Structured Review

Roche shrimp alkaline phosphatase
Shrimp Alkaline Phosphatase, supplied by Roche, used in various techniques. Bioz Stars score: 91/100, based on 109 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/shrimp alkaline phosphatase/product/Roche
Average 91 stars, based on 109 article reviews
Price from $9.99 to $1999.99
shrimp alkaline phosphatase - by Bioz Stars, 2020-01
91/100 stars

Images

Related Articles

Centrifugation:

Article Title: Extensive phosphorylation of AMPA receptors in neurons
Article Snippet: In some experiments cells were lysed without phosphatase inhibitors and lysates were treated with shrimp alkaline phosphatase (Roche) in the presence of 10 mM MgCl2 at 37 °C overnight. .. Sepharose beads were pelleted by centrifugation at 500 × g at 4 °C.

Amplification:

Article Title: Generating In Vivo Cloning Vectors for Parallel Cloning of Large Gene Clusters by Homologous Recombination
Article Snippet: DNA dephosphorylation was performed using shrimp alkaline phosphatase (Roche, Indianapolis, IN, USA). .. The DNA was amplified using Pyrobest (Takara, Otsu, Shiga, Japan), which is a pfu polymerase, while the large DNAs ( > 10kb) were amplified using KOD-FX polymerase (Toyobo, Osaka, Japan).

Article Title: Diversity of Middle East respiratory syndrome coronaviruses in 109 dromedary camels based on full-genome sequencing, Abu Dhabi, United Arab Emirates
Article Snippet: Fill in PCR and Sanger sequencing analysis Thirty-two pairs of nested PCR assays that span the genome were designed based on alignment of available MERS-CoV genomes., MERS-CoV genomes or partial genomes were amplified as needed to fill the gaps missed by Fluidigm Access Array PCR. .. Positive bands of the expected size that had strong signal and without additional bands were cleaned up using Exonuclease I (New England Biolabs) and Shrimp Alkaline Phosphatase (Roche).

Article Title: Genetic Polymorphisms of Metabolic Enzymes and the Pharmacokinetics of Indapamide in Taiwanese Subjects
Article Snippet: .. After amplification, the unincorporated dNTPs were dephosphorylated by use of shrimp alkaline phosphatase (Hoffman-LaRoche, Basel, Switzerland) followed by primer extension. .. The purified extension reactions were spotted onto a 384-element silicon chip (Sequenom), and analyzed by a Bruker Biflex III MALDI-TOF SpectroREADER mass spectrometer.

Article Title: Analysis of alterative cleavage and polyadenylation by 3? region extraction and deep sequencing
Article Snippet: The resultant RNA was reverse-transcribed to cDNA with Superscript III (Invitrogen), and the cDNA was amplified by 12 cycles of PCR with Phusion high fidelity polymerase (NEB). .. RNA-seq was carried out using essentially the same protocol except that 1) the 3′ end region extraction step using the CU5 T45 oligo was omitted and 2) fragmented RNA was dephosphorylated at the 3′ end with shrimp alkaline phosphatase (Roche) before ligation with adapters.

Synthesized:

Article Title: Quantitative multiplexing analysis of PCR-amplified ribosomal RNA genes by hierarchical oligonucleotide primer extension reaction
Article Snippet: The primers are synthesized and HPLC-purified by Sigma-Proligo, Singapore (Singapore). .. After primer extension reaction, 1 U of shrimp alkaline phosphatase (Roche Applied Science, Penzberg, Germany) is added into the reaction mixture to hydrolyze 5′ phosphate groups of unincorporated dye-terminators, thus eliminating the possible fluorescence signal associated with these unincorporated dye-terminators in post analysis.

Blocking Assay:

Article Title: GSK-3? phosphorylation of functionally distinct tau isoforms has differential, but mild effects
Article Snippet: .. 0N3R, 0N4R, and 1N3R were transferred to PVDF by standard western blotting techniques as described above, and PVDF blots were treated with shrimp alkaline phosphatase (Roche) before blocking, to remove the phosphate groups that interfere with tau 46.1 antibody binding. .. Images of gels and blots were collected and processed by methods described above, except that due to the large concentration of tubulin we were unable to normalize the data to the corresponding band.

Incubation:

Article Title: Diversity of Middle East respiratory syndrome coronaviruses in 109 dromedary camels based on full-genome sequencing, Abu Dhabi, United Arab Emirates
Article Snippet: Positive bands of the expected size that had strong signal and without additional bands were cleaned up using Exonuclease I (New England Biolabs) and Shrimp Alkaline Phosphatase (Roche). .. Samples were incubated at 37 °C for 15 min followed by 80 °C for 15 min to inactivate the Exonuclease and Shrimp Alkaline Phosphatase.

Article Title: Quantitative multiplexing analysis of PCR-amplified ribosomal RNA genes by hierarchical oligonucleotide primer extension reaction
Article Snippet: After primer extension reaction, 1 U of shrimp alkaline phosphatase (Roche Applied Science, Penzberg, Germany) is added into the reaction mixture to hydrolyze 5′ phosphate groups of unincorporated dye-terminators, thus eliminating the possible fluorescence signal associated with these unincorporated dye-terminators in post analysis. .. The mixture is incubated at 37°C for 60 min, and the reaction is stopped by thermal denaturation at 85°C for 10 min. Alternatively, to shorten the experiment time, the HOPE products can be purified using Microcon-YM3 spin column (Millipore). lists all the primers used.

Article Title: Regulatory Interactions of a Virulence-Associated Serine/Threonine Phosphatase-Kinase Pair in Bacillus anthracis ▿
Article Snippet: Dephosphorylation reactions of 2 μM BA-Stk1cat were initiated by the addition of equimolar amounts (5 μM) of either purified BA-Stp1, the D18A mutant, or a control of shrimp alkaline phosphatase (Roche) diluted in reaction buffer. .. Reaction mixtures were incubated at 37°C, stopped at 5, 15, and 30 min with the addition of 4× SDS-Laemmli buffer, and boiled for 5 min.

Article Title: mKast is dispensable for normal development and sexual maturation of the male European honeybee
Article Snippet: Each larva or embryo was homogenized in lysis buffer (5 mM Tris-HCl, pH 8.5, containing 100 mM KCl, 2.5 mM MgCl2 , 1%(v/v) NP40, 0.4 M sucrose, and 200 μg/ml proteinase K) in a plastic tube, and incubated at 66 °C for 2 h, followed by 92 °C for 10 min. PCR was performed to amplify the genomic region around the sgRNA target site using PrimeSTAR Max Premix (Takara, Japan) and gene-specific primers (forward: TGATGAGTTGAGAGAGGGTCG, reverse: AGTTCTGACAAACAACGCTCG). .. The PCR products were then treated with Exonuclease I (Wako, Japan) and Shrimp Alkaline Phosphatase (Roche), and the sequences were determined (Fasmac, Japan).

