saci  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 98
    Name:
    SacI
    Description:
    SacI 10 000 units
    Catalog Number:
    r0156l
    Price:
    249
    Size:
    10 000 units
    Category:
    Restriction Enzymes
    Buy from Supplier


    Structured Review

    New England Biolabs saci
    SacI
    SacI 10 000 units
    https://www.bioz.com/result/saci/product/New England Biolabs
    Average 98 stars, based on 109 article reviews
    Price from $9.99 to $1999.99
    saci - by Bioz Stars, 2020-07
    98/100 stars

    Images

    1) Product Images from "The Transcriptional Enhancer of the Pea Plastocyanin Gene Associates with the Nuclear Matrix and Regulates Gene Expression through Histone Acetylation"

    Article Title: The Transcriptional Enhancer of the Pea Plastocyanin Gene Associates with the Nuclear Matrix and Regulates Gene Expression through Histone Acetylation

    Journal: The Plant Cell

    doi: 10.1105/tpc.011825

    Association of the PetE Enhancer Region with Nuclear Matrices in Isolated Nuclei. Nuclei were isolated from E-P-GUS or P-GUS seedlings, extracted with LIS, and digested with PvuII, MfeI, and SacI to separate the enhancer, the uidA coding region, and the nos 3′ region into individual fragments. The nuclear matrices were collected by centrifugation, and DNA was isolated from the pellet (P) and supernatant (S) fractions and analyzed by semiquantitative PCR. Total represents a sample of the digestion mixture taken before centrifugation. The enhancer and promoter regions of PetE were amplified with primer pairs y6 and y13, the uidA coding region was amplified with primer pairs G1 and G2, and the PetE promoter region was amplified with primer pairs c2 and y13.
    Figure Legend Snippet: Association of the PetE Enhancer Region with Nuclear Matrices in Isolated Nuclei. Nuclei were isolated from E-P-GUS or P-GUS seedlings, extracted with LIS, and digested with PvuII, MfeI, and SacI to separate the enhancer, the uidA coding region, and the nos 3′ region into individual fragments. The nuclear matrices were collected by centrifugation, and DNA was isolated from the pellet (P) and supernatant (S) fractions and analyzed by semiquantitative PCR. Total represents a sample of the digestion mixture taken before centrifugation. The enhancer and promoter regions of PetE were amplified with primer pairs y6 and y13, the uidA coding region was amplified with primer pairs G1 and G2, and the PetE promoter region was amplified with primer pairs c2 and y13.

    Techniques Used: Isolation, Centrifugation, Polymerase Chain Reaction, Amplification

    2) Product Images from "Codon Usage Optimization and Construction of Plasmid Encoding Iranian Human Papillomavirus Type 16 E7 Oncogene for Lactococcus Lactis Subsp. Cremoris MG1363"

    Article Title: Codon Usage Optimization and Construction of Plasmid Encoding Iranian Human Papillomavirus Type 16 E7 Oncogene for Lactococcus Lactis Subsp. Cremoris MG1363

    Journal: Asian Pacific Journal of Cancer Prevention : APJCP

    doi: 10.22034/APJCP.2017.18.3.783

    The Double Digestion Patterns of the pNZ8148-HPV16-optiE7 Shuttle Plasmid via NcoI and SacI Restriction Endonuclease
    Figure Legend Snippet: The Double Digestion Patterns of the pNZ8148-HPV16-optiE7 Shuttle Plasmid via NcoI and SacI Restriction Endonuclease

    Techniques Used: Plasmid Preparation

    3) Product Images from "Assembly of evolved ligninolytic genes in Saccharomyces cerevisiae"

    Article Title: Assembly of evolved ligninolytic genes in Saccharomyces cerevisiae

    Journal: Bioengineered

    doi: 10.4161/bioe.29167

    Figure 4. In vivo assembly of synthetic genes by IVOE. Each overlapping region allowed crossover events to occur between fragments giving rise to an autonomously repaired vector containing single and double expression cassettes in the correct orientation. ( A ) and ( B ) Single expression cassettes are constructed in pESC by engineering specific primers containing overhangs to foster in vivo cloning with the linearized plasmid in yeast (pJRoC30 was used as template for Vp or Lac amplifications). ( C ) and ( D ) The pESC constructs obtained in ( A ) and ( B ) were used as scaffolds to assemble Lac and Vp genes under the control of different promoter/terminator pairs. Primers used: (1)-MCS1- Vp / Lac -α-BamHI, (2)-MCS2- Vp -ter-NheI, (3)-MCS2- Lac -ter-NheI, (4)-MCS1- Vp / Lac -α-SpeI, (5)-MCS1- Lac -ter-SacI and (6)-MCS1- Vp -ter-SacI. Black arrows indicate the direction of the transcription process.
    Figure Legend Snippet: Figure 4. In vivo assembly of synthetic genes by IVOE. Each overlapping region allowed crossover events to occur between fragments giving rise to an autonomously repaired vector containing single and double expression cassettes in the correct orientation. ( A ) and ( B ) Single expression cassettes are constructed in pESC by engineering specific primers containing overhangs to foster in vivo cloning with the linearized plasmid in yeast (pJRoC30 was used as template for Vp or Lac amplifications). ( C ) and ( D ) The pESC constructs obtained in ( A ) and ( B ) were used as scaffolds to assemble Lac and Vp genes under the control of different promoter/terminator pairs. Primers used: (1)-MCS1- Vp / Lac -α-BamHI, (2)-MCS2- Vp -ter-NheI, (3)-MCS2- Lac -ter-NheI, (4)-MCS1- Vp / Lac -α-SpeI, (5)-MCS1- Lac -ter-SacI and (6)-MCS1- Vp -ter-SacI. Black arrows indicate the direction of the transcription process.

