saci  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    SacI
    Description:
    SacI 10 000 units
    Catalog Number:
    R0156L
    Price:
    244
    Size:
    10 000 units
    Category:
    Restriction Enzymes
    Score:
    85
    Buy from Supplier


    Structured Review

    New England Biolabs saci
    SacI
    SacI 10 000 units
    https://www.bioz.com/result/saci/product/New England Biolabs
    Average 99 stars, based on 0 article reviews
    Price from $9.99 to $1999.99
    saci - by Bioz Stars, 2019-12
    99/100 stars

    Images

    1) Product Images from "The mechanism of transactivation regulation due to polymorphic short tandem repeats (STRs) using IGF1 promoter as a model"

    Article Title: The mechanism of transactivation regulation due to polymorphic short tandem repeats (STRs) using IGF1 promoter as a model

    Journal: Scientific Reports

    doi: 10.1038/srep38225

    Effect of the C allele of rs35767 on IGF1 promoter activity. (a) There was no significant difference in promoter activity between haplotype T-T-T and SacI digested haplotype C-T-T. (b) Compared to the promoter activity of haplotype C-T-T, which has been described previously 29 , a significant decrease in promoter activity was observed in plasmids with low microsatellite repeat numbers, 17 or 18 repeats. Relative luciferase activity is shown as mean ± SD. One-way ANOVA was used for group comparison among four STRs (in a ) and student’s t test was used for comparison of two haplotypes (in b ). Each assay was repeated for four times in each of the four independent experiments (n = 16) (* p
    Figure Legend Snippet: Effect of the C allele of rs35767 on IGF1 promoter activity. (a) There was no significant difference in promoter activity between haplotype T-T-T and SacI digested haplotype C-T-T. (b) Compared to the promoter activity of haplotype C-T-T, which has been described previously 29 , a significant decrease in promoter activity was observed in plasmids with low microsatellite repeat numbers, 17 or 18 repeats. Relative luciferase activity is shown as mean ± SD. One-way ANOVA was used for group comparison among four STRs (in a ) and student’s t test was used for comparison of two haplotypes (in b ). Each assay was repeated for four times in each of the four independent experiments (n = 16) (* p

    Techniques Used: Activity Assay, Luciferase

    2) Product Images from "Dynamic Reconfiguration of Long Human Genes during One Transcription Cycle"

    Article Title: Dynamic Reconfiguration of Long Human Genes during One Transcription Cycle

    Journal:

    doi: 10.1128/MCB.00179-12

    Stimulation induces an enlarging subgene loop to form in 221-kbp SAMD4A . HUVECs were treated with TNF-α for 0 to 85 min, and 3C was performed. In some cases, DRB (50 μM) was added 25 min before harvesting. Diagrams on the left illustrate regions targeted by 3C primers (green arrow for reference point, white for others). (A) Changing contacts detected using 3C and conventional PCR (3C-PCR) on templates generated using SacI. Frequent contacts between reference point b and the segment of the gene indicated are reflected by a band (from b plus a at the top through b plus c to b plus i). Contacts sweep down the gene in time with the traveling wave. DRB abolishes contacts. At 0 min, primers b plus h yield a band (indicative of a “whole-gene loop”) that disappears upon stimulation to reappear after 85 min. BAC, control 3C samples prepared using DNA from a bacterial artificial chromosome encoding SAMD4A ; different primer pairs yield bands of comparable intensities. Intra- GAPDH and loading, unchanging (control) bands given by primers targeting two different restriction fragments in GAPDH or convergent primers targeting the same restriction fragment in SAMD4A . (B) Changing contacts detected using 3C-PCR on templates generated using HindIII. Primer i (green) was paired in turn with the primers indicated. Details and controls are as for panel A. Contacts sweep down the gene in time with the traveling wave, and a whole-gene loop is seen at 0 min. (C) 3C-PCR on templates generated using HindIII confirms the formation of enlarging subgene loops using primers from panel B. The positions of the traveling (green) and standing waves (yellow) are shown (data from reference ). Interaction frequencies (arbitrary units [au] ± the SD; n = 4) are normalized relative to values given by “loading” and “intra- GAPDH ” controls. Peak interactions coincide with peaks in the traveling wave, and a whole-gene loop is only seen at 0 and 85 min. *, difference significant ( P < 0.01, two-tailed Student t test) compared to the 0-min sample or to the 30-min sample in the case of the 0-min sample.
    Figure Legend Snippet: Stimulation induces an enlarging subgene loop to form in 221-kbp SAMD4A . HUVECs were treated with TNF-α for 0 to 85 min, and 3C was performed. In some cases, DRB (50 μM) was added 25 min before harvesting. Diagrams on the left illustrate regions targeted by 3C primers (green arrow for reference point, white for others). (A) Changing contacts detected using 3C and conventional PCR (3C-PCR) on templates generated using SacI. Frequent contacts between reference point b and the segment of the gene indicated are reflected by a band (from b plus a at the top through b plus c to b plus i). Contacts sweep down the gene in time with the traveling wave. DRB abolishes contacts. At 0 min, primers b plus h yield a band (indicative of a “whole-gene loop”) that disappears upon stimulation to reappear after 85 min. BAC, control 3C samples prepared using DNA from a bacterial artificial chromosome encoding SAMD4A ; different primer pairs yield bands of comparable intensities. Intra- GAPDH and loading, unchanging (control) bands given by primers targeting two different restriction fragments in GAPDH or convergent primers targeting the same restriction fragment in SAMD4A . (B) Changing contacts detected using 3C-PCR on templates generated using HindIII. Primer i (green) was paired in turn with the primers indicated. Details and controls are as for panel A. Contacts sweep down the gene in time with the traveling wave, and a whole-gene loop is seen at 0 min. (C) 3C-PCR on templates generated using HindIII confirms the formation of enlarging subgene loops using primers from panel B. The positions of the traveling (green) and standing waves (yellow) are shown (data from reference ). Interaction frequencies (arbitrary units [au] ± the SD; n = 4) are normalized relative to values given by “loading” and “intra- GAPDH ” controls. Peak interactions coincide with peaks in the traveling wave, and a whole-gene loop is only seen at 0 and 85 min. *, difference significant ( P < 0.01, two-tailed Student t test) compared to the 0-min sample or to the 30-min sample in the case of the 0-min sample.

    Techniques Used: Polymerase Chain Reaction, Generated, BAC Assay, Two Tailed Test

    3) Product Images from "Host Ranges of Listeria-Specific Bacteriophages from the Turkey Processing Plant Environment in the United States"

    Article Title: Host Ranges of Listeria-Specific Bacteriophages from the Turkey Processing Plant Environment in the United States

    Journal:

    doi: 10.1128/AEM.01282-08

    Genomic profiles of DNA from 20422-1, 805405-1, and P100 following digestion with SacI. Lanes M1 and M2, size markers exACTGene (Fisher Scientific, Fairlawn, NJ) and DNA molecular-weight marker II (Roche, Indianapolis, IN), respectively; lanes 1 to 3, SacI-digested DNA from 20422-1, 805405-1, and P100, respectively.
    Figure Legend Snippet: Genomic profiles of DNA from 20422-1, 805405-1, and P100 following digestion with SacI. Lanes M1 and M2, size markers exACTGene (Fisher Scientific, Fairlawn, NJ) and DNA molecular-weight marker II (Roche, Indianapolis, IN), respectively; lanes 1 to 3, SacI-digested DNA from 20422-1, 805405-1, and P100, respectively.

    Techniques Used: Molecular Weight, Marker

    4) Product Images from "Evidence that Plasmid-Borne Botulinum Neurotoxin Type B Genes Are Widespread among Clostridium botulinum Serotype B Strains"

    Article Title: Evidence that Plasmid-Borne Botulinum Neurotoxin Type B Genes Are Widespread among Clostridium botulinum Serotype B Strains

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0004829

    BamHI, HindIII, SacI and EcoRV restrictions of the bont /B PCR products obtained from strains CDC-1758 (lanes 1, 5, 9, 14); CDC-1828 (lanes 2, 6, 10, 15); CDC-1436 (lanes 3, 7, 11, 16); CDC-4848 (lanes 4, 8, 12); CDC-816 (lane 13). M.S. (Molecular standard, 1 kb Promega).
    Figure Legend Snippet: BamHI, HindIII, SacI and EcoRV restrictions of the bont /B PCR products obtained from strains CDC-1758 (lanes 1, 5, 9, 14); CDC-1828 (lanes 2, 6, 10, 15); CDC-1436 (lanes 3, 7, 11, 16); CDC-4848 (lanes 4, 8, 12); CDC-816 (lane 13). M.S. (Molecular standard, 1 kb Promega).

    Techniques Used: Polymerase Chain Reaction

    5) Product Images from "Codon Usage Optimization and Construction of Plasmid Encoding Iranian Human Papillomavirus Type 16 E7 Oncogene for Lactococcus Lactis Subsp. Cremoris MG1363"

    Article Title: Codon Usage Optimization and Construction of Plasmid Encoding Iranian Human Papillomavirus Type 16 E7 Oncogene for Lactococcus Lactis Subsp. Cremoris MG1363

    Journal: Asian Pacific Journal of Cancer Prevention : APJCP

    doi: 10.22034/APJCP.2017.18.3.783

    The Double Digestion Patterns of the pNZ8148-HPV16-optiE7 Shuttle Plasmid via NcoI and SacI Restriction Endonuclease
    Figure Legend Snippet: The Double Digestion Patterns of the pNZ8148-HPV16-optiE7 Shuttle Plasmid via NcoI and SacI Restriction Endonuclease

    Techniques Used: Plasmid Preparation

    6) Product Images from "CRISPR-Cas9 genome editing induces megabase-scale chromosomal truncations"

    Article Title: CRISPR-Cas9 genome editing induces megabase-scale chromosomal truncations

    Journal: Nature Communications

    doi: 10.1038/s41467-019-09006-2

    Single nickase-mediated gene editing results in c.217 C clone for CEP disease modeling a (Left) Scheme of gene editing approach to convert wild-type HEK293T (WT HEK) into homozygous c.217 C HEK clone using nickase and a 181nt-ssODN carrying c.217 C mutation (called 181nt-ssODN-c.217 C). (Right) Detailed view of exon 4 region and CRISPR-mediated HDR design using a c.217T-targeting sgRNA and a 181nt-ssODN-c.217 C carrying c.217 C mutation (red) in addition to silent SacI restriction site (blue). Expected cleavage position using nickase is indicated with a red arrow. b – d (From left to right) Illustrative flow cytometry results for fluorocyte analysis, representative RFLP analysis, sequence spanning UROS exon 4 c.217 position obtained by Sanger sequencing and indels and HDR quantification by TIDER analysis ( b ) for WT HEK, ( c ) for cells transfected with nickase and a 181nt-ssODN-c.217 C (Mixed HEK population) and ( d ) for sorted and subcloned fluorocytes (PE-Cy5A-positive), called c.217 C HEK clone. Loq: limit of quantification. e Characterization of c.217 C HEK clone. UROS functionality assay with (Left) quantification of UROS-specific activity and (Right) fluorocyte frequencies from WT HEK or c.217 C HEK clone. Values for UROS-specific activity are normalized against WT HEK. Results are presented as mean ± SEM. For ( e ), source data are provided as a Source data file
    Figure Legend Snippet: Single nickase-mediated gene editing results in c.217 C clone for CEP disease modeling a (Left) Scheme of gene editing approach to convert wild-type HEK293T (WT HEK) into homozygous c.217 C HEK clone using nickase and a 181nt-ssODN carrying c.217 C mutation (called 181nt-ssODN-c.217 C). (Right) Detailed view of exon 4 region and CRISPR-mediated HDR design using a c.217T-targeting sgRNA and a 181nt-ssODN-c.217 C carrying c.217 C mutation (red) in addition to silent SacI restriction site (blue). Expected cleavage position using nickase is indicated with a red arrow. b – d (From left to right) Illustrative flow cytometry results for fluorocyte analysis, representative RFLP analysis, sequence spanning UROS exon 4 c.217 position obtained by Sanger sequencing and indels and HDR quantification by TIDER analysis ( b ) for WT HEK, ( c ) for cells transfected with nickase and a 181nt-ssODN-c.217 C (Mixed HEK population) and ( d ) for sorted and subcloned fluorocytes (PE-Cy5A-positive), called c.217 C HEK clone. Loq: limit of quantification. e Characterization of c.217 C HEK clone. UROS functionality assay with (Left) quantification of UROS-specific activity and (Right) fluorocyte frequencies from WT HEK or c.217 C HEK clone. Values for UROS-specific activity are normalized against WT HEK. Results are presented as mean ± SEM. For ( e ), source data are provided as a Source data file

    Techniques Used: Mutagenesis, CRISPR, Flow Cytometry, Cytometry, Sequencing, Transfection, Activity Assay

    Single nickase-mediated gene editing allows precise genetic and phenotypic correction. a (Left) Scheme of gene editing approach to modify the c.217 C HEK clone and turn it into genetically and phenotypically corrected HEK using nickase and a 181nt-ssODN carrying the c.217 T correcting mutation (called 181nt-ssODN-c.217 T). (Right) Detailed view of the c.217 C HEK clone containing c.217 C mutation (red) and SacI restriction site (blue). Nickase-mediated HDR design using a c.217C- SacI -specific sgRNA and a 181nt-ssODN-c.217 T carrying the c.217 T correcting mutation (grey) in addition to silent SacI restriction site (blue). Expected cleavage position using nickase is indicated with a red arrow. b – d (From left to right) Illustrative FACS (fluorescent activating cell sorting)results for fluorocyte analysis (PE-Cy5A-positive), representative RFLP analysis, sequence spanning UROS exon 4 c.217 position obtained by Sanger sequencing and indels and HDR quantification by TIDER analysis, ( b ) for the c.217 C HEK clone, ( c ) for cells transfected with nickase and 181nt-ssODN-c.217 T (Mix corrected HEK population), and ( d ) for PE-Cy5A-negative HEK293T cells sorted by FACS (called Sorted corrected HEK population). Loq: limit of quantification. e UROS functionality assays with (Left) quantification of UROS-specific activity ( n = 3) and (Right) fluorocytes frequencies from the c.217 C HEK clone, corrected HEK population and sorted corrected HEK population ( n ≥ 3). Values for UROS-specific activity are normalized with WT HEK. Results are presented as mean ± SEM. Data are from independent experiments. Statistical significance is inferred on raw data using two-tailed unpaired t-test for UROS-specific activity and paired one-way ANOVA for fluorocyte frequencies; ** p
    Figure Legend Snippet: Single nickase-mediated gene editing allows precise genetic and phenotypic correction. a (Left) Scheme of gene editing approach to modify the c.217 C HEK clone and turn it into genetically and phenotypically corrected HEK using nickase and a 181nt-ssODN carrying the c.217 T correcting mutation (called 181nt-ssODN-c.217 T). (Right) Detailed view of the c.217 C HEK clone containing c.217 C mutation (red) and SacI restriction site (blue). Nickase-mediated HDR design using a c.217C- SacI -specific sgRNA and a 181nt-ssODN-c.217 T carrying the c.217 T correcting mutation (grey) in addition to silent SacI restriction site (blue). Expected cleavage position using nickase is indicated with a red arrow. b – d (From left to right) Illustrative FACS (fluorescent activating cell sorting)results for fluorocyte analysis (PE-Cy5A-positive), representative RFLP analysis, sequence spanning UROS exon 4 c.217 position obtained by Sanger sequencing and indels and HDR quantification by TIDER analysis, ( b ) for the c.217 C HEK clone, ( c ) for cells transfected with nickase and 181nt-ssODN-c.217 T (Mix corrected HEK population), and ( d ) for PE-Cy5A-negative HEK293T cells sorted by FACS (called Sorted corrected HEK population). Loq: limit of quantification. e UROS functionality assays with (Left) quantification of UROS-specific activity ( n = 3) and (Right) fluorocytes frequencies from the c.217 C HEK clone, corrected HEK population and sorted corrected HEK population ( n ≥ 3). Values for UROS-specific activity are normalized with WT HEK. Results are presented as mean ± SEM. Data are from independent experiments. Statistical significance is inferred on raw data using two-tailed unpaired t-test for UROS-specific activity and paired one-way ANOVA for fluorocyte frequencies; ** p

