|
Shanghai GenePharma
shrna sequences for serpinh1, sqle, sp1, and scrambled negative shrna (shctrl) Shrna Sequences For Serpinh1, Sqle, Sp1, And Scrambled Negative Shrna (Shctrl), supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/shctrl+scrambled+sequence/shrna+sequences+for+serpinh1++sqle++sp1++and+scrambled+negative+shrna++shctrl+/pm39946769-125-3-16 Average 90 stars, based on 1 article reviews
shrna sequences for serpinh1, sqle, sp1, and scrambled negative shrna (shctrl) - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Addgene inc
plko 1 shctrl puro target sequence 5 cctaaggttaagtcgccctcg 3 Plko 1 Shctrl Puro Target Sequence 5 Cctaaggttaagtcgccctcg 3, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/shctrl+scrambled+sequence/PLKO%2E1-Scrambled+(Plasmid+%23136035)/pmc10140597-109-0-5 Average 93 stars, based on 1 article reviews
plko 1 shctrl puro target sequence 5 cctaaggttaagtcgccctcg 3 - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
|
Millipore
a scramble control sequence (shctrl) ![]() A Scramble Control Sequence (Shctrl), supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/shctrl+scrambled+sequence/a+scramble+control+sequence++shctrl+/pmc06874158-51-26-33 Average 90 stars, based on 1 article reviews
a scramble control sequence (shctrl) - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
SuperArray Bioscience Corporation
shctrl scrambled sequence ![]() Shctrl Scrambled Sequence, supplied by SuperArray Bioscience Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/shctrl+scrambled+sequence/shctrl+scrambled+sequence/pmc02815570-106-11-18 Average 90 stars, based on 1 article reviews
shctrl scrambled sequence - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
Journal: Frontiers in Oncology
Article Title: Casein Kinase 1 Delta Regulates Cell Proliferation, Response to Chemotherapy and Migration in Human Ovarian Cancer Cells
doi: 10.3389/fonc.2019.01211
Figure Lengend Snippet: CK1δ knockdown affects human ovarian cancer cell proliferation. (A,B) Growth curves of shCTRL, sh599, and sh1552 OVCAR3 (A) and IGROV1 (B) cells determined by crystal violet proliferation assay. Crystal violet absorbance (595 nm) was normalized to T1. Data are expressed as the mean ± S.D. (N=6). *, # p < 0.05; **, ## p < 0.001; ***, ### p < 0.001; *sh599 vs. shCTRL; # sh1552 vs. shCTRL. (C,D) Cell cycle analysis of EdU-positive shCTRL, sh599, and sh1552 OVCAR3 (C) and IGROV1 (D) cells performed after 8 and 7 h culture, respectively. On the left, graphs represent the mean ± S.D ( N = 3). * p < 0.05; ** p < 0.01; *** p < 0.001. On the right, representative dot plots are shown. (E,F) Growth curves of tumors generated by shCTRL, sh599, and sh1552 OVCAR3 (E) and IGROV1 (F) cells after s.c. injection in NSG mice. Data are expressed as the mean ± S.D ( N = 5 mice/experimental group). *, # p < 0.05; **, ## p < 0.001; *sh599 vs. shCTRL; # sh1552 vs. shCTRL.
Article Snippet: For CSNK1D gene knockdown, MISSION® TRC shRNA bacterial glycerol stocks transformed with plasmids encoding short hairpin RNA (shRNA) specifically targeting human CSNK1D (sh599, sh1552) or a
Techniques: Proliferation Assay, Cell Cycle Assay, Generated, Injection
Journal: Frontiers in Oncology
Article Title: Casein Kinase 1 Delta Regulates Cell Proliferation, Response to Chemotherapy and Migration in Human Ovarian Cancer Cells
doi: 10.3389/fonc.2019.01211
Figure Lengend Snippet: CK1δ knockdown sensitizes human ovarian cancer cells to CPT treatment. (A, B, E) ShCTRL, sh599, and sh1552 OVCAR3 (A) , IGROV1 (B) , and OVCAR3 CBP (E) cells were challenged with scalar doses of CPT for 72 h. Apoptosis was then assayed by Annexin-V staining. The graphs represent the mean ± S.D ( N = 3). Data were normalized to the corresponding shCTRL. * p < 0.05; ** p < 0.01; *** p < 0.001 (C,D,F) WB analysis of p21 andXIAP in shCTRL, sh599, and sh1552 OVCAR3 (C) , IGROV1 (D) , and OVCAR3 CBP (F) cells. Signals were normalized to α-tubulin or β-actin, as indicated. On the top, representative blots. On the bottom, graphs represent the mean ± S.D ( N = 3). * p < 0.05; ** p < 0.01; *** p < 0.001.
