s adenosylmethionine sam 32mm  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Name:
    S adenosylmethionine SAM 32mM
    Description:
    S adenosylmethionine SAM 32mM 0 5 ml
    Catalog Number:
    b9003s
    Price:
    38
    Size:
    0 5 ml
    Category:
    Biochemical Reagents
    Buy from Supplier


    Structured Review

    New England Biolabs s adenosylmethionine sam 32mm
    S adenosylmethionine SAM 32mM
    S adenosylmethionine SAM 32mM 0 5 ml
    https://www.bioz.com/result/s adenosylmethionine sam 32mm/product/New England Biolabs
    Average 90 stars, based on 20 article reviews
    Price from $9.99 to $1999.99
    s adenosylmethionine sam 32mm - by Bioz Stars, 2020-01
    90/100 stars

    Images

    1) Product Images from "A post‐translational modification switch controls coactivator function of histone methyltransferases G9a and GLP"

    Article Title: A post‐translational modification switch controls coactivator function of histone methyltransferases G9a and GLP

    Journal: EMBO Reports

    doi: 10.15252/embr.201744060

    G9a and GLP are methylated on their N‐terminal domain in cells Schematic representation of the related proteins GLP (EHMT1) and G9a (EHMT2). N: N‐terminal coactivator domain, E: polyglutamate domain, Cys: cysteine‐rich region, ANK: six ankyrin repeats, SET: SET‐domain containing methyltransferase activity. Partial protein sequence of hG9a and hGLP homologs shows the hypothetical methylated lysine residues (K) in red. After protein methylation reactions, in vitro methylated proteins were detected by immunoblot with pan‐methyllysine antibody (pan met‐K). The corresponding Coomassie‐stained gels are shown as loading controls. SAM, S‐adenosylmethionine. Cos‐7 cells were transfected with plasmids encoding full‐length HA‐hG9a wild type or K185R mutant, or full‐length HA‐hGLP wild type or K205R mutant. Lysates were immunoprecipitated (IP) with pan met‐K antibody and immunoblotted with HA antibody (top), or the usage of the two antibodies was reversed (bottom). Expression of HA‐tagged proteins and β‐actin (loading control) in the unfractionated extracts is shown at the bottom (Input). Cos‐7 cells were transfected with a plasmid encoding full‐length HA‐hG9a and treated with 2 μM UNC0646 or vehicle DMSO for 24 h. Lysates were immunoprecipitated with pan met‐K antibody and immunoblotted with HA antibody (top), or the usage of the two antibodies was reversed (bottom). Methylation and phosphorylation of endogenous G9a and GLP in A549 cells treated with 100 nM dex for 4 h were analyzed by immunoprecipitation with control IgG antibody, anti‐G9a (top), or anti‐GLP (bottom), followed by immunoblot with antibodies listed. Expression of G9a, GLP, and β‐actin (loading control) in the unfractionated extracts is shown at the bottom (Input).
    Figure Legend Snippet: G9a and GLP are methylated on their N‐terminal domain in cells Schematic representation of the related proteins GLP (EHMT1) and G9a (EHMT2). N: N‐terminal coactivator domain, E: polyglutamate domain, Cys: cysteine‐rich region, ANK: six ankyrin repeats, SET: SET‐domain containing methyltransferase activity. Partial protein sequence of hG9a and hGLP homologs shows the hypothetical methylated lysine residues (K) in red. After protein methylation reactions, in vitro methylated proteins were detected by immunoblot with pan‐methyllysine antibody (pan met‐K). The corresponding Coomassie‐stained gels are shown as loading controls. SAM, S‐adenosylmethionine. Cos‐7 cells were transfected with plasmids encoding full‐length HA‐hG9a wild type or K185R mutant, or full‐length HA‐hGLP wild type or K205R mutant. Lysates were immunoprecipitated (IP) with pan met‐K antibody and immunoblotted with HA antibody (top), or the usage of the two antibodies was reversed (bottom). Expression of HA‐tagged proteins and β‐actin (loading control) in the unfractionated extracts is shown at the bottom (Input). Cos‐7 cells were transfected with a plasmid encoding full‐length HA‐hG9a and treated with 2 μM UNC0646 or vehicle DMSO for 24 h. Lysates were immunoprecipitated with pan met‐K antibody and immunoblotted with HA antibody (top), or the usage of the two antibodies was reversed (bottom). Methylation and phosphorylation of endogenous G9a and GLP in A549 cells treated with 100 nM dex for 4 h were analyzed by immunoprecipitation with control IgG antibody, anti‐G9a (top), or anti‐GLP (bottom), followed by immunoblot with antibodies listed. Expression of G9a, GLP, and β‐actin (loading control) in the unfractionated extracts is shown at the bottom (Input).

    Techniques Used: Methylation, Activity Assay, Sequencing, In Vitro, Staining, Transfection, Mutagenesis, Immunoprecipitation, Expressing, Plasmid Preparation

    2) Product Images from "Methyl donor S-adenosylmethionine (SAM) supplementation attenuates breast cancer growth, invasion, and metastasis in vivo; therapeutic and chemopreventive applications"

    Article Title: Methyl donor S-adenosylmethionine (SAM) supplementation attenuates breast cancer growth, invasion, and metastasis in vivo; therapeutic and chemopreventive applications