    Techniques Used: Mutagenesis, FACS, Sequencing, Transfection, Activity Assay, Two Tailed Test

    UROS gene editing strategy and workflow analysis. a Experimental workflow for UROS gene editing and analysis of outcomes. Cells were nucleofected with the 181nt-ssODN template and either with nuclease or nickase followed by puromycin-positive selection. Then, (i) UROS locus was characterized by RFLP to quantify HDR and by TIDER or deep sequencing to evaluate indels and to confirm HDR percentage; (ii) UROS functionality was assessed by quantifying UROS-specific activity and type-I porphyrin accumulation, respectively determined by HPLC and flow cytometry; (iii) Chromosomal integrity was tested for Chr10 loss or Chr10q terminal deletion either by DNA-FISH assay or array-CGH. b (Top) Schematic UROS locus in chromosome 10 with UROS gene overview (middle). (Bottom) Detailed view of exon 4 region and CRISPR-mediated HDR design using a c.217T-targeting sgRNA (highlighted in orange) with adjacent PAM and an 181nt-ssODN carrying a silent SacI restriction site (highlighted in blue) close to c.217 T position. Red arrows indicate expected cleavage site using nuclease. Chr chromosome, CGH comparative genomic hybridization, D day, e exon, HDR homology-directed repair, HPLC high performance liquid chromatography, NGS (next-generation sequencing), RFLP (restriction fragment length polymorphism), PAM protospacer adjacent motif, sgRNA single guide RNA, TIDER (tracking of insertions, deletions and recombination events)
    Figure Legend Snippet: UROS gene editing strategy and workflow analysis. a Experimental workflow for UROS gene editing and analysis of outcomes. Cells were nucleofected with the 181nt-ssODN template and either with nuclease or nickase followed by puromycin-positive selection. Then, (i) UROS locus was characterized by RFLP to quantify HDR and by TIDER or deep sequencing to evaluate indels and to confirm HDR percentage; (ii) UROS functionality was assessed by quantifying UROS-specific activity and type-I porphyrin accumulation, respectively determined by HPLC and flow cytometry; (iii) Chromosomal integrity was tested for Chr10 loss or Chr10q terminal deletion either by DNA-FISH assay or array-CGH. b (Top) Schematic UROS locus in chromosome 10 with UROS gene overview (middle). (Bottom) Detailed view of exon 4 region and CRISPR-mediated HDR design using a c.217T-targeting sgRNA (highlighted in orange) with adjacent PAM and an 181nt-ssODN carrying a silent SacI restriction site (highlighted in blue) close to c.217 T position. Red arrows indicate expected cleavage site using nuclease. Chr chromosome, CGH comparative genomic hybridization, D day, e exon, HDR homology-directed repair, HPLC high performance liquid chromatography, NGS (next-generation sequencing), RFLP (restriction fragment length polymorphism), PAM protospacer adjacent motif, sgRNA single guide RNA, TIDER (tracking of insertions, deletions and recombination events)

    Techniques Used: Selection, Sequencing, Activity Assay, High Performance Liquid Chromatography, Flow Cytometry, Cytometry, Fluorescence In Situ Hybridization, CRISPR, Hybridization, Next-Generation Sequencing

    Nuclease-mediated HDR is associated with predominant indels leading to impaired UROS functionality. a (Left) Scheme of SacI -digested PCR products obtained for alleles with or without HDR. (Center) Illustrative RFLP analysis of non-transfected HEK293T cells (NT) or transfected with nuclease only or co-delivered with the 181nt-ssODN template. (Right) HDR frequency induced by nuclease and a 181nt-ssODN ( n = 5). b (Left) NGS analysis of allelic outcomes and associated HDR/indel ratio following transfection of HEK293T cells with nuclease and 181nt-ssODN. (Center) Frequencies of reads carrying either insertion or deletion. Region spanning sgRNA sequence is highlighted in grey. (Right) Most common observed alleles (with frequencies ≥ 1%) aligned on the sgRNA sequence. HDR modification in blue and indels in red. c (Left) Quantification of UROS-specific activity from HEK293T cells NT or transfected with nuclease and 181nt-ssODN ( n = 3). Values are normalized with NT cells. (Right) Fluorocyte frequencies and illustrative flow cytometry results from NT or HEK293T cells transfected with nuclease and a 181nt-ssODN ( n = 5). Blue and red dots (and associated percentages) depict non-fluorescent cells and fluorocytes, respectively, with type-I porphyrin accumulation. Results are presented as mean ± SEM. The data are from independent experiments. Statistical significance is inferred on raw data using two-tailed unpaired t test for UROS-specific activity. *** p
    Figure Legend Snippet: Nuclease-mediated HDR is associated with predominant indels leading to impaired UROS functionality. a (Left) Scheme of SacI -digested PCR products obtained for alleles with or without HDR. (Center) Illustrative RFLP analysis of non-transfected HEK293T cells (NT) or transfected with nuclease only or co-delivered with the 181nt-ssODN template. (Right) HDR frequency induced by nuclease and a 181nt-ssODN ( n = 5). b (Left) NGS analysis of allelic outcomes and associated HDR/indel ratio following transfection of HEK293T cells with nuclease and 181nt-ssODN. (Center) Frequencies of reads carrying either insertion or deletion. Region spanning sgRNA sequence is highlighted in grey. (Right) Most common observed alleles (with frequencies ≥ 1%) aligned on the sgRNA sequence. HDR modification in blue and indels in red. c (Left) Quantification of UROS-specific activity from HEK293T cells NT or transfected with nuclease and 181nt-ssODN ( n = 3). Values are normalized with NT cells. (Right) Fluorocyte frequencies and illustrative flow cytometry results from NT or HEK293T cells transfected with nuclease and a 181nt-ssODN ( n = 5). Blue and red dots (and associated percentages) depict non-fluorescent cells and fluorocytes, respectively, with type-I porphyrin accumulation. Results are presented as mean ± SEM. The data are from independent experiments. Statistical significance is inferred on raw data using two-tailed unpaired t test for UROS-specific activity. *** p

    Techniques Used: Polymerase Chain Reaction, Transfection, Next-Generation Sequencing, Sequencing, Modification, Activity Assay, Flow Cytometry, Cytometry, Two Tailed Test

    Related Articles

    Clone Assay:

    Article Title: Identification and Characterization of Fusolisin, the Fusobacterium nucleatum Autotransporter Serine Protease
    Article Snippet: The 3.9 kb PCR product was restricted with SacI (New England Biolabs Inc. USA), and inserted into the SacI site of the pHS30 E. coli-F. nucleatum shuttle vector , to generate pHSPROT. .. Plasmid electroporation into F. nucleatum ATCC 23726 was performed as described previously .

    Article Title: DTDP-rhamnosyl transferase RfbF, is a newfound receptor-related regulatory protein for phage phiYe-F10 specific for Yersinia enterocolitica serotype O:3
    Article Snippet: Primers rfbf CF and rfbf CR, incorporating NdeI and SacI restriction sites , were used to amplify the ORF of rfbc , including the 904-bp region in the HNF10 genome. .. The amplicon was digested with NdeI and SacI (New England BioLabs) and ligated into the NdeI - and SacI -digested plasmid pSRKKm (D3050; TaKaRa, Japan) , producing plasmid pSRKKm–rfbf (the rfbc ORF cloned into pSRKKm, KmR); introduced into the competent cell S17λpir; and then mobilized into Y. enterocolitica HNF10-Δrfbf using biparental conjugation. .. The recombinant clones HNF10-Δrfbf /Crfbf were confirmed using PCR and sequenced to ensure they contained the correct insert sequence.

    Article Title: Regulation of TFPIα expression by miR-27a/b-3p in human endothelial cells under normal conditions and in response to androgens
    Article Snippet: PCR product (198 bp) containing a fragment of TFPI 3′UTR (NM_006287) with miR-27a/b-3p binding site was cloned into pCR 2.1 vector (Life Technologies, Madrid, Spain) using the primers: (5′GAGCTCCGTTATTTTTACCGTGTTTTG and 5′ACGCGTCGTTTGAGTGGTTTTCAG). .. SacI and MluI were used to digest positive clones (New England Biolabs, Ipswich, MA). .. The insert was subcloned into luciferase reporter plasmid pMIR-REPORT (Life Technologies, Madrid, Spain) previously digested with these enzymes.

    Article Title: Enterococcal Surface Protein, Esp, Enhances Biofilm Formation by Enterococcus faecalis
    Article Snippet: The amplified fragment was sequentially restricted with SacI and BamHI (New England Biolabs, Inc., Beverly, Mass.) and purified from a 0.8% low-melting-point agarose gel by using the Wizard Preps DNA purification system (Promega, Madison, Wis.). .. FA2-2 and OG1RF were transformed with plasmid pAT28 to generate FA2-2(pAT28) and OG1RF(pAT28), which served as controls.

    Article Title: The end of a long-standing hypothesis: the Pseudomonas signalling molecules 4-hydroxy-2-alkylquinolines are derived from fatty acids, not 3-ketofatty acids
    Article Snippet: After purification, the PCR product was cloned into the linearized plasmid pGEM® -T Easy according to the method described by Promega, and then transformed in E. coli DH5α. .. This subclone was purified using the Wizard Plus SV Minipreps (Promega) and digested with XbaI and SacI (NEB).

    Article Title: Allelic variation in two distinct Pseudomonas syringae flagellin epitopes modulates the strength of plant immune responses but not bacterial motility
    Article Snippet: Paragraph title: Cloning of fliC and complementation of Pto DC3000Δ fliC ... PCR products were cleaned using AccuPrep PCR purification kit (Bioneer, Alameda, CA, USA) and digested by SacI and XhoI (NEB, Ipswich, MA, USA) at 37°C for 3 h. The broad expression vector pME6010 was similarly digested with SacI and XhoI .

    Article Title: Campylobacter hyointestinalis Isolated from Pigs Produces Multiple Variants of Biologically Active Cytolethal Distending Toxin
    Article Snippet: The cdt-IIA , cdt-IIB , and cdt-IIC genes (open reading frames [ORFs] 11 to 13 in ; also see Table S3 in the supplemental material) were PCR amplified using the genomic DNA of C. hyointestinalis strain ATCC 35217T as the template (see Table S1). .. Each of these amplified DNA fragments was digested with either EcoRI and HindIII or EcoRI and SacI (New England Biolabs Inc.) and cloned into the region downstream of the EcoRI site of the modified pET28a+ vector (Novagen, New Canaan, CT). .. This vector encoded His6 sequence and a tobacco etch virus protease cleavage (TEV) sequence upstream of the EcoRI restriction site.

    Article Title: SSD1 Is Integral to Host Defense Peptide Resistance in Candida albicans
    Article Snippet: Plasmids from randomly selected S. cerevisiae clones with confirmed protamine resistance were rescued and subcloned into pE-20H and transformed into S. cerevisiae LL20, and transformants were then assayed for protamine resistance as described above. .. In addition, candidal DNAs from two random protamine-resistant clones were digested by SacI (New England Biolabs), and their restriction maps were analyzed. .. Clones encoding the protamine-resistant phenotype contained a 6.3-kb fragment located within a SacI site and mapped to 1.9 kb from its end.

    Centrifugation:

    Article Title: Campylobacter hyointestinalis Isolated from Pigs Produces Multiple Variants of Biologically Active Cytolethal Distending Toxin
    Article Snippet: Each of these amplified DNA fragments was digested with either EcoRI and HindIII or EcoRI and SacI (New England Biolabs Inc.) and cloned into the region downstream of the EcoRI site of the modified pET28a+ vector (Novagen, New Canaan, CT). .. When the optical density at 600 nm of the culture reached 0.3 to 0.6, IPTG was added to a final concentration of 0.1 to 1.0 mM, and the culture was further incubated at 37°C for 3 h with vigorous shaking.

    Amplification:

    Article Title: Engineering and Validation of a Vector for Concomitant Expression of Rare Transfer RNA (tRNA) and HIV-1 nef Genes in Escherichia coli
    Article Snippet: The HIV-1 vif gene encoding 192 residues of wild type Vif protein was PCR amplified from pNL4.3 plasmid (NIH AIDS Reagent Program, #114) using Vif-Nhe I-F and Vif-Sac I-R primers ( ). .. The resulting 600bp amplicon was gel purified and restricted with Nhe I (NEB, #R0131L) and Sac I (NEB, #R0156L) for 8h at 37°C, and purified. .. Two vector backbones were prepared by whole plasmid PCR of 100 ng pSA-HNef-6His and pSA-HNef-6His-RIL using pSA-Nhe I-R and pSA-F primers ( ) and 25 cycles.

    Article Title: Metabolic engineering of raffinose-family oligosaccharides in the phloem reveals alterations in carbon partitioning and enhances resistance to green peach aphid
    Article Snippet: The mutagenized cDNA was created by a final PCR with oligonucleotides Raf5Kpn and Raf3Xma, digested with KpnI and SacI restriction enzymes (NEB) and inserted into the same sites of pUC-GUT:T7CO (Ayre and Turgeon, ). .. The mutagenized cDNA was created by a final PCR with oligonucleotides Raf5Kpn and Raf3Xma, digested with KpnI and SacI restriction enzymes (NEB) and inserted into the same sites of pUC-GUT:T7CO (Ayre and Turgeon, ).

    Article Title: pKBuS13, a KPC-2-Encoding Plasmid from Klebsiella pneumoniae Sequence Type 833, Carrying Tn4401b Inserted into an Xer Site-Specific Recombination Locus
    Article Snippet: The plasmid profile was analyzed after S1 nuclease (Roche) digestion (20 U enzyme in each sample) on crude plasmid extract (30 min at 37°C) and on DNA extracted from cells embedded in agarose plugs ( ) (1 h at 37°C), followed by separation on agarose gel electrophoresis using different running conditions: (i) 20 V for 20 h on 1% agarose gel and (ii) pulsed-field gel electrophoresis (PFGE) on 0.8% agarose gel with a CHEF-DR III apparatus (Bio-Rad) at 14°C and 6 V/cm for 13 h by using pulse times from 1 to 10 s. Separated DNA was hybridized with a digoxigenin (DIG)-labeled bla KPC -specific probe, obtained by amplification of an internal fragment of bla KPC with primers KPC-F and KPC-R ( ) in the presence of 70 μM DIG-11-dUTP (Roche) after capillary blotting onto Hybond-N-positive (N+ ) membranes (Amersham Biosciences, Piscataway, NJ). .. Plasmid restriction analysis was carried on with BamHI, HindIII, PstI, and SacI restriction enzymes according to the manufacturer's instructions (New England BioLabs, Mississauga, Ontario, Canada) followed by separation on 0.8% agarose gel.

    Article Title: pax1-1 partially suppresses gain-of-function mutations in Arabidopsis AXR3/IAA17
    Article Snippet: Genomic DNA was isolated from individual plants and amplified with primers for SSLP, CAPS and SNP markers listed at The Arabidopsis Information Resource (TAIR) [ ]. .. Primer sequences for the remaining markers were as follows: cer465593: 5' caacaatggtgatatttgttttgc 3' and 5' caacttttaggctctctagcgttt 3'; cer453516: 5' tatcagcaaattgcaaggattaga 3' and 5' tcaccactttgtattgtttttcct 3'; cer465605: 5' tgggagttccaatgtttaaag 3' and 5' attgatggaatggaacagaga 3'; cer452156 5' acacgaccaagaagtcaaata 3' and 5' acaattcttgtcgggcagat 3'; cer474010 5' cgaccctcgagaaagaacaa 3' and 5' gttatactgcgcctggaacc 3'; cer453463: 5' aataaaggcccatcttgtgtgt 3' and 5' actggagcgtcgtcattagttt 3'; cer453259: 5' ggtccaaacaaaaacaaattcc 3' and 5' cgaacaatcaagccacctct 3'; SNP82: 5' tggaaagccattgatggaagg 3' (Col) or 5' tggaaagccattgatggaagc 3' (Ler ), and 5' ttccgaagaccagaataacca 3'; SM106: 5' tatataagagaagagaaaga 3' and 5' gctgagtgagacccagtcct 3', SacI (New England Biolabs) was used to cleave the PCR product.