Article Title: GSK-3? phosphorylation of functionally distinct tau isoforms has differential, but mild effects
Article Snippet: Phosphorylated microtubule binding Individual tau isoform phosphorylation reactions (92 μL), containing 18.11 μM final concentration of tau, 0.018 U GSK-3β per pmol of tau in buffer containing 40 mM HEPES, pH 7.64, 5 mM EGTA, 3 mM MgCl2 , and 2 mM ATP were incubated for 20 hours at 30°C. .. 0N3R, 0N4R, and 1N3R were transferred to PVDF by standard western blotting techniques as described above, and PVDF blots were treated with shrimp alkaline phosphatase (Roche) before blocking, to remove the phosphate groups that interfere with tau 46.1 antibody binding.

Article Title: Genetic polymorphisms of the drug-metabolizing enzyme CYP2J2 in a Tibetan population
Article Snippet: .. PCR products were incubated with 0.5 μL shrimp alkaline phosphatase (Roche Diagnostics, Basel, Switzerland), 8 μL HotStar PCR product, and 1.5 μL deionized water (to a total volume of 10 μL), at 37°C for 30 minutes, followed by heat inactivation at 80°C for 15 minutes. .. Purified PCR products were directly sequenced using the ABI Prism BigDye Terminator Cycle Sequencing Kit version 3.1 (Applied Biosystems; Thermo Fisher Scientific, Inc., Waltham, MA) using an ABI Prism 3100 sequencer (Applied Biosystems, Thermo Fisher Scientific, Inc.).

Article Title: Neutralizing blood-borne polyphosphate in vivo provides safe thromboprotection
Article Snippet: Heparin (10 μg ml−1 , Sigma-Aldrich) was incubated with PPX or heparinase I (1 U ml−1 , Sigma-Aldrich), analysed on a 10% polyacrylamide TBE-urea (7 M) and visualized with negative DAPI technique. .. ATP (1 μM) was treated with PPX (0–10 μg ml−1 ) or shrimp alkaline phosphatase (0–2.3 μg ml−1 , Roche), and ATP was quantified using a luciferase-based bioluminescence assay according to the instructions from the ATP determination kit (Invitrogen).

Luciferase:

Article Title: Neutralizing blood-borne polyphosphate in vivo provides safe thromboprotection
Article Snippet: .. ATP (1 μM) was treated with PPX (0–10 μg ml−1 ) or shrimp alkaline phosphatase (0–2.3 μg ml−1 , Roche), and ATP was quantified using a luciferase-based bioluminescence assay according to the instructions from the ATP determination kit (Invitrogen). ..

In Silico:

Article Title: Genetic Polymorphisms of Metabolic Enzymes and the Pharmacokinetics of Indapamide in Taiwanese Subjects
Article Snippet: The primer specificity and the generated amplicons were checked by use of BLAST and UCSC In silico PCR, respectively. .. After amplification, the unincorporated dNTPs were dephosphorylated by use of shrimp alkaline phosphatase (Hoffman-LaRoche, Basel, Switzerland) followed by primer extension.

Mass Spectrometry:

Article Title: Genetic Polymorphisms of Metabolic Enzymes and the Pharmacokinetics of Indapamide in Taiwanese Subjects
Article Snippet: Matrix-assisted laser desorption and ionization-time of flight (MALDI-TOF) mass spectrometry (SEQUENOM MassARRAY system, Sequenom, San Diego, CA, USA) was used to identify the SNPs ( ). .. After amplification, the unincorporated dNTPs were dephosphorylated by use of shrimp alkaline phosphatase (Hoffman-LaRoche, Basel, Switzerland) followed by primer extension.

Article Title: Association between RAGE variants and the susceptibility to atherosclerotic lesions in Chinese Han population
Article Snippet: Genotyping The 25 tagSNPs of the RAGE gene in samples from the CAD and control patients were analyzed by matrix-assisted laser desorption time of flight (MALDI-TOF) mass spectrometry. .. Polymerase chain reaction (PCR) was generally adopted ( ); however, the phosphorylation state was also analyzed using shrimp alkaline phosphatase (Hoffman-La Roche, Basel, Switzerland) ( ).

Western Blot:

Article Title: Regulatory Interactions of a Virulence-Associated Serine/Threonine Phosphatase-Kinase Pair in Bacillus anthracis ▿
Article Snippet: Paragraph title: Western blot analysis of dephosphorylation of BA-Stk1cat . ... Dephosphorylation reactions of 2 μM BA-Stk1cat were initiated by the addition of equimolar amounts (5 μM) of either purified BA-Stp1, the D18A mutant, or a control of shrimp alkaline phosphatase (Roche) diluted in reaction buffer.

Article Title: Extensive phosphorylation of AMPA receptors in neurons
Article Snippet: In some experiments cells were lysed without phosphatase inhibitors and lysates were treated with shrimp alkaline phosphatase (Roche) in the presence of 10 mM MgCl2 at 37 °C overnight. .. In some experiments cells were lysed without phosphatase inhibitors and lysates were treated with shrimp alkaline phosphatase (Roche) in the presence of 10 mM MgCl2 at 37 °C overnight.

Article Title: GSK-3? phosphorylation of functionally distinct tau isoforms has differential, but mild effects
Article Snippet: .. 0N3R, 0N4R, and 1N3R were transferred to PVDF by standard western blotting techniques as described above, and PVDF blots were treated with shrimp alkaline phosphatase (Roche) before blocking, to remove the phosphate groups that interfere with tau 46.1 antibody binding. .. Images of gels and blots were collected and processed by methods described above, except that due to the large concentration of tubulin we were unable to normalize the data to the corresponding band.

Derivative Assay:

Article Title: mKast is dispensable for normal development and sexual maturation of the male European honeybee
Article Snippet: To identify mosaic queens, drone larvae or embryos (approximately 40 individuals) derived from candidate mosaic queens were collected. .. The PCR products were then treated with Exonuclease I (Wako, Japan) and Shrimp Alkaline Phosphatase (Roche), and the sequences were determined (Fasmac, Japan).

High Performance Liquid Chromatography:

Article Title: Quantitative multiplexing analysis of PCR-amplified ribosomal RNA genes by hierarchical oligonucleotide primer extension reaction
Article Snippet: The primers are synthesized and HPLC-purified by Sigma-Proligo, Singapore (Singapore). .. After primer extension reaction, 1 U of shrimp alkaline phosphatase (Roche Applied Science, Penzberg, Germany) is added into the reaction mixture to hydrolyze 5′ phosphate groups of unincorporated dye-terminators, thus eliminating the possible fluorescence signal associated with these unincorporated dye-terminators in post analysis.