    Techniques Used: In Vivo, Plasmid Preparation, Expressing, Construct, Clone Assay

    4) Product Images from "CRISPR-Cas9 genome editing induces megabase-scale chromosomal truncations"

    Article Title: CRISPR-Cas9 genome editing induces megabase-scale chromosomal truncations

    Journal: Nature Communications

    doi: 10.1038/s41467-019-09006-2

    Single nickase-mediated gene editing results in c.217 C clone for CEP disease modeling a (Left) Scheme of gene editing approach to convert wild-type HEK293T (WT HEK) into homozygous c.217 C HEK clone using nickase and a 181nt-ssODN carrying c.217 C mutation (called 181nt-ssODN-c.217 C). (Right) Detailed view of exon 4 region and CRISPR-mediated HDR design using a c.217T-targeting sgRNA and a 181nt-ssODN-c.217 C carrying c.217 C mutation (red) in addition to silent SacI restriction site (blue). Expected cleavage position using nickase is indicated with a red arrow. b – d (From left to right) Illustrative flow cytometry results for fluorocyte analysis, representative RFLP analysis, sequence spanning UROS exon 4 c.217 position obtained by Sanger sequencing and indels and HDR quantification by TIDER analysis ( b ) for WT HEK, ( c ) for cells transfected with nickase and a 181nt-ssODN-c.217 C (Mixed HEK population) and ( d ) for sorted and subcloned fluorocytes (PE-Cy5A-positive), called c.217 C HEK clone. Loq: limit of quantification. e Characterization of c.217 C HEK clone. UROS functionality assay with (Left) quantification of UROS-specific activity and (Right) fluorocyte frequencies from WT HEK or c.217 C HEK clone. Values for UROS-specific activity are normalized against WT HEK. Results are presented as mean ± SEM. For ( e ), source data are provided as a Source data file
    Figure Legend Snippet: Single nickase-mediated gene editing results in c.217 C clone for CEP disease modeling a (Left) Scheme of gene editing approach to convert wild-type HEK293T (WT HEK) into homozygous c.217 C HEK clone using nickase and a 181nt-ssODN carrying c.217 C mutation (called 181nt-ssODN-c.217 C). (Right) Detailed view of exon 4 region and CRISPR-mediated HDR design using a c.217T-targeting sgRNA and a 181nt-ssODN-c.217 C carrying c.217 C mutation (red) in addition to silent SacI restriction site (blue). Expected cleavage position using nickase is indicated with a red arrow. b – d (From left to right) Illustrative flow cytometry results for fluorocyte analysis, representative RFLP analysis, sequence spanning UROS exon 4 c.217 position obtained by Sanger sequencing and indels and HDR quantification by TIDER analysis ( b ) for WT HEK, ( c ) for cells transfected with nickase and a 181nt-ssODN-c.217 C (Mixed HEK population) and ( d ) for sorted and subcloned fluorocytes (PE-Cy5A-positive), called c.217 C HEK clone. Loq: limit of quantification. e Characterization of c.217 C HEK clone. UROS functionality assay with (Left) quantification of UROS-specific activity and (Right) fluorocyte frequencies from WT HEK or c.217 C HEK clone. Values for UROS-specific activity are normalized against WT HEK. Results are presented as mean ± SEM. For ( e ), source data are provided as a Source data file

    Techniques Used: Mutagenesis, CRISPR, Flow Cytometry, Cytometry, Sequencing, Transfection, Activity Assay