    Article Title: Identification and Characterization of Fusolisin, the Fusobacterium nucleatum Autotransporter Serine Protease
    Article Snippet: The DNA fragment containing fsp25586 and 556 bp of its up-stream region was amplified using the F-25586-SP90 (5′-CCgagctcGGAGCTTGATTTACATCCAAG-3′) and R- 25586-SP90 (5′-CCgagctcACTAGTGTTAGTGACGCAA-3′) primers that include a SacI restriction site (small case letters). .. The 3.9 kb PCR product was restricted with SacI (New England Biolabs Inc. USA), and inserted into the SacI site of the pHS30 E. coli-F. nucleatum shuttle vector , to generate pHSPROT.

    Article Title: Transcriptomic changes of Legionella pneumophila in water
    Article Snippet: The location of SacI and XbaI restriction site in pMMB207c allowed the bdhA gene to be inserted downstream of the Ptac promoter, allowing the expression of bdhA to be induced by IPTG. .. The amplicon and the pMMB207c plasmid were both digested with SacI and XbaI (NEB) before ligating with T4 DNA ligase (NEB). .. The ligation mixture was transformed into competent E. coli DH5α and the transformants were selected for chloramphenicol resistance.

    Article Title: DTDP-rhamnosyl transferase RfbF, is a newfound receptor-related regulatory protein for phage phiYe-F10 specific for Yersinia enterocolitica serotype O:3
    Article Snippet: Primers rfbf CF and rfbf CR, incorporating NdeI and SacI restriction sites , were used to amplify the ORF of rfbc , including the 904-bp region in the HNF10 genome. .. The amplicon was digested with NdeI and SacI (New England BioLabs) and ligated into the NdeI - and SacI -digested plasmid pSRKKm (D3050; TaKaRa, Japan) , producing plasmid pSRKKm–rfbf (the rfbc ORF cloned into pSRKKm, KmR); introduced into the competent cell S17λpir; and then mobilized into Y. enterocolitica HNF10-Δrfbf using biparental conjugation. .. The recombinant clones HNF10-Δrfbf /Crfbf were confirmed using PCR and sequenced to ensure they contained the correct insert sequence.

    Article Title: Regulation of TFPIα expression by miR-27a/b-3p in human endothelial cells under normal conditions and in response to androgens
    Article Snippet: SacI and MluI were used to digest positive clones (New England Biolabs, Ipswich, MA). .. Insertion of TFPI 3′ UTR fragment and seed sequence deletion was confirmed by sequencing.

    Article Title: Transcriptional Organization and Physiological Contributions of the relQ Operon of Streptococcus mutans
    Article Snippet: Briefly, fragments flanking the gene of interest were amplified with gene-specific primers carrying a BamHI or SacI recognition site. .. The PCR products were digested with either BamHI or SacI (New England BioLabs) and ligated with T4 DNA ligase (Invitrogen) to a nonpolar kanamycin resistance (NPKm) ( )- or erythromycin resistance (NPErm) ( )-encoding gene that had been digested with the same restriction enzymes.

    Article Title: Enterococcal Surface Protein, Esp, Enhances Biofilm Formation by Enterococcus faecalis
    Article Snippet: The entire esp gene, along with 160-bp region upstream of the putative transcriptional start site, was amplified by using the primers Esp103 (5′-GAGA GAGCTC GGGATGTTCCAGTGACCCC-3′) and Esp104 (5′-GAGA GGATCC GAGGAAGAGACTTCTTCCTCTTGT-3′), which contain recognition sequences (underlined) for SacI and BamHI respectively, at the 5′ ends. .. The amplified fragment was sequentially restricted with SacI and BamHI (New England Biolabs, Inc., Beverly, Mass.) and purified from a 0.8% low-melting-point agarose gel by using the Wizard Preps DNA purification system (Promega, Madison, Wis.). .. Plasmid pESPF was generated by ligating the PCR-amplified and -restricted fragment into SacI- and BamHI-cut shuttle vector pAT28 ( ).

    Article Title: Allelic variation in two distinct Pseudomonas syringae flagellin epitopes modulates the strength of plant immune responses but not bacterial motility
    Article Snippet: Genomic DNA was extracted from the Pto strains DC3000, K40, T1, and ES4326 and used as a template for PCR amplification of fliC . .. PCR products were cleaned using AccuPrep PCR purification kit (Bioneer, Alameda, CA, USA) and digested by SacI and XhoI (NEB, Ipswich, MA, USA) at 37°C for 3 h. The broad expression vector pME6010 was similarly digested with SacI and XhoI .

    Article Title: Campylobacter hyointestinalis Isolated from Pigs Produces Multiple Variants of Biologically Active Cytolethal Distending Toxin
    Article Snippet: The cdt-IIA , cdt-IIB , and cdt-IIC genes (open reading frames [ORFs] 11 to 13 in ; also see Table S3 in the supplemental material) were PCR amplified using the genomic DNA of C. hyointestinalis strain ATCC 35217T as the template (see Table S1). .. Each of these amplified DNA fragments was digested with either EcoRI and HindIII or EcoRI and SacI (New England Biolabs Inc.) and cloned into the region downstream of the EcoRI site of the modified pET28a+ vector (Novagen, New Canaan, CT). .. This vector encoded His6 sequence and a tobacco etch virus protease cleavage (TEV) sequence upstream of the EcoRI restriction site.

    Article Title: SSD1 Is Integral to Host Defense Peptide Resistance in Candida albicans
    Article Snippet: Plasmids from protamine-resistant clones of S. cerevisiae LL20 were rescued, amplified in E. coli , and reintroduced into protamine-susceptible (wild-type) S. cerevisiae LL20 as previously detailed ( ). .. In addition, candidal DNAs from two random protamine-resistant clones were digested by SacI (New England Biolabs), and their restriction maps were analyzed.

    Article Title: Aging impairs double‐strand break repair by homologous recombination in Drosophila germ cells
    Article Snippet: Gene conversion of the wild‐type iwhite sequence is confirmed molecularly by amplification of the repair events as described previously (Do et al ., ). .. For I‐SceI and SacI digests, PCR products were directly digested (New England Biolabs, Ipswich, MA, USA).

    Autoradiography:

    Article Title: Base-excision repair deficiency alone or combined with increased oxidative stress does not increase mtDNA point mutations in mice
    Article Snippet: After the electrophoresis, the gel was transferred like a Southern blot gel as described above, mtDNA was visualized with a [α-32 P]dCTP-labeled probe (pAM1) and the membrane was used to expose a phosphorimager screen or autoradiography film (Amersham hyperfilm MP, GE Healthcare). .. To visualize different topological isomers of the mtDNA, 400 ng of control total DNA was additionally incubated at 37°C for 30 min with only buffer (no treatment), SacI (linear) (New England Biolabs; 20 U), Nt.BbvCI (nicked circles) (New England Biolabs; 10 U), Topo I (relaxes the closed circles) (New England Biolabs; 5 U), DNA gyrase (compacts the closed circles) (New England Biolabs; 5 U).

    Construct:

    Article Title: Loss of function and inhibitory effects of human CSX/NKX2.5 homeoprotein mutations associated with congenital heart disease
    Article Snippet: Here, we report the initial biochemical characterization of ten different CSX/NKX2.5 mutations associated with human congenital heart disease. .. pBS SK(-)- CSX/NKX2.5 (ref. ) digested with BglI -blunt–ended and EcoRI was ligated into SacI -blunt–ended and EcoRI -digested pMALC2 (New England Biolabs Inc., Beverly, Massachusetts, USA) to construct maltose binding protein–CSX/NKX2.5 (MBP-CSX/NKX2.5). .. BglI -blunt–ended and XhoI -digested pBS SK(-)-CSX/NKX2.5 was ligated into EcoRV - XhoI -digested pcDNA3 (Invitrogen Corp., San Diego, California, USA) to construct pcDNA3-CSX/NKX2.5.

    End-sequence Profiling:

    Article Title: Enterococcal Surface Protein, Esp, Enhances Biofilm Formation by Enterococcus faecalis
    Article Snippet: The entire esp gene, along with 160-bp region upstream of the putative transcriptional start site, was amplified by using the primers Esp103 (5′-GAGA GAGCTC GGGATGTTCCAGTGACCCC-3′) and Esp104 (5′-GAGA GGATCC GAGGAAGAGACTTCTTCCTCTTGT-3′), which contain recognition sequences (underlined) for SacI and BamHI respectively, at the 5′ ends. .. The amplified fragment was sequentially restricted with SacI and BamHI (New England Biolabs, Inc., Beverly, Mass.) and purified from a 0.8% low-melting-point agarose gel by using the Wizard Preps DNA purification system (Promega, Madison, Wis.).

    Electrophoresis:

    Article Title: Base-excision repair deficiency alone or combined with increased oxidative stress does not increase mtDNA point mutations in mice
    Article Snippet: After the electrophoresis, the gel was transferred like a Southern blot gel as described above, mtDNA was visualized with a [α-32 P]dCTP-labeled probe (pAM1) and the membrane was used to expose a phosphorimager screen or autoradiography film (Amersham hyperfilm MP, GE Healthcare). .. To visualize different topological isomers of the mtDNA, 400 ng of control total DNA was additionally incubated at 37°C for 30 min with only buffer (no treatment), SacI (linear) (New England Biolabs; 20 U), Nt.BbvCI (nicked circles) (New England Biolabs; 10 U), Topo I (relaxes the closed circles) (New England Biolabs; 5 U), DNA gyrase (compacts the closed circles) (New England Biolabs; 5 U).

    Incubation:

    Article Title: Engineering and Validation of a Vector for Concomitant Expression of Rare Transfer RNA (tRNA) and HIV-1 nef Genes in Escherichia coli
    Article Snippet: The resulting 600bp amplicon was gel purified and restricted with Nhe I (NEB, #R0131L) and Sac I (NEB, #R0156L) for 8h at 37°C, and purified. .. The resulting 600bp amplicon was gel purified and restricted with Nhe I (NEB, #R0131L) and Sac I (NEB, #R0156L) for 8h at 37°C, and purified.

    Article Title: Campylobacter hyointestinalis Isolated from Pigs Produces Multiple Variants of Biologically Active Cytolethal Distending Toxin
    Article Snippet: Each of these amplified DNA fragments was digested with either EcoRI and HindIII or EcoRI and SacI (New England Biolabs Inc.) and cloned into the region downstream of the EcoRI site of the modified pET28a+ vector (Novagen, New Canaan, CT). .. The recombinant plasmid was transformed into E. coli strain BL21(DE3), and a transformant was selected and grown in LB broth containing 30 μg/ml kanamycin at 37°C.

    Article Title: Base-excision repair deficiency alone or combined with increased oxidative stress does not increase mtDNA point mutations in mice
    Article Snippet: The quantifications were made from the phosphorimager screen. .. To visualize different topological isomers of the mtDNA, 400 ng of control total DNA was additionally incubated at 37°C for 30 min with only buffer (no treatment), SacI (linear) (New England Biolabs; 20 U), Nt.BbvCI (nicked circles) (New England Biolabs; 10 U), Topo I (relaxes the closed circles) (New England Biolabs; 5 U), DNA gyrase (compacts the closed circles) (New England Biolabs; 5 U). .. Total DNA was extracted and analysed as in the topology gel method.

    Expressing:

    Article Title: Identification and Characterization of Fusolisin, the Fusobacterium nucleatum Autotransporter Serine Protease
    Article Snippet: Paragraph title: Expression of Fsp25586 in F. nucleatum ATCC 23726 ... The 3.9 kb PCR product was restricted with SacI (New England Biolabs Inc. USA), and inserted into the SacI site of the pHS30 E. coli-F. nucleatum shuttle vector , to generate pHSPROT.

    Article Title: Transcriptomic changes of Legionella pneumophila in water
    Article Snippet: The location of SacI and XbaI restriction site in pMMB207c allowed the bdhA gene to be inserted downstream of the Ptac promoter, allowing the expression of bdhA to be induced by IPTG. .. The amplicon and the pMMB207c plasmid were both digested with SacI and XbaI (NEB) before ligating with T4 DNA ligase (NEB).

    Article Title: The end of a long-standing hypothesis: the Pseudomonas signalling molecules 4-hydroxy-2-alkylquinolines are derived from fatty acids, not 3-ketofatty acids
    Article Snippet: Paragraph title: Construction of pqsB -6xHis vector for P. aeruginosa expression (pCD2) ... This subclone was purified using the Wizard Plus SV Minipreps (Promega) and digested with XbaI and SacI (NEB).

    Article Title: Allelic variation in two distinct Pseudomonas syringae flagellin epitopes modulates the strength of plant immune responses but not bacterial motility
    Article Snippet: This region contains both the fliC ORF and nearly the entire flanking regions up to the flanking genes in the flagellum gene cluster. .. PCR products were cleaned using AccuPrep PCR purification kit (Bioneer, Alameda, CA, USA) and digested by SacI and XhoI (NEB, Ipswich, MA, USA) at 37°C for 3 h. The broad expression vector pME6010 was similarly digested with SacI and XhoI . .. All digested products were separated using gel electrophoresis and cleaned using AccuPrep gel extraction kit (Bioneer) and each PCR product was individually ligated into the digested pME6010 vector using DNA ligase (Takara Bio, Shiga, Japan).

    Article Title: Campylobacter hyointestinalis Isolated from Pigs Produces Multiple Variants of Biologically Active Cytolethal Distending Toxin
    Article Snippet: Paragraph title: Expression and preparation of recombinant protein. ... Each of these amplified DNA fragments was digested with either EcoRI and HindIII or EcoRI and SacI (New England Biolabs Inc.) and cloned into the region downstream of the EcoRI site of the modified pET28a+ vector (Novagen, New Canaan, CT).

    Article Title: Aging impairs double‐strand break repair by homologous recombination in Drosophila germ cells
    Article Snippet: Repair by HR includes utilizing the downstream iwhite sequence restoring the wild‐type white sequence, which results in wild‐type white expression and red‐eyed progeny. .. For I‐SceI and SacI digests, PCR products were directly digested (New England Biolabs, Ipswich, MA, USA).

    Modification:

    Article Title: Campylobacter hyointestinalis Isolated from Pigs Produces Multiple Variants of Biologically Active Cytolethal Distending Toxin
    Article Snippet: The cdt-IIA , cdt-IIB , and cdt-IIC genes (open reading frames [ORFs] 11 to 13 in ; also see Table S3 in the supplemental material) were PCR amplified using the genomic DNA of C. hyointestinalis strain ATCC 35217T as the template (see Table S1). .. Each of these amplified DNA fragments was digested with either EcoRI and HindIII or EcoRI and SacI (New England Biolabs Inc.) and cloned into the region downstream of the EcoRI site of the modified pET28a+ vector (Novagen, New Canaan, CT). .. This vector encoded His6 sequence and a tobacco etch virus protease cleavage (TEV) sequence upstream of the EcoRI restriction site.

    Transformation Assay:

    Article Title: Transcriptomic changes of Legionella pneumophila in water
    Article Snippet: The ligation mixture was amplified by PCR using Phusion taq polymerase (NEB) to amplify the 3 kb mutant allele and the purified amplicon was introduced into KS79 through natural transformation [ ]. .. The amplicon and the pMMB207c plasmid were both digested with SacI and XbaI (NEB) before ligating with T4 DNA ligase (NEB).

