Structured Review

Illumina Inc sequencing pcr amplicons
Schematic representation of the paired-end library preparation using a two-step tailed <t>PCR.</t> The workflow is derived from a document ‘16S metagenomic sequencing library preparation: preparing 16S ribosomal gene <t>amplicons</t> for the Illumina MiSeq system’ distributed by Illumina (part no. 15044223 Rev. B) and the figure was drawn with reference to a website of the Genomics and Sequencing Center at the University of Rhode Island ( http://web.uri.edu/gsc/next-generation-sequencing/ ).
Sequencing Pcr Amplicons, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 89/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sequencing pcr amplicons/product/Illumina Inc
Average 89 stars, based on 1 article reviews
Price from $9.99 to $1999.99
sequencing pcr amplicons - by Bioz Stars, 2020-07
89/100 stars

Images

1) Product Images from "MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species"

Article Title: MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species

Journal: Royal Society Open Science

doi: 10.1098/rsos.150088

Schematic representation of the paired-end library preparation using a two-step tailed PCR. The workflow is derived from a document ‘16S metagenomic sequencing library preparation: preparing 16S ribosomal gene amplicons for the Illumina MiSeq system’ distributed by Illumina (part no. 15044223 Rev. B) and the figure was drawn with reference to a website of the Genomics and Sequencing Center at the University of Rhode Island ( http://web.uri.edu/gsc/next-generation-sequencing/ ).
Figure Legend Snippet: Schematic representation of the paired-end library preparation using a two-step tailed PCR. The workflow is derived from a document ‘16S metagenomic sequencing library preparation: preparing 16S ribosomal gene amplicons for the Illumina MiSeq system’ distributed by Illumina (part no. 15044223 Rev. B) and the figure was drawn with reference to a website of the Genomics and Sequencing Center at the University of Rhode Island ( http://web.uri.edu/gsc/next-generation-sequencing/ ).

Techniques Used: Polymerase Chain Reaction, Derivative Assay, Sequencing, Next-Generation Sequencing

Related Articles

Sequencing:

Article Title: Cathelicidins in the Tasmanian devil (Sarcophilus harrisii)
Article Snippet: .. Change of pouch microbiome during lactation To test the hypothesis that the microbial community in devil’s pouch undergoes compositional changes in response to lactation, we examined the pouch microbiota of three non-lactating and three lactating devils by sequencing PCR amplicons of the bacterial 16S rRNA gene V3-V4 region (around 465 bp) on the Illumina MiSeq System. ..

Article Title: MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species
Article Snippet: .. More recently, Kelly et al. [ ] attempted to estimate the fish fauna in a large tank at the Monterey Bay Aquarium with known species composition by sequencing PCR amplicons from eDNA using an NGS platform (Illumina MiSeq). .. They used a set of published universal PCR primers to amplify a 106 bp fragment of the mitochondrial 12S rRNA gene [ ] for metabarcoding fish species in the tank.

Polymerase Chain Reaction:

Article Title: Cathelicidins in the Tasmanian devil (Sarcophilus harrisii)
Article Snippet: .. Change of pouch microbiome during lactation To test the hypothesis that the microbial community in devil’s pouch undergoes compositional changes in response to lactation, we examined the pouch microbiota of three non-lactating and three lactating devils by sequencing PCR amplicons of the bacterial 16S rRNA gene V3-V4 region (around 465 bp) on the Illumina MiSeq System. ..

Article Title: MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species
Article Snippet: .. More recently, Kelly et al. [ ] attempted to estimate the fish fauna in a large tank at the Monterey Bay Aquarium with known species composition by sequencing PCR amplicons from eDNA using an NGS platform (Illumina MiSeq). .. They used a set of published universal PCR primers to amplify a 106 bp fragment of the mitochondrial 12S rRNA gene [ ] for metabarcoding fish species in the tank.

Next-Generation Sequencing:

Article Title: MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species
Article Snippet: .. More recently, Kelly et al. [ ] attempted to estimate the fish fauna in a large tank at the Monterey Bay Aquarium with known species composition by sequencing PCR amplicons from eDNA using an NGS platform (Illumina MiSeq). .. They used a set of published universal PCR primers to amplify a 106 bp fragment of the mitochondrial 12S rRNA gene [ ] for metabarcoding fish species in the tank.

