shrimp alkaline phosphatase  (Roche)


Bioz Verified Symbol Roche is a verified supplier
Bioz Manufacturer Symbol Roche manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    Roche shrimp alkaline phosphatase
    Shrimp Alkaline Phosphatase, supplied by Roche, used in various techniques. Bioz Stars score: 93/100, based on 24 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/shrimp alkaline phosphatase/product/Roche
    Average 93 stars, based on 24 article reviews
    Price from $9.99 to $1999.99
    shrimp alkaline phosphatase - by Bioz Stars, 2020-08
    93/100 stars

    Images

    Related Articles

    Polymerase Chain Reaction:

    Article Title: Double‐strand break repair based on short‐homology regions is suppressed under terminal deoxynucleotidyltransferase expression, as revealed by a novel vector system for analysing DNA repair by nonhomologous end joining
    Article Snippet: .. Briefly, a 2‐μl reaction mixture containing 1 μg of PCR products was mixed with 1 μL of ExoSAP reagent containing 0.005 U of exonuclease I (NEB) and 0.0025 U of Shrimp Alkaline Phosphatase (Roche). .. DNA sequences were determined by the Sanger method with the reverse primer 5′‐TTCAGGGTCAGCTTGCCGTA‐3′, on an ABI 3100 capillary DNA sequencer (Life Technologies Japan).

    Article Title: Genetic effect of MTHFR C677T polymorphism on the structural covariance network and white‐matter integrity in Alzheimer's disease
    Article Snippet: .. A multiplex polymerase chain reaction was performed, in which unincorporated double‐stranded nucleotide triphosphate bases were dephosphorylated with shrimp alkaline phosphatase (Hoffman‐LaRoche, Basel) followed by primer extension. .. The purified primer extension reaction was spotted onto a 384‐element silicon chip (SpectroCHIP, Sequenom, San Diego, US) and analyzed in a BrukerBiflex III MALDI‐TOF SpectroREADER mass spectrometer (Sequenom, San Diego, US).

    Multiplex Assay:

    Article Title: Genetic effect of MTHFR C677T polymorphism on the structural covariance network and white‐matter integrity in Alzheimer's disease
    Article Snippet: .. A multiplex polymerase chain reaction was performed, in which unincorporated double‐stranded nucleotide triphosphate bases were dephosphorylated with shrimp alkaline phosphatase (Hoffman‐LaRoche, Basel) followed by primer extension. .. The purified primer extension reaction was spotted onto a 384‐element silicon chip (SpectroCHIP, Sequenom, San Diego, US) and analyzed in a BrukerBiflex III MALDI‐TOF SpectroREADER mass spectrometer (Sequenom, San Diego, US).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 85
    Roche unspecific phosphatase shrimp alkaline phosphatase
    Kinetics analysis of Tyr-48 phosphorylated and dephosphorylated cytochrome c with cytochrome c oxidase (CcO). Increasing amounts of isolated phosphorylated (open squares) and <t>shrimp</t> <t>alkaline</t> <t>phosphatase-treated</t> (closed squares) cytochrome c were added to solubilized CcO. CcO activity was measured with the polarographic method at 25 °C. CcO activity (turnover number, TN) is defined as consumed O 2 [μmoles]/(s · CcO [μmoles]).
    Unspecific Phosphatase Shrimp Alkaline Phosphatase, supplied by Roche, used in various techniques. Bioz Stars score: 85/100, based on 33 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/unspecific phosphatase shrimp alkaline phosphatase/product/Roche
    Average 85 stars, based on 33 article reviews
    Price from $9.99 to $1999.99
    unspecific phosphatase shrimp alkaline phosphatase - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    Image Search Results


    Kinetics analysis of Tyr-48 phosphorylated and dephosphorylated cytochrome c with cytochrome c oxidase (CcO). Increasing amounts of isolated phosphorylated (open squares) and shrimp alkaline phosphatase-treated (closed squares) cytochrome c were added to solubilized CcO. CcO activity was measured with the polarographic method at 25 °C. CcO activity (turnover number, TN) is defined as consumed O 2 [μmoles]/(s · CcO [μmoles]).

    Journal: Biochimica et biophysica acta

    Article Title: Mammalian liver cytochrome c is tyrosine-48 phosphorylated in vivo, inhibiting mitochondrial respiration

    doi: 10.1016/j.bbabio.2008.04.023

    Figure Lengend Snippet: Kinetics analysis of Tyr-48 phosphorylated and dephosphorylated cytochrome c with cytochrome c oxidase (CcO). Increasing amounts of isolated phosphorylated (open squares) and shrimp alkaline phosphatase-treated (closed squares) cytochrome c were added to solubilized CcO. CcO activity was measured with the polarographic method at 25 °C. CcO activity (turnover number, TN) is defined as consumed O 2 [μmoles]/(s · CcO [μmoles]).

    Article Snippet: Unspecific phosphatase shrimp alkaline phosphatase (10 units, Roche, Indianapolis, IN) was employed to dephosphorylate Cyt c as previously described [ ] using 300 μL of a 40 μM Cyt c solution and overnight incubation at 30 °C.