    Article Title: Enterococcal Surface Protein, Esp, Enhances Biofilm Formation by Enterococcus faecalis
    Article Snippet: The amplified fragment was sequentially restricted with SacI and BamHI (New England Biolabs, Inc., Beverly, Mass.) and purified from a 0.8% low-melting-point agarose gel by using the Wizard Preps DNA purification system (Promega, Madison, Wis.). .. Plasmid pESPF was generated by ligating the PCR-amplified and -restricted fragment into SacI- and BamHI-cut shuttle vector pAT28 ( ).

    Article Title: The end of a long-standing hypothesis: the Pseudomonas signalling molecules 4-hydroxy-2-alkylquinolines are derived from fatty acids, not 3-ketofatty acids
    Article Snippet: After purification, the PCR product was cloned into the linearized plasmid pGEM® -T Easy according to the method described by Promega, and then transformed in E. coli DH5α. .. This subclone was purified using the Wizard Plus SV Minipreps (Promega) and digested with XbaI and SacI (NEB).

    Article Title: Allelic variation in two distinct Pseudomonas syringae flagellin epitopes modulates the strength of plant immune responses but not bacterial motility
    Article Snippet: PCR products were cleaned using AccuPrep PCR purification kit (Bioneer, Alameda, CA, USA) and digested by SacI and XhoI (NEB, Ipswich, MA, USA) at 37°C for 3 h. The broad expression vector pME6010 was similarly digested with SacI and XhoI . .. Because of the orientation of restriction enzyme sites in the multiple cloning site of pME6010, each PCR product was ligated 3′ to 5′ with respect to the Pk promoter of 6010; therefore, fliC is under control of its native promoter in these vectors.

    Article Title: SSD1 Is Integral to Host Defense Peptide Resistance in Candida albicans
    Article Snippet: Plasmids from randomly selected S. cerevisiae clones with confirmed protamine resistance were rescued and subcloned into pE-20H and transformed into S. cerevisiae LL20, and transformants were then assayed for protamine resistance as described above. .. In addition, candidal DNAs from two random protamine-resistant clones were digested by SacI (New England Biolabs), and their restriction maps were analyzed.

    Hybridization:

    Article Title: Transient Neuronal Populations Are Required to Guide Callosal Axons: A Role for Semaphorin 3CNeurons Help Bridge the Brain's Communication Gap
    Article Snippet: Paragraph title: In Situ Hybridization ... EphA4, Npn-1, EphB1 plasmids were linearized with SacI (New England Biolabs) for antisense RNA synthesis by T3 polymerase (Promega). ephrinB2 plasmid was linearized with BamH1 (New England Biolabs) for antisense RNA synthesis by sp6 polymerase (Promega).

    Conjugation Assay:

    Article Title: DTDP-rhamnosyl transferase RfbF, is a newfound receptor-related regulatory protein for phage phiYe-F10 specific for Yersinia enterocolitica serotype O:3
    Article Snippet: Primers rfbf CF and rfbf CR, incorporating NdeI and SacI restriction sites , were used to amplify the ORF of rfbc , including the 904-bp region in the HNF10 genome. .. The amplicon was digested with NdeI and SacI (New England BioLabs) and ligated into the NdeI - and SacI -digested plasmid pSRKKm (D3050; TaKaRa, Japan) , producing plasmid pSRKKm–rfbf (the rfbc ORF cloned into pSRKKm, KmR); introduced into the competent cell S17λpir; and then mobilized into Y. enterocolitica HNF10-Δrfbf using biparental conjugation. .. The recombinant clones HNF10-Δrfbf /Crfbf were confirmed using PCR and sequenced to ensure they contained the correct insert sequence.

    Article Title: Allelic variation in two distinct Pseudomonas syringae flagellin epitopes modulates the strength of plant immune responses but not bacterial motility
    Article Snippet: PCR products were cleaned using AccuPrep PCR purification kit (Bioneer, Alameda, CA, USA) and digested by SacI and XhoI (NEB, Ipswich, MA, USA) at 37°C for 3 h. The broad expression vector pME6010 was similarly digested with SacI and XhoI . .. Because of the orientation of restriction enzyme sites in the multiple cloning site of pME6010, each PCR product was ligated 3′ to 5′ with respect to the Pk promoter of 6010; therefore, fliC is under control of its native promoter in these vectors.

    Southern Blot:

    Article Title: Genome-Wide Saturation Mutagenesis of Burkholderia pseudomallei K96243 Predicts Essential Genes and Novel Targets for Antimicrobial Development
    Article Snippet: Southern blotting was used to test individual colonies and to confirm individual random-insertion events. .. Briefly, genomic DNA was extracted from individual colonies, and 3 µg was digested using the SacI restriction enzyme (NEB).

    Article Title: Base-excision repair deficiency alone or combined with increased oxidative stress does not increase mtDNA point mutations in mice
    Article Snippet: After the electrophoresis, the gel was transferred like a Southern blot gel as described above, mtDNA was visualized with a [α-32 P]dCTP-labeled probe (pAM1) and the membrane was used to expose a phosphorimager screen or autoradiography film (Amersham hyperfilm MP, GE Healthcare). .. To visualize different topological isomers of the mtDNA, 400 ng of control total DNA was additionally incubated at 37°C for 30 min with only buffer (no treatment), SacI (linear) (New England Biolabs; 20 U), Nt.BbvCI (nicked circles) (New England Biolabs; 10 U), Topo I (relaxes the closed circles) (New England Biolabs; 5 U), DNA gyrase (compacts the closed circles) (New England Biolabs; 5 U).

    Ligation:

    Article Title: Metabolic engineering of raffinose-family oligosaccharides in the phloem reveals alterations in carbon partitioning and enhances resistance to green peach aphid
    Article Snippet: The PCR product was phosphorylated with polynucleotide kinase (NEB) and circularized by ligation with T4 DNA ligase (NEB). .. The mutagenized cDNA was created by a final PCR with oligonucleotides Raf5Kpn and Raf3Xma, digested with KpnI and SacI restriction enzymes (NEB) and inserted into the same sites of pUC-GUT:T7CO (Ayre and Turgeon, ).

    Article Title: Transcriptomic changes of Legionella pneumophila in water
    Article Snippet: The ligation mixture was amplified by PCR using Phusion taq polymerase (NEB) to amplify the 3 kb mutant allele and the purified amplicon was introduced into KS79 through natural transformation [ ]. .. The amplicon and the pMMB207c plasmid were both digested with SacI and XbaI (NEB) before ligating with T4 DNA ligase (NEB).

    Article Title: The end of a long-standing hypothesis: the Pseudomonas signalling molecules 4-hydroxy-2-alkylquinolines are derived from fatty acids, not 3-ketofatty acids
    Article Snippet: This subclone was purified using the Wizard Plus SV Minipreps (Promega) and digested with XbaI and SacI (NEB). .. In parallel, pDN19 was digested with the same enzymes and purified.

    Cell Culture:

    Article Title: Enterococcal Surface Protein, Esp, Enhances Biofilm Formation by Enterococcus faecalis
    Article Snippet: Enterococcal strains were cultured in brain heart infusion or Trypticase soy broth (TSB) supplemented with various concentrations of glucose and appropriate antibiotics. .. The amplified fragment was sequentially restricted with SacI and BamHI (New England Biolabs, Inc., Beverly, Mass.) and purified from a 0.8% low-melting-point agarose gel by using the Wizard Preps DNA purification system (Promega, Madison, Wis.).

    Generated:

    Article Title: Regulation of TFPIα expression by miR-27a/b-3p in human endothelial cells under normal conditions and in response to androgens
    Article Snippet: SacI and MluI were used to digest positive clones (New England Biolabs, Ipswich, MA). .. The insert was subcloned into luciferase reporter plasmid pMIR-REPORT (Life Technologies, Madrid, Spain) previously digested with these enzymes.

    DNA Sequencing:

    Article Title: Transcriptional Organization and Physiological Contributions of the relQ Operon of Streptococcus mutans
    Article Snippet: The PCR products were digested with either BamHI or SacI (New England BioLabs) and ligated with T4 DNA ligase (Invitrogen) to a nonpolar kanamycin resistance (NPKm) ( )- or erythromycin resistance (NPErm) ( )-encoding gene that had been digested with the same restriction enzymes. .. Transformants were isolated on BHI agar plates supplemented with either kanamycin or erythromycin.

    Sequencing:

    Article Title: Metabolic engineering of raffinose-family oligosaccharides in the phloem reveals alterations in carbon partitioning and enhances resistance to green peach aphid
    Article Snippet: pGPTV-Hyg-CmGAS1p:CmGAS1 was previously described (Ayre et al., ) and consists of a 5 kb genomic sequence from Cucumis melo (muskmelon) subcloned in the EcoRI site of pCambia1301. pGPTV-Kan-CmGAS1p:CsRFS contains a phloem-specific RAFFINOSE SYNTHASE (CsRFS ; NCBI accession no. AF073744) cDNA from Cucumis sativum (cucumber) downstream of the CmGAS1 promoter. .. The mutagenized cDNA was created by a final PCR with oligonucleotides Raf5Kpn and Raf3Xma, digested with KpnI and SacI restriction enzymes (NEB) and inserted into the same sites of pUC-GUT:T7CO (Ayre and Turgeon, ).

    Article Title: Regulation of TFPIα expression by miR-27a/b-3p in human endothelial cells under normal conditions and in response to androgens
    Article Snippet: SacI and MluI were used to digest positive clones (New England Biolabs, Ipswich, MA). .. SacI and MluI were used to digest positive clones (New England Biolabs, Ipswich, MA).

    Article Title: Aging impairs double‐strand break repair by homologous recombination in Drosophila germ cells
    Article Snippet: Gene conversion of the wild‐type iwhite sequence is confirmed molecularly by amplification of the repair events as described previously (Do et al ., ). .. For I‐SceI and SacI digests, PCR products were directly digested (New England Biolabs, Ipswich, MA, USA).

    Sonication:

    Article Title: Campylobacter hyointestinalis Isolated from Pigs Produces Multiple Variants of Biologically Active Cytolethal Distending Toxin
    Article Snippet: Each of these amplified DNA fragments was digested with either EcoRI and HindIII or EcoRI and SacI (New England Biolabs Inc.) and cloned into the region downstream of the EcoRI site of the modified pET28a+ vector (Novagen, New Canaan, CT). .. When the optical density at 600 nm of the culture reached 0.3 to 0.6, IPTG was added to a final concentration of 0.1 to 1.0 mM, and the culture was further incubated at 37°C for 3 h with vigorous shaking.

    Binding Assay:

    Article Title: Regulation of TFPIα expression by miR-27a/b-3p in human endothelial cells under normal conditions and in response to androgens
    Article Snippet: PCR product (198 bp) containing a fragment of TFPI 3′UTR (NM_006287) with miR-27a/b-3p binding site was cloned into pCR 2.1 vector (Life Technologies, Madrid, Spain) using the primers: (5′GAGCTCCGTTATTTTTACCGTGTTTTG and 5′ACGCGTCGTTTGAGTGGTTTTCAG). .. SacI and MluI were used to digest positive clones (New England Biolabs, Ipswich, MA).

    Article Title: Loss of function and inhibitory effects of human CSX/NKX2.5 homeoprotein mutations associated with congenital heart disease
    Article Snippet: Here, we report the initial biochemical characterization of ten different CSX/NKX2.5 mutations associated with human congenital heart disease. .. pBS SK(-)- CSX/NKX2.5 (ref. ) digested with BglI -blunt–ended and EcoRI was ligated into SacI -blunt–ended and EcoRI -digested pMALC2 (New England Biolabs Inc., Beverly, Massachusetts, USA) to construct maltose binding protein–CSX/NKX2.5 (MBP-CSX/NKX2.5). .. BglI -blunt–ended and XhoI -digested pBS SK(-)-CSX/NKX2.5 was ligated into EcoRV - XhoI -digested pcDNA3 (Invitrogen Corp., San Diego, California, USA) to construct pcDNA3-CSX/NKX2.5.

    Immunofluorescence:

    Article Title: Transient Neuronal Populations Are Required to Guide Callosal Axons: A Role for Semaphorin 3CNeurons Help Bridge the Brain's Communication Gap
    Article Snippet: EphA4, Npn-1, EphB1 plasmids were linearized with SacI (New England Biolabs) for antisense RNA synthesis by T3 polymerase (Promega). ephrinB2 plasmid was linearized with BamH1 (New England Biolabs) for antisense RNA synthesis by sp6 polymerase (Promega). .. EphA4, Npn-1, EphB1 plasmids were linearized with SacI (New England Biolabs) for antisense RNA synthesis by T3 polymerase (Promega). ephrinB2 plasmid was linearized with BamH1 (New England Biolabs) for antisense RNA synthesis by sp6 polymerase (Promega).

    Pulsed-Field Gel:

    Article Title: pKBuS13, a KPC-2-Encoding Plasmid from Klebsiella pneumoniae Sequence Type 833, Carrying Tn4401b Inserted into an Xer Site-Specific Recombination Locus
    Article Snippet: The plasmid profile was analyzed after S1 nuclease (Roche) digestion (20 U enzyme in each sample) on crude plasmid extract (30 min at 37°C) and on DNA extracted from cells embedded in agarose plugs ( ) (1 h at 37°C), followed by separation on agarose gel electrophoresis using different running conditions: (i) 20 V for 20 h on 1% agarose gel and (ii) pulsed-field gel electrophoresis (PFGE) on 0.8% agarose gel with a CHEF-DR III apparatus (Bio-Rad) at 14°C and 6 V/cm for 13 h by using pulse times from 1 to 10 s. Separated DNA was hybridized with a digoxigenin (DIG)-labeled bla KPC -specific probe, obtained by amplification of an internal fragment of bla KPC with primers KPC-F and KPC-R ( ) in the presence of 70 μM DIG-11-dUTP (Roche) after capillary blotting onto Hybond-N-positive (N+ ) membranes (Amersham Biosciences, Piscataway, NJ). .. Plasmid restriction analysis was carried on with BamHI, HindIII, PstI, and SacI restriction enzymes according to the manufacturer's instructions (New England BioLabs, Mississauga, Ontario, Canada) followed by separation on 0.8% agarose gel.

    Non-Homologous End Joining:

    Article Title: Aging impairs double‐strand break repair by homologous recombination in Drosophila germ cells
    Article Snippet: For I‐SceI and SacI digests, PCR products were directly digested (New England Biolabs, Ipswich, MA, USA). .. For I‐SceI and SacI digests, PCR products were directly digested (New England Biolabs, Ipswich, MA, USA).

    Electroporation:

    Article Title: Transcriptomic changes of Legionella pneumophila in water
    Article Snippet: The amplicon and the pMMB207c plasmid were both digested with SacI and XbaI (NEB) before ligating with T4 DNA ligase (NEB). .. The presence of bdhA in the plasmid extracted from transformants was validated by PCR using the primers PromF, which hybridizes to the Ptac promoter in pMMB207c, and Com_bdhA_R.