Fluorescence In Situ Hybridization:

Article Title: MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species
Article Snippet: .. More recently, Kelly et al. [ ] attempted to estimate the fish fauna in a large tank at the Monterey Bay Aquarium with known species composition by sequencing PCR amplicons from eDNA using an NGS platform (Illumina MiSeq). .. They used a set of published universal PCR primers to amplify a 106 bp fragment of the mitochondrial 12S rRNA gene [ ] for metabarcoding fish species in the tank.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 91
    Illumina Inc rt pcr amplicons
    Generation of diabetic INS C94Y transgenic (tg) pigs (expression construct, Southern blot, glucose levels, transgene expression). A : Expression cassette including the porcine INS gene with the Cys→Tyr exchange at amino acid position 94, essential regulatory elements, and a neomycin selection cassette (neo) . Restriction site of Bam HI and binding site of the probe (bar) used for Southern blot analysis are indicated. B : Southern blot analysis of Bam HI digested genomic DNA from INS C94Y tg pigs and littermate control animals (wt) showing different integration sites in founders 9725, 9726, 9727, 9728, 9745, 9746, and 9747. Tg offspring (1334, 1336, 1340, 1341) of founder 9747 show the same integration pattern as founder 9747, demonstrating a single integration site. C : Fasting blood glucose levels of INS C94Y tg founder boars showing hyperglycemia in founder 9747 progressively deteriorating over time, whereas blood glucose levels of the six other founders remain within the reference range (70–115 mg/dL, depending on the laboratory); arrow indicates start of insulin therapy. D : Quantification of INS C94Y and wt INS transcripts in pancreatic tissue of INS C94Y tg pigs by next- generation sequencing of <t>RT-PCR</t> <t>amplicons.</t> Founder 9747 shows at least five-fold higher expression of the mutant INS C94Y compared with the other six founders (F0) and similar expression compared with its F1 offspring (F1; n = 3). Inset : RT-PCR products of INS C94Y / INS transcripts in pancreatic tissue of all INS C94Y tg founders ( left) and founder 9747, as well as its offspring ( right ). M, pUC Mix Marker; gDNA, genomic DNA; H 2 O, Aqua bidest.
    Rt Pcr Amplicons, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 91/100, based on 372 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rt pcr amplicons/product/Illumina Inc
    Average 91 stars, based on 372 article reviews
    Price from $9.99 to $1999.99
    rt pcr amplicons - by Bioz Stars, 2020-07
    91/100 stars
      Buy from Supplier

    90
    Illumina Inc amplicon sequencing libraries
    FLT3 ITD detection performance of a novel algorithm ITDseek versus Pindel, GATK HaplotypeCaller and Samtools. a Detected combination of ITD length and relative position in the FLT3 NGS <t>amplicon</t> 2 (chr13:28,608,112-28,608,312) was indicated by red shading in the corresponding panel of each caller. b Venn diagram showing the number of ITD alleles detected by any or none of the four tested callers.
    Amplicon Sequencing Libraries, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 14 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/amplicon sequencing libraries/product/Illumina Inc
    Average 90 stars, based on 14 article reviews
    Price from $9.99 to $1999.99
    amplicon sequencing libraries - by Bioz Stars, 2020-07
    90/100 stars
      Buy from Supplier

    89
    Illumina Inc amplicon generation
    RTS,S Amino Acid Changes and Positions. The 84 amino acids (positions 288–371) comprising the C-terminal <t>amplicon</t> are represented by columns in the bar-chart. The percentage of samples sharing the 3D7 amino acid are represented in pale yellow. Non-3D7 amino acid alternatives are represented in descending order of frequency in dark blue, red, light blue, or orange. Below the bar-chart, the 3D7 amino acid sequence is shown, with positions corresponding to the coordinates above. The substitutions at each of the 84 positions are enumerated below the 3D7 sequence.
    Amplicon Generation, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 89/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/amplicon generation/product/Illumina Inc
    Average 89 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    amplicon generation - by Bioz Stars, 2020-07
    89/100 stars
      Buy from Supplier

