h at 37°C via incubation in 1 U of shrimp alkaline phosphatase (Takara, Otsu, Shiga, Japan), followed by incubation for 15 minutes at 75°C to inactivate this enzyme.

Article Title: Association of Apolipoprotein C3 Genetic Polymorphisms with the Risk of Ischemic Stroke in the Northern Chinese Han Population
Article Snippet: The DNA purity was measured with spectrophotometry, and the DNA samples were stored at −80°C. .. The extension products were purified through a 1-h incubation with 1 U of shrimp alkaline phosphatase (Takara: Otsu, Shiga, Japan) at 37°C, followed by incubation at 75°C for 15 min to inactivate the enzyme.

Article Title: The association between apolipoprotein A1-C3-A5 gene cluster promoter polymorphisms and risk of ischemic stroke in the northern Chinese Han population
Article Snippet: DNA purity was measured via spectrophotometry, and DNA samples were stored at −80℃. .. Extension products were purified over a 1-h incubation period with 1 U of shrimp alkaline phosphatase (Takara, Otsu, Shiga, Japan) at 37℃, followed by incubation at 75℃ for 15 min to inactivate the enzyme.

Concentration Assay:

Article Title: First evidence of asexual recruitment of Pocillopora acuta in Okinawa Island using genotypic identification
Article Snippet: PCR reaction mixtures (10 µL) contained template DNA ( < 50 ng/µL), AmpliTaq Gold 360 Master Mix (Thermo Fisher Scientific), and primers (final concentration: 2 µM for each primer) for mtORF: FATP6.1 (5′-TTTGGGSATTCGTTTAGCAG-3′) and RORF (5′-SCCAATATGTTAAACASCATGTCA-3′). .. PCR products were cleaned with Exonuclease I (Takara) and Shrimp Alkaline Phosphatase (Takara).

DNA Purification:

Article Title: Association of Apolipoprotein C3 Genetic Polymorphisms with the Risk of Ischemic Stroke in the Northern Chinese Han Population
Article Snippet: Genomic DNA was extracted from 200 μL of EDTA-anticoagulated peripheral blood using a DNA Purification Kit (Promega, Madison, USA). .. The extension products were purified through a 1-h incubation with 1 U of shrimp alkaline phosphatase (Takara: Otsu, Shiga, Japan) at 37°C, followed by incubation at 75°C for 15 min to inactivate the enzyme.

Staining:

Article Title: Mutation analysis of the EGFR pathway genes, EGFR, RAS, PIK3CA, BRAF, and AKT1, in salivary gland adenoid cystic carcinoma
Article Snippet: Formalin-fixed, paraffin-embedded tumor samples were cut at 4 μm, and tissue sections were deparaffinized and lightly stained with methyl green. .. The PCR products were treated with exonuclease I (Exo-I, Takara Bio, Kusatsu, Japan) and shrimp alkaline phosphatase (SAP, Takara Bio) to remove unincorporated primers and deoxynucleotide triphosphates.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 75
    TaKaRa shrimp alkaline phosphatase
    Shrimp Alkaline Phosphatase, supplied by TaKaRa, used in various techniques. Bioz Stars score: 75/100, based on 0 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/shrimp alkaline phosphatase/product/TaKaRa
    Average 75 stars, based on 0 article reviews
    Price from $9.99 to $1999.99
    shrimp alkaline phosphatase - by Bioz Stars, 2019-12
    75/100 stars
      Buy from Supplier

    Image Search Results