    Mutagenesis:

    Article Title: pax1-1 partially suppresses gain-of-function mutations in Arabidopsis AXR3/IAA17
    Article Snippet: pax1-1 was crossed with Ler plants and F2 individuals showing the pax1-1 mutant phenotype were selected to form the mapping population. .. Primer sequences for the remaining markers were as follows: cer465593: 5' caacaatggtgatatttgttttgc 3' and 5' caacttttaggctctctagcgttt 3'; cer453516: 5' tatcagcaaattgcaaggattaga 3' and 5' tcaccactttgtattgtttttcct 3'; cer465605: 5' tgggagttccaatgtttaaag 3' and 5' attgatggaatggaacagaga 3'; cer452156 5' acacgaccaagaagtcaaata 3' and 5' acaattcttgtcgggcagat 3'; cer474010 5' cgaccctcgagaaagaacaa 3' and 5' gttatactgcgcctggaacc 3'; cer453463: 5' aataaaggcccatcttgtgtgt 3' and 5' actggagcgtcgtcattagttt 3'; cer453259: 5' ggtccaaacaaaaacaaattcc 3' and 5' cgaacaatcaagccacctct 3'; SNP82: 5' tggaaagccattgatggaagg 3' (Col) or 5' tggaaagccattgatggaagc 3' (Ler ), and 5' ttccgaagaccagaataacca 3'; SM106: 5' tatataagagaagagaaaga 3' and 5' gctgagtgagacccagtcct 3', SacI (New England Biolabs) was used to cleave the PCR product.

    Article Title: Transcriptomic changes of Legionella pneumophila in water
    Article Snippet: Paragraph title: Mutant construction and complementation ... The amplicon and the pMMB207c plasmid were both digested with SacI and XbaI (NEB) before ligating with T4 DNA ligase (NEB).

    Article Title: Regulation of TFPIα expression by miR-27a/b-3p in human endothelial cells under normal conditions and in response to androgens
    Article Snippet: Paragraph title: Plasmid construction and deletion mutagenesis ... SacI and MluI were used to digest positive clones (New England Biolabs, Ipswich, MA).

    Article Title: Transcriptional Organization and Physiological Contributions of the relQ Operon of Streptococcus mutans
    Article Snippet: The PCR products were digested with either BamHI or SacI (New England BioLabs) and ligated with T4 DNA ligase (Invitrogen) to a nonpolar kanamycin resistance (NPKm) ( )- or erythromycin resistance (NPErm) ( )-encoding gene that had been digested with the same restriction enzymes. .. Transformants were isolated on BHI agar plates supplemented with either kanamycin or erythromycin.

    Article Title: Impact of Nef-Mediated Downregulation of Major Histocompatibility Complex Class I on Immune Response to Simian Immunodeficiency Virus
    Article Snippet: Paragraph title: Site-specific mutagenesis. ... PCR fragments containing the desired mutations were inserted into the pSIV-3′ vector (containing SIV nef sequences) with SacI and EcoRI restriction enzymes (New England Biolabs, Beverly, Mass.).

    Article Title: Loss of function and inhibitory effects of human CSX/NKX2.5 homeoprotein mutations associated with congenital heart disease
    Article Snippet: pBS SK(-)- CSX/NKX2.5 (ref. ) digested with BglI -blunt–ended and EcoRI was ligated into SacI -blunt–ended and EcoRI -digested pMALC2 (New England Biolabs Inc., Beverly, Massachusetts, USA) to construct maltose binding protein–CSX/NKX2.5 (MBP-CSX/NKX2.5). .. FLAG epitope tag (gac tac aaa gac gat gac gac aag) was inserted at the NH2 -terminus of pcDNA3-CSX/NKX2.5.

    Isolation:

    Article Title: Metabolic engineering of raffinose-family oligosaccharides in the phloem reveals alterations in carbon partitioning and enhances resistance to green peach aphid
    Article Snippet: RNA from muskmelon seedlings was isolated with Trizol (Life Technologies, Carlsbad, CA) and reverse transcribed with Superscript RT II (Life Technologies) and an oligo dT primer according to the manufactures instructions. .. The mutagenized cDNA was created by a final PCR with oligonucleotides Raf5Kpn and Raf3Xma, digested with KpnI and SacI restriction enzymes (NEB) and inserted into the same sites of pUC-GUT:T7CO (Ayre and Turgeon, ).

    Article Title: pax1-1 partially suppresses gain-of-function mutations in Arabidopsis AXR3/IAA17
    Article Snippet: Genomic DNA was isolated from individual plants and amplified with primers for SSLP, CAPS and SNP markers listed at The Arabidopsis Information Resource (TAIR) [ ]. .. Primer sequences for the remaining markers were as follows: cer465593: 5' caacaatggtgatatttgttttgc 3' and 5' caacttttaggctctctagcgttt 3'; cer453516: 5' tatcagcaaattgcaaggattaga 3' and 5' tcaccactttgtattgtttttcct 3'; cer465605: 5' tgggagttccaatgtttaaag 3' and 5' attgatggaatggaacagaga 3'; cer452156 5' acacgaccaagaagtcaaata 3' and 5' acaattcttgtcgggcagat 3'; cer474010 5' cgaccctcgagaaagaacaa 3' and 5' gttatactgcgcctggaacc 3'; cer453463: 5' aataaaggcccatcttgtgtgt 3' and 5' actggagcgtcgtcattagttt 3'; cer453259: 5' ggtccaaacaaaaacaaattcc 3' and 5' cgaacaatcaagccacctct 3'; SNP82: 5' tggaaagccattgatggaagg 3' (Col) or 5' tggaaagccattgatggaagc 3' (Ler ), and 5' ttccgaagaccagaataacca 3'; SM106: 5' tatataagagaagagaaaga 3' and 5' gctgagtgagacccagtcct 3', SacI (New England Biolabs) was used to cleave the PCR product.

    Article Title: Transcriptional Organization and Physiological Contributions of the relQ Operon of Streptococcus mutans
    Article Snippet: The PCR products were digested with either BamHI or SacI (New England BioLabs) and ligated with T4 DNA ligase (Invitrogen) to a nonpolar kanamycin resistance (NPKm) ( )- or erythromycin resistance (NPErm) ( )-encoding gene that had been digested with the same restriction enzymes. .. The resulting ligation mixtures were used to transform competent S. mutans to replace the target genes.

    Purification:

    Article Title: Engineering and Validation of a Vector for Concomitant Expression of Rare Transfer RNA (tRNA) and HIV-1 nef Genes in Escherichia coli
    Article Snippet: The HIV-1 vif gene encoding 192 residues of wild type Vif protein was PCR amplified from pNL4.3 plasmid (NIH AIDS Reagent Program, #114) using Vif-Nhe I-F and Vif-Sac I-R primers ( ). .. The resulting 600bp amplicon was gel purified and restricted with Nhe I (NEB, #R0131L) and Sac I (NEB, #R0156L) for 8h at 37°C, and purified. .. Two vector backbones were prepared by whole plasmid PCR of 100 ng pSA-HNef-6His and pSA-HNef-6His-RIL using pSA-Nhe I-R and pSA-F primers ( ) and 25 cycles.

    Article Title: Transcriptomic changes of Legionella pneumophila in water
    Article Snippet: The ligation mixture was amplified by PCR using Phusion taq polymerase (NEB) to amplify the 3 kb mutant allele and the purified amplicon was introduced into KS79 through natural transformation [ ]. .. The amplicon and the pMMB207c plasmid were both digested with SacI and XbaI (NEB) before ligating with T4 DNA ligase (NEB).

    Article Title: Enterococcal Surface Protein, Esp, Enhances Biofilm Formation by Enterococcus faecalis
    Article Snippet: The entire esp gene, along with 160-bp region upstream of the putative transcriptional start site, was amplified by using the primers Esp103 (5′-GAGA GAGCTC GGGATGTTCCAGTGACCCC-3′) and Esp104 (5′-GAGA GGATCC GAGGAAGAGACTTCTTCCTCTTGT-3′), which contain recognition sequences (underlined) for SacI and BamHI respectively, at the 5′ ends. .. The amplified fragment was sequentially restricted with SacI and BamHI (New England Biolabs, Inc., Beverly, Mass.) and purified from a 0.8% low-melting-point agarose gel by using the Wizard Preps DNA purification system (Promega, Madison, Wis.). .. Plasmid pESPF was generated by ligating the PCR-amplified and -restricted fragment into SacI- and BamHI-cut shuttle vector pAT28 ( ).

    Article Title: The end of a long-standing hypothesis: the Pseudomonas signalling molecules 4-hydroxy-2-alkylquinolines are derived from fatty acids, not 3-ketofatty acids
    Article Snippet: After purification, the PCR product was cloned into the linearized plasmid pGEM® -T Easy according to the method described by Promega, and then transformed in E. coli DH5α. .. This subclone was purified using the Wizard Plus SV Minipreps (Promega) and digested with XbaI and SacI (NEB). .. The pqsB -6xHis-tag fragment was separated on agarose gel electrophoresis and purified.

    Article Title: Allelic variation in two distinct Pseudomonas syringae flagellin epitopes modulates the strength of plant immune responses but not bacterial motility
    Article Snippet: This region contains both the fliC ORF and nearly the entire flanking regions up to the flanking genes in the flagellum gene cluster. .. PCR products were cleaned using AccuPrep PCR purification kit (Bioneer, Alameda, CA, USA) and digested by SacI and XhoI (NEB, Ipswich, MA, USA) at 37°C for 3 h. The broad expression vector pME6010 was similarly digested with SacI and XhoI . .. All digested products were separated using gel electrophoresis and cleaned using AccuPrep gel extraction kit (Bioneer) and each PCR product was individually ligated into the digested pME6010 vector using DNA ligase (Takara Bio, Shiga, Japan).

    Polymerase Chain Reaction:

    Article Title: Engineering and Validation of a Vector for Concomitant Expression of Rare Transfer RNA (tRNA) and HIV-1 nef Genes in Escherichia coli
    Article Snippet: The HIV-1 vif gene encoding 192 residues of wild type Vif protein was PCR amplified from pNL4.3 plasmid (NIH AIDS Reagent Program, #114) using Vif-Nhe I-F and Vif-Sac I-R primers ( ). .. The resulting 600bp amplicon was gel purified and restricted with Nhe I (NEB, #R0131L) and Sac I (NEB, #R0156L) for 8h at 37°C, and purified.

    Article Title: Metabolic engineering of raffinose-family oligosaccharides in the phloem reveals alterations in carbon partitioning and enhances resistance to green peach aphid
    Article Snippet: An internal SacI site was removed with Vent polymerase and mutagenic oligonucleotide pairs RafSmut 5′-CAGTGATGAGTTCAAATTCGAATGG-3′ and RafSmut2 5′-CCATTCGAATTTGAACTCATCACTG-3′. .. The mutagenized cDNA was created by a final PCR with oligonucleotides Raf5Kpn and Raf3Xma, digested with KpnI and SacI restriction enzymes (NEB) and inserted into the same sites of pUC-GUT:T7CO (Ayre and Turgeon, ). .. The CmGAS1 promoter:CsRFS cDNA cassette was inserted into pGPTV-Kan (Becker et al., ) as a SbfI—SacI cassette. pGPTV-Bar-IAA11p:AmSTS contains STACHYOSE SYNTHASE from Alonsoa meridionalis (AmSTS1 ; NCBI Genbank accession no. AJ487030) downstream of the minor-vein and companion-cell-specific MMVE1 promoter element (McGarry and Ayre, ).

    Article Title: pKBuS13, a KPC-2-Encoding Plasmid from Klebsiella pneumoniae Sequence Type 833, Carrying Tn4401b Inserted into an Xer Site-Specific Recombination Locus
    Article Snippet: Transformants were selected on LB agar plus ampicillin and analyzed by PCR for the presence of all the bla genes previously detected in the donor strain. .. Plasmid restriction analysis was carried on with BamHI, HindIII, PstI, and SacI restriction enzymes according to the manufacturer's instructions (New England BioLabs, Mississauga, Ontario, Canada) followed by separation on 0.8% agarose gel.

    Article Title: pax1-1 partially suppresses gain-of-function mutations in Arabidopsis AXR3/IAA17
    Article Snippet: Primer sequences and restriction sites for markers nga392, M59 and CAT3 were obtained from TAIR. .. Primer sequences for the remaining markers were as follows: cer465593: 5' caacaatggtgatatttgttttgc 3' and 5' caacttttaggctctctagcgttt 3'; cer453516: 5' tatcagcaaattgcaaggattaga 3' and 5' tcaccactttgtattgtttttcct 3'; cer465605: 5' tgggagttccaatgtttaaag 3' and 5' attgatggaatggaacagaga 3'; cer452156 5' acacgaccaagaagtcaaata 3' and 5' acaattcttgtcgggcagat 3'; cer474010 5' cgaccctcgagaaagaacaa 3' and 5' gttatactgcgcctggaacc 3'; cer453463: 5' aataaaggcccatcttgtgtgt 3' and 5' actggagcgtcgtcattagttt 3'; cer453259: 5' ggtccaaacaaaaacaaattcc 3' and 5' cgaacaatcaagccacctct 3'; SNP82: 5' tggaaagccattgatggaagg 3' (Col) or 5' tggaaagccattgatggaagc 3' (Ler ), and 5' ttccgaagaccagaataacca 3'; SM106: 5' tatataagagaagagaaaga 3' and 5' gctgagtgagacccagtcct 3', SacI (New England Biolabs) was used to cleave the PCR product. .. To verify the genotypes of double mutants, each line was backcrossed to both pax1-1 and wild type.

    Article Title: Identification and Characterization of Fusolisin, the Fusobacterium nucleatum Autotransporter Serine Protease
    Article Snippet: The DNA fragment containing fsp25586 and 556 bp of its up-stream region was amplified using the F-25586-SP90 (5′-CCgagctcGGAGCTTGATTTACATCCAAG-3′) and R- 25586-SP90 (5′-CCgagctcACTAGTGTTAGTGACGCAA-3′) primers that include a SacI restriction site (small case letters). .. The 3.9 kb PCR product was restricted with SacI (New England Biolabs Inc. USA), and inserted into the SacI site of the pHS30 E. coli-F. nucleatum shuttle vector , to generate pHSPROT. .. Plasmid electroporation into F. nucleatum ATCC 23726 was performed as described previously .

    Article Title: Transcriptomic changes of Legionella pneumophila in water
    Article Snippet: The recombinants were selected for gentamycin resistance and successful deletion of bdhA was validated by PCR. .. The amplicon and the pMMB207c plasmid were both digested with SacI and XbaI (NEB) before ligating with T4 DNA ligase (NEB).

    Article Title: Regulation of TFPIα expression by miR-27a/b-3p in human endothelial cells under normal conditions and in response to androgens
    Article Snippet: PCR product (198 bp) containing a fragment of TFPI 3′UTR (NM_006287) with miR-27a/b-3p binding site was cloned into pCR 2.1 vector (Life Technologies, Madrid, Spain) using the primers: (5′GAGCTCCGTTATTTTTACCGTGTTTTG and 5′ACGCGTCGTTTGAGTGGTTTTCAG). .. SacI and MluI were used to digest positive clones (New England Biolabs, Ipswich, MA).

    Article Title: Transcriptional Organization and Physiological Contributions of the relQ Operon of Streptococcus mutans
    Article Snippet: Briefly, fragments flanking the gene of interest were amplified with gene-specific primers carrying a BamHI or SacI recognition site. .. The PCR products were digested with either BamHI or SacI (New England BioLabs) and ligated with T4 DNA ligase (Invitrogen) to a nonpolar kanamycin resistance (NPKm) ( )- or erythromycin resistance (NPErm) ( )-encoding gene that had been digested with the same restriction enzymes. .. The resulting ligation mixtures were used to transform competent S. mutans to replace the target genes.

    Article Title: The end of a long-standing hypothesis: the Pseudomonas signalling molecules 4-hydroxy-2-alkylquinolines are derived from fatty acids, not 3-ketofatty acids
    Article Snippet: After purification, the PCR product was cloned into the linearized plasmid pGEM® -T Easy according to the method described by Promega, and then transformed in E. coli DH5α. .. This subclone was purified using the Wizard Plus SV Minipreps (Promega) and digested with XbaI and SacI (NEB).