    Single nickase-mediated gene editing allows precise genetic and phenotypic correction. a (Left) Scheme of gene editing approach to modify the c.217 C HEK clone and turn it into genetically and phenotypically corrected HEK using nickase and a 181nt-ssODN carrying the c.217 T correcting mutation (called 181nt-ssODN-c.217 T). (Right) Detailed view of the c.217 C HEK clone containing c.217 C mutation (red) and SacI restriction site (blue). Nickase-mediated HDR design using a c.217C- SacI -specific sgRNA and a 181nt-ssODN-c.217 T carrying the c.217 T correcting mutation (grey) in addition to silent SacI restriction site (blue). Expected cleavage position using nickase is indicated with a red arrow. b – d (From left to right) Illustrative FACS (fluorescent activating cell sorting)results for fluorocyte analysis (PE-Cy5A-positive), representative RFLP analysis, sequence spanning UROS exon 4 c.217 position obtained by Sanger sequencing and indels and HDR quantification by TIDER analysis, ( b ) for the c.217 C HEK clone, ( c ) for cells transfected with nickase and 181nt-ssODN-c.217 T (Mix corrected HEK population), and ( d ) for PE-Cy5A-negative HEK293T cells sorted by FACS (called Sorted corrected HEK population). Loq: limit of quantification. e UROS functionality assays with (Left) quantification of UROS-specific activity ( n = 3) and (Right) fluorocytes frequencies from the c.217 C HEK clone, corrected HEK population and sorted corrected HEK population ( n ≥ 3). Values for UROS-specific activity are normalized with WT HEK. Results are presented as mean ± SEM. Data are from independent experiments. Statistical significance is inferred on raw data using two-tailed unpaired t-test for UROS-specific activity and paired one-way ANOVA for fluorocyte frequencies; ** p
    Figure Legend Snippet: Single nickase-mediated gene editing allows precise genetic and phenotypic correction. a (Left) Scheme of gene editing approach to modify the c.217 C HEK clone and turn it into genetically and phenotypically corrected HEK using nickase and a 181nt-ssODN carrying the c.217 T correcting mutation (called 181nt-ssODN-c.217 T). (Right) Detailed view of the c.217 C HEK clone containing c.217 C mutation (red) and SacI restriction site (blue). Nickase-mediated HDR design using a c.217C- SacI -specific sgRNA and a 181nt-ssODN-c.217 T carrying the c.217 T correcting mutation (grey) in addition to silent SacI restriction site (blue). Expected cleavage position using nickase is indicated with a red arrow. b – d (From left to right) Illustrative FACS (fluorescent activating cell sorting)results for fluorocyte analysis (PE-Cy5A-positive), representative RFLP analysis, sequence spanning UROS exon 4 c.217 position obtained by Sanger sequencing and indels and HDR quantification by TIDER analysis, ( b ) for the c.217 C HEK clone, ( c ) for cells transfected with nickase and 181nt-ssODN-c.217 T (Mix corrected HEK population), and ( d ) for PE-Cy5A-negative HEK293T cells sorted by FACS (called Sorted corrected HEK population). Loq: limit of quantification. e UROS functionality assays with (Left) quantification of UROS-specific activity ( n = 3) and (Right) fluorocytes frequencies from the c.217 C HEK clone, corrected HEK population and sorted corrected HEK population ( n ≥ 3). Values for UROS-specific activity are normalized with WT HEK. Results are presented as mean ± SEM. Data are from independent experiments. Statistical significance is inferred on raw data using two-tailed unpaired t-test for UROS-specific activity and paired one-way ANOVA for fluorocyte frequencies; ** p

    Techniques Used: Mutagenesis, FACS, Sequencing, Transfection, Activity Assay, Two Tailed Test

    UROS gene editing strategy and workflow analysis. a Experimental workflow for UROS gene editing and analysis of outcomes. Cells were nucleofected with the 181nt-ssODN template and either with nuclease or nickase followed by puromycin-positive selection. Then, (i) UROS locus was characterized by RFLP to quantify HDR and by TIDER or deep sequencing to evaluate indels and to confirm HDR percentage; (ii) UROS functionality was assessed by quantifying UROS-specific activity and type-I porphyrin accumulation, respectively determined by HPLC and flow cytometry; (iii) Chromosomal integrity was tested for Chr10 loss or Chr10q terminal deletion either by DNA-FISH assay or array-CGH. b (Top) Schematic UROS locus in chromosome 10 with UROS gene overview (middle). (Bottom) Detailed view of exon 4 region and CRISPR-mediated HDR design using a c.217T-targeting sgRNA (highlighted in orange) with adjacent PAM and an 181nt-ssODN carrying a silent SacI restriction site (highlighted in blue) close to c.217 T position. Red arrows indicate expected cleavage site using nuclease. Chr chromosome, CGH comparative genomic hybridization, D day, e exon, HDR homology-directed repair, HPLC high performance liquid chromatography, NGS (next-generation sequencing), RFLP (restriction fragment length polymorphism), PAM protospacer adjacent motif, sgRNA single guide RNA, TIDER (tracking of insertions, deletions and recombination events)
    Figure Legend Snippet: UROS gene editing strategy and workflow analysis. a Experimental workflow for UROS gene editing and analysis of outcomes. Cells were nucleofected with the 181nt-ssODN template and either with nuclease or nickase followed by puromycin-positive selection. Then, (i) UROS locus was characterized by RFLP to quantify HDR and by TIDER or deep sequencing to evaluate indels and to confirm HDR percentage; (ii) UROS functionality was assessed by quantifying UROS-specific activity and type-I porphyrin accumulation, respectively determined by HPLC and flow cytometry; (iii) Chromosomal integrity was tested for Chr10 loss or Chr10q terminal deletion either by DNA-FISH assay or array-CGH. b (Top) Schematic UROS locus in chromosome 10 with UROS gene overview (middle). (Bottom) Detailed view of exon 4 region and CRISPR-mediated HDR design using a c.217T-targeting sgRNA (highlighted in orange) with adjacent PAM and an 181nt-ssODN carrying a silent SacI restriction site (highlighted in blue) close to c.217 T position. Red arrows indicate expected cleavage site using nuclease. Chr chromosome, CGH comparative genomic hybridization, D day, e exon, HDR homology-directed repair, HPLC high performance liquid chromatography, NGS (next-generation sequencing), RFLP (restriction fragment length polymorphism), PAM protospacer adjacent motif, sgRNA single guide RNA, TIDER (tracking of insertions, deletions and recombination events)