    Image Search Results


    Generation of diabetic INS C94Y transgenic (tg) pigs (expression construct, Southern blot, glucose levels, transgene expression). A : Expression cassette including the porcine INS gene with the Cys→Tyr exchange at amino acid position 94, essential regulatory elements, and a neomycin selection cassette (neo) . Restriction site of Bam HI and binding site of the probe (bar) used for Southern blot analysis are indicated. B : Southern blot analysis of Bam HI digested genomic DNA from INS C94Y tg pigs and littermate control animals (wt) showing different integration sites in founders 9725, 9726, 9727, 9728, 9745, 9746, and 9747. Tg offspring (1334, 1336, 1340, 1341) of founder 9747 show the same integration pattern as founder 9747, demonstrating a single integration site. C : Fasting blood glucose levels of INS C94Y tg founder boars showing hyperglycemia in founder 9747 progressively deteriorating over time, whereas blood glucose levels of the six other founders remain within the reference range (70–115 mg/dL, depending on the laboratory); arrow indicates start of insulin therapy. D : Quantification of INS C94Y and wt INS transcripts in pancreatic tissue of INS C94Y tg pigs by next- generation sequencing of RT-PCR amplicons. Founder 9747 shows at least five-fold higher expression of the mutant INS C94Y compared with the other six founders (F0) and similar expression compared with its F1 offspring (F1; n = 3). Inset : RT-PCR products of INS C94Y / INS transcripts in pancreatic tissue of all INS C94Y tg founders ( left) and founder 9747, as well as its offspring ( right ). M, pUC Mix Marker; gDNA, genomic DNA; H 2 O, Aqua bidest.

    Journal: Diabetes

    Article Title: Permanent Neonatal Diabetes in INSC94Y Transgenic Pigs

    doi: 10.2337/db12-1065

    Figure Lengend Snippet: Generation of diabetic INS C94Y transgenic (tg) pigs (expression construct, Southern blot, glucose levels, transgene expression). A : Expression cassette including the porcine INS gene with the Cys→Tyr exchange at amino acid position 94, essential regulatory elements, and a neomycin selection cassette (neo) . Restriction site of Bam HI and binding site of the probe (bar) used for Southern blot analysis are indicated. B : Southern blot analysis of Bam HI digested genomic DNA from INS C94Y tg pigs and littermate control animals (wt) showing different integration sites in founders 9725, 9726, 9727, 9728, 9745, 9746, and 9747. Tg offspring (1334, 1336, 1340, 1341) of founder 9747 show the same integration pattern as founder 9747, demonstrating a single integration site. C : Fasting blood glucose levels of INS C94Y tg founder boars showing hyperglycemia in founder 9747 progressively deteriorating over time, whereas blood glucose levels of the six other founders remain within the reference range (70–115 mg/dL, depending on the laboratory); arrow indicates start of insulin therapy. D : Quantification of INS C94Y and wt INS transcripts in pancreatic tissue of INS C94Y tg pigs by next- generation sequencing of RT-PCR amplicons. Founder 9747 shows at least five-fold higher expression of the mutant INS C94Y compared with the other six founders (F0) and similar expression compared with its F1 offspring (F1; n = 3). Inset : RT-PCR products of INS C94Y / INS transcripts in pancreatic tissue of all INS C94Y tg founders ( left) and founder 9747, as well as its offspring ( right ). M, pUC Mix Marker; gDNA, genomic DNA; H 2 O, Aqua bidest.

    Article Snippet: INS C94Y and wild-type INS cDNAs were amplified by PCR using insulin-specific primers 5′-TTT TTA TCC GCA TTC TTA CAC GG-3′ and 5′-ATC TTC CTC AGC TCC TTC CAG G-3′, and their ratio was determined by next-generation sequencing of RT-PCR amplicons (Genome Analyzer IIx; Illumina; > 10,000 reads per sample).

    Techniques: Transgenic Assay, Expressing, Construct, Southern Blot, Selection, Binding Assay, Next-Generation Sequencing, Reverse Transcription Polymerase Chain Reaction, Mutagenesis, Marker