Ligation:

Article Title: Analysis of alterative cleavage and polyadenylation by 3? region extraction and deep sequencing
Article Snippet: .. RNA-seq was carried out using essentially the same protocol except that 1) the 3′ end region extraction step using the CU5 T45 oligo was omitted and 2) fragmented RNA was dephosphorylated at the 3′ end with shrimp alkaline phosphatase (Roche) before ligation with adapters. .. CLIP-seq Our CLIP-seq method was largely based on the protocol used by Wang et al. with some minor modifications.

Protease Inhibitor:

Article Title: Extensive phosphorylation of AMPA receptors in neurons
Article Snippet: Following experimental treatment, neurons were lysed in lysis buffer [1% Triton X-100, 0.5% sodium deoxycholate, 0.02% SDS, 50 mM NaF, 5 mM sodium pyrophosphate, 1 mM EDTA, 200 nM okadaic acid, protease inhibitor mixture (Roche), in PBS]. .. In some experiments cells were lysed without phosphatase inhibitors and lysates were treated with shrimp alkaline phosphatase (Roche) in the presence of 10 mM MgCl2 at 37 °C overnight.

Generated:

Article Title: Genetic Polymorphisms of Metabolic Enzymes and the Pharmacokinetics of Indapamide in Taiwanese Subjects
Article Snippet: The primer specificity and the generated amplicons were checked by use of BLAST and UCSC In silico PCR, respectively. .. After amplification, the unincorporated dNTPs were dephosphorylated by use of shrimp alkaline phosphatase (Hoffman-LaRoche, Basel, Switzerland) followed by primer extension.

DNA Sequencing:

Article Title: Genetic polymorphisms of the drug-metabolizing enzyme CYP2J2 in a Tibetan population
Article Snippet: Paragraph title: 2.2. DNA sequencing ... PCR products were incubated with 0.5 μL shrimp alkaline phosphatase (Roche Diagnostics, Basel, Switzerland), 8 μL HotStar PCR product, and 1.5 μL deionized water (to a total volume of 10 μL), at 37°C for 30 minutes, followed by heat inactivation at 80°C for 15 minutes.

Sequencing:

Article Title: Diversity of Middle East respiratory syndrome coronaviruses in 109 dromedary camels based on full-genome sequencing, Abu Dhabi, United Arab Emirates
Article Snippet: Paragraph title: Fill in PCR and Sanger sequencing analysis ... Positive bands of the expected size that had strong signal and without additional bands were cleaned up using Exonuclease I (New England Biolabs) and Shrimp Alkaline Phosphatase (Roche).

Article Title: Genetic Polymorphisms of Metabolic Enzymes and the Pharmacokinetics of Indapamide in Taiwanese Subjects
Article Snippet: Paragraph title: Genomic DNA Isolation, Genotyping, and Sequencing ... After amplification, the unincorporated dNTPs were dephosphorylated by use of shrimp alkaline phosphatase (Hoffman-LaRoche, Basel, Switzerland) followed by primer extension.

Article Title: Analysis of alterative cleavage and polyadenylation by 3? region extraction and deep sequencing
Article Snippet: We designed adapter sequences so that the RNA fragments can be sequenced from the 5′ end (forward sequencing) or from the 3′ end (reverse sequencing). .. RNA-seq was carried out using essentially the same protocol except that 1) the 3′ end region extraction step using the CU5 T45 oligo was omitted and 2) fragmented RNA was dephosphorylated at the 3′ end with shrimp alkaline phosphatase (Roche) before ligation with adapters.

Article Title: Genetic polymorphisms of the drug-metabolizing enzyme CYP2J2 in a Tibetan population
Article Snippet: PCR products were incubated with 0.5 μL shrimp alkaline phosphatase (Roche Diagnostics, Basel, Switzerland), 8 μL HotStar PCR product, and 1.5 μL deionized water (to a total volume of 10 μL), at 37°C for 30 minutes, followed by heat inactivation at 80°C for 15 minutes. .. Purified PCR products were directly sequenced using the ABI Prism BigDye Terminator Cycle Sequencing Kit version 3.1 (Applied Biosystems; Thermo Fisher Scientific, Inc., Waltham, MA) using an ABI Prism 3100 sequencer (Applied Biosystems, Thermo Fisher Scientific, Inc.).

Binding Assay:

Article Title: Regulatory Interactions of a Virulence-Associated Serine/Threonine Phosphatase-Kinase Pair in Bacillus anthracis ▿
Article Snippet: Dephosphorylation reactions of 2 μM BA-Stk1cat were initiated by the addition of equimolar amounts (5 μM) of either purified BA-Stp1, the D18A mutant, or a control of shrimp alkaline phosphatase (Roche) diluted in reaction buffer. .. Subsequently, 10-μl portions of the reaction products were separated on a 10% SDS-PAGE gel and transferred to a polyvinylidene difluoride (PVDF) membrane, which was probed with a 1:1,000 concentration of Phospho-(Ser) 14-3-3 binding motif antibody (Cell Signaling).

Article Title: GSK-3? phosphorylation of functionally distinct tau isoforms has differential, but mild effects
Article Snippet: .. 0N3R, 0N4R, and 1N3R were transferred to PVDF by standard western blotting techniques as described above, and PVDF blots were treated with shrimp alkaline phosphatase (Roche) before blocking, to remove the phosphate groups that interfere with tau 46.1 antibody binding. .. Images of gels and blots were collected and processed by methods described above, except that due to the large concentration of tubulin we were unable to normalize the data to the corresponding band.

DNA Extraction:

Article Title: Genetic Polymorphisms of Metabolic Enzymes and the Pharmacokinetics of Indapamide in Taiwanese Subjects
Article Snippet: Paragraph title: Genomic DNA Isolation, Genotyping, and Sequencing ... After amplification, the unincorporated dNTPs were dephosphorylated by use of shrimp alkaline phosphatase (Hoffman-LaRoche, Basel, Switzerland) followed by primer extension.

Article Title: mKast is dispensable for normal development and sexual maturation of the male European honeybee
Article Snippet: The PCR products were then treated with Exonuclease I (Wako, Japan) and Shrimp Alkaline Phosphatase (Roche), and the sequences were determined (Fasmac, Japan). .. Genomic DNA extraction and PCR were conducted as described above.

Nucleic Acid Electrophoresis:

Article Title: GSK-3? phosphorylation of functionally distinct tau isoforms has differential, but mild effects
Article Snippet: Microtubule binding reactions were carried out as described above and separated by SDS-polyacrylamide gel electrophoresis. .. 0N3R, 0N4R, and 1N3R were transferred to PVDF by standard western blotting techniques as described above, and PVDF blots were treated with shrimp alkaline phosphatase (Roche) before blocking, to remove the phosphate groups that interfere with tau 46.1 antibody binding.