    Techniques Used: Selection, Sequencing, Activity Assay, High Performance Liquid Chromatography, Flow Cytometry, Cytometry, Fluorescence In Situ Hybridization, CRISPR, Hybridization, Next-Generation Sequencing

    Nuclease-mediated HDR is associated with predominant indels leading to impaired UROS functionality. a (Left) Scheme of SacI -digested PCR products obtained for alleles with or without HDR. (Center) Illustrative RFLP analysis of non-transfected HEK293T cells (NT) or transfected with nuclease only or co-delivered with the 181nt-ssODN template. (Right) HDR frequency induced by nuclease and a 181nt-ssODN ( n = 5). b (Left) NGS analysis of allelic outcomes and associated HDR/indel ratio following transfection of HEK293T cells with nuclease and 181nt-ssODN. (Center) Frequencies of reads carrying either insertion or deletion. Region spanning sgRNA sequence is highlighted in grey. (Right) Most common observed alleles (with frequencies ≥ 1%) aligned on the sgRNA sequence. HDR modification in blue and indels in red. c (Left) Quantification of UROS-specific activity from HEK293T cells NT or transfected with nuclease and 181nt-ssODN ( n = 3). Values are normalized with NT cells. (Right) Fluorocyte frequencies and illustrative flow cytometry results from NT or HEK293T cells transfected with nuclease and a 181nt-ssODN ( n = 5). Blue and red dots (and associated percentages) depict non-fluorescent cells and fluorocytes, respectively, with type-I porphyrin accumulation. Results are presented as mean ± SEM. The data are from independent experiments. Statistical significance is inferred on raw data using two-tailed unpaired t test for UROS-specific activity. *** p
    Figure Legend Snippet: Nuclease-mediated HDR is associated with predominant indels leading to impaired UROS functionality. a (Left) Scheme of SacI -digested PCR products obtained for alleles with or without HDR. (Center) Illustrative RFLP analysis of non-transfected HEK293T cells (NT) or transfected with nuclease only or co-delivered with the 181nt-ssODN template. (Right) HDR frequency induced by nuclease and a 181nt-ssODN ( n = 5). b (Left) NGS analysis of allelic outcomes and associated HDR/indel ratio following transfection of HEK293T cells with nuclease and 181nt-ssODN. (Center) Frequencies of reads carrying either insertion or deletion. Region spanning sgRNA sequence is highlighted in grey. (Right) Most common observed alleles (with frequencies ≥ 1%) aligned on the sgRNA sequence. HDR modification in blue and indels in red. c (Left) Quantification of UROS-specific activity from HEK293T cells NT or transfected with nuclease and 181nt-ssODN ( n = 3). Values are normalized with NT cells. (Right) Fluorocyte frequencies and illustrative flow cytometry results from NT or HEK293T cells transfected with nuclease and a 181nt-ssODN ( n = 5). Blue and red dots (and associated percentages) depict non-fluorescent cells and fluorocytes, respectively, with type-I porphyrin accumulation. Results are presented as mean ± SEM. The data are from independent experiments. Statistical significance is inferred on raw data using two-tailed unpaired t test for UROS-specific activity. *** p

    Techniques Used: Polymerase Chain Reaction, Transfection, Next-Generation Sequencing, Sequencing, Modification, Activity Assay, Flow Cytometry, Cytometry, Two Tailed Test

    Related Articles

    Polymerase Chain Reaction:

    Article Title: CRISPR-Cas9 genome editing induces megabase-scale chromosomal truncations
    Article Snippet: .. PCR products were purified with Nucleospin® Gel and PCR Clean-up (Macherey-Nagel) and digested with SacI (or ApaI for exon 10 UROS analysis) restriction enzyme (New England Biolabs, Ipswich, MA, USA) for 1 h at 37 °C. .. Then, 5 ng digestion products were loaded into the Agilent® 2200 TapeStation (Santa Clara, CA, USA) capillary electrophoresis using D1000 ScreenTape and D1000 reagents according to the manufacturer’s protocol.