    Journal: Oncotarget

    doi: 10.18632/oncotarget.23704

    Effect of S-adenosylmethionine (SAM) on breast cancer cell proliferation, migration, invasion, anchorage-independent growth, and apoptosis in vitro (A) Schematic diagram of the treatment strategy for all the in vitro experiments. Human breast cancer cells MDA-MB-231 and Hs578T were treated with SAM (100 and 200 μM) by directly adding it to regular growth medium every other day from day 2 until they were harvested. (B) Human breast cancer cells MDA-MB-231 and Hs578T were plated in 6-well plates and treated with vehicle alone as control or SAM (100 and 200 μM). Cell growth rate in each group was determined on day 1, 3, 5, and 7 by Coulter counter as described in Methods. Results are shown as bar graphs of data obtained from three different experiments. (C) Wound healing assay for determining the migration capacity of the cells was carried out by making a cross-like scratch on the plate when they reached 90% confluency. Control and SAM (100 and 200 μM) treated cells were grown in culture media containing 2% FBS and migrating cells were photographed and recorded at different time points, and percentage of wound healing with respect to initial scratch (T0) was calculated using the equation described in ‘Supplementary Materials’. The results are represented as bar graphs obtained from three experiments. (D) Boyden chamber Matrigel invasion assay was used to measure the invasiveness of control and SAM-treated (100 and 200 μM) MDA-MB-231 and Hs578T cells. The cells were placed in the upper chamber, and conditioned media used as ‘chemoattractant’ was added into the lower chamber. Following an incubation period of 18 hours, the invasion process was stopped and the invaded cells from control and 100 and 200 μM SAM-treated groups were fixed, stained and randomly selected fields were counted under the microscope and averaged. Representative image of one randomly selected field for each treatment for both cell lines along with the number of cells invaded per field are shown. (E) After the usual treatment regimen, 5 × 10 3 cell from control and SAM-treated (100 μM and 200 μM) groups were plated onto soft agar for anchorage-independent growth assay. The culture media was replenished every other day for two weeks, and the number of colonies was counted. (F) Apoptosis was determined by flow cytometry after staining the control and SAM-treated cells with Annexin V/propidium iodide. Representative contour plots of annexinV-FITC staining of apoptotic cells vs. PI staining for both control and SAM-treated (100 μM) cells are shown. The bar graphs on the right panels show the total percentages of apoptotic cells for different treatments. Results are presented as the mean ± SEM from control and SAM-treated experimental cells. Significant differences were determined using ANOVA followed by post hoc Bonferroni test and are represented by asterisks ( * P
    Figure Legend Snippet: Effect of S-adenosylmethionine (SAM) on breast cancer cell proliferation, migration, invasion, anchorage-independent growth, and apoptosis in vitro (A) Schematic diagram of the treatment strategy for all the in vitro experiments. Human breast cancer cells MDA-MB-231 and Hs578T were treated with SAM (100 and 200 μM) by directly adding it to regular growth medium every other day from day 2 until they were harvested. (B) Human breast cancer cells MDA-MB-231 and Hs578T were plated in 6-well plates and treated with vehicle alone as control or SAM (100 and 200 μM). Cell growth rate in each group was determined on day 1, 3, 5, and 7 by Coulter counter as described in Methods. Results are shown as bar graphs of data obtained from three different experiments. (C) Wound healing assay for determining the migration capacity of the cells was carried out by making a cross-like scratch on the plate when they reached 90% confluency. Control and SAM (100 and 200 μM) treated cells were grown in culture media containing 2% FBS and migrating cells were photographed and recorded at different time points, and percentage of wound healing with respect to initial scratch (T0) was calculated using the equation described in ‘Supplementary Materials’. The results are represented as bar graphs obtained from three experiments. (D) Boyden chamber Matrigel invasion assay was used to measure the invasiveness of control and SAM-treated (100 and 200 μM) MDA-MB-231 and Hs578T cells. The cells were placed in the upper chamber, and conditioned media used as ‘chemoattractant’ was added into the lower chamber. Following an incubation period of 18 hours, the invasion process was stopped and the invaded cells from control and 100 and 200 μM SAM-treated groups were fixed, stained and randomly selected fields were counted under the microscope and averaged. Representative image of one randomly selected field for each treatment for both cell lines along with the number of cells invaded per field are shown. (E) After the usual treatment regimen, 5 × 10 3 cell from control and SAM-treated (100 μM and 200 μM) groups were plated onto soft agar for anchorage-independent growth assay. The culture media was replenished every other day for two weeks, and the number of colonies was counted. (F) Apoptosis was determined by flow cytometry after staining the control and SAM-treated cells with Annexin V/propidium iodide. Representative contour plots of annexinV-FITC staining of apoptotic cells vs. PI staining for both control and SAM-treated (100 μM) cells are shown. The bar graphs on the right panels show the total percentages of apoptotic cells for different treatments. Results are presented as the mean ± SEM from control and SAM-treated experimental cells. Significant differences were determined using ANOVA followed by post hoc Bonferroni test and are represented by asterisks ( * P

    Techniques Used: Migration, In Vitro, Multiple Displacement Amplification, Wound Healing Assay, Invasion Assay, Incubation, Staining, Microscopy, Growth Assay, Flow Cytometry, Cytometry

    Related Articles

    Transduction:

    Article Title: Alternative splicing regulates the expression of G9A and SUV39H2 methyltransferases, and dramatically changes SUV39H2 functions
    Article Snippet: Recombinant proteins and in vitro histone methyltransferase (HMT) assay For each recombinant protein, two plates (150 cm2 ) of 293T cells were transduced with virus issued from the corresponding pLVX construct. .. For in vitro HMT assay, the purified Flag-V5-tagged proteins and 1 μg of recombinant histone H3.1 (NEB, #M2503S) were incubated in HMT buffer (1 mM of S-adenosylmethionine (NEB, #B9003S), 25 mM Tris pH 8, 10% glycerol) 1 h at 37°C.

    Methylation Sequencing:

    Article Title: Early-life gene expression in neurons modulates lasting epigenetic states
    Article Snippet: 100 ng of unmethylated lambda DNA (Promega D1521) was sonicated to 200 bp using a Covaris S2 and was incubated with 1 µg of full-length human DNMT3A (Abcam 170408) along with 5µM biotinylated histone H3 (amino acids 1–20; Epicypher 12-0001) and S-Adenosyl methionine (SAM) (NEB B9003S) in 0.5mg/mL BSA, 25mM Tris-Cl (pH 8). .. After the incubation, DNA was isolated by phenol-chloroform extraction followed by ethanol precipitation, and bisulfite sequencing libraries were prepared as described above.

    Amplification:

    Article Title: Fitness Analyses of All Possible Point-Mutants for Regions of Genes in Yeast
    Article Snippet: T4 DNA ligase (New England Biolabs, cat. no.M0202) T4 DNA Ligase Buffer 10× (New England Biolabs, cat. no. B0202S) T4 Polynucleotide Kinase (New England Biolabs, cat. no. M0201) Deoxyribonucleotide triphosphates (dNTPs; 10 mM each nucleotide; New England Biolabs, cat. no. N0447) DpnI restriction endonuclease (New England Biolabs, cat. no. R0176) Taq polymerase (New England Biolabs, cat. no. M0273) Phusion® High-Fidelity DNA polymerase (New England Biolabs, cat. no. M0530S) ▲CRITICAL – a high-fidelity polymerase should be used for amplification products intended for use in downstream deep-sequencing to limit PCR errors. .. BsaI restriction endonuclease (New England Biolabs, cat. no.R0535) SphI restriction endonuclease (New Englan Biolabs, cat. no.R0182) MmeI restriction endonuclease (New England Biolabs, cat. no. R0637L) S-adenosyl methionine (SAM; New England Biolabs, cat. no. B9003S) NEB3 buffer (10× with 100× BSA; New England Biolabs, cat. no.B7003) NEB4 buffer (10×; New England Biolabs, cat. no. B7004S) Agarose, PCR grade (Fisher Bioreagents, cat. no. 9012-36-6) Ethidium bromide (Sigma, cat. no. E1510) !

    Article Title: DNA methylation and chromatin accessibility profiling of mouse and human fetal germ cells
    Article Snippet: The nuclei was released, washed with DPBS, and spiked in with 0.1% unmodified lambda DNA (ThermoFisher #SD0011), and then subjected to the 15 U M.CviPI GpC Methyltransferase (NEB #M0227L) treatment for 1 h at 37 °C, supplemented with 160 nM fresh SAM (NEB #B9003S), then followed by a boost with an additional 15 U M.CviPI and 160 nM fresh SAM for another 2 h at 37 °C. .. Briefly, the isolated genomic DNA was first bisulfite converted using MethylCode Bisulfite Conversion Kit (ThermoFisher #MECOV-50), and first strand was synthesized using random nonamer primers with biotin-tagged truncated Illumina P5 adapter (5′-biotin-CTACACGACGCTCTTCCGATCTNNNNNNNNN-3′), and second strands were synthesized using random nonamer primers containing a truncated P7 Illumina adapter (5′-AGACGTGTGCTCTTCCGATCTNNNNNNNNN-3′), the final library was amplified with 4-6 cycles of PCR using 1 U Kapa HiFi HS DNA Polymerase (KAPA Biosystems), and then AMpure XP Beads (Beckman Coulter) purified, quantified and pooled on Illumina HiSeq 2500 platform with 100 or 150 bp paired-end mode (sequenced by Novogene).