RNA Sequencing Assay:

Article Title: Analysis of alterative cleavage and polyadenylation by 3? region extraction and deep sequencing
Article Snippet: .. RNA-seq was carried out using essentially the same protocol except that 1) the 3′ end region extraction step using the CU5 T45 oligo was omitted and 2) fragmented RNA was dephosphorylated at the 3′ end with shrimp alkaline phosphatase (Roche) before ligation with adapters. .. CLIP-seq Our CLIP-seq method was largely based on the protocol used by Wang et al. with some minor modifications.

Fluorescence:

Article Title: Quantitative multiplexing analysis of PCR-amplified ribosomal RNA genes by hierarchical oligonucleotide primer extension reaction
Article Snippet: .. After primer extension reaction, 1 U of shrimp alkaline phosphatase (Roche Applied Science, Penzberg, Germany) is added into the reaction mixture to hydrolyze 5′ phosphate groups of unincorporated dye-terminators, thus eliminating the possible fluorescence signal associated with these unincorporated dye-terminators in post analysis. .. The mixture is incubated at 37°C for 60 min, and the reaction is stopped by thermal denaturation at 85°C for 10 min. Alternatively, to shorten the experiment time, the HOPE products can be purified using Microcon-YM3 spin column (Millipore). lists all the primers used.

Mutagenesis:

Article Title: Regulatory Interactions of a Virulence-Associated Serine/Threonine Phosphatase-Kinase Pair in Bacillus anthracis ▿
Article Snippet: .. Dephosphorylation reactions of 2 μM BA-Stk1cat were initiated by the addition of equimolar amounts (5 μM) of either purified BA-Stp1, the D18A mutant, or a control of shrimp alkaline phosphatase (Roche) diluted in reaction buffer. .. Reaction mixtures were incubated at 37°C, stopped at 5, 15, and 30 min with the addition of 4× SDS-Laemmli buffer, and boiled for 5 min.

Article Title: mKast is dispensable for normal development and sexual maturation of the male European honeybee
Article Snippet: Paragraph title: Genotyping of candidate mutant drones and heterozygous workers ... The PCR products were then treated with Exonuclease I (Wako, Japan) and Shrimp Alkaline Phosphatase (Roche), and the sequences were determined (Fasmac, Japan).

Isolation:

Article Title: Generating In Vivo Cloning Vectors for Parallel Cloning of Large Gene Clusters by Homologous Recombination
Article Snippet: DNA dephosphorylation was performed using shrimp alkaline phosphatase (Roche, Indianapolis, IN, USA). .. Qiagen kits were used to purify the PCR products and for plasmid isolation.

Article Title: Genetic Polymorphisms of Metabolic Enzymes and the Pharmacokinetics of Indapamide in Taiwanese Subjects
Article Snippet: Genomic DNA was isolated by use of the PURGENE DNA purification system (Gentra System, Minneapolis, MN, USA). .. After amplification, the unincorporated dNTPs were dephosphorylated by use of shrimp alkaline phosphatase (Hoffman-LaRoche, Basel, Switzerland) followed by primer extension.

Labeling:

Article Title: Quantitative multiplexing analysis of PCR-amplified ribosomal RNA genes by hierarchical oligonucleotide primer extension reaction
Article Snippet: The ddNTPs are labeled with four different WellRed fluorescent dyes (D1, D2, D3 and D4) (Beckman Coulter). .. After primer extension reaction, 1 U of shrimp alkaline phosphatase (Roche Applied Science, Penzberg, Germany) is added into the reaction mixture to hydrolyze 5′ phosphate groups of unincorporated dye-terminators, thus eliminating the possible fluorescence signal associated with these unincorporated dye-terminators in post analysis.

Purification:

Article Title: Diversity of Middle East respiratory syndrome coronaviruses in 109 dromedary camels based on full-genome sequencing, Abu Dhabi, United Arab Emirates
Article Snippet: Positive bands of the expected size that had strong signal and without additional bands were cleaned up using Exonuclease I (New England Biolabs) and Shrimp Alkaline Phosphatase (Roche). .. Purified PCR amplicons were sequenced with the PCR primers in both directions on an ABI Prism 3130 Automated Capillary Sequencer (Applied Biosystems, Foster City, CA, USA) using Big Dye 3.1 cycle sequencing kits (Life Technologies, Carlsbad, CA, USA).

Article Title: Quantitative multiplexing analysis of PCR-amplified ribosomal RNA genes by hierarchical oligonucleotide primer extension reaction
Article Snippet: Hierarchical oligonucleotide primer extension (HOPE) HOPE reaction (5–20 μl in volume) contains 5–10 pico-mole (pmol) of individually unlabeled oligonucleotide primers, 5–20 femto-mole (fmol) of purified PCR products and 1× premixed solution from the CEQ™ SNP-Primer extension kit (Beckman Coulter, Fullerton, CA). .. After primer extension reaction, 1 U of shrimp alkaline phosphatase (Roche Applied Science, Penzberg, Germany) is added into the reaction mixture to hydrolyze 5′ phosphate groups of unincorporated dye-terminators, thus eliminating the possible fluorescence signal associated with these unincorporated dye-terminators in post analysis.

Article Title: Regulatory Interactions of a Virulence-Associated Serine/Threonine Phosphatase-Kinase Pair in Bacillus anthracis ▿
Article Snippet: .. Dephosphorylation reactions of 2 μM BA-Stk1cat were initiated by the addition of equimolar amounts (5 μM) of either purified BA-Stp1, the D18A mutant, or a control of shrimp alkaline phosphatase (Roche) diluted in reaction buffer. .. Reaction mixtures were incubated at 37°C, stopped at 5, 15, and 30 min with the addition of 4× SDS-Laemmli buffer, and boiled for 5 min.

Article Title: Genetic Polymorphisms of Metabolic Enzymes and the Pharmacokinetics of Indapamide in Taiwanese Subjects
Article Snippet: After amplification, the unincorporated dNTPs were dephosphorylated by use of shrimp alkaline phosphatase (Hoffman-LaRoche, Basel, Switzerland) followed by primer extension. .. The purified extension reactions were spotted onto a 384-element silicon chip (Sequenom), and analyzed by a Bruker Biflex III MALDI-TOF SpectroREADER mass spectrometer.

Article Title: Analysis of alterative cleavage and polyadenylation by 3? region extraction and deep sequencing
Article Snippet: Phosphorylated RNA was then purified by the RNeasy kit (Qiagen) and was sequentially ligated to a 5′-adenylated 3′ adapter with the truncated T4 RNA ligase II (Bioo Scientific) and to a 5′ adapter with T4 RNA ligase I (NEB). .. RNA-seq was carried out using essentially the same protocol except that 1) the 3′ end region extraction step using the CU5 T45 oligo was omitted and 2) fragmented RNA was dephosphorylated at the 3′ end with shrimp alkaline phosphatase (Roche) before ligation with adapters.