    Article Title: Allelic variation in two distinct Pseudomonas syringae flagellin epitopes modulates the strength of plant immune responses but not bacterial motility
    Article Snippet: This region contains both the fliC ORF and nearly the entire flanking regions up to the flanking genes in the flagellum gene cluster. .. PCR products were cleaned using AccuPrep PCR purification kit (Bioneer, Alameda, CA, USA) and digested by SacI and XhoI (NEB, Ipswich, MA, USA) at 37°C for 3 h. The broad expression vector pME6010 was similarly digested with SacI and XhoI . .. All digested products were separated using gel electrophoresis and cleaned using AccuPrep gel extraction kit (Bioneer) and each PCR product was individually ligated into the digested pME6010 vector using DNA ligase (Takara Bio, Shiga, Japan).

    Article Title: Campylobacter hyointestinalis Isolated from Pigs Produces Multiple Variants of Biologically Active Cytolethal Distending Toxin
    Article Snippet: The cdt-IIA , cdt-IIB , and cdt-IIC genes (open reading frames [ORFs] 11 to 13 in ; also see Table S3 in the supplemental material) were PCR amplified using the genomic DNA of C. hyointestinalis strain ATCC 35217T as the template (see Table S1). .. Each of these amplified DNA fragments was digested with either EcoRI and HindIII or EcoRI and SacI (New England Biolabs Inc.) and cloned into the region downstream of the EcoRI site of the modified pET28a+ vector (Novagen, New Canaan, CT).

    Article Title: Impact of Nef-Mediated Downregulation of Major Histocompatibility Complex Class I on Immune Response to Simian Immunodeficiency Virus
    Article Snippet: Mutations were engineered with a splice overlap extension technique ( ). .. PCR fragments containing the desired mutations were inserted into the pSIV-3′ vector (containing SIV nef sequences) with SacI and EcoRI restriction enzymes (New England Biolabs, Beverly, Mass.). .. Thorough DNA sequences of the resultant recombinant vectors verified the proper sequences for all mutants; recombinant clones selected for study contained the exactly desired sequence.

    Article Title: Aging impairs double‐strand break repair by homologous recombination in Drosophila germ cells
    Article Snippet: Briefly, Sce.white was PCR‐amplified using Sce.white ‐specific primers (Fig. A) (forward, 5′ GTTTTGGGTGGGTAAGCAGG; reverse, 5′ AGACCCACGTAGTCCAGC) using SapphireAmp Fast PCR Master Mix (Clontech, Mountain View, CA, USA). .. For I‐SceI and SacI digests, PCR products were directly digested (New England Biolabs, Ipswich, MA, USA). .. Repair by SSA results in loss of the yellow (y+) transgene.

    Plasmid Preparation:

    Article Title: Engineering and Validation of a Vector for Concomitant Expression of Rare Transfer RNA (tRNA) and HIV-1 nef Genes in Escherichia coli
    Article Snippet: The HIV-1 vif gene encoding 192 residues of wild type Vif protein was PCR amplified from pNL4.3 plasmid (NIH AIDS Reagent Program, #114) using Vif-Nhe I-F and Vif-Sac I-R primers ( ). .. The resulting 600bp amplicon was gel purified and restricted with Nhe I (NEB, #R0131L) and Sac I (NEB, #R0156L) for 8h at 37°C, and purified.

    Article Title: Metabolic engineering of raffinose-family oligosaccharides in the phloem reveals alterations in carbon partitioning and enhances resistance to green peach aphid
    Article Snippet: Paragraph title: Plasmid constructions ... The mutagenized cDNA was created by a final PCR with oligonucleotides Raf5Kpn and Raf3Xma, digested with KpnI and SacI restriction enzymes (NEB) and inserted into the same sites of pUC-GUT:T7CO (Ayre and Turgeon, ).

    Article Title: pKBuS13, a KPC-2-Encoding Plasmid from Klebsiella pneumoniae Sequence Type 833, Carrying Tn4401b Inserted into an Xer Site-Specific Recombination Locus
    Article Snippet: The plasmid profile was analyzed after S1 nuclease (Roche) digestion (20 U enzyme in each sample) on crude plasmid extract (30 min at 37°C) and on DNA extracted from cells embedded in agarose plugs ( ) (1 h at 37°C), followed by separation on agarose gel electrophoresis using different running conditions: (i) 20 V for 20 h on 1% agarose gel and (ii) pulsed-field gel electrophoresis (PFGE) on 0.8% agarose gel with a CHEF-DR III apparatus (Bio-Rad) at 14°C and 6 V/cm for 13 h by using pulse times from 1 to 10 s. Separated DNA was hybridized with a digoxigenin (DIG)-labeled bla KPC -specific probe, obtained by amplification of an internal fragment of bla KPC with primers KPC-F and KPC-R ( ) in the presence of 70 μM DIG-11-dUTP (Roche) after capillary blotting onto Hybond-N-positive (N+ ) membranes (Amersham Biosciences, Piscataway, NJ). .. Plasmid restriction analysis was carried on with BamHI, HindIII, PstI, and SacI restriction enzymes according to the manufacturer's instructions (New England BioLabs, Mississauga, Ontario, Canada) followed by separation on 0.8% agarose gel. .. The 13-kb band recognized by the bla KPC -specific probe was extracted from low-melting agarose by GELase digestion (Epicentre, Madison, WI, USA) and electroporated into E. coli JM101.

    Article Title: Transient Neuronal Populations Are Required to Guide Callosal Axons: A Role for Semaphorin 3CNeurons Help Bridge the Brain's Communication Gap
    Article Snippet: Sema3C plasmid was linearized with EcoRI (New England Biolabs) for antisense RNA synthesis by T7 polymerase (Promega) and with XhoI (New England Biolabs) for sense RNA synthesis by T3 polymerase (Promega). .. EphA4, Npn-1, EphB1 plasmids were linearized with SacI (New England Biolabs) for antisense RNA synthesis by T3 polymerase (Promega). ephrinB2 plasmid was linearized with BamH1 (New England Biolabs) for antisense RNA synthesis by sp6 polymerase (Promega). .. Slit2 plasmid was linearized with Xba1 (New England Biolabs) for antisense RNA synthesis by T7 polymerase (Promega).

    Article Title: Identification and Characterization of Fusolisin, the Fusobacterium nucleatum Autotransporter Serine Protease
    Article Snippet: The DNA fragment containing fsp25586 and 556 bp of its up-stream region was amplified using the F-25586-SP90 (5′-CCgagctcGGAGCTTGATTTACATCCAAG-3′) and R- 25586-SP90 (5′-CCgagctcACTAGTGTTAGTGACGCAA-3′) primers that include a SacI restriction site (small case letters). .. The 3.9 kb PCR product was restricted with SacI (New England Biolabs Inc. USA), and inserted into the SacI site of the pHS30 E. coli-F. nucleatum shuttle vector , to generate pHSPROT. .. Plasmid electroporation into F. nucleatum ATCC 23726 was performed as described previously .

    Article Title: Transcriptomic changes of Legionella pneumophila in water
    Article Snippet: The location of SacI and XbaI restriction site in pMMB207c allowed the bdhA gene to be inserted downstream of the Ptac promoter, allowing the expression of bdhA to be induced by IPTG. .. The amplicon and the pMMB207c plasmid were both digested with SacI and XbaI (NEB) before ligating with T4 DNA ligase (NEB). .. The ligation mixture was transformed into competent E. coli DH5α and the transformants were selected for chloramphenicol resistance.

    Article Title: DTDP-rhamnosyl transferase RfbF, is a newfound receptor-related regulatory protein for phage phiYe-F10 specific for Yersinia enterocolitica serotype O:3
    Article Snippet: Primers rfbf CF and rfbf CR, incorporating NdeI and SacI restriction sites , were used to amplify the ORF of rfbc , including the 904-bp region in the HNF10 genome. .. The amplicon was digested with NdeI and SacI (New England BioLabs) and ligated into the NdeI - and SacI -digested plasmid pSRKKm (D3050; TaKaRa, Japan) , producing plasmid pSRKKm–rfbf (the rfbc ORF cloned into pSRKKm, KmR); introduced into the competent cell S17λpir; and then mobilized into Y. enterocolitica HNF10-Δrfbf using biparental conjugation. .. The recombinant clones HNF10-Δrfbf /Crfbf were confirmed using PCR and sequenced to ensure they contained the correct insert sequence.

    Article Title: Regulation of TFPIα expression by miR-27a/b-3p in human endothelial cells under normal conditions and in response to androgens
    Article Snippet: Paragraph title: Plasmid construction and deletion mutagenesis ... SacI and MluI were used to digest positive clones (New England Biolabs, Ipswich, MA).

    Article Title: Enterococcal Surface Protein, Esp, Enhances Biofilm Formation by Enterococcus faecalis
    Article Snippet: E. coli XL1-Blue was obtained from Stratagene (La Jolla, Calif.), and used as a host for plasmid purifications. .. The amplified fragment was sequentially restricted with SacI and BamHI (New England Biolabs, Inc., Beverly, Mass.) and purified from a 0.8% low-melting-point agarose gel by using the Wizard Preps DNA purification system (Promega, Madison, Wis.).

    Article Title: The end of a long-standing hypothesis: the Pseudomonas signalling molecules 4-hydroxy-2-alkylquinolines are derived from fatty acids, not 3-ketofatty acids
    Article Snippet: Paragraph title: Construction of pqsB -6xHis vector for P. aeruginosa expression (pCD2) ... This subclone was purified using the Wizard Plus SV Minipreps (Promega) and digested with XbaI and SacI (NEB).

    Article Title: Allelic variation in two distinct Pseudomonas syringae flagellin epitopes modulates the strength of plant immune responses but not bacterial motility
    Article Snippet: This region contains both the fliC ORF and nearly the entire flanking regions up to the flanking genes in the flagellum gene cluster. .. PCR products were cleaned using AccuPrep PCR purification kit (Bioneer, Alameda, CA, USA) and digested by SacI and XhoI (NEB, Ipswich, MA, USA) at 37°C for 3 h. The broad expression vector pME6010 was similarly digested with SacI and XhoI . .. All digested products were separated using gel electrophoresis and cleaned using AccuPrep gel extraction kit (Bioneer) and each PCR product was individually ligated into the digested pME6010 vector using DNA ligase (Takara Bio, Shiga, Japan).

    Article Title: Campylobacter hyointestinalis Isolated from Pigs Produces Multiple Variants of Biologically Active Cytolethal Distending Toxin
    Article Snippet: The cdt-IIA , cdt-IIB , and cdt-IIC genes (open reading frames [ORFs] 11 to 13 in ; also see Table S3 in the supplemental material) were PCR amplified using the genomic DNA of C. hyointestinalis strain ATCC 35217T as the template (see Table S1). .. Each of these amplified DNA fragments was digested with either EcoRI and HindIII or EcoRI and SacI (New England Biolabs Inc.) and cloned into the region downstream of the EcoRI site of the modified pET28a+ vector (Novagen, New Canaan, CT). .. This vector encoded His6 sequence and a tobacco etch virus protease cleavage (TEV) sequence upstream of the EcoRI restriction site.

    Article Title: Impact of Nef-Mediated Downregulation of Major Histocompatibility Complex Class I on Immune Response to Simian Immunodeficiency Virus
    Article Snippet: Mutations were engineered with a splice overlap extension technique ( ). .. PCR fragments containing the desired mutations were inserted into the pSIV-3′ vector (containing SIV nef sequences) with SacI and EcoRI restriction enzymes (New England Biolabs, Beverly, Mass.). .. Thorough DNA sequences of the resultant recombinant vectors verified the proper sequences for all mutants; recombinant clones selected for study contained the exactly desired sequence.

    Article Title: Loss of function and inhibitory effects of human CSX/NKX2.5 homeoprotein mutations associated with congenital heart disease
    Article Snippet: Paragraph title: Plasmid construct. ... pBS SK(-)- CSX/NKX2.5 (ref. ) digested with BglI -blunt–ended and EcoRI was ligated into SacI -blunt–ended and EcoRI -digested pMALC2 (New England Biolabs Inc., Beverly, Massachusetts, USA) to construct maltose binding protein–CSX/NKX2.5 (MBP-CSX/NKX2.5).

    Recombinant:

    Article Title: Campylobacter hyointestinalis Isolated from Pigs Produces Multiple Variants of Biologically Active Cytolethal Distending Toxin
    Article Snippet: Paragraph title: Expression and preparation of recombinant protein. ... Each of these amplified DNA fragments was digested with either EcoRI and HindIII or EcoRI and SacI (New England Biolabs Inc.) and cloned into the region downstream of the EcoRI site of the modified pET28a+ vector (Novagen, New Canaan, CT).

    Agarose Gel Electrophoresis:

    Article Title: Engineering and Validation of a Vector for Concomitant Expression of Rare Transfer RNA (tRNA) and HIV-1 nef Genes in Escherichia coli
    Article Snippet: The resulting 600bp amplicon was gel purified and restricted with Nhe I (NEB, #R0131L) and Sac I (NEB, #R0156L) for 8h at 37°C, and purified. .. Ten units of Dpn I (NEB, #R0176) and 1 unit of Shrimp Alkaline Phosphatase (NEB, #M0371) was added to the same reaction and incubated for 60min at 37°C.

    Article Title: pKBuS13, a KPC-2-Encoding Plasmid from Klebsiella pneumoniae Sequence Type 833, Carrying Tn4401b Inserted into an Xer Site-Specific Recombination Locus
    Article Snippet: The plasmid profile was analyzed after S1 nuclease (Roche) digestion (20 U enzyme in each sample) on crude plasmid extract (30 min at 37°C) and on DNA extracted from cells embedded in agarose plugs ( ) (1 h at 37°C), followed by separation on agarose gel electrophoresis using different running conditions: (i) 20 V for 20 h on 1% agarose gel and (ii) pulsed-field gel electrophoresis (PFGE) on 0.8% agarose gel with a CHEF-DR III apparatus (Bio-Rad) at 14°C and 6 V/cm for 13 h by using pulse times from 1 to 10 s. Separated DNA was hybridized with a digoxigenin (DIG)-labeled bla KPC -specific probe, obtained by amplification of an internal fragment of bla KPC with primers KPC-F and KPC-R ( ) in the presence of 70 μM DIG-11-dUTP (Roche) after capillary blotting onto Hybond-N-positive (N+ ) membranes (Amersham Biosciences, Piscataway, NJ). .. Plasmid restriction analysis was carried on with BamHI, HindIII, PstI, and SacI restriction enzymes according to the manufacturer's instructions (New England BioLabs, Mississauga, Ontario, Canada) followed by separation on 0.8% agarose gel. .. The 13-kb band recognized by the bla KPC -specific probe was extracted from low-melting agarose by GELase digestion (Epicentre, Madison, WI, USA) and electroporated into E. coli JM101.

    Article Title: Enterococcal Surface Protein, Esp, Enhances Biofilm Formation by Enterococcus faecalis
    Article Snippet: The entire esp gene, along with 160-bp region upstream of the putative transcriptional start site, was amplified by using the primers Esp103 (5′-GAGA GAGCTC GGGATGTTCCAGTGACCCC-3′) and Esp104 (5′-GAGA GGATCC GAGGAAGAGACTTCTTCCTCTTGT-3′), which contain recognition sequences (underlined) for SacI and BamHI respectively, at the 5′ ends. .. The amplified fragment was sequentially restricted with SacI and BamHI (New England Biolabs, Inc., Beverly, Mass.) and purified from a 0.8% low-melting-point agarose gel by using the Wizard Preps DNA purification system (Promega, Madison, Wis.). .. Plasmid pESPF was generated by ligating the PCR-amplified and -restricted fragment into SacI- and BamHI-cut shuttle vector pAT28 ( ).