    Article Title: NDRG2 gene copy number is not altered in colorectal carcinoma
    Article Snippet: Bisulfite treatment and sequencing Bisulfite treatment of genomic DNA was performed as previously described[ ], using glycogen as carrier, and the precipitated DNA was redissolved in TE buffer, amplified by PCR and sequenced directly. .. A positive control with in vitro methylated (IVM) DNA was prepared by mixing 2 μL NEB2 buffer, 1 μL 20 x S-adenosylmethionine (New England Biolabs, B9003S), 200 ng reference human genomic DNA and 1 µL SssI methyltransferase (New England BioLabs, M0226S) in a total of 20 μL.

    Positive Control:

    Article Title: NDRG2 gene copy number is not altered in colorectal carcinoma
    Article Snippet: .. A positive control with in vitro methylated (IVM) DNA was prepared by mixing 2 μL NEB2 buffer, 1 μL 20 x S-adenosylmethionine (New England Biolabs, B9003S), 200 ng reference human genomic DNA and 1 µL SssI methyltransferase (New England BioLabs, M0226S) in a total of 20 μL. .. Samples were incubated at 37 °C overnight with occasional addition of 2 μL 20 x S-adenosylmethionine to ensure sufficient methyl-donor substrate.

    Synthesized:

    Article Title: DNA methylation and chromatin accessibility profiling of mouse and human fetal germ cells
    Article Snippet: The nuclei was released, washed with DPBS, and spiked in with 0.1% unmodified lambda DNA (ThermoFisher #SD0011), and then subjected to the 15 U M.CviPI GpC Methyltransferase (NEB #M0227L) treatment for 1 h at 37 °C, supplemented with 160 nM fresh SAM (NEB #B9003S), then followed by a boost with an additional 15 U M.CviPI and 160 nM fresh SAM for another 2 h at 37 °C. .. Briefly, the isolated genomic DNA was first bisulfite converted using MethylCode Bisulfite Conversion Kit (ThermoFisher #MECOV-50), and first strand was synthesized using random nonamer primers with biotin-tagged truncated Illumina P5 adapter (5′-biotin-CTACACGACGCTCTTCCGATCTNNNNNNNNN-3′), and second strands were synthesized using random nonamer primers containing a truncated P7 Illumina adapter (5′-AGACGTGTGCTCTTCCGATCTNNNNNNNNN-3′), the final library was amplified with 4-6 cycles of PCR using 1 U Kapa HiFi HS DNA Polymerase (KAPA Biosystems), and then AMpure XP Beads (Beckman Coulter) purified, quantified and pooled on Illumina HiSeq 2500 platform with 100 or 150 bp paired-end mode (sequenced by Novogene).

    Lambda DNA Preparation:

    Article Title: DNA methylation and chromatin accessibility profiling of mouse and human fetal germ cells
    Article Snippet: .. The nuclei was released, washed with DPBS, and spiked in with 0.1% unmodified lambda DNA (ThermoFisher #SD0011), and then subjected to the 15 U M.CviPI GpC Methyltransferase (NEB #M0227L) treatment for 1 h at 37 °C, supplemented with 160 nM fresh SAM (NEB #B9003S), then followed by a boost with an additional 15 U M.CviPI and 160 nM fresh SAM for another 2 h at 37 °C. ..

    Article Title: Base-resolution profiling of active DNA demethylation using methylase-assisted bisulfite sequencing (MAB-seq) and caMAB-seq
    Article Snippet: Sodium acetate buffer solution (3 M, pH 5.2±0.1; Sigma-Aldrich, cat. no. S7899) EDTA (0.5 M, pH8.0; Life Technologies, cat. no. 15575-020) EGTA (0.5 M, pH8.0; prepared from Sigma-Aldrich, cat. no. 03777) RNase A (10 mg/mL; Life Technologies, cat. no. EN0531) Anti-H3K4me1 (10 μg/mL; Abcam, cat. no. ab8895) TaqαI (20 U/μL; New England Biolabs, cat. no. R0149L) Klenow fragment (exo– , 5 U/μL; Thermo Scientific, cat. no. EP0422) T4 DNA ligase (2000 U/μL; New England Biolabs, cat. no. M0202M) CutSmart buffer (10×; New England Biolabs, cat. no. B7204S) ATP (100 mM; Thermo Scientific, cat. no. R0441) dNTP set 100 mM solutions (Life Technologies, cat. no. R0181) SPRIselect reagent kit (Beckman Coulter, cat. no. ) DNeasy blood & tissue kit (Qiagen, cat. no. 69504) Qiagen EpiTect DNA bisulfite kit (Qiagen, cat. no. 59104) QIAquick nucleotide removal kit (Qiagen, cat. no. 28304) MinElute PCR purification kit (Qiagen, cat. no. 28004) M.SssI (20 U/μL, New England Biolabs, M0226M) NEBuffer 2 (10x; cat. no. B7002S) S-adenosylmethionine (SAM) (32 mM; New England Biolabs, cat. no. B9003S) CRITICAL Always use SAM before its expiration date and make aliquots to avoid multiple cycles of freeze / thaw. .. Unmethylated Lambda DNA (Promega, cat. no. D1521) Agilent High Sensitivity DNA Kit (Agilent Technologies, cat. no. 5067-4626) cOmplete EDTA-free proteinase inhibitor (Roche, cat. no. 11873580001) Dynabeads Protein G for Immunoprecipitation (ThermoFisher Scientific, cat. no. 10004D) RNase A (Life Technologies, cat. no. 12091-201) Proteinase K (New England Biolabs, cat. no. P8107S) Glycogen (Roche Life Science, cat. no. 10901393001) 5 PRIME Phase Lock Gel heavy 2 mL (Fisher Scientific, cat. no. FP2302830) Phenol - chloroform - isoamyl alcohol mixture (Sigma-Aldrich, cat. no. 77617) !

    Article Title: Early-life gene expression in neurons modulates lasting epigenetic states
    Article Snippet: .. 100 ng of unmethylated lambda DNA (Promega D1521) was sonicated to 200 bp using a Covaris S2 and was incubated with 1 µg of full-length human DNMT3A (Abcam 170408) along with 5µM biotinylated histone H3 (amino acids 1–20; Epicypher 12-0001) and S-Adenosyl methionine (SAM) (NEB B9003S) in 0.5mg/mL BSA, 25mM Tris-Cl (pH 8). ..

    Construct:

    Article Title: Alternative splicing regulates the expression of G9A and SUV39H2 methyltransferases, and dramatically changes SUV39H2 functions
    Article Snippet: Recombinant proteins and in vitro histone methyltransferase (HMT) assay For each recombinant protein, two plates (150 cm2 ) of 293T cells were transduced with virus issued from the corresponding pLVX construct. .. For in vitro HMT assay, the purified Flag-V5-tagged proteins and 1 μg of recombinant histone H3.1 (NEB, #M2503S) were incubated in HMT buffer (1 mM of S-adenosylmethionine (NEB, #B9003S), 25 mM Tris pH 8, 10% glycerol) 1 h at 37°C.