Article Title: Genetic polymorphisms of the drug-metabolizing enzyme CYP2J2 in a Tibetan population
Article Snippet: PCR products were incubated with 0.5 μL shrimp alkaline phosphatase (Roche Diagnostics, Basel, Switzerland), 8 μL HotStar PCR product, and 1.5 μL deionized water (to a total volume of 10 μL), at 37°C for 30 minutes, followed by heat inactivation at 80°C for 15 minutes. .. Purified PCR products were directly sequenced using the ABI Prism BigDye Terminator Cycle Sequencing Kit version 3.1 (Applied Biosystems; Thermo Fisher Scientific, Inc., Waltham, MA) using an ABI Prism 3100 sequencer (Applied Biosystems, Thermo Fisher Scientific, Inc.).

Polymerase Chain Reaction:

Article Title: Generating In Vivo Cloning Vectors for Parallel Cloning of Large Gene Clusters by Homologous Recombination
Article Snippet: DNA dephosphorylation was performed using shrimp alkaline phosphatase (Roche, Indianapolis, IN, USA). .. Qiagen kits were used to purify the PCR products and for plasmid isolation.

Article Title: Diversity of Middle East respiratory syndrome coronaviruses in 109 dromedary camels based on full-genome sequencing, Abu Dhabi, United Arab Emirates
Article Snippet: Paragraph title: Fill in PCR and Sanger sequencing analysis ... Positive bands of the expected size that had strong signal and without additional bands were cleaned up using Exonuclease I (New England Biolabs) and Shrimp Alkaline Phosphatase (Roche).

Article Title: Quantitative multiplexing analysis of PCR-amplified ribosomal RNA genes by hierarchical oligonucleotide primer extension reaction
Article Snippet: Hierarchical oligonucleotide primer extension (HOPE) HOPE reaction (5–20 μl in volume) contains 5–10 pico-mole (pmol) of individually unlabeled oligonucleotide primers, 5–20 femto-mole (fmol) of purified PCR products and 1× premixed solution from the CEQ™ SNP-Primer extension kit (Beckman Coulter, Fullerton, CA). .. After primer extension reaction, 1 U of shrimp alkaline phosphatase (Roche Applied Science, Penzberg, Germany) is added into the reaction mixture to hydrolyze 5′ phosphate groups of unincorporated dye-terminators, thus eliminating the possible fluorescence signal associated with these unincorporated dye-terminators in post analysis.

Article Title: Genetic Polymorphisms of Metabolic Enzymes and the Pharmacokinetics of Indapamide in Taiwanese Subjects
Article Snippet: The primer specificity and the generated amplicons were checked by use of BLAST and UCSC In silico PCR, respectively. .. After amplification, the unincorporated dNTPs were dephosphorylated by use of shrimp alkaline phosphatase (Hoffman-LaRoche, Basel, Switzerland) followed by primer extension.

Article Title: mKast is dispensable for normal development and sexual maturation of the male European honeybee
Article Snippet: .. The PCR products were then treated with Exonuclease I (Wako, Japan) and Shrimp Alkaline Phosphatase (Roche), and the sequences were determined (Fasmac, Japan). .. To genotype the adult drones derived from the mosaic queen and adult workers derived from a wild-type queen that was artificially inseminated with sperm from a mutant drone, a hind leg was excised from each drone or worker.

Article Title: Analysis of alterative cleavage and polyadenylation by 3? region extraction and deep sequencing
Article Snippet: The resultant RNA was reverse-transcribed to cDNA with Superscript III (Invitrogen), and the cDNA was amplified by 12 cycles of PCR with Phusion high fidelity polymerase (NEB). .. RNA-seq was carried out using essentially the same protocol except that 1) the 3′ end region extraction step using the CU5 T45 oligo was omitted and 2) fragmented RNA was dephosphorylated at the 3′ end with shrimp alkaline phosphatase (Roche) before ligation with adapters.

Article Title: Association between RAGE variants and the susceptibility to atherosclerotic lesions in Chinese Han population
Article Snippet: .. Polymerase chain reaction (PCR) was generally adopted ( ); however, the phosphorylation state was also analyzed using shrimp alkaline phosphatase (Hoffman-La Roche, Basel, Switzerland) ( ). .. All analyses were performed using a silicon chip made of a 384-well porous plate.

Article Title: Genetic polymorphisms of the drug-metabolizing enzyme CYP2J2 in a Tibetan population
Article Snippet: .. PCR products were incubated with 0.5 μL shrimp alkaline phosphatase (Roche Diagnostics, Basel, Switzerland), 8 μL HotStar PCR product, and 1.5 μL deionized water (to a total volume of 10 μL), at 37°C for 30 minutes, followed by heat inactivation at 80°C for 15 minutes. .. Purified PCR products were directly sequenced using the ABI Prism BigDye Terminator Cycle Sequencing Kit version 3.1 (Applied Biosystems; Thermo Fisher Scientific, Inc., Waltham, MA) using an ABI Prism 3100 sequencer (Applied Biosystems, Thermo Fisher Scientific, Inc.).

De-Phosphorylation Assay:

Article Title: Generating In Vivo Cloning Vectors for Parallel Cloning of Large Gene Clusters by Homologous Recombination
Article Snippet: .. DNA dephosphorylation was performed using shrimp alkaline phosphatase (Roche, Indianapolis, IN, USA). .. The DNA was amplified using Pyrobest (Takara, Otsu, Shiga, Japan), which is a pfu polymerase, while the large DNAs ( > 10kb) were amplified using KOD-FX polymerase (Toyobo, Osaka, Japan).

Article Title: Regulatory Interactions of a Virulence-Associated Serine/Threonine Phosphatase-Kinase Pair in Bacillus anthracis ▿
Article Snippet: .. Dephosphorylation reactions of 2 μM BA-Stk1cat were initiated by the addition of equimolar amounts (5 μM) of either purified BA-Stp1, the D18A mutant, or a control of shrimp alkaline phosphatase (Roche) diluted in reaction buffer. .. Reaction mixtures were incubated at 37°C, stopped at 5, 15, and 30 min with the addition of 4× SDS-Laemmli buffer, and boiled for 5 min.

Lysis:

Article Title: mKast is dispensable for normal development and sexual maturation of the male European honeybee
Article Snippet: Each larva or embryo was homogenized in lysis buffer (5 mM Tris-HCl, pH 8.5, containing 100 mM KCl, 2.5 mM MgCl2 , 1%(v/v) NP40, 0.4 M sucrose, and 200 μg/ml proteinase K) in a plastic tube, and incubated at 66 °C for 2 h, followed by 92 °C for 10 min. PCR was performed to amplify the genomic region around the sgRNA target site using PrimeSTAR Max Premix (Takara, Japan) and gene-specific primers (forward: TGATGAGTTGAGAGAGGGTCG, reverse: AGTTCTGACAAACAACGCTCG). .. The PCR products were then treated with Exonuclease I (Wako, Japan) and Shrimp Alkaline Phosphatase (Roche), and the sequences were determined (Fasmac, Japan).