    Imprinted chromatin as a model system to quantify epigenetic influences on genome editing. (A) Schematic outlining the experimental workflow. Throughout the text, F1 hybrid cell lines are depicted with the maternal strain denoted before the paternal strain (i.e., In B×J: B is maternal and J paternal). sgRNAs are designed to cleave approximately 40–100 bp from a heterozygous SNP within imprinted chromatin (open and closed circles). MiSeq amplicons span both the SNP and site of mutation, which allows simultaneous assessment of genome editing outcome and parental allele at high-throughput. (B) Top: schematic showing the imprinted mouse Kcnq1 gene including H3K9me3 ChIP and DNase-I–seq data from mESCs available through EncODE (ENCSR000CFZ, GSM1014187) (bottom). Higher-resolution view of the KvDMR imprinted CpG island within Kcnq1 , showing the position of three sgRNAs used in panel E. (C) Allele-specific enrichment of H3K9me3 and H4K20me3. PCR fragments spanning the target sites of sgKvDMR#2 and #3 were amplified from input, or ChIP DNA prior to Sanger sequencing across an allelic SNP. gDNA = genomic DNA from purebred mice. (D) Example of CpG methylation data from the KvDMR . ChIP, chromatin immunoprecipitation; gDNA, genomic DNA; HDR, homology-directed repair; mESC, mouse embryonic stem cell, NHEJ, nonhomologous end joining; sgRNA, single guide RNA; SNP, single nucleotide polymorphism; SRA, Sequence Read Archive; ssODN, single-stranded oligodeoxynucleotide.

    Journal: PLoS Biology

    Article Title: Heterochromatin delays CRISPR-Cas9 mutagenesis but does not influence the outcome of mutagenic DNA repair

    doi: 10.1371/journal.pbio.2005595

    Figure Lengend Snippet: Imprinted chromatin as a model system to quantify epigenetic influences on genome editing. (A) Schematic outlining the experimental workflow. Throughout the text, F1 hybrid cell lines are depicted with the maternal strain denoted before the paternal strain (i.e., In B×J: B is maternal and J paternal). sgRNAs are designed to cleave approximately 40–100 bp from a heterozygous SNP within imprinted chromatin (open and closed circles). MiSeq amplicons span both the SNP and site of mutation, which allows simultaneous assessment of genome editing outcome and parental allele at high-throughput. (B) Top: schematic showing the imprinted mouse Kcnq1 gene including H3K9me3 ChIP and DNase-I–seq data from mESCs available through EncODE (ENCSR000CFZ, GSM1014187) (bottom). Higher-resolution view of the KvDMR imprinted CpG island within Kcnq1 , showing the position of three sgRNAs used in panel E. (C) Allele-specific enrichment of H3K9me3 and H4K20me3. PCR fragments spanning the target sites of sgKvDMR#2 and #3 were amplified from input, or ChIP DNA prior to Sanger sequencing across an allelic SNP. gDNA = genomic DNA from purebred mice. (D) Example of CpG methylation data from the KvDMR . ChIP, chromatin immunoprecipitation; gDNA, genomic DNA; HDR, homology-directed repair; mESC, mouse embryonic stem cell, NHEJ, nonhomologous end joining; sgRNA, single guide RNA; SNP, single nucleotide polymorphism; SRA, Sequence Read Archive; ssODN, single-stranded oligodeoxynucleotide.

    Article Snippet: Editing was quantified by Illumina sequencing of PCR amplicons spanning both the site of cleavage and an allelic SNP ( and , for detailed experimental protocols see ).

    Techniques: Mutagenesis, High Throughput Screening Assay, Chromatin Immunoprecipitation, Polymerase Chain Reaction, Amplification, Sequencing, Mouse Assay, CpG Methylation Assay, Non-Homologous End Joining

    FLT3 ITD detection performance of a novel algorithm ITDseek versus Pindel, GATK HaplotypeCaller and Samtools. a Detected combination of ITD length and relative position in the FLT3 NGS amplicon 2 (chr13:28,608,112-28,608,312) was indicated by red shading in the corresponding panel of each caller. b Venn diagram showing the number of ITD alleles detected by any or none of the four tested callers.

    Journal: Diagnostic Pathology

    Article Title: Clinical evaluation of panel testing by next-generation sequencing (NGS) for gene mutations in myeloid neoplasms

    doi: 10.1186/s13000-016-0456-8

    Figure Lengend Snippet: FLT3 ITD detection performance of a novel algorithm ITDseek versus Pindel, GATK HaplotypeCaller and Samtools. a Detected combination of ITD length and relative position in the FLT3 NGS amplicon 2 (chr13:28,608,112-28,608,312) was indicated by red shading in the corresponding panel of each caller. b Venn diagram showing the number of ITD alleles detected by any or none of the four tested callers.