    SYBR Green Assay:

    Article Title: Fitness Analyses of All Possible Point-Mutants for Regions of Genes in Yeast
    Article Snippet: BsaI restriction endonuclease (New England Biolabs, cat. no.R0535) SphI restriction endonuclease (New Englan Biolabs, cat. no.R0182) MmeI restriction endonuclease (New England Biolabs, cat. no. R0637L) S-adenosyl methionine (SAM; New England Biolabs, cat. no. B9003S) NEB3 buffer (10× with 100× BSA; New England Biolabs, cat. no.B7003) NEB4 buffer (10×; New England Biolabs, cat. no. B7004S) Agarose, PCR grade (Fisher Bioreagents, cat. no. 9012-36-6) Ethidium bromide (Sigma, cat. no. E1510) ! .. SYBR Green I (10000×; Invitrogen, cat. no. S-7563) Tris Base (Fisher Bioreagents, cat. no. BP152-500) Acetic acid, glacial (Fisher Scientific, cat. no. A38-500) Bromophenol Blue (Sigma-Aldrich, cat. no. B0126) Ethylenediaminetetraacetic acid (EDTA; Sigma-Aldrich, cat. no. E6758) DNA ladder – 1 KB (New England Biolabs, cat. no. N3232) DNA ladder – 100 BP(New England Biolabs, cat. no. N3231) Zymoclean Gel DNA Recovery Kit (Zymoresearch, cat. no. D4001) ZR Plasmid Miniprep Kit (Zymoresearch, cat. no. D4015) OmniMax competent E. coli strain (Invitrogen, cat. no. C854003) Kanamycin-A monosulfate (or bacterial antibiotic matching vector marker)(Sigma-Aldrich, cat. no. K4000) Ampicillin sodium salt (Sigma-Aldrich, cat. no. A9518-100G) G418 disulfate salt (Sigma-Aldrich, cat. no. A1720) Polyethylene Glycol 3350 (PEG 3350; Hampton Research cat. no. HR2-591) Lithium acetate dihydrate (Sigma-Aldrich, cat. no. L4158) Salmon Sperm DNA (Sigma-Aldrich, cat. no. D1626) Yeast nitrogenous base without Amino Acids (VWR, cat. no. 61000-200) Ammonium Sulfate (Sigma-Aldrich, cat. no. A5132) Sodium Chloride (Fisher Bioreagents, cat. no. 5271-3) Zymolyase (Zymoresearch, cat. No E1004) Bacto- Tryptone (Becton Dickison, cat. no. 211705) Bacto- Peptone (Becton Dickison, cat. no. 211677) Bacto- Yeast Extract (Becton Dickison, cat. no. 212750) Bacto- Agar (Becton Dickison, cat. no. 214010) Adenine Hemisulfate (Sigma-Aldrich, cat. no. A9126-100g) L-Aspartic acid (Sigma-Aldrich, cat. no. A8949) L-Arginine (Sigma-Aldrich, cat. no. A5006) L-Valine (Sigma-Aldrich, cat. no. V0513) L-Glutamic Acid (Sigma-Aldrich, cat. no. G1251) L-Serine (Sigma-Aldrich, cat. no. S4311) L-Threonine (Sigma-Aldrich, cat. no. T8625) L-Isoleucine (Sigma-Aldrich, cat. no. I2752) L-Phenylalanine (Sigma-Aldrich, cat. no. P2126) L-Tyrosine (Sigma-Aldrich, cat. no. T8566) L-Histidine (Sigma-Aldrich, cat. no. H8000) L-Methionine (Sigma-Aldrich, cat. no. M5308) L-Leucine (Sigma-Aldrich, cat. no. L8000) L-Lysine (Sigma-Aldrich, cat. no. L5501) Oligonucleotides (IDT DNA Technologies) see for oligonucleotides used to study a 10 amino acid sequence of Hsp90 (DNA sequence: 5’ GCTAGTGAAACTTTTGAATTTCAAGCTGAA 3’) in pRNDM Custom bio-informatics software (available from ).

    Incubation:

    Article Title: Alternative splicing regulates the expression of G9A and SUV39H2 methyltransferases, and dramatically changes SUV39H2 functions
    Article Snippet: .. For in vitro HMT assay, the purified Flag-V5-tagged proteins and 1 μg of recombinant histone H3.1 (NEB, #M2503S) were incubated in HMT buffer (1 mM of S-adenosylmethionine (NEB, #B9003S), 25 mM Tris pH 8, 10% glycerol) 1 h at 37°C. .. Then, in vitro reaction were analyzed by western blot to follow histone methylation levels as indicated in figure.

    Article Title: Tumor Necrosis Factor (TNF)-α Induction of CXCL10 in Endothelial Cells Requires Protein Arginine Methyltransferase 5 (PRMT5)-mediated Nuclear Factor (NF)-κB p65 Methylation *
    Article Snippet: .. Active, recombinant human PRMT5 expressed in HEK293 (Sigma-Aldrich, SRP0145), full-length recombinant human p65 produced in HEK293 (OriGene, TA301086), and the methyl donor S -adenosylmethionine (New England Biolabs, B9003S) were incubated for 90 min at 37 °C in a 30-μl volume according to published methods ( ). .. In each reaction, 0.3 μg of PRMT5, 1.0 μg of p65, and S -adenosylmethionine was added to a final concentration of 80 μ m .

    Article Title: A Cotransformation Method To Identify a Restriction-Modification Enzyme That Reduces Conjugation Efficiency in Campylobacter jejuni
    Article Snippet: The assay for the endonuclease activity of rCjeI was performed in the volume of 50 μl composed of 2.25 μg of purified rCjeI, 3 μg of shuttle vector pRY107, 50 mM potassium acetate, 20 mM Tris-acetate (pH 7.9), 10 mM magnesium acetate, 1 mM dithiothreitol (DTT), 100 μg/ml bovine serum albumin (BSA; NEB), and 80 μM S -adenosyl-methionine (catalog no. B9003S; NEB). .. The reaction mixture was incubated at 37°C; samples were taken at different time points, followed by immediate heat inactivation of rCjeI at 65°C for 15 min.

    Article Title: The Effect of PRMT1-Mediated Arginine Methylation on the Subcellular Localization, Stress Granules, and Detergent-Insoluble Aggregates of FUS/TLS
    Article Snippet: .. Then 1 µg of recombinant PRMT1 (10 units) was combined with 1 µg GST-FUS or GST alone and 80 µM S -adenosyl- L-methionine (SAM)(New England Biolabs, #B9003S) in reaction buffer [20 mM Tris–HCl (pH 8.0), 200 mM NaCl, 0.4 mM EDTA], and reactions were incubated for 1 hour at 37°C. .. The reaction mixture was resuspended in loading buffer, boiled, resolved by SDS-PAGE, and transferred onto PVDF membrane.

    Article Title: NDRG2 gene copy number is not altered in colorectal carcinoma
    Article Snippet: A positive control with in vitro methylated (IVM) DNA was prepared by mixing 2 μL NEB2 buffer, 1 μL 20 x S-adenosylmethionine (New England Biolabs, B9003S), 200 ng reference human genomic DNA and 1 µL SssI methyltransferase (New England BioLabs, M0226S) in a total of 20 μL. .. Samples were incubated at 37 °C overnight with occasional addition of 2 μL 20 x S-adenosylmethionine to ensure sufficient methyl-donor substrate.