Article Snippet: For CSNK1D gene knockdown, MISSION® TRC shRNA bacterial glycerol stocks transformed with plasmids encoding short hairpin RNA (shRNA) specifically targeting human CSNK1D (sh599, sh1552) or a
Techniques: Staining
Journal: Frontiers in Oncology
Article Title: Casein Kinase 1 Delta Regulates Cell Proliferation, Response to Chemotherapy and Migration in Human Ovarian Cancer Cells
doi: 10.3389/fonc.2019.01211
Figure Lengend Snippet: CK1δ knockdown enhances OVCAR3 cell motility. (A,B) Wound healing assay performed on shCTRL, sh599, and sh1552 OVCAR3 cells. Pictures of the scratch area were taken at T0 and after 24 and 48 h. Distance between the two sides of the scratch was quantified using ImageJ software. The repaired area was normalized to shCTRL. (A) One representative experiment is shown. (B) The graphs represent the mean of repaired area at T24 and T48h ± S.D ( N = 3). * p < 0.05; ** p < 0.01 (C) Transwell migration assay performed on shCTRL, sh599, and sh1552 OVCAR3 cells. On the left, representative pictures of migrated cells. On the right, the graphs represent the mean fold change of total area ± S.D ( N = 3). * p < 0.05; *** p < 0.001 (D,E) Lung colonization assay. ShCTRL, sh599, and sh1552 Fluc-OVCAR3 were injected i.v. in NOD/SCID mice. Luciferin was administered to detect tumor cells. (D) Ex vivo imaging of lungs harvested at 2 (T2h) and 24 h (T24h) after i.v. injection. Representative pictures are shown. (E) The graph represents the mean of bioluminescence signals ± S.E.M ( N = 5 mice/experimental group), normalized to shCTRL group. ** p < 0.01; ns, not significant.
Article Snippet: For CSNK1D gene knockdown, MISSION® TRC shRNA bacterial glycerol stocks transformed with plasmids encoding short hairpin RNA (shRNA) specifically targeting human CSNK1D (sh599, sh1552) or a
Techniques: Wound Healing Assay, Software, Transwell Migration Assay, Injection, Ex Vivo, Imaging
Journal: Frontiers in Oncology
Article Title: Casein Kinase 1 Delta Regulates Cell Proliferation, Response to Chemotherapy and Migration in Human Ovarian Cancer Cells
doi: 10.3389/fonc.2019.01211
Figure Lengend Snippet: CK1δ knockdown impairs IGROV1 cell motility. (A,B) Wound healing assay performed on shCTRL, sh599, and sh1552 IGROV1 cells. Pictures of the scratch area were taken at T0 and after 24 and 48 h. Distance between the two sides of the scratch was quantified using ImageJ software. The repaired area was normalized to shCTRL. (A) One representative experiment is shown. (B) The graphs represent the mean of repaired area at T24 and T48h ± S.D ( N = 3). * p < 0.05; ** p < 0.01 (C) Transwell migration assay performed on shCTRL, sh599, and sh1552 IGROV1 cells. On the left, representative pictures of migrated cells. On the right, the graphs represent the mean fold change of total area ± S.D ( N = 3). *** p < 0.001 (D,E) Lung colonization assay. ShCTRL, sh599, and sh1552 Fluc-IGROV1 were injected i.v. in NOD/SCID mice. Luciferin was administered to detect tumor cells. (D) Ex vivo imaging of lungs harvested at 2 (T2h) and 24 h (T24h) after i.v. injection. Representative pictures are shown. (E) The graph represents the mean of bioluminescence signals ± S.E.M. ( N = 5 mice/experimental group), normalized to shCTRL group. *** p < 0.001; ns, not significant.
Article Snippet: For CSNK1D gene knockdown, MISSION® TRC shRNA bacterial glycerol stocks transformed with plasmids encoding short hairpin RNA (shRNA) specifically targeting human CSNK1D (sh599, sh1552) or a
Techniques: Wound Healing Assay, Software, Transwell Migration Assay, Injection, Ex Vivo, Imaging
Journal: Frontiers in Oncology
Article Title: Casein Kinase 1 Delta Regulates Cell Proliferation, Response to Chemotherapy and Migration in Human Ovarian Cancer Cells
doi: 10.3389/fonc.2019.01211
Figure Lengend Snippet: CK1δ knockdown impairs SKOV3 and MES-OV cell motility. (A,B; D,E) Wound healing assay performed on shCTRL, sh599, and sh1552 SKOV3 (A,B) and MES-OV (D,E) cells. Pictures of the scratch area were taken at T0 and after 24 h. Distance between the two sides of the scratch was quantified using ImageJ software. The repaired area was normalized to shCTRL. (A,D) One representative experiment is shown. (B,E) The graphs represent the mean of repaired area at T24 ± S.D. ( N = 4). *** p < 0.001 (C,F) Transwell migration assay performed on shCTRL, sh599, and sh1552 SKOV3 (C) and MES-OV (F) cells. On the left, representative pictures of migrated cells. On the right, the graphs represent the mean fold change of total area ± S.D. ( N = 3). ** p < 0.01; *** p < 0.001.
Article Snippet: For CSNK1D gene knockdown, MISSION® TRC shRNA bacterial glycerol stocks transformed with plasmids encoding short hairpin RNA (shRNA) specifically targeting human CSNK1D (sh599, sh1552) or a
Techniques: Wound Healing Assay, Software, Transwell Migration Assay