    Article Snippet: Amplicon sequencing libraries were prepared from 50 ng of DNA per sample using TruSight myeloid sequencing panel (Illumina, USA).

    Techniques: Next-Generation Sequencing, Amplification

    FLT3 of patients 36 and 20 as characterized by next-generation sequencing and fragment analysis. a NGS sequencing depth histogram for 3 amplicons covering FLT3 exons 13 to 15 at scale 0–30000X. Magnitude of drops in sequencing depth at amplicon 2 and the region of 3 bp deletion (c.1739_1741delAGG; indicated by arrow) was proportional to the deletion VAF as indicated. The amplicon 2 covered the 75 bp ITD (indicated by triangle) but was affected by the 3 bp deletion in cis . b PCR fragment analysis for FLT3 ITD detection. ITD of 54 bp, 63 bp (patient 36 initial sample), 25 bp and 119 bp (patient 20) detected by NGS and ITDseek were confirmed by the corresponding fragments. Single additional fragment detected in both initial and relapsed samples of patient 36 confirmed the additional allele, which consisted of 75 bp ITD and 3 bp deletion in cis and was not detected by NGS due to allele drop-out.

    Journal: Diagnostic Pathology

    Article Title: Clinical evaluation of panel testing by next-generation sequencing (NGS) for gene mutations in myeloid neoplasms

    doi: 10.1186/s13000-016-0456-8

    Figure Lengend Snippet: FLT3 of patients 36 and 20 as characterized by next-generation sequencing and fragment analysis. a NGS sequencing depth histogram for 3 amplicons covering FLT3 exons 13 to 15 at scale 0–30000X. Magnitude of drops in sequencing depth at amplicon 2 and the region of 3 bp deletion (c.1739_1741delAGG; indicated by arrow) was proportional to the deletion VAF as indicated. The amplicon 2 covered the 75 bp ITD (indicated by triangle) but was affected by the 3 bp deletion in cis . b PCR fragment analysis for FLT3 ITD detection. ITD of 54 bp, 63 bp (patient 36 initial sample), 25 bp and 119 bp (patient 20) detected by NGS and ITDseek were confirmed by the corresponding fragments. Single additional fragment detected in both initial and relapsed samples of patient 36 confirmed the additional allele, which consisted of 75 bp ITD and 3 bp deletion in cis and was not detected by NGS due to allele drop-out.

    Article Snippet: Amplicon sequencing libraries were prepared from 50 ng of DNA per sample using TruSight myeloid sequencing panel (Illumina, USA).

    Techniques: Next-Generation Sequencing, Sequencing, Amplification, Polymerase Chain Reaction

    RTS,S Amino Acid Changes and Positions. The 84 amino acids (positions 288–371) comprising the C-terminal amplicon are represented by columns in the bar-chart. The percentage of samples sharing the 3D7 amino acid are represented in pale yellow. Non-3D7 amino acid alternatives are represented in descending order of frequency in dark blue, red, light blue, or orange. Below the bar-chart, the 3D7 amino acid sequence is shown, with positions corresponding to the coordinates above. The substitutions at each of the 84 positions are enumerated below the 3D7 sequence.

    Journal: Scientific Reports

    Article Title: RTS,S/AS01 malaria vaccine mismatch observed among Plasmodium falciparum isolates from southern and central Africa and globally

    doi: 10.1038/s41598-018-24585-8

    Figure Lengend Snippet: RTS,S Amino Acid Changes and Positions. The 84 amino acids (positions 288–371) comprising the C-terminal amplicon are represented by columns in the bar-chart. The percentage of samples sharing the 3D7 amino acid are represented in pale yellow. Non-3D7 amino acid alternatives are represented in descending order of frequency in dark blue, red, light blue, or orange. Below the bar-chart, the 3D7 amino acid sequence is shown, with positions corresponding to the coordinates above. The substitutions at each of the 84 positions are enumerated below the 3D7 sequence.

    Article Snippet: Amplicon Generation and Sequencing A 300-bp amplicon containing the C-terminal Pfcsp (839-1,139-bp, clone 3D7 0304600.1, PlasmoDB ) was amplified from P. falciparum positive samples using the forward primer GACAAGGTCACAATATGCCAAA and reverse primer ACATTAAACACACTGGAACATTTTTC fused with Illumina MiSeq adapter sequences for library indexing during PCR .

    Techniques: Amplification, Sequencing