    Article Title: Base-excision repair deficiency alone or combined with increased oxidative stress does not increase mtDNA point mutations in mice
    Article Snippet: 400 ng of total DNA was then resolved on 0.4% agarose gel (15 × 15 cm) (Seakem Gold agarose, Lonza) with 40 V for 16–20 h with and without EtBr (0.5 mg/ml) to condense the different supercoiling states of the closed circle molecule. .. To visualize different topological isomers of the mtDNA, 400 ng of control total DNA was additionally incubated at 37°C for 30 min with only buffer (no treatment), SacI (linear) (New England Biolabs; 20 U), Nt.BbvCI (nicked circles) (New England Biolabs; 10 U), Topo I (relaxes the closed circles) (New England Biolabs; 5 U), DNA gyrase (compacts the closed circles) (New England Biolabs; 5 U).

    In Situ:

    Article Title: Transient Neuronal Populations Are Required to Guide Callosal Axons: A Role for Semaphorin 3CNeurons Help Bridge the Brain's Communication Gap
    Article Snippet: Paragraph title: In Situ Hybridization ... EphA4, Npn-1, EphB1 plasmids were linearized with SacI (New England Biolabs) for antisense RNA synthesis by T3 polymerase (Promega). ephrinB2 plasmid was linearized with BamH1 (New England Biolabs) for antisense RNA synthesis by sp6 polymerase (Promega).

    Concentration Assay:

    Article Title: Campylobacter hyointestinalis Isolated from Pigs Produces Multiple Variants of Biologically Active Cytolethal Distending Toxin
    Article Snippet: Each of these amplified DNA fragments was digested with either EcoRI and HindIII or EcoRI and SacI (New England Biolabs Inc.) and cloned into the region downstream of the EcoRI site of the modified pET28a+ vector (Novagen, New Canaan, CT). .. The recombinant plasmid was transformed into E. coli strain BL21(DE3), and a transformant was selected and grown in LB broth containing 30 μg/ml kanamycin at 37°C.

    Alkaline Lysis:

    Article Title: pKBuS13, a KPC-2-Encoding Plasmid from Klebsiella pneumoniae Sequence Type 833, Carrying Tn4401b Inserted into an Xer Site-Specific Recombination Locus
    Article Snippet: Plasmid DNA from K. pneumoniae KBu-1 was extracted by the alkaline lysis method ( ) and electroporated into E. coli JM101 using a Gene Pulser apparatus (Bio-Rad, Hercules, CA, USA) according to the manufacturer's instructions. .. Plasmid restriction analysis was carried on with BamHI, HindIII, PstI, and SacI restriction enzymes according to the manufacturer's instructions (New England BioLabs, Mississauga, Ontario, Canada) followed by separation on 0.8% agarose gel.

    DNA Purification:

    Article Title: Enterococcal Surface Protein, Esp, Enhances Biofilm Formation by Enterococcus faecalis
    Article Snippet: The entire esp gene, along with 160-bp region upstream of the putative transcriptional start site, was amplified by using the primers Esp103 (5′-GAGA GAGCTC GGGATGTTCCAGTGACCCC-3′) and Esp104 (5′-GAGA GGATCC GAGGAAGAGACTTCTTCCTCTTGT-3′), which contain recognition sequences (underlined) for SacI and BamHI respectively, at the 5′ ends. .. The amplified fragment was sequentially restricted with SacI and BamHI (New England Biolabs, Inc., Beverly, Mass.) and purified from a 0.8% low-melting-point agarose gel by using the Wizard Preps DNA purification system (Promega, Madison, Wis.). .. Plasmid pESPF was generated by ligating the PCR-amplified and -restricted fragment into SacI- and BamHI-cut shuttle vector pAT28 ( ).

    FLAG-tag:

    Article Title: Loss of function and inhibitory effects of human CSX/NKX2.5 homeoprotein mutations associated with congenital heart disease
    Article Snippet: pBS SK(-)- CSX/NKX2.5 (ref. ) digested with BglI -blunt–ended and EcoRI was ligated into SacI -blunt–ended and EcoRI -digested pMALC2 (New England Biolabs Inc., Beverly, Massachusetts, USA) to construct maltose binding protein–CSX/NKX2.5 (MBP-CSX/NKX2.5). .. BglI -blunt–ended and XhoI -digested pBS SK(-)-CSX/NKX2.5 was ligated into EcoRV - XhoI -digested pcDNA3 (Invitrogen Corp., San Diego, California, USA) to construct pcDNA3-CSX/NKX2.5.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs saci hf restriction enzyme
    Heart Sod2 knockout mice show normal mtDNA topology and no decrease in mtDNA copy number. ( A ) Representative phosphorimager exposure of mtDNA topology analysis of total <t>DNA</t> from heart tissue from 10-week old Sod2 loxP x Ckmm cre mice. MtDNA is visualized using radioactive probes towards mtDNA. Control DNA was treated with various enzymes to reveal the different topologies of mtDNA. <t>SacI</t> cuts both strands of mtDNA once (linear), Nt. BbvCI cuts only one strand of mtDNA (nicked), TopoI relaxes the mtDNA (looser coiling), Gyrase creates coiling to mtDNA (compacted supercoiled DNA). Experimental samples are untreated. First gel does not have ethidium bromide (EtBr), second gel has the same samples and EtBr in the gel to compact the closed circle DNA into a quantifiable band. Phosphorimager images are filtered with averaging to reduce noise. Quantifications were made from the original images. ( B ) Quantification of the proportion of closed circle form of mtDNA per total mtDNA. Quantification is done from phosphorimager exposure of the topology gels. White circles indicate samples from controls (pp, n = 11, 9–10 week old) and gray circles indicate samples from Sod2 loxP x Ckmm cre mice (pp,cre, n = 12, 10-week old). ( C ) Relative mtDNA copy number in heart of Sod2 loxP x Ckmm cre mice as assessed with qPCR. MtDNA levels were analyzed with a CytB probe and nuclear DNA with a 18S probe. White circles indicate samples from controls (pp, n = 12, 10–12 week old) and gray circles indicate samples from Sod2 loxP x Ckmm cre mice (pp, cre, n = 11, 10–12 week old). Horizontal lines represent means, error bars represent SD, * P
    Saci Hf Restriction Enzyme, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/saci hf restriction enzyme/product/New England Biolabs
    Average 99 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    saci hf restriction enzyme - by Bioz Stars, 2019-12
    99/100 stars
      Buy from Supplier

    99
    New England Biolabs saci plus bamhi
    Possible involvement of NHEJ in PM-DSB repair. ( A ) Construct for the ectopic expression of GFP-tagged DNA-PKcs (TTHERM_00203010). GFP under the cadmium-inducible MTT1 promoter was introduced into DNA-PKcs in the MAC. Approximately 1 kb of the DNA-PKcs 5′ UTR and ORF were amplified from SB210 genomic DNA using PrimeSTAR Max DNA Polymerase (TaKaRa) and the following primers: DNA-PKcs 5′ forward – AGTCGAGCTCACTTTAGCATTGGCTAATGCATG, reverse – AGTCGTCGACTTTTTAACGAATTCAAAAAAATAATAATAAGC; and DNA-PKcs 3′ forward – AGTCGGATCCATGTTAGAGCATTTACTTGAAAGCGC, reverse – AGTCGGTACCTGAGAATAAGCTGTCAACAC. Amplified forward and reverse target fragments were cloned into the <t>SacI–SalI</t> and <t>BamHI–KpnI</t> sites, respectively, of the backbone plasmid pBNMB1-EGFP (a gift from Dr Kazufumi Mochizuki, CNRS Institute of Human Genetics, Montpellier, France). The resulting vector (pEGFP-DNA-PKcs-NEO5) was linearized with Sac I plus Kpn I before biolistic transformation into Tetrahymena . ( B ) Localization of GFP-DNA-PKcs at the post-meiotic stage. Wild-type cells (left) were mated with tagged cells (right). Prior to pronuclear selection, DNA-PKcs localizes only to the MAC. Upon pronuclear selection, it appears in the selected pronucleus (red arrowhead). Scale bar denotes 10 μm. DOI: http://dx.doi.org/10.7554/eLife.26176.006
    Saci Plus Bamhi, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/saci plus bamhi/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    saci plus bamhi - by Bioz Stars, 2019-12
    99/100 stars
      Buy from Supplier

    74
    New England Biolabs saci
    Single nickase-mediated gene editing results in c.217 C clone for CEP disease modeling a (Left) Scheme of gene editing approach to convert wild-type HEK293T (WT HEK) into homozygous c.217 C HEK clone using nickase and a 181nt-ssODN carrying c.217 C mutation (called 181nt-ssODN-c.217 C). (Right) Detailed view of exon 4 region and CRISPR-mediated HDR design using a c.217T-targeting sgRNA and a 181nt-ssODN-c.217 C carrying c.217 C mutation (red) in addition to silent <t>SacI</t> restriction site (blue). Expected cleavage position using nickase is indicated with a red arrow. b – d (From left to right) Illustrative flow cytometry results for fluorocyte analysis, representative RFLP analysis, sequence spanning <t>UROS</t> exon 4 c.217 position obtained by Sanger sequencing and indels and HDR quantification by TIDER analysis ( b ) for WT HEK, ( c ) for cells transfected with nickase and a 181nt-ssODN-c.217 C (Mixed HEK population) and ( d ) for sorted and subcloned fluorocytes (PE-Cy5A-positive), called c.217 C HEK clone. Loq: limit of quantification. e Characterization of c.217 C HEK clone. UROS functionality assay with (Left) quantification of UROS-specific activity and (Right) fluorocyte frequencies from WT HEK or c.217 C HEK clone. Values for UROS-specific activity are normalized against WT HEK. Results are presented as mean ± SEM. For ( e ), source data are provided as a Source data file
    Saci, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 74/100, based on 0 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/saci/product/New England Biolabs
    Average 74 stars, based on 0 article reviews
    Price from $9.99 to $1999.99
    saci - by Bioz Stars, 2019-12
    74/100 stars
      Buy from Supplier

    Image Search Results


    Heart Sod2 knockout mice show normal mtDNA topology and no decrease in mtDNA copy number. ( A ) Representative phosphorimager exposure of mtDNA topology analysis of total DNA from heart tissue from 10-week old Sod2 loxP x Ckmm cre mice. MtDNA is visualized using radioactive probes towards mtDNA. Control DNA was treated with various enzymes to reveal the different topologies of mtDNA. SacI cuts both strands of mtDNA once (linear), Nt. BbvCI cuts only one strand of mtDNA (nicked), TopoI relaxes the mtDNA (looser coiling), Gyrase creates coiling to mtDNA (compacted supercoiled DNA). Experimental samples are untreated. First gel does not have ethidium bromide (EtBr), second gel has the same samples and EtBr in the gel to compact the closed circle DNA into a quantifiable band. Phosphorimager images are filtered with averaging to reduce noise. Quantifications were made from the original images. ( B ) Quantification of the proportion of closed circle form of mtDNA per total mtDNA. Quantification is done from phosphorimager exposure of the topology gels. White circles indicate samples from controls (pp, n = 11, 9–10 week old) and gray circles indicate samples from Sod2 loxP x Ckmm cre mice (pp,cre, n = 12, 10-week old). ( C ) Relative mtDNA copy number in heart of Sod2 loxP x Ckmm cre mice as assessed with qPCR. MtDNA levels were analyzed with a CytB probe and nuclear DNA with a 18S probe. White circles indicate samples from controls (pp, n = 12, 10–12 week old) and gray circles indicate samples from Sod2 loxP x Ckmm cre mice (pp, cre, n = 11, 10–12 week old). Horizontal lines represent means, error bars represent SD, * P

    Journal: Nucleic Acids Research

    Article Title: Base-excision repair deficiency alone or combined with increased oxidative stress does not increase mtDNA point mutations in mice

    doi: 10.1093/nar/gky456

    Figure Lengend Snippet: Heart Sod2 knockout mice show normal mtDNA topology and no decrease in mtDNA copy number. ( A ) Representative phosphorimager exposure of mtDNA topology analysis of total DNA from heart tissue from 10-week old Sod2 loxP x Ckmm cre mice. MtDNA is visualized using radioactive probes towards mtDNA. Control DNA was treated with various enzymes to reveal the different topologies of mtDNA. SacI cuts both strands of mtDNA once (linear), Nt. BbvCI cuts only one strand of mtDNA (nicked), TopoI relaxes the mtDNA (looser coiling), Gyrase creates coiling to mtDNA (compacted supercoiled DNA). Experimental samples are untreated. First gel does not have ethidium bromide (EtBr), second gel has the same samples and EtBr in the gel to compact the closed circle DNA into a quantifiable band. Phosphorimager images are filtered with averaging to reduce noise. Quantifications were made from the original images. ( B ) Quantification of the proportion of closed circle form of mtDNA per total mtDNA. Quantification is done from phosphorimager exposure of the topology gels. White circles indicate samples from controls (pp, n = 11, 9–10 week old) and gray circles indicate samples from Sod2 loxP x Ckmm cre mice (pp,cre, n = 12, 10-week old). ( C ) Relative mtDNA copy number in heart of Sod2 loxP x Ckmm cre mice as assessed with qPCR. MtDNA levels were analyzed with a CytB probe and nuclear DNA with a 18S probe. White circles indicate samples from controls (pp, n = 12, 10–12 week old) and gray circles indicate samples from Sod2 loxP x Ckmm cre mice (pp, cre, n = 11, 10–12 week old). Horizontal lines represent means, error bars represent SD, * P

    Article Snippet: The DNA was digested overnight with SacI-HF restriction enzyme (New England Biolabs) and ethanol precipitated.

    Techniques: Knock-Out, Mouse Assay, Real-time Polymerase Chain Reaction

    Possible involvement of NHEJ in PM-DSB repair. ( A ) Construct for the ectopic expression of GFP-tagged DNA-PKcs (TTHERM_00203010). GFP under the cadmium-inducible MTT1 promoter was introduced into DNA-PKcs in the MAC. Approximately 1 kb of the DNA-PKcs 5′ UTR and ORF were amplified from SB210 genomic DNA using PrimeSTAR Max DNA Polymerase (TaKaRa) and the following primers: DNA-PKcs 5′ forward – AGTCGAGCTCACTTTAGCATTGGCTAATGCATG, reverse – AGTCGTCGACTTTTTAACGAATTCAAAAAAATAATAATAAGC; and DNA-PKcs 3′ forward – AGTCGGATCCATGTTAGAGCATTTACTTGAAAGCGC, reverse – AGTCGGTACCTGAGAATAAGCTGTCAACAC. Amplified forward and reverse target fragments were cloned into the SacI–SalI and BamHI–KpnI sites, respectively, of the backbone plasmid pBNMB1-EGFP (a gift from Dr Kazufumi Mochizuki, CNRS Institute of Human Genetics, Montpellier, France). The resulting vector (pEGFP-DNA-PKcs-NEO5) was linearized with Sac I plus Kpn I before biolistic transformation into Tetrahymena . ( B ) Localization of GFP-DNA-PKcs at the post-meiotic stage. Wild-type cells (left) were mated with tagged cells (right). Prior to pronuclear selection, DNA-PKcs localizes only to the MAC. Upon pronuclear selection, it appears in the selected pronucleus (red arrowhead). Scale bar denotes 10 μm. DOI: http://dx.doi.org/10.7554/eLife.26176.006

    Journal: eLife

    Article Title: Post-meiotic DNA double-strand breaks occur in Tetrahymena, and require Topoisomerase II and Spo11

    doi: 10.7554/eLife.26176

    Figure Lengend Snippet: Possible involvement of NHEJ in PM-DSB repair. ( A ) Construct for the ectopic expression of GFP-tagged DNA-PKcs (TTHERM_00203010). GFP under the cadmium-inducible MTT1 promoter was introduced into DNA-PKcs in the MAC. Approximately 1 kb of the DNA-PKcs 5′ UTR and ORF were amplified from SB210 genomic DNA using PrimeSTAR Max DNA Polymerase (TaKaRa) and the following primers: DNA-PKcs 5′ forward – AGTCGAGCTCACTTTAGCATTGGCTAATGCATG, reverse – AGTCGTCGACTTTTTAACGAATTCAAAAAAATAATAATAAGC; and DNA-PKcs 3′ forward – AGTCGGATCCATGTTAGAGCATTTACTTGAAAGCGC, reverse – AGTCGGTACCTGAGAATAAGCTGTCAACAC. Amplified forward and reverse target fragments were cloned into the SacI–SalI and BamHI–KpnI sites, respectively, of the backbone plasmid pBNMB1-EGFP (a gift from Dr Kazufumi Mochizuki, CNRS Institute of Human Genetics, Montpellier, France). The resulting vector (pEGFP-DNA-PKcs-NEO5) was linearized with Sac I plus Kpn I before biolistic transformation into Tetrahymena . ( B ) Localization of GFP-DNA-PKcs at the post-meiotic stage. Wild-type cells (left) were mated with tagged cells (right). Prior to pronuclear selection, DNA-PKcs localizes only to the MAC. Upon pronuclear selection, it appears in the selected pronucleus (red arrowhead). Scale bar denotes 10 μm. DOI: http://dx.doi.org/10.7554/eLife.26176.006

    Article Snippet: Amplified PCR products were purified with a PCR Clean-up kit (Promega, Madison, WI), then 5′ sequences were digested with SacI plus BamHI (New England BioLabs, Ipswich, MA) and 3′ sequences with XhoI plus KpnI (New England BioLabs).