Article Title: Extensive phosphorylation of AMPA receptors in neurons
Article Snippet: Following experimental treatment, neurons were lysed in lysis buffer [1% Triton X-100, 0.5% sodium deoxycholate, 0.02% SDS, 50 mM NaF, 5 mM sodium pyrophosphate, 1 mM EDTA, 200 nM okadaic acid, protease inhibitor mixture (Roche), in PBS]. .. In some experiments cells were lysed without phosphatase inhibitors and lysates were treated with shrimp alkaline phosphatase (Roche) in the presence of 10 mM MgCl2 at 37 °C overnight.

Nested PCR:

Article Title: Diversity of Middle East respiratory syndrome coronaviruses in 109 dromedary camels based on full-genome sequencing, Abu Dhabi, United Arab Emirates
Article Snippet: Fill in PCR and Sanger sequencing analysis Thirty-two pairs of nested PCR assays that span the genome were designed based on alignment of available MERS-CoV genomes., MERS-CoV genomes or partial genomes were amplified as needed to fill the gaps missed by Fluidigm Access Array PCR. .. Positive bands of the expected size that had strong signal and without additional bands were cleaned up using Exonuclease I (New England Biolabs) and Shrimp Alkaline Phosphatase (Roche).

Chromatin Immunoprecipitation:

Article Title: Genetic Polymorphisms of Metabolic Enzymes and the Pharmacokinetics of Indapamide in Taiwanese Subjects
Article Snippet: After amplification, the unincorporated dNTPs were dephosphorylated by use of shrimp alkaline phosphatase (Hoffman-LaRoche, Basel, Switzerland) followed by primer extension. .. The purified extension reactions were spotted onto a 384-element silicon chip (Sequenom), and analyzed by a Bruker Biflex III MALDI-TOF SpectroREADER mass spectrometer.

Article Title: Association between RAGE variants and the susceptibility to atherosclerotic lesions in Chinese Han population
Article Snippet: Polymerase chain reaction (PCR) was generally adopted ( ); however, the phosphorylation state was also analyzed using shrimp alkaline phosphatase (Hoffman-La Roche, Basel, Switzerland) ( ). .. All analyses were performed using a silicon chip made of a 384-well porous plate.

SDS Page:

Article Title: Regulatory Interactions of a Virulence-Associated Serine/Threonine Phosphatase-Kinase Pair in Bacillus anthracis ▿
Article Snippet: Dephosphorylation reactions of 2 μM BA-Stk1cat were initiated by the addition of equimolar amounts (5 μM) of either purified BA-Stp1, the D18A mutant, or a control of shrimp alkaline phosphatase (Roche) diluted in reaction buffer. .. Subsequently, 10-μl portions of the reaction products were separated on a 10% SDS-PAGE gel and transferred to a polyvinylidene difluoride (PVDF) membrane, which was probed with a 1:1,000 concentration of Phospho-(Ser) 14-3-3 binding motif antibody (Cell Signaling).

Article Title: Extensive phosphorylation of AMPA receptors in neurons
Article Snippet: In some experiments cells were lysed without phosphatase inhibitors and lysates were treated with shrimp alkaline phosphatase (Roche) in the presence of 10 mM MgCl2 at 37 °C overnight. .. In some experiments cells were lysed without phosphatase inhibitors and lysates were treated with shrimp alkaline phosphatase (Roche) in the presence of 10 mM MgCl2 at 37 °C overnight.

Plasmid Preparation:

Article Title: Generating In Vivo Cloning Vectors for Parallel Cloning of Large Gene Clusters by Homologous Recombination
Article Snippet: DNA dephosphorylation was performed using shrimp alkaline phosphatase (Roche, Indianapolis, IN, USA). .. Qiagen kits were used to purify the PCR products and for plasmid isolation.

Software:

Article Title: Association between RAGE variants and the susceptibility to atherosclerotic lesions in Chinese Han population
Article Snippet: Polymerase chain reaction (PCR) was generally adopted ( ); however, the phosphorylation state was also analyzed using shrimp alkaline phosphatase (Hoffman-La Roche, Basel, Switzerland) ( ). .. The mass spectra were analyzed using SpectroTyper software (Sequenom, Inc., San Diego, CA, USA).

Article Title: Neutralizing blood-borne polyphosphate in vivo provides safe thromboprotection
Article Snippet: Relative amounts of polyP were determined by densitometric scans using ImageJ software. .. ATP (1 μM) was treated with PPX (0–10 μg ml−1 ) or shrimp alkaline phosphatase (0–2.3 μg ml−1 , Roche), and ATP was quantified using a luciferase-based bioluminescence assay according to the instructions from the ATP determination kit (Invitrogen).

Multiplex Assay:

Article Title: Genetic Polymorphisms of Metabolic Enzymes and the Pharmacokinetics of Indapamide in Taiwanese Subjects
Article Snippet: Primers and the extending probes were designed in multiplex format by using SpectroDESIGNER (Sequenom, San Diego, CA, USA). .. After amplification, the unincorporated dNTPs were dephosphorylated by use of shrimp alkaline phosphatase (Hoffman-LaRoche, Basel, Switzerland) followed by primer extension.

Ethanol Precipitation:

Article Title: Analysis of alterative cleavage and polyadenylation by 3? region extraction and deep sequencing
Article Snippet: Eluted RNA fragments were purified by Phenol: Chloroform extraction and Ethanol precipitation, followed by phosphorylation of the 5′ end with T4 kinase (NEB). .. RNA-seq was carried out using essentially the same protocol except that 1) the 3′ end region extraction step using the CU5 T45 oligo was omitted and 2) fragmented RNA was dephosphorylated at the 3′ end with shrimp alkaline phosphatase (Roche) before ligation with adapters.

Concentration Assay:

Article Title: Regulatory Interactions of a Virulence-Associated Serine/Threonine Phosphatase-Kinase Pair in Bacillus anthracis ▿
Article Snippet: Dephosphorylation reactions of 2 μM BA-Stk1cat were initiated by the addition of equimolar amounts (5 μM) of either purified BA-Stp1, the D18A mutant, or a control of shrimp alkaline phosphatase (Roche) diluted in reaction buffer. .. Subsequently, 10-μl portions of the reaction products were separated on a 10% SDS-PAGE gel and transferred to a polyvinylidene difluoride (PVDF) membrane, which was probed with a 1:1,000 concentration of Phospho-(Ser) 14-3-3 binding motif antibody (Cell Signaling).

Article Title: GSK-3? phosphorylation of functionally distinct tau isoforms has differential, but mild effects
Article Snippet: Phosphorylated microtubule binding Individual tau isoform phosphorylation reactions (92 μL), containing 18.11 μM final concentration of tau, 0.018 U GSK-3β per pmol of tau in buffer containing 40 mM HEPES, pH 7.64, 5 mM EGTA, 3 mM MgCl2 , and 2 mM ATP were incubated for 20 hours at 30°C. .. 0N3R, 0N4R, and 1N3R were transferred to PVDF by standard western blotting techniques as described above, and PVDF blots were treated with shrimp alkaline phosphatase (Roche) before blocking, to remove the phosphate groups that interfere with tau 46.1 antibody binding.