    Article Title: Increasing G9a automethylation sensitizes B acute lymphoblastic leukemia cells to glucocorticoid-induced death
    Article Snippet: .. In vitro methylation and demethylation assays For G9a methylation 1 μg of recombinant G9a protein (hG9a FL, Active Motif, #31410) was incubated with 1 mM unradiolabeled S -adenosylmethionine (SAM, New England Biolabs, B9003S) for 3 h at room temperature in methylation buffer (50 mM Tris-HCl pH 8.6, 0.02% Triton X-100, 2 mM MgCl2 , 1 mM TCEP (tris(2-carboxyethyl)phosphine)). .. For GLP methylation bacterially produced glutathione S -transferase (GST) fusion proteins (2 μg) of N-terminal fragments of GLP (GST-hGLP N) were incubated for 90 min at 30 °C with GST-hGLP ΔN in the presence of 1 mM of unradiolabeled SAM.

    Article Title: A post‐translational modification switch controls coactivator function of histone methyltransferases G9a and GLP
    Article Snippet: .. Bacterially produced GST fusion proteins (2 μg) of N‐terminal fragments of G9a or GLP (GST‐hG9a N or GST‐hGLP N), mutant (GST‐hG9a N K185R or GST‐hGLP N K205R or GST‐hG9a N T186A), or GST alone were incubated 90 min at 30°C with GST‐hG9a ΔN or GST‐hGLP ΔN in the presence (or not) of 1 mM of unradiolabeled SAM (New England Biolabs, B9003S). .. Methylated products were analyzed by standard SDS gel electrophoresis followed by immunoblot.

    Article Title: Early-life gene expression in neurons modulates lasting epigenetic states
    Article Snippet: .. 100 ng of unmethylated lambda DNA (Promega D1521) was sonicated to 200 bp using a Covaris S2 and was incubated with 1 µg of full-length human DNMT3A (Abcam 170408) along with 5µM biotinylated histone H3 (amino acids 1–20; Epicypher 12-0001) and S-Adenosyl methionine (SAM) (NEB B9003S) in 0.5mg/mL BSA, 25mM Tris-Cl (pH 8). ..

    Article Title: CLDN18.1 attenuates malignancy and related signaling pathways of lung adenocarcinoma in vivo and in vitro
    Article Snippet: .. The plasmids pCpGL and pCpGL-300 (20 μg) were each incubated for 48 hours at 37°C with 50 units of methyltransferase Sss I (New England Biolabs, Ipswich, MA; #M0226L) and 160 μM S-adenosylmethionine (SAM) (New England Biolabs; #B9003S). ..

    Luciferase:

    Article Title: CLDN18.1 attenuates malignancy and related signaling pathways of lung adenocarcinoma in vivo and in vitro
    Article Snippet: Paragraph title: Methylation, transient transfections and luciferase assays ... The plasmids pCpGL and pCpGL-300 (20 μg) were each incubated for 48 hours at 37°C with 50 units of methyltransferase Sss I (New England Biolabs, Ipswich, MA; #M0226L) and 160 μM S-adenosylmethionine (SAM) (New England Biolabs; #B9003S).

    Activity Assay:

    Article Title: A Cotransformation Method To Identify a Restriction-Modification Enzyme That Reduces Conjugation Efficiency in Campylobacter jejuni
    Article Snippet: .. The assay for the endonuclease activity of rCjeI was performed in the volume of 50 μl composed of 2.25 μg of purified rCjeI, 3 μg of shuttle vector pRY107, 50 mM potassium acetate, 20 mM Tris-acetate (pH 7.9), 10 mM magnesium acetate, 1 mM dithiothreitol (DTT), 100 μg/ml bovine serum albumin (BSA; NEB), and 80 μM S -adenosyl-methionine (catalog no. B9003S; NEB). .. The reaction mixture was incubated at 37°C; samples were taken at different time points, followed by immediate heat inactivation of rCjeI at 65°C for 15 min.

    Article Title: Genetic variation affecting DNA methylation and the human imprinting disorder, Beckwith-Wiedemann syndrome
    Article Snippet: Paragraph title: Measurement of DNA methyltransferase activity ... Fifteen nanograms of each purified pull-down GFP-tagged DNMT1 protein (bead-bound) derived from each DNMT1 protein variant was resuspended in buffer (100 mM KCl, 10 mM Tris-HCl, pH 7.6, 1 mM EDTA, 1 mM DTT) supplemented with 100 μM S -adenosyl-l -methionine (SAM) (New England Biolabs, Cat #B9003S), 4 μL end-labelled DNA trapping substrate (prepared as described above) and 160 ng/μL BSA in a total reaction volume of 200 μL.

    Article Title: Early-life gene expression in neurons modulates lasting epigenetic states
    Article Snippet: Paragraph title: In vitro DNA methyltransferase activity assay ... 100 ng of unmethylated lambda DNA (Promega D1521) was sonicated to 200 bp using a Covaris S2 and was incubated with 1 µg of full-length human DNMT3A (Abcam 170408) along with 5µM biotinylated histone H3 (amino acids 1–20; Epicypher 12-0001) and S-Adenosyl methionine (SAM) (NEB B9003S) in 0.5mg/mL BSA, 25mM Tris-Cl (pH 8).

    Article Title: CLDN18.1 attenuates malignancy and related signaling pathways of lung adenocarcinoma in vivo and in vitro
    Article Snippet: The plasmids pCpGL and pCpGL-300 (20 μg) were each incubated for 48 hours at 37°C with 50 units of methyltransferase Sss I (New England Biolabs, Ipswich, MA; #M0226L) and 160 μM S-adenosylmethionine (SAM) (New England Biolabs; #B9003S). .. Reporter activity was determined 48 hr later with the Dual-Luciferase Reporter System (Promega, Madison, WI; #E1960). siRNA transfections of H23/C18 cells were performed with Lipofectamine RNAi-MAX (Thermo Fisher, Waltham, MA; #13778030) according to the manufacturer’s instructions.

    Expressing:

    Article Title: The Effect of PRMT1-Mediated Arginine Methylation on the Subcellular Localization, Stress Granules, and Detergent-Insoluble Aggregates of FUS/TLS
    Article Snippet: Full-length FUS/TLS cDNA was subcloned into the pGEX-5X (GE Healthcare) bacterial expression vector to produce glutathione S -transferase (GST) fusion proteins for assay. .. Then 1 µg of recombinant PRMT1 (10 units) was combined with 1 µg GST-FUS or GST alone and 80 µM S -adenosyl- L-methionine (SAM)(New England Biolabs, #B9003S) in reaction buffer [20 mM Tris–HCl (pH 8.0), 200 mM NaCl, 0.4 mM EDTA], and reactions were incubated for 1 hour at 37°C.