    Techniques: Isolation, Activity Assay

    Gel and Western analysis of isolated cow liver Cyt c . A, Cyt c was purified under conditions preserving the in vivo phosphorylation status (lane 2) and treated with shrimp alkaline phosphatase (SAP, lane 3). Samples were applied to a 4–12% SDS-PAGE gradient gel and protein bands were detected using the silver staining method. Lane M, protein size marker (kDa); lane 1, Sigma Cyt c ; lane 4, EGF stimulated A431 cell lysate (positive control for Western analysis); lane 5, ovalbumin (negative control for Western analysis). B, for Western analysis, protein samples were applied to SDS-PAGE and subsequently transferred to a nitrocellulose membrane and analyzed using an anti-phosphotyrosine antibody (4G10, Upstate). Purified Cyt c (lane 2) produces a strong signal with the anti-phosphotyrosine antibody, whereas overnight treatment with SAP abolishes the signal (lane 3). Samples in lanes 1 – 5 as denoted in A. Protein sizes are indicated on the left.

    Journal: Biochimica et biophysica acta

    Article Title: Mammalian liver cytochrome c is tyrosine-48 phosphorylated in vivo, inhibiting mitochondrial respiration

    doi: 10.1016/j.bbabio.2008.04.023

    Figure Lengend Snippet: Gel and Western analysis of isolated cow liver Cyt c . A, Cyt c was purified under conditions preserving the in vivo phosphorylation status (lane 2) and treated with shrimp alkaline phosphatase (SAP, lane 3). Samples were applied to a 4–12% SDS-PAGE gradient gel and protein bands were detected using the silver staining method. Lane M, protein size marker (kDa); lane 1, Sigma Cyt c ; lane 4, EGF stimulated A431 cell lysate (positive control for Western analysis); lane 5, ovalbumin (negative control for Western analysis). B, for Western analysis, protein samples were applied to SDS-PAGE and subsequently transferred to a nitrocellulose membrane and analyzed using an anti-phosphotyrosine antibody (4G10, Upstate). Purified Cyt c (lane 2) produces a strong signal with the anti-phosphotyrosine antibody, whereas overnight treatment with SAP abolishes the signal (lane 3). Samples in lanes 1 – 5 as denoted in A. Protein sizes are indicated on the left.

    Article Snippet: Unspecific phosphatase shrimp alkaline phosphatase (10 units, Roche, Indianapolis, IN) was employed to dephosphorylate Cyt c as previously described [ ] using 300 μL of a 40 μM Cyt c solution and overnight incubation at 30 °C.

    Techniques: Western Blot, Isolation, Purification, Preserving, In Vivo, SDS Page, Silver Staining, Marker, Positive Control, Negative Control

    IFN induction by NSV vRNAs depends on RIG-I and the 5′ triphosphate group. (A) Verification of knockdowns. Human 293T cells were treated with retroviral shRNA constructs directed against either RIG-I or MDA5, and cotransfected with expression constructs for HA-tagged MDA5 (left panels) or GFP-fused RIG-I (right panels). Western blot analysis using antibodies against the respective fusion tags is shown. Detection of cellular β-tubulin was used as an internal control. (B) Effect of shRNA knockdowns on IFN induction by viral RNAs, using the reporter constructs and RNA transfection protocols as described for Fig. 1A . The negative control shRNA construct (CTRL) targets the heat shock 70 interacting protein and was tested to have no effect on IFN induction (data not shown). (C) Genomic RNAs from ZEBOV and NiV were either mock treated, treated with SAP, or treated with SAP in the presence of the phosphatase inhibitor EDTA. IFN-β reporter assays and RNA transfections were performed as described for Fig. 1A . Mean values and standard deviations from 3 independent experiments are shown.

    Journal: PLoS ONE

    Article Title: Processing of Genome 5? Termini as a Strategy of Negative-Strand RNA Viruses to Avoid RIG-I-Dependent Interferon Induction

    doi: 10.1371/journal.pone.0002032

    Figure Lengend Snippet: IFN induction by NSV vRNAs depends on RIG-I and the 5′ triphosphate group. (A) Verification of knockdowns. Human 293T cells were treated with retroviral shRNA constructs directed against either RIG-I or MDA5, and cotransfected with expression constructs for HA-tagged MDA5 (left panels) or GFP-fused RIG-I (right panels). Western blot analysis using antibodies against the respective fusion tags is shown. Detection of cellular β-tubulin was used as an internal control. (B) Effect of shRNA knockdowns on IFN induction by viral RNAs, using the reporter constructs and RNA transfection protocols as described for Fig. 1A . The negative control shRNA construct (CTRL) targets the heat shock 70 interacting protein and was tested to have no effect on IFN induction (data not shown). (C) Genomic RNAs from ZEBOV and NiV were either mock treated, treated with SAP, or treated with SAP in the presence of the phosphatase inhibitor EDTA. IFN-β reporter assays and RNA transfections were performed as described for Fig. 1A . Mean values and standard deviations from 3 independent experiments are shown.

    Article Snippet: Enzymatic treatments of RNA To remove 5′-terminal phosphates, purified RNAs were treated with 1 U of shrimp alkaline phosphatase (SAP) according to the protocol of the manufacturer (Roche).

    Techniques: shRNA, Construct, Expressing, Western Blot, Transfection, Negative Control