    Amplification:

    Article Title: Engineering and Validation of a Vector for Concomitant Expression of Rare Transfer RNA (tRNA) and HIV-1 nef Genes in Escherichia coli
    Article Snippet: .. The resulting 600bp amplicon was gel purified and restricted with Nhe I (NEB, #R0131L) and Sac I (NEB, #R0156L) for 8h at 37°C, and purified. .. Two vector backbones were prepared by whole plasmid PCR of 100 ng pSA-HNef-6His and pSA-HNef-6His-RIL using pSA-Nhe I-R and pSA-F primers ( ) and 25 cycles.

    Agarose Gel Electrophoresis:

    Article Title: pKBuS13, a KPC-2-Encoding Plasmid from Klebsiella pneumoniae Sequence Type 833, Carrying Tn4401b Inserted into an Xer Site-Specific Recombination Locus
    Article Snippet: .. Plasmid restriction analysis was carried on with BamHI, HindIII, PstI, and SacI restriction enzymes according to the manufacturer's instructions (New England BioLabs, Mississauga, Ontario, Canada) followed by separation on 0.8% agarose gel. ..

    Plasmid Preparation:

    Article Title: Codon Usage Optimization and Construction of Plasmid Encoding Iranian Human Papillomavirus Type 16 E7 Oncogene for Lactococcus Lactis Subsp. Cremoris MG1363
    Article Snippet: .. Construction of shuttle vector The optimized E7 gene, encoding the E7 oncoprotein from HPV 16, was obtained as a 291 bp DNA fragment by digesting plasmid PMD18 with restriction enzymes NcoI and SacI (New England Biolabs). .. The resultant DNA fragment was ligated into the NcoI/SacI site of pNZ8148 shuttle vector (MoBiTec, Germany).

    Article Title: pKBuS13, a KPC-2-Encoding Plasmid from Klebsiella pneumoniae Sequence Type 833, Carrying Tn4401b Inserted into an Xer Site-Specific Recombination Locus
    Article Snippet: .. Plasmid restriction analysis was carried on with BamHI, HindIII, PstI, and SacI restriction enzymes according to the manufacturer's instructions (New England BioLabs, Mississauga, Ontario, Canada) followed by separation on 0.8% agarose gel. ..

    Article Title: Assembly of evolved ligninolytic genes in Saccharomyces cerevisiae
    Article Snippet: .. The ura3 -deficient S. cerevisiae strain BJ5465 ( α ura3–52 trp1 leu2Δ1 his3Δ200 pep4::HIS2 prb1Δ1.6R can1 GAL1 ) was obtained from LGCPromochem, the NucleoSpin Plasmid kit was purchased from Macherey-Nagel, and the restriction enzymes BamHI, NheI, SpeI, SacI, and NotI from New England Biolabs. ..

    Purification:

    Article Title: CRISPR-Cas9 genome editing induces megabase-scale chromosomal truncations
    Article Snippet: .. PCR products were purified with Nucleospin® Gel and PCR Clean-up (Macherey-Nagel) and digested with SacI (or ApaI for exon 10 UROS analysis) restriction enzyme (New England Biolabs, Ipswich, MA, USA) for 1 h at 37 °C. .. Then, 5 ng digestion products were loaded into the Agilent® 2200 TapeStation (Santa Clara, CA, USA) capillary electrophoresis using D1000 ScreenTape and D1000 reagents according to the manufacturer’s protocol.

    Article Title: Engineering and Validation of a Vector for Concomitant Expression of Rare Transfer RNA (tRNA) and HIV-1 nef Genes in Escherichia coli
    Article Snippet: .. The resulting 600bp amplicon was gel purified and restricted with Nhe I (NEB, #R0131L) and Sac I (NEB, #R0156L) for 8h at 37°C, and purified. .. Two vector backbones were prepared by whole plasmid PCR of 100 ng pSA-HNef-6His and pSA-HNef-6His-RIL using pSA-Nhe I-R and pSA-F primers ( ) and 25 cycles.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs saci plus bamhi
    Possible involvement of NHEJ in PM-DSB repair. ( A ) Construct for the ectopic expression of GFP-tagged DNA-PKcs (TTHERM_00203010). GFP under the cadmium-inducible MTT1 promoter was introduced into DNA-PKcs in the MAC. Approximately 1 kb of the DNA-PKcs 5′ UTR and ORF were amplified from SB210 genomic DNA using PrimeSTAR Max DNA Polymerase (TaKaRa) and the following primers: DNA-PKcs 5′ forward – AGTCGAGCTCACTTTAGCATTGGCTAATGCATG, reverse – AGTCGTCGACTTTTTAACGAATTCAAAAAAATAATAATAAGC; and DNA-PKcs 3′ forward – AGTCGGATCCATGTTAGAGCATTTACTTGAAAGCGC, reverse – AGTCGGTACCTGAGAATAAGCTGTCAACAC. Amplified forward and reverse target fragments were cloned into the <t>SacI–SalI</t> and <t>BamHI–KpnI</t> sites, respectively, of the backbone plasmid pBNMB1-EGFP (a gift from Dr Kazufumi Mochizuki, CNRS Institute of Human Genetics, Montpellier, France). The resulting vector (pEGFP-DNA-PKcs-NEO5) was linearized with Sac I plus Kpn I before biolistic transformation into Tetrahymena . ( B ) Localization of GFP-DNA-PKcs at the post-meiotic stage. Wild-type cells (left) were mated with tagged cells (right). Prior to pronuclear selection, DNA-PKcs localizes only to the MAC. Upon pronuclear selection, it appears in the selected pronucleus (red arrowhead). Scale bar denotes 10 μm. DOI: http://dx.doi.org/10.7554/eLife.26176.006
    Saci Plus Bamhi, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/saci plus bamhi/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    saci plus bamhi - by Bioz Stars, 2020-07
    99/100 stars
      Buy from Supplier