    Modification:

    Article Title: Base-resolution profiling of active DNA demethylation using methylase-assisted bisulfite sequencing (MAB-seq) and caMAB-seq
    Article Snippet: Sodium acetate buffer solution (3 M, pH 5.2±0.1; Sigma-Aldrich, cat. no. S7899) EDTA (0.5 M, pH8.0; Life Technologies, cat. no. 15575-020) EGTA (0.5 M, pH8.0; prepared from Sigma-Aldrich, cat. no. 03777) RNase A (10 mg/mL; Life Technologies, cat. no. EN0531) Anti-H3K4me1 (10 μg/mL; Abcam, cat. no. ab8895) TaqαI (20 U/μL; New England Biolabs, cat. no. R0149L) Klenow fragment (exo– , 5 U/μL; Thermo Scientific, cat. no. EP0422) T4 DNA ligase (2000 U/μL; New England Biolabs, cat. no. M0202M) CutSmart buffer (10×; New England Biolabs, cat. no. B7204S) ATP (100 mM; Thermo Scientific, cat. no. R0441) dNTP set 100 mM solutions (Life Technologies, cat. no. R0181) SPRIselect reagent kit (Beckman Coulter, cat. no. ) DNeasy blood & tissue kit (Qiagen, cat. no. 69504) Qiagen EpiTect DNA bisulfite kit (Qiagen, cat. no. 59104) QIAquick nucleotide removal kit (Qiagen, cat. no. 28304) MinElute PCR purification kit (Qiagen, cat. no. 28004) M.SssI (20 U/μL, New England Biolabs, M0226M) NEBuffer 2 (10x; cat. no. B7002S) S-adenosylmethionine (SAM) (32 mM; New England Biolabs, cat. no. B9003S) CRITICAL Always use SAM before its expiration date and make aliquots to avoid multiple cycles of freeze / thaw. .. KAPA HiFi Uracil+ HotStart ReadyMix (Kapa Biosystems, KK2801) NEBNext Multiplex Oligos for Illumina (Index Primers Set 1; New England Biolabs, cat. no. E7335L) NEBNext Multiplex Oligos for Illumina (Index Primers Set 2; New England Biolabs, cat. no. E7500L) NEBNext ultra DNA Library Prep Kit for Illumina (New England Biolabs, cat. no. E7370S) NEBNext DNA Library Prep Master Mix Set for Illumina (New England Biolabs, cat. no. E6040S) Custom methylated adapters (asterisk denotes phosphorothioate bond, all cytosines are modified as 5mC; Integrated DNA Technologies): Forward: 5′-ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3′ Reverse: 5′-/5Phos/GATCGGAAGAGCACACGTCTGAACTCCAGTC-3′ Custom 5hmC/5fC/5caC-modified oligo (X: 5hmC, 5fC or 5caC): Forward: 5′-AGCCXGXGCXGXGCXGGTXGAGXGGCXGCTCCXGCAGC-3′, Reverse: 5′-GCTGXGGGAGXGGCXGCTXGACXGGXGXGGXGXGGGCT-3′ CRITICAL Only CpG site of these oligos are modified, which is different from the methylated adaptor in which all cytosines are modified as 5mC.

    Western Blot:

    Article Title: Alternative splicing regulates the expression of G9A and SUV39H2 methyltransferases, and dramatically changes SUV39H2 functions
    Article Snippet: Purified proteins were stored at -80°C in LS buffer supplemented with 10% glycerol, and their quantity estimated by western blot using anti-V5 antibody. .. For in vitro HMT assay, the purified Flag-V5-tagged proteins and 1 μg of recombinant histone H3.1 (NEB, #M2503S) were incubated in HMT buffer (1 mM of S-adenosylmethionine (NEB, #B9003S), 25 mM Tris pH 8, 10% glycerol) 1 h at 37°C.

    Article Title: The Effect of PRMT1-Mediated Arginine Methylation on the Subcellular Localization, Stress Granules, and Detergent-Insoluble Aggregates of FUS/TLS
    Article Snippet: Then 1 µg of recombinant PRMT1 (10 units) was combined with 1 µg GST-FUS or GST alone and 80 µM S -adenosyl- L-methionine (SAM)(New England Biolabs, #B9003S) in reaction buffer [20 mM Tris–HCl (pH 8.0), 200 mM NaCl, 0.4 mM EDTA], and reactions were incubated for 1 hour at 37°C. .. The methylation status was measured by Western blot with anti-Dimethyl Arginine (7E6) antibody (Novus Biologicals, #NB500-120) or Anti-dimethyl-Arginine Antibody, asymmetric (ASYM24, Millipore #07-414).

    Derivative Assay:

    Article Title: Genetic variation affecting DNA methylation and the human imprinting disorder, Beckwith-Wiedemann syndrome
    Article Snippet: .. Fifteen nanograms of each purified pull-down GFP-tagged DNMT1 protein (bead-bound) derived from each DNMT1 protein variant was resuspended in buffer (100 mM KCl, 10 mM Tris-HCl, pH 7.6, 1 mM EDTA, 1 mM DTT) supplemented with 100 μM S -adenosyl-l -methionine (SAM) (New England Biolabs, Cat #B9003S), 4 μL end-labelled DNA trapping substrate (prepared as described above) and 160 ng/μL BSA in a total reaction volume of 200 μL. .. For determination of DNA methyltransferase activity, trapping was performed at 37 °C for 90 min with constant mixing.

    Article Title: Genetic variation affecting DNA methylation and the human imprinting disorder, Beckwith-Wiedemann syndrome
    Article Snippet: .. Fifteen nanograms of each purified pull-down GFP-tagged DNMT1 protein (bead-bound) derived from each DNMT1 protein variant was resuspended in buffer (100 mM KCl, 10 mM Tris-HCl, pH 7.6, 1 mM EDTA, 1 mM DTT) supplemented with 100 μM S -adenosyl- l -methionine (SAM) (New England Biolabs, Cat #B9003S), 4 μL end-labelled DNA trapping substrate (prepared as described above) and 160 ng/μL BSA in a total reaction volume of 200 μL. .. For determination of DNA methyltransferase activity, trapping was performed at 37 °C for 90 min with constant mixing.

    Transfection:

    Article Title: CLDN18.1 attenuates malignancy and related signaling pathways of lung adenocarcinoma in vivo and in vitro
    Article Snippet: Paragraph title: Methylation, transient transfections and luciferase assays ... The plasmids pCpGL and pCpGL-300 (20 μg) were each incubated for 48 hours at 37°C with 50 units of methyltransferase Sss I (New England Biolabs, Ipswich, MA; #M0226L) and 160 μM S-adenosylmethionine (SAM) (New England Biolabs; #B9003S).

    Ligation:

    Article Title: Fitness Analyses of All Possible Point-Mutants for Regions of Genes in Yeast
    Article Snippet: A starting plasmid to generate libraries that does not contain sites for the type IIS endonuclease that you plan to use for the cassette ligation strategy, such as pRNDM ( ). .. BsaI restriction endonuclease (New England Biolabs, cat. no.R0535) SphI restriction endonuclease (New Englan Biolabs, cat. no.R0182) MmeI restriction endonuclease (New England Biolabs, cat. no. R0637L) S-adenosyl methionine (SAM; New England Biolabs, cat. no. B9003S) NEB3 buffer (10× with 100× BSA; New England Biolabs, cat. no.B7003) NEB4 buffer (10×; New England Biolabs, cat. no. B7004S) Agarose, PCR grade (Fisher Bioreagents, cat. no. 9012-36-6) Ethidium bromide (Sigma, cat. no. E1510) !

    Protease Inhibitor:

    Article Title: DNA methylation and chromatin accessibility profiling of mouse and human fetal germ cells
    Article Snippet: Briefly, cell pellet was first lysed in 1× lysis buffer (part of the NOMe-Seq Kit, Active motif #54000) with Protease inhibitor and PMSF (part of the NOMe-Seq Kit, Active motif #54000) on ice for 1 h with intermittent vortex. .. The nuclei was released, washed with DPBS, and spiked in with 0.1% unmodified lambda DNA (ThermoFisher #SD0011), and then subjected to the 15 U M.CviPI GpC Methyltransferase (NEB #M0227L) treatment for 1 h at 37 °C, supplemented with 160 nM fresh SAM (NEB #B9003S), then followed by a boost with an additional 15 U M.CviPI and 160 nM fresh SAM for another 2 h at 37 °C.