ATP Bioluminescent Assay:

Article Title: Neutralizing blood-borne polyphosphate in vivo provides safe thromboprotection
Article Snippet: .. ATP (1 μM) was treated with PPX (0–10 μg ml−1 ) or shrimp alkaline phosphatase (0–2.3 μg ml−1 , Roche), and ATP was quantified using a luciferase-based bioluminescence assay according to the instructions from the ATP determination kit (Invitrogen). ..

DNA Purification:

Article Title: Genetic Polymorphisms of Metabolic Enzymes and the Pharmacokinetics of Indapamide in Taiwanese Subjects
Article Snippet: Genomic DNA was isolated by use of the PURGENE DNA purification system (Gentra System, Minneapolis, MN, USA). .. After amplification, the unincorporated dNTPs were dephosphorylated by use of shrimp alkaline phosphatase (Hoffman-LaRoche, Basel, Switzerland) followed by primer extension.

Article Title: Genetic polymorphisms of the drug-metabolizing enzyme CYP2J2 in a Tibetan population
Article Snippet: Genomic DNA was extracted using the GoldMag-Mini Whole Blood Genomic DNA Purification Kit (GoldMag Ltd, Xi’an, China) according to the manufacturer's protocol. .. PCR products were incubated with 0.5 μL shrimp alkaline phosphatase (Roche Diagnostics, Basel, Switzerland), 8 μL HotStar PCR product, and 1.5 μL deionized water (to a total volume of 10 μL), at 37°C for 30 minutes, followed by heat inactivation at 80°C for 15 minutes.

High Throughput Screening Assay:

Article Title: Genetic Polymorphisms of Metabolic Enzymes and the Pharmacokinetics of Indapamide in Taiwanese Subjects
Article Snippet: After amplification, the unincorporated dNTPs were dephosphorylated by use of shrimp alkaline phosphatase (Hoffman-LaRoche, Basel, Switzerland) followed by primer extension. .. SNPs that failed to perform in the high throughput MALDI-TOF were identified by direct sequencing.

Staining:

Article Title: Neutralizing blood-borne polyphosphate in vivo provides safe thromboprotection
Article Snippet: DNA and RNA (1 μg) were treated with PPX (10 μg ml−1 ), DNase (0.1 mg ml−1 , Sigma-Aldrich) or RNase (0.5 mg ml−1 , Qiagen), and were analysed on 1% agarose gels containing Gel Red Nucleic Acid Stain (Biotum). .. ATP (1 μM) was treated with PPX (0–10 μg ml−1 ) or shrimp alkaline phosphatase (0–2.3 μg ml−1 , Roche), and ATP was quantified using a luciferase-based bioluminescence assay according to the instructions from the ATP determination kit (Invitrogen).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 78
    Roche unspecific phosphatase shrimp alkaline phosphatase
    Kinetics analysis of Tyr-48 phosphorylated and dephosphorylated cytochrome c with cytochrome c oxidase (CcO). Increasing amounts of isolated phosphorylated (open squares) and <t>shrimp</t> <t>alkaline</t> <t>phosphatase-treated</t> (closed squares) cytochrome c were added to solubilized CcO. CcO activity was measured with the polarographic method at 25 °C. CcO activity (turnover number, TN) is defined as consumed O 2 [μmoles]/(s · CcO [μmoles]).
    Unspecific Phosphatase Shrimp Alkaline Phosphatase, supplied by Roche, used in various techniques. Bioz Stars score: 78/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/unspecific phosphatase shrimp alkaline phosphatase/product/Roche
    Average 78 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    unspecific phosphatase shrimp alkaline phosphatase - by Bioz Stars, 2020-01
    78/100 stars
      Buy from Supplier

    87
    Roche shrimp alkaline phosphatase sap
    IFN induction by NSV vRNAs depends on RIG-I and the 5′ triphosphate group. (A) Verification of knockdowns. Human 293T cells were treated with retroviral shRNA constructs directed against either RIG-I or MDA5, and cotransfected with expression constructs for HA-tagged MDA5 (left panels) or GFP-fused RIG-I (right panels). Western blot analysis using antibodies against the respective fusion tags is shown. Detection of cellular β-tubulin was used as an internal control. (B) Effect of shRNA knockdowns on IFN induction by viral <t>RNAs,</t> using the reporter constructs and RNA transfection protocols as described for Fig. 1A . The negative control shRNA construct (CTRL) targets the heat shock 70 interacting protein and was tested to have no effect on IFN induction (data not shown). (C) Genomic RNAs from ZEBOV and NiV were either mock treated, treated with <t>SAP,</t> or treated with SAP in the presence of the phosphatase inhibitor EDTA. IFN-β reporter assays and RNA transfections were performed as described for Fig. 1A . Mean values and standard deviations from 3 independent experiments are shown.
    Shrimp Alkaline Phosphatase Sap, supplied by Roche, used in various techniques. Bioz Stars score: 87/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/shrimp alkaline phosphatase sap/product/Roche
    Average 87 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    shrimp alkaline phosphatase sap - by Bioz Stars, 2020-01
    87/100 stars
      Buy from Supplier

    91
    Roche shrimp alkaline phosphatase
    IFN induction by NSV vRNAs depends on RIG-I and the 5′ triphosphate group. (A) Verification of knockdowns. Human 293T cells were treated with retroviral shRNA constructs directed against either RIG-I or MDA5, and cotransfected with expression constructs for HA-tagged MDA5 (left panels) or GFP-fused RIG-I (right panels). Western blot analysis using antibodies against the respective fusion tags is shown. Detection of cellular β-tubulin was used as an internal control. (B) Effect of shRNA knockdowns on IFN induction by viral <t>RNAs,</t> using the reporter constructs and RNA transfection protocols as described for Fig. 1A . The negative control shRNA construct (CTRL) targets the heat shock 70 interacting protein and was tested to have no effect on IFN induction (data not shown). (C) Genomic RNAs from ZEBOV and NiV were either mock treated, treated with <t>SAP,</t> or treated with SAP in the presence of the phosphatase inhibitor EDTA. IFN-β reporter assays and RNA transfections were performed as described for Fig. 1A . Mean values and standard deviations from 3 independent experiments are shown.
    Shrimp Alkaline Phosphatase, supplied by Roche, used in various techniques. Bioz Stars score: 91/100, based on 109 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/shrimp alkaline phosphatase/product/Roche
    Average 91 stars, based on 109 article reviews
    Price from $9.99 to $1999.99
    shrimp alkaline phosphatase - by Bioz Stars, 2020-01
    91/100 stars
      Buy from Supplier

    Image Search Results


    Kinetics analysis of Tyr-48 phosphorylated and dephosphorylated cytochrome c with cytochrome c oxidase (CcO). Increasing amounts of isolated phosphorylated (open squares) and shrimp alkaline phosphatase-treated (closed squares) cytochrome c were added to solubilized CcO. CcO activity was measured with the polarographic method at 25 °C. CcO activity (turnover number, TN) is defined as consumed O 2 [μmoles]/(s · CcO [μmoles]).