    91
    New England Biolabs saci sites
    CpAls7 disruption strategy based on SAT1 flipper cassette ( A ). Upstream and downstream homology sequences from C. parapsilosis reference strain ATCC 22019 were amplified and inserted at the <t>ApaI/XhoI</t> and <t>SacII/SacI</t> sites surrounding the SAT1 flipper cassette.
    Saci Sites, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/saci sites/product/New England Biolabs
    Average 91 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    saci sites - by Bioz Stars, 2020-07
    91/100 stars
      Buy from Supplier

    95
    New England Biolabs saci hf
    Plasmid stability. GFP expression was induced with 500 ng/ml of ATc. ON culture of day 0 was supplemented with 15 μg/ml kanamycin, while ON cultures of days 1–4 were supplemented with 50 μg/ml ampicillin. (A) GFP expression in F. novicida U112 pFNMB1 msfgfp ON cultures of day 0 and day 4. (B) GFP expression in F. novicida U112 pFNMB2 msfgfp ON cultures of day 0 and day 4. (A,B) Images are a merge of phase contrast and GFP channel. 26 × 39 μm fields of view are shown. Scale bar represent 5 μm. Representative replicates are shown. Three independent experiments were performed. (C) Survival assay performed with ON cultures of F. novicida U112 pFNMB1 msfgfp and F. novicida U112 pFNMB2 msfgfp plated on ampicillin and ampicillin/kanamycin plates. Three independent experiments were performed. (D) Digestion of pFNMB1 msfgfp with <t>SacI</t> and <t>SpeI</t> restriction enzymes. (E) Digestion of pFNMB2 msfgfp with SacI and SpeI restriction enzymes. (D,E) Plasmids were passaged in F. novicida for 4 days before being transformed into E. coli . Controls were isolated directly from E. coli . Representative replicates are shown. Three independent experiments were performed.
    Saci Hf, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/saci hf/product/New England Biolabs
    Average 95 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    saci hf - by Bioz Stars, 2020-07
    95/100 stars
      Buy from Supplier

    Image Search Results


    Possible involvement of NHEJ in PM-DSB repair. ( A ) Construct for the ectopic expression of GFP-tagged DNA-PKcs (TTHERM_00203010). GFP under the cadmium-inducible MTT1 promoter was introduced into DNA-PKcs in the MAC. Approximately 1 kb of the DNA-PKcs 5′ UTR and ORF were amplified from SB210 genomic DNA using PrimeSTAR Max DNA Polymerase (TaKaRa) and the following primers: DNA-PKcs 5′ forward – AGTCGAGCTCACTTTAGCATTGGCTAATGCATG, reverse – AGTCGTCGACTTTTTAACGAATTCAAAAAAATAATAATAAGC; and DNA-PKcs 3′ forward – AGTCGGATCCATGTTAGAGCATTTACTTGAAAGCGC, reverse – AGTCGGTACCTGAGAATAAGCTGTCAACAC. Amplified forward and reverse target fragments were cloned into the SacI–SalI and BamHI–KpnI sites, respectively, of the backbone plasmid pBNMB1-EGFP (a gift from Dr Kazufumi Mochizuki, CNRS Institute of Human Genetics, Montpellier, France). The resulting vector (pEGFP-DNA-PKcs-NEO5) was linearized with Sac I plus Kpn I before biolistic transformation into Tetrahymena . ( B ) Localization of GFP-DNA-PKcs at the post-meiotic stage. Wild-type cells (left) were mated with tagged cells (right). Prior to pronuclear selection, DNA-PKcs localizes only to the MAC. Upon pronuclear selection, it appears in the selected pronucleus (red arrowhead). Scale bar denotes 10 μm. DOI: http://dx.doi.org/10.7554/eLife.26176.006