    Cell Culture:

    Article Title: Uremic Toxin Lanthionine Interferes with the Transsulfuration Pathway, Angiogenetic Signaling and Increases Intracellular Calcium
    Article Snippet: Paragraph title: 4.1. Cell Culture and Treatments ... Cells treatments under stimulating conditions (referred to as “stimulated”) were performed by supplying cells in the presence of final concentrations of the following compounds: 1mM DL-cysteine (Cys, 861677, Aldrich, St.Louis, MO, USA), 1 mM pyridoxine hydrochloride (B6, P6280, Sigma, St.Louis, MO, USA) and 5 μM S-adenosyl-L-methionine (SAM, B9003S, New England Biolabs Inc, Ipswich, MA, USA).

    SDS Page:

    Article Title: The Effect of PRMT1-Mediated Arginine Methylation on the Subcellular Localization, Stress Granules, and Detergent-Insoluble Aggregates of FUS/TLS
    Article Snippet: Then 1 µg of recombinant PRMT1 (10 units) was combined with 1 µg GST-FUS or GST alone and 80 µM S -adenosyl- L-methionine (SAM)(New England Biolabs, #B9003S) in reaction buffer [20 mM Tris–HCl (pH 8.0), 200 mM NaCl, 0.4 mM EDTA], and reactions were incubated for 1 hour at 37°C. .. The reaction mixture was resuspended in loading buffer, boiled, resolved by SDS-PAGE, and transferred onto PVDF membrane.

    Article Title: A post‐translational modification switch controls coactivator function of histone methyltransferases G9a and GLP
    Article Snippet: Bacterially produced GST fusion proteins (2 μg) of N‐terminal fragments of G9a or GLP (GST‐hG9a N or GST‐hGLP N), mutant (GST‐hG9a N K185R or GST‐hGLP N K205R or GST‐hG9a N T186A), or GST alone were incubated 90 min at 30°C with GST‐hG9a ΔN or GST‐hGLP ΔN in the presence (or not) of 1 mM of unradiolabeled SAM (New England Biolabs, B9003S). .. Methylation reactions were separated on SDS–PAGE.

    Generated:

    Article Title: Fitness Analyses of All Possible Point-Mutants for Regions of Genes in Yeast
    Article Snippet: Conditional yeast strains can be generated de novo, or located in previously published work and requested. .. BsaI restriction endonuclease (New England Biolabs, cat. no.R0535) SphI restriction endonuclease (New Englan Biolabs, cat. no.R0182) MmeI restriction endonuclease (New England Biolabs, cat. no. R0637L) S-adenosyl methionine (SAM; New England Biolabs, cat. no. B9003S) NEB3 buffer (10× with 100× BSA; New England Biolabs, cat. no.B7003) NEB4 buffer (10×; New England Biolabs, cat. no. B7004S) Agarose, PCR grade (Fisher Bioreagents, cat. no. 9012-36-6) Ethidium bromide (Sigma, cat. no. E1510) !

    Article Title: Genetic variation affecting DNA methylation and the human imprinting disorder, Beckwith-Wiedemann syndrome
    Article Snippet: Double-stranded DNA generated by oligo extension was prepared by denaturing 1 μL of each oligo at 100 μM in NEB2 buffer at 95 °C for 2 min followed by a slow cooling to 37 °C in a total final reaction volume of 15.2 μL. .. Fifteen nanograms of each purified pull-down GFP-tagged DNMT1 protein (bead-bound) derived from each DNMT1 protein variant was resuspended in buffer (100 mM KCl, 10 mM Tris-HCl, pH 7.6, 1 mM EDTA, 1 mM DTT) supplemented with 100 μM S -adenosyl-l -methionine (SAM) (New England Biolabs, Cat #B9003S), 4 μL end-labelled DNA trapping substrate (prepared as described above) and 160 ng/μL BSA in a total reaction volume of 200 μL.

    Article Title: Genetic variation affecting DNA methylation and the human imprinting disorder, Beckwith-Wiedemann syndrome
    Article Snippet: Double-stranded DNA generated by oligo extension was prepared by denaturing 1 μL of each oligo at 100 μM in NEB2 buffer at 95 °C for 2 min followed by a slow cooling to 37 °C in a total final reaction volume of 15.2 μL. .. Fifteen nanograms of each purified pull-down GFP-tagged DNMT1 protein (bead-bound) derived from each DNMT1 protein variant was resuspended in buffer (100 mM KCl, 10 mM Tris-HCl, pH 7.6, 1 mM EDTA, 1 mM DTT) supplemented with 100 μM S -adenosyl- l -methionine (SAM) (New England Biolabs, Cat #B9003S), 4 μL end-labelled DNA trapping substrate (prepared as described above) and 160 ng/μL BSA in a total reaction volume of 200 μL.

    Sequencing:

    Article Title: Fitness Analyses of All Possible Point-Mutants for Regions of Genes in Yeast
    Article Snippet: BsaI restriction endonuclease (New England Biolabs, cat. no.R0535) SphI restriction endonuclease (New Englan Biolabs, cat. no.R0182) MmeI restriction endonuclease (New England Biolabs, cat. no. R0637L) S-adenosyl methionine (SAM; New England Biolabs, cat. no. B9003S) NEB3 buffer (10× with 100× BSA; New England Biolabs, cat. no.B7003) NEB4 buffer (10×; New England Biolabs, cat. no. B7004S) Agarose, PCR grade (Fisher Bioreagents, cat. no. 9012-36-6) Ethidium bromide (Sigma, cat. no. E1510) ! .. SYBR Green I (10000×; Invitrogen, cat. no. S-7563) Tris Base (Fisher Bioreagents, cat. no. BP152-500) Acetic acid, glacial (Fisher Scientific, cat. no. A38-500) Bromophenol Blue (Sigma-Aldrich, cat. no. B0126) Ethylenediaminetetraacetic acid (EDTA; Sigma-Aldrich, cat. no. E6758) DNA ladder – 1 KB (New England Biolabs, cat. no. N3232) DNA ladder – 100 BP(New England Biolabs, cat. no. N3231) Zymoclean Gel DNA Recovery Kit (Zymoresearch, cat. no. D4001) ZR Plasmid Miniprep Kit (Zymoresearch, cat. no. D4015) OmniMax competent E. coli strain (Invitrogen, cat. no. C854003) Kanamycin-A monosulfate (or bacterial antibiotic matching vector marker)(Sigma-Aldrich, cat. no. K4000) Ampicillin sodium salt (Sigma-Aldrich, cat. no. A9518-100G) G418 disulfate salt (Sigma-Aldrich, cat. no. A1720) Polyethylene Glycol 3350 (PEG 3350; Hampton Research cat. no. HR2-591) Lithium acetate dihydrate (Sigma-Aldrich, cat. no. L4158) Salmon Sperm DNA (Sigma-Aldrich, cat. no. D1626) Yeast nitrogenous base without Amino Acids (VWR, cat. no. 61000-200) Ammonium Sulfate (Sigma-Aldrich, cat. no. A5132) Sodium Chloride (Fisher Bioreagents, cat. no. 5271-3) Zymolyase (Zymoresearch, cat. No E1004) Bacto- Tryptone (Becton Dickison, cat. no. 211705) Bacto- Peptone (Becton Dickison, cat. no. 211677) Bacto- Yeast Extract (Becton Dickison, cat. no. 212750) Bacto- Agar (Becton Dickison, cat. no. 214010) Adenine Hemisulfate (Sigma-Aldrich, cat. no. A9126-100g) L-Aspartic acid (Sigma-Aldrich, cat. no. A8949) L-Arginine (Sigma-Aldrich, cat. no. A5006) L-Valine (Sigma-Aldrich, cat. no. V0513) L-Glutamic Acid (Sigma-Aldrich, cat. no. G1251) L-Serine (Sigma-Aldrich, cat. no. S4311) L-Threonine (Sigma-Aldrich, cat. no. T8625) L-Isoleucine (Sigma-Aldrich, cat. no. I2752) L-Phenylalanine (Sigma-Aldrich, cat. no. P2126) L-Tyrosine (Sigma-Aldrich, cat. no. T8566) L-Histidine (Sigma-Aldrich, cat. no. H8000) L-Methionine (Sigma-Aldrich, cat. no. M5308) L-Leucine (Sigma-Aldrich, cat. no. L8000) L-Lysine (Sigma-Aldrich, cat. no. L5501) Oligonucleotides (IDT DNA Technologies) see for oligonucleotides used to study a 10 amino acid sequence of Hsp90 (DNA sequence: 5’ GCTAGTGAAACTTTTGAATTTCAAGCTGAA 3’) in pRNDM Custom bio-informatics software (available from ).