    Journal: Biochimica et biophysica acta

    Article Title: Mammalian liver cytochrome c is tyrosine-48 phosphorylated in vivo, inhibiting mitochondrial respiration

    doi: 10.1016/j.bbabio.2008.04.023

    Figure Lengend Snippet: Kinetics analysis of Tyr-48 phosphorylated and dephosphorylated cytochrome c with cytochrome c oxidase (CcO). Increasing amounts of isolated phosphorylated (open squares) and shrimp alkaline phosphatase-treated (closed squares) cytochrome c were added to solubilized CcO. CcO activity was measured with the polarographic method at 25 °C. CcO activity (turnover number, TN) is defined as consumed O 2 [μmoles]/(s · CcO [μmoles]).

    Article Snippet: Unspecific phosphatase shrimp alkaline phosphatase (10 units, Roche, Indianapolis, IN) was employed to dephosphorylate Cyt c as previously described [ ] using 300 μL of a 40 μM Cyt c solution and overnight incubation at 30 °C.

    Techniques: Isolation, Activity Assay

    Gel and Western analysis of isolated cow liver Cyt c . A, Cyt c was purified under conditions preserving the in vivo phosphorylation status (lane 2) and treated with shrimp alkaline phosphatase (SAP, lane 3). Samples were applied to a 4–12% SDS-PAGE gradient gel and protein bands were detected using the silver staining method. Lane M, protein size marker (kDa); lane 1, Sigma Cyt c ; lane 4, EGF stimulated A431 cell lysate (positive control for Western analysis); lane 5, ovalbumin (negative control for Western analysis). B, for Western analysis, protein samples were applied to SDS-PAGE and subsequently transferred to a nitrocellulose membrane and analyzed using an anti-phosphotyrosine antibody (4G10, Upstate). Purified Cyt c (lane 2) produces a strong signal with the anti-phosphotyrosine antibody, whereas overnight treatment with SAP abolishes the signal (lane 3). Samples in lanes 1 – 5 as denoted in A. Protein sizes are indicated on the left.

    Journal: Biochimica et biophysica acta

    Article Title: Mammalian liver cytochrome c is tyrosine-48 phosphorylated in vivo, inhibiting mitochondrial respiration

    doi: 10.1016/j.bbabio.2008.04.023

    Figure Lengend Snippet: Gel and Western analysis of isolated cow liver Cyt c . A, Cyt c was purified under conditions preserving the in vivo phosphorylation status (lane 2) and treated with shrimp alkaline phosphatase (SAP, lane 3). Samples were applied to a 4–12% SDS-PAGE gradient gel and protein bands were detected using the silver staining method. Lane M, protein size marker (kDa); lane 1, Sigma Cyt c ; lane 4, EGF stimulated A431 cell lysate (positive control for Western analysis); lane 5, ovalbumin (negative control for Western analysis). B, for Western analysis, protein samples were applied to SDS-PAGE and subsequently transferred to a nitrocellulose membrane and analyzed using an anti-phosphotyrosine antibody (4G10, Upstate). Purified Cyt c (lane 2) produces a strong signal with the anti-phosphotyrosine antibody, whereas overnight treatment with SAP abolishes the signal (lane 3). Samples in lanes 1 – 5 as denoted in A. Protein sizes are indicated on the left.

    Article Snippet: Unspecific phosphatase shrimp alkaline phosphatase (10 units, Roche, Indianapolis, IN) was employed to dephosphorylate Cyt c as previously described [ ] using 300 μL of a 40 μM Cyt c solution and overnight incubation at 30 °C.

    Techniques: Western Blot, Isolation, Purification, Preserving, In Vivo, SDS Page, Silver Staining, Marker, Positive Control, Negative Control

    IFN induction by NSV vRNAs depends on RIG-I and the 5′ triphosphate group. (A) Verification of knockdowns. Human 293T cells were treated with retroviral shRNA constructs directed against either RIG-I or MDA5, and cotransfected with expression constructs for HA-tagged MDA5 (left panels) or GFP-fused RIG-I (right panels). Western blot analysis using antibodies against the respective fusion tags is shown. Detection of cellular β-tubulin was used as an internal control. (B) Effect of shRNA knockdowns on IFN induction by viral RNAs, using the reporter constructs and RNA transfection protocols as described for Fig. 1A . The negative control shRNA construct (CTRL) targets the heat shock 70 interacting protein and was tested to have no effect on IFN induction (data not shown). (C) Genomic RNAs from ZEBOV and NiV were either mock treated, treated with SAP, or treated with SAP in the presence of the phosphatase inhibitor EDTA. IFN-β reporter assays and RNA transfections were performed as described for Fig. 1A . Mean values and standard deviations from 3 independent experiments are shown.

    Journal: PLoS ONE

    Article Title: Processing of Genome 5? Termini as a Strategy of Negative-Strand RNA Viruses to Avoid RIG-I-Dependent Interferon Induction

    doi: 10.1371/journal.pone.0002032

    Figure Lengend Snippet: IFN induction by NSV vRNAs depends on RIG-I and the 5′ triphosphate group. (A) Verification of knockdowns. Human 293T cells were treated with retroviral shRNA constructs directed against either RIG-I or MDA5, and cotransfected with expression constructs for HA-tagged MDA5 (left panels) or GFP-fused RIG-I (right panels). Western blot analysis using antibodies against the respective fusion tags is shown. Detection of cellular β-tubulin was used as an internal control. (B) Effect of shRNA knockdowns on IFN induction by viral RNAs, using the reporter constructs and RNA transfection protocols as described for Fig. 1A . The negative control shRNA construct (CTRL) targets the heat shock 70 interacting protein and was tested to have no effect on IFN induction (data not shown). (C) Genomic RNAs from ZEBOV and NiV were either mock treated, treated with SAP, or treated with SAP in the presence of the phosphatase inhibitor EDTA. IFN-β reporter assays and RNA transfections were performed as described for Fig. 1A . Mean values and standard deviations from 3 independent experiments are shown.

    Article Snippet: Enzymatic treatments of RNA To remove 5′-terminal phosphates, purified RNAs were treated with 1 U of shrimp alkaline phosphatase (SAP) according to the protocol of the manufacturer (Roche).

    Techniques: shRNA, Construct, Expressing, Western Blot, Transfection, Negative Control