    Journal: eLife

    Article Title: Post-meiotic DNA double-strand breaks occur in Tetrahymena, and require Topoisomerase II and Spo11

    doi: 10.7554/eLife.26176

    Figure Lengend Snippet: Possible involvement of NHEJ in PM-DSB repair. ( A ) Construct for the ectopic expression of GFP-tagged DNA-PKcs (TTHERM_00203010). GFP under the cadmium-inducible MTT1 promoter was introduced into DNA-PKcs in the MAC. Approximately 1 kb of the DNA-PKcs 5′ UTR and ORF were amplified from SB210 genomic DNA using PrimeSTAR Max DNA Polymerase (TaKaRa) and the following primers: DNA-PKcs 5′ forward – AGTCGAGCTCACTTTAGCATTGGCTAATGCATG, reverse – AGTCGTCGACTTTTTAACGAATTCAAAAAAATAATAATAAGC; and DNA-PKcs 3′ forward – AGTCGGATCCATGTTAGAGCATTTACTTGAAAGCGC, reverse – AGTCGGTACCTGAGAATAAGCTGTCAACAC. Amplified forward and reverse target fragments were cloned into the SacI–SalI and BamHI–KpnI sites, respectively, of the backbone plasmid pBNMB1-EGFP (a gift from Dr Kazufumi Mochizuki, CNRS Institute of Human Genetics, Montpellier, France). The resulting vector (pEGFP-DNA-PKcs-NEO5) was linearized with Sac I plus Kpn I before biolistic transformation into Tetrahymena . ( B ) Localization of GFP-DNA-PKcs at the post-meiotic stage. Wild-type cells (left) were mated with tagged cells (right). Prior to pronuclear selection, DNA-PKcs localizes only to the MAC. Upon pronuclear selection, it appears in the selected pronucleus (red arrowhead). Scale bar denotes 10 μm. DOI: http://dx.doi.org/10.7554/eLife.26176.006

    Article Snippet: Amplified PCR products were purified with a PCR Clean-up kit (Promega, Madison, WI), then 5′ sequences were digested with SacI plus BamHI (New England BioLabs, Ipswich, MA) and 3′ sequences with XhoI plus KpnI (New England BioLabs).

    Techniques: Non-Homologous End Joining, Construct, Expressing, Amplification, Clone Assay, Plasmid Preparation, Transformation Assay, Selection

    CpAls7 disruption strategy based on SAT1 flipper cassette ( A ). Upstream and downstream homology sequences from C. parapsilosis reference strain ATCC 22019 were amplified and inserted at the ApaI/XhoI and SacII/SacI sites surrounding the SAT1 flipper cassette.

    Journal: Virulence

    Article Title: Targeted gene disruption in Candida parapsilosis demonstrates a role for CPAR2_404800 in adhesion to a biotic surface and in a murine model of ascending urinary tract infection

    doi: 10.1080/21505594.2015.1112491

    Figure Lengend Snippet: CpAls7 disruption strategy based on SAT1 flipper cassette ( A ). Upstream and downstream homology sequences from C. parapsilosis reference strain ATCC 22019 were amplified and inserted at the ApaI/XhoI and SacII/SacI sites surrounding the SAT1 flipper cassette.

    Article Snippet: Primers 5COM3F and 5COM3R ( Table S2 ), containing ApaI and SacI sites respectively were used in order to amplify the entire coding sequence of CpALS7 (+4439 bp, comprehensive of −26 upstream and +261 downstream bp) using Q5® High-Fidelity DNA Polymerases by New England Biolabs Inc..

    Techniques: Amplification

    Plasmid stability. GFP expression was induced with 500 ng/ml of ATc. ON culture of day 0 was supplemented with 15 μg/ml kanamycin, while ON cultures of days 1–4 were supplemented with 50 μg/ml ampicillin. (A) GFP expression in F. novicida U112 pFNMB1 msfgfp ON cultures of day 0 and day 4. (B) GFP expression in F. novicida U112 pFNMB2 msfgfp ON cultures of day 0 and day 4. (A,B) Images are a merge of phase contrast and GFP channel. 26 × 39 μm fields of view are shown. Scale bar represent 5 μm. Representative replicates are shown. Three independent experiments were performed. (C) Survival assay performed with ON cultures of F. novicida U112 pFNMB1 msfgfp and F. novicida U112 pFNMB2 msfgfp plated on ampicillin and ampicillin/kanamycin plates. Three independent experiments were performed. (D) Digestion of pFNMB1 msfgfp with SacI and SpeI restriction enzymes. (E) Digestion of pFNMB2 msfgfp with SacI and SpeI restriction enzymes. (D,E) Plasmids were passaged in F. novicida for 4 days before being transformed into E. coli . Controls were isolated directly from E. coli . Representative replicates are shown. Three independent experiments were performed.