    Techniques: Non-Homologous End Joining, Construct, Expressing, Amplification, Clone Assay, Plasmid Preparation, Transformation Assay, Selection

    Single nickase-mediated gene editing results in c.217 C clone for CEP disease modeling a (Left) Scheme of gene editing approach to convert wild-type HEK293T (WT HEK) into homozygous c.217 C HEK clone using nickase and a 181nt-ssODN carrying c.217 C mutation (called 181nt-ssODN-c.217 C). (Right) Detailed view of exon 4 region and CRISPR-mediated HDR design using a c.217T-targeting sgRNA and a 181nt-ssODN-c.217 C carrying c.217 C mutation (red) in addition to silent SacI restriction site (blue). Expected cleavage position using nickase is indicated with a red arrow. b – d (From left to right) Illustrative flow cytometry results for fluorocyte analysis, representative RFLP analysis, sequence spanning UROS exon 4 c.217 position obtained by Sanger sequencing and indels and HDR quantification by TIDER analysis ( b ) for WT HEK, ( c ) for cells transfected with nickase and a 181nt-ssODN-c.217 C (Mixed HEK population) and ( d ) for sorted and subcloned fluorocytes (PE-Cy5A-positive), called c.217 C HEK clone. Loq: limit of quantification. e Characterization of c.217 C HEK clone. UROS functionality assay with (Left) quantification of UROS-specific activity and (Right) fluorocyte frequencies from WT HEK or c.217 C HEK clone. Values for UROS-specific activity are normalized against WT HEK. Results are presented as mean ± SEM. For ( e ), source data are provided as a Source data file

    Journal: Nature Communications

    Article Title: CRISPR-Cas9 genome editing induces megabase-scale chromosomal truncations

    doi: 10.1038/s41467-019-09006-2

    Figure Lengend Snippet: Single nickase-mediated gene editing results in c.217 C clone for CEP disease modeling a (Left) Scheme of gene editing approach to convert wild-type HEK293T (WT HEK) into homozygous c.217 C HEK clone using nickase and a 181nt-ssODN carrying c.217 C mutation (called 181nt-ssODN-c.217 C). (Right) Detailed view of exon 4 region and CRISPR-mediated HDR design using a c.217T-targeting sgRNA and a 181nt-ssODN-c.217 C carrying c.217 C mutation (red) in addition to silent SacI restriction site (blue). Expected cleavage position using nickase is indicated with a red arrow. b – d (From left to right) Illustrative flow cytometry results for fluorocyte analysis, representative RFLP analysis, sequence spanning UROS exon 4 c.217 position obtained by Sanger sequencing and indels and HDR quantification by TIDER analysis ( b ) for WT HEK, ( c ) for cells transfected with nickase and a 181nt-ssODN-c.217 C (Mixed HEK population) and ( d ) for sorted and subcloned fluorocytes (PE-Cy5A-positive), called c.217 C HEK clone. Loq: limit of quantification. e Characterization of c.217 C HEK clone. UROS functionality assay with (Left) quantification of UROS-specific activity and (Right) fluorocyte frequencies from WT HEK or c.217 C HEK clone. Values for UROS-specific activity are normalized against WT HEK. Results are presented as mean ± SEM. For ( e ), source data are provided as a Source data file

    Article Snippet: PCR products were purified with Nucleospin® Gel and PCR Clean-up (Macherey-Nagel) and digested with SacI (or ApaI for exon 10 UROS analysis) restriction enzyme (New England Biolabs, Ipswich, MA, USA) for 1 h at 37 °C.

    Techniques: Mutagenesis, CRISPR, Flow Cytometry, Cytometry, Sequencing, Transfection, Activity Assay

    Single nickase-mediated gene editing allows precise genetic and phenotypic correction. a (Left) Scheme of gene editing approach to modify the c.217 C HEK clone and turn it into genetically and phenotypically corrected HEK using nickase and a 181nt-ssODN carrying the c.217 T correcting mutation (called 181nt-ssODN-c.217 T). (Right) Detailed view of the c.217 C HEK clone containing c.217 C mutation (red) and SacI restriction site (blue). Nickase-mediated HDR design using a c.217C- SacI -specific sgRNA and a 181nt-ssODN-c.217 T carrying the c.217 T correcting mutation (grey) in addition to silent SacI restriction site (blue). Expected cleavage position using nickase is indicated with a red arrow. b – d (From left to right) Illustrative FACS (fluorescent activating cell sorting)results for fluorocyte analysis (PE-Cy5A-positive), representative RFLP analysis, sequence spanning UROS exon 4 c.217 position obtained by Sanger sequencing and indels and HDR quantification by TIDER analysis, ( b ) for the c.217 C HEK clone, ( c ) for cells transfected with nickase and 181nt-ssODN-c.217 T (Mix corrected HEK population), and ( d ) for PE-Cy5A-negative HEK293T cells sorted by FACS (called Sorted corrected HEK population). Loq: limit of quantification. e UROS functionality assays with (Left) quantification of UROS-specific activity ( n = 3) and (Right) fluorocytes frequencies from the c.217 C HEK clone, corrected HEK population and sorted corrected HEK population ( n ≥ 3). Values for UROS-specific activity are normalized with WT HEK. Results are presented as mean ± SEM. Data are from independent experiments. Statistical significance is inferred on raw data using two-tailed unpaired t-test for UROS-specific activity and paired one-way ANOVA for fluorocyte frequencies; ** p

    Journal: Nature Communications

    Article Title: CRISPR-Cas9 genome editing induces megabase-scale chromosomal truncations

    doi: 10.1038/s41467-019-09006-2

    Figure Lengend Snippet: Single nickase-mediated gene editing allows precise genetic and phenotypic correction. a (Left) Scheme of gene editing approach to modify the c.217 C HEK clone and turn it into genetically and phenotypically corrected HEK using nickase and a 181nt-ssODN carrying the c.217 T correcting mutation (called 181nt-ssODN-c.217 T). (Right) Detailed view of the c.217 C HEK clone containing c.217 C mutation (red) and SacI restriction site (blue). Nickase-mediated HDR design using a c.217C- SacI -specific sgRNA and a 181nt-ssODN-c.217 T carrying the c.217 T correcting mutation (grey) in addition to silent SacI restriction site (blue). Expected cleavage position using nickase is indicated with a red arrow. b – d (From left to right) Illustrative FACS (fluorescent activating cell sorting)results for fluorocyte analysis (PE-Cy5A-positive), representative RFLP analysis, sequence spanning UROS exon 4 c.217 position obtained by Sanger sequencing and indels and HDR quantification by TIDER analysis, ( b ) for the c.217 C HEK clone, ( c ) for cells transfected with nickase and 181nt-ssODN-c.217 T (Mix corrected HEK population), and ( d ) for PE-Cy5A-negative HEK293T cells sorted by FACS (called Sorted corrected HEK population). Loq: limit of quantification. e UROS functionality assays with (Left) quantification of UROS-specific activity ( n = 3) and (Right) fluorocytes frequencies from the c.217 C HEK clone, corrected HEK population and sorted corrected HEK population ( n ≥ 3). Values for UROS-specific activity are normalized with WT HEK. Results are presented as mean ± SEM. Data are from independent experiments. Statistical significance is inferred on raw data using two-tailed unpaired t-test for UROS-specific activity and paired one-way ANOVA for fluorocyte frequencies; ** p

    Article Snippet: PCR products were purified with Nucleospin® Gel and PCR Clean-up (Macherey-Nagel) and digested with SacI (or ApaI for exon 10 UROS analysis) restriction enzyme (New England Biolabs, Ipswich, MA, USA) for 1 h at 37 °C.

    Techniques: Mutagenesis, FACS, Sequencing, Transfection, Activity Assay, Two Tailed Test

    UROS gene editing strategy and workflow analysis. a Experimental workflow for UROS gene editing and analysis of outcomes. Cells were nucleofected with the 181nt-ssODN template and either with nuclease or nickase followed by puromycin-positive selection. Then, (i) UROS locus was characterized by RFLP to quantify HDR and by TIDER or deep sequencing to evaluate indels and to confirm HDR percentage; (ii) UROS functionality was assessed by quantifying UROS-specific activity and type-I porphyrin accumulation, respectively determined by HPLC and flow cytometry; (iii) Chromosomal integrity was tested for Chr10 loss or Chr10q terminal deletion either by DNA-FISH assay or array-CGH. b (Top) Schematic UROS locus in chromosome 10 with UROS gene overview (middle). (Bottom) Detailed view of exon 4 region and CRISPR-mediated HDR design using a c.217T-targeting sgRNA (highlighted in orange) with adjacent PAM and an 181nt-ssODN carrying a silent SacI restriction site (highlighted in blue) close to c.217 T position. Red arrows indicate expected cleavage site using nuclease. Chr chromosome, CGH comparative genomic hybridization, D day, e exon, HDR homology-directed repair, HPLC high performance liquid chromatography, NGS (next-generation sequencing), RFLP (restriction fragment length polymorphism), PAM protospacer adjacent motif, sgRNA single guide RNA, TIDER (tracking of insertions, deletions and recombination events)

    Journal: Nature Communications

    Article Title: CRISPR-Cas9 genome editing induces megabase-scale chromosomal truncations

    doi: 10.1038/s41467-019-09006-2

    Figure Lengend Snippet: UROS gene editing strategy and workflow analysis. a Experimental workflow for UROS gene editing and analysis of outcomes. Cells were nucleofected with the 181nt-ssODN template and either with nuclease or nickase followed by puromycin-positive selection. Then, (i) UROS locus was characterized by RFLP to quantify HDR and by TIDER or deep sequencing to evaluate indels and to confirm HDR percentage; (ii) UROS functionality was assessed by quantifying UROS-specific activity and type-I porphyrin accumulation, respectively determined by HPLC and flow cytometry; (iii) Chromosomal integrity was tested for Chr10 loss or Chr10q terminal deletion either by DNA-FISH assay or array-CGH. b (Top) Schematic UROS locus in chromosome 10 with UROS gene overview (middle). (Bottom) Detailed view of exon 4 region and CRISPR-mediated HDR design using a c.217T-targeting sgRNA (highlighted in orange) with adjacent PAM and an 181nt-ssODN carrying a silent SacI restriction site (highlighted in blue) close to c.217 T position. Red arrows indicate expected cleavage site using nuclease. Chr chromosome, CGH comparative genomic hybridization, D day, e exon, HDR homology-directed repair, HPLC high performance liquid chromatography, NGS (next-generation sequencing), RFLP (restriction fragment length polymorphism), PAM protospacer adjacent motif, sgRNA single guide RNA, TIDER (tracking of insertions, deletions and recombination events)

    Article Snippet: PCR products were purified with Nucleospin® Gel and PCR Clean-up (Macherey-Nagel) and digested with SacI (or ApaI for exon 10 UROS analysis) restriction enzyme (New England Biolabs, Ipswich, MA, USA) for 1 h at 37 °C.

    Techniques: Selection, Sequencing, Activity Assay, High Performance Liquid Chromatography, Flow Cytometry, Cytometry, Fluorescence In Situ Hybridization, CRISPR, Hybridization, Next-Generation Sequencing

    Nuclease-mediated HDR is associated with predominant indels leading to impaired UROS functionality. a (Left) Scheme of SacI -digested PCR products obtained for alleles with or without HDR. (Center) Illustrative RFLP analysis of non-transfected HEK293T cells (NT) or transfected with nuclease only or co-delivered with the 181nt-ssODN template. (Right) HDR frequency induced by nuclease and a 181nt-ssODN ( n = 5). b (Left) NGS analysis of allelic outcomes and associated HDR/indel ratio following transfection of HEK293T cells with nuclease and 181nt-ssODN. (Center) Frequencies of reads carrying either insertion or deletion. Region spanning sgRNA sequence is highlighted in grey. (Right) Most common observed alleles (with frequencies ≥ 1%) aligned on the sgRNA sequence. HDR modification in blue and indels in red. c (Left) Quantification of UROS-specific activity from HEK293T cells NT or transfected with nuclease and 181nt-ssODN ( n = 3). Values are normalized with NT cells. (Right) Fluorocyte frequencies and illustrative flow cytometry results from NT or HEK293T cells transfected with nuclease and a 181nt-ssODN ( n = 5). Blue and red dots (and associated percentages) depict non-fluorescent cells and fluorocytes, respectively, with type-I porphyrin accumulation. Results are presented as mean ± SEM. The data are from independent experiments. Statistical significance is inferred on raw data using two-tailed unpaired t test for UROS-specific activity. *** p

    Journal: Nature Communications

    Article Title: CRISPR-Cas9 genome editing induces megabase-scale chromosomal truncations

    doi: 10.1038/s41467-019-09006-2

    Figure Lengend Snippet: Nuclease-mediated HDR is associated with predominant indels leading to impaired UROS functionality. a (Left) Scheme of SacI -digested PCR products obtained for alleles with or without HDR. (Center) Illustrative RFLP analysis of non-transfected HEK293T cells (NT) or transfected with nuclease only or co-delivered with the 181nt-ssODN template. (Right) HDR frequency induced by nuclease and a 181nt-ssODN ( n = 5). b (Left) NGS analysis of allelic outcomes and associated HDR/indel ratio following transfection of HEK293T cells with nuclease and 181nt-ssODN. (Center) Frequencies of reads carrying either insertion or deletion. Region spanning sgRNA sequence is highlighted in grey. (Right) Most common observed alleles (with frequencies ≥ 1%) aligned on the sgRNA sequence. HDR modification in blue and indels in red. c (Left) Quantification of UROS-specific activity from HEK293T cells NT or transfected with nuclease and 181nt-ssODN ( n = 3). Values are normalized with NT cells. (Right) Fluorocyte frequencies and illustrative flow cytometry results from NT or HEK293T cells transfected with nuclease and a 181nt-ssODN ( n = 5). Blue and red dots (and associated percentages) depict non-fluorescent cells and fluorocytes, respectively, with type-I porphyrin accumulation. Results are presented as mean ± SEM. The data are from independent experiments. Statistical significance is inferred on raw data using two-tailed unpaired t test for UROS-specific activity. *** p

    Article Snippet: PCR products were purified with Nucleospin® Gel and PCR Clean-up (Macherey-Nagel) and digested with SacI (or ApaI for exon 10 UROS analysis) restriction enzyme (New England Biolabs, Ipswich, MA, USA) for 1 h at 37 °C.

    Techniques: Polymerase Chain Reaction, Transfection, Next-Generation Sequencing, Sequencing, Modification, Activity Assay, Flow Cytometry, Cytometry, Two Tailed Test