    Journal: Frontiers in Cellular and Infection Microbiology

    Article Title: Mobilizable Plasmids for Tunable Gene Expression in Francisella novicida

    doi: 10.3389/fcimb.2018.00284

    Figure Lengend Snippet: Plasmid stability. GFP expression was induced with 500 ng/ml of ATc. ON culture of day 0 was supplemented with 15 μg/ml kanamycin, while ON cultures of days 1–4 were supplemented with 50 μg/ml ampicillin. (A) GFP expression in F. novicida U112 pFNMB1 msfgfp ON cultures of day 0 and day 4. (B) GFP expression in F. novicida U112 pFNMB2 msfgfp ON cultures of day 0 and day 4. (A,B) Images are a merge of phase contrast and GFP channel. 26 × 39 μm fields of view are shown. Scale bar represent 5 μm. Representative replicates are shown. Three independent experiments were performed. (C) Survival assay performed with ON cultures of F. novicida U112 pFNMB1 msfgfp and F. novicida U112 pFNMB2 msfgfp plated on ampicillin and ampicillin/kanamycin plates. Three independent experiments were performed. (D) Digestion of pFNMB1 msfgfp with SacI and SpeI restriction enzymes. (E) Digestion of pFNMB2 msfgfp with SacI and SpeI restriction enzymes. (D,E) Plasmids were passaged in F. novicida for 4 days before being transformed into E. coli . Controls were isolated directly from E. coli . Representative replicates are shown. Three independent experiments were performed.

    Article Snippet: The next day, colonies were grown in liquid LB supplemented with 50 μg/ml kanamycin, plasmid DNA was isolated and 250 ng of each plasmid was digested with SacI-HF and SpeI restriction enzymes (New England BioLabs) for 1 h. As control, both plasmids were additionally isolated from E. coli directly, without passaging in F. novicida , and digested identically.

    Techniques: Plasmid Preparation, Expressing, Clonogenic Cell Survival Assay, Transformation Assay, Isolation

    Effect of linker length on methylation targeting in ER2267 E . coli cells. (a) Schematic of protein constructs and linkers used in E . coli studies. (b) Methylation was tested in a two plasmid ER2267 system with inducible dCas9-MC/MN genes and constitutively expressed sgRNA1. Each of site 1 and site 2 contains a CpG site imbedded in an FspI site to allow screening of methylation by FspI endonuclease. Plasmid DNA isolated from cells containing this plasmid pair and expressing sgRNA1 were subjected to in vitro restriction enzyme protection assay to test (c) the effect of shortening the linker length on methylation at a fixed gap distance (d) the effect of lengthening the linker on methylation at longer gap distances, and (e) the effect of lengthening the linker on methylation at gap distances for which the dCas9-MC/MN enzyme with the 15 aa linker is ineffective at methylation. sgRNA1 is designed to target methylation to site 1. The sizes of bands corresponding to methylation at the indicated sites are specified to the right of the gel images. The asterisk indicates that dCas9-MC/MN expression was not induced. All plasmid DNA was digested with SacI (to linearize the plasmid) and FspI (to test for methylation at sites 1 and 2). Plasmid pEncode lacks FspI restriction enzyme site and is the band at the top of the gel.

    Journal: PLoS ONE

    Article Title: Protein engineering strategies for improving the selective methylation of target CpG sites by a dCas9-directed cytosine methyltransferase in bacteria

    doi: 10.1371/journal.pone.0209408

    Figure Lengend Snippet: Effect of linker length on methylation targeting in ER2267 E . coli cells. (a) Schematic of protein constructs and linkers used in E . coli studies. (b) Methylation was tested in a two plasmid ER2267 system with inducible dCas9-MC/MN genes and constitutively expressed sgRNA1. Each of site 1 and site 2 contains a CpG site imbedded in an FspI site to allow screening of methylation by FspI endonuclease. Plasmid DNA isolated from cells containing this plasmid pair and expressing sgRNA1 were subjected to in vitro restriction enzyme protection assay to test (c) the effect of shortening the linker length on methylation at a fixed gap distance (d) the effect of lengthening the linker on methylation at longer gap distances, and (e) the effect of lengthening the linker on methylation at gap distances for which the dCas9-MC/MN enzyme with the 15 aa linker is ineffective at methylation. sgRNA1 is designed to target methylation to site 1. The sizes of bands corresponding to methylation at the indicated sites are specified to the right of the gel images. The asterisk indicates that dCas9-MC/MN expression was not induced. All plasmid DNA was digested with SacI (to linearize the plasmid) and FspI (to test for methylation at sites 1 and 2). Plasmid pEncode lacks FspI restriction enzyme site and is the band at the top of the gel.

    Article Snippet: Plasmid DNA (180 ng) was incubated with 10 units FspI and 20 units SacI-HF in 10 μl Cutsmart Buffer (NEB) at 37°C for 1.5 hours.

    Techniques: Methylation, Construct, Plasmid Preparation, Isolation, Expressing, In Vitro