    Article Title: DNA methylation and chromatin accessibility profiling of mouse and human fetal germ cells
    Article Snippet: Paragraph title: Nucleosome occupancy and methylome sequencing ... The nuclei was released, washed with DPBS, and spiked in with 0.1% unmodified lambda DNA (ThermoFisher #SD0011), and then subjected to the 15 U M.CviPI GpC Methyltransferase (NEB #M0227L) treatment for 1 h at 37 °C, supplemented with 160 nM fresh SAM (NEB #B9003S), then followed by a boost with an additional 15 U M.CviPI and 160 nM fresh SAM for another 2 h at 37 °C.

    Article Title: NDRG2 gene copy number is not altered in colorectal carcinoma
    Article Snippet: Paragraph title: Bisulfite treatment and sequencing ... A positive control with in vitro methylated (IVM) DNA was prepared by mixing 2 μL NEB2 buffer, 1 μL 20 x S-adenosylmethionine (New England Biolabs, B9003S), 200 ng reference human genomic DNA and 1 µL SssI methyltransferase (New England BioLabs, M0226S) in a total of 20 μL.

    Sonication:

    Article Title: Early-life gene expression in neurons modulates lasting epigenetic states
    Article Snippet: .. 100 ng of unmethylated lambda DNA (Promega D1521) was sonicated to 200 bp using a Covaris S2 and was incubated with 1 µg of full-length human DNMT3A (Abcam 170408) along with 5µM biotinylated histone H3 (amino acids 1–20; Epicypher 12-0001) and S-Adenosyl methionine (SAM) (NEB B9003S) in 0.5mg/mL BSA, 25mM Tris-Cl (pH 8). ..

    Recombinant:

    Article Title: Alternative splicing regulates the expression of G9A and SUV39H2 methyltransferases, and dramatically changes SUV39H2 functions
    Article Snippet: .. For in vitro HMT assay, the purified Flag-V5-tagged proteins and 1 μg of recombinant histone H3.1 (NEB, #M2503S) were incubated in HMT buffer (1 mM of S-adenosylmethionine (NEB, #B9003S), 25 mM Tris pH 8, 10% glycerol) 1 h at 37°C. .. Then, in vitro reaction were analyzed by western blot to follow histone methylation levels as indicated in figure.

    Article Title: Tumor Necrosis Factor (TNF)-α Induction of CXCL10 in Endothelial Cells Requires Protein Arginine Methyltransferase 5 (PRMT5)-mediated Nuclear Factor (NF)-κB p65 Methylation *
    Article Snippet: .. Active, recombinant human PRMT5 expressed in HEK293 (Sigma-Aldrich, SRP0145), full-length recombinant human p65 produced in HEK293 (OriGene, TA301086), and the methyl donor S -adenosylmethionine (New England Biolabs, B9003S) were incubated for 90 min at 37 °C in a 30-μl volume according to published methods ( ). .. In each reaction, 0.3 μg of PRMT5, 1.0 μg of p65, and S -adenosylmethionine was added to a final concentration of 80 μ m .

    Article Title: The Effect of PRMT1-Mediated Arginine Methylation on the Subcellular Localization, Stress Granules, and Detergent-Insoluble Aggregates of FUS/TLS
    Article Snippet: .. Then 1 µg of recombinant PRMT1 (10 units) was combined with 1 µg GST-FUS or GST alone and 80 µM S -adenosyl- L-methionine (SAM)(New England Biolabs, #B9003S) in reaction buffer [20 mM Tris–HCl (pH 8.0), 200 mM NaCl, 0.4 mM EDTA], and reactions were incubated for 1 hour at 37°C. .. The reaction mixture was resuspended in loading buffer, boiled, resolved by SDS-PAGE, and transferred onto PVDF membrane.

    Article Title: Increasing G9a automethylation sensitizes B acute lymphoblastic leukemia cells to glucocorticoid-induced death
    Article Snippet: .. In vitro methylation and demethylation assays For G9a methylation 1 μg of recombinant G9a protein (hG9a FL, Active Motif, #31410) was incubated with 1 mM unradiolabeled S -adenosylmethionine (SAM, New England Biolabs, B9003S) for 3 h at room temperature in methylation buffer (50 mM Tris-HCl pH 8.6, 0.02% Triton X-100, 2 mM MgCl2 , 1 mM TCEP (tris(2-carboxyethyl)phosphine)). .. For GLP methylation bacterially produced glutathione S -transferase (GST) fusion proteins (2 μg) of N-terminal fragments of GLP (GST-hGLP N) were incubated for 90 min at 30 °C with GST-hGLP ΔN in the presence of 1 mM of unradiolabeled SAM.

    In Vivo:

    Article Title: The Effect of PRMT1-Mediated Arginine Methylation on the Subcellular Localization, Stress Granules, and Detergent-Insoluble Aggregates of FUS/TLS
    Article Snippet: Paragraph title: In vitro and in vivo Methylation Assay ... Then 1 µg of recombinant PRMT1 (10 units) was combined with 1 µg GST-FUS or GST alone and 80 µM S -adenosyl- L-methionine (SAM)(New England Biolabs, #B9003S) in reaction buffer [20 mM Tris–HCl (pH 8.0), 200 mM NaCl, 0.4 mM EDTA], and reactions were incubated for 1 hour at 37°C.

    Fluorescence:

    Article Title: Genetic variation affecting DNA methylation and the human imprinting disorder, Beckwith-Wiedemann syndrome
    Article Snippet: Fifteen nanograms of each purified pull-down GFP-tagged DNMT1 protein (bead-bound) derived from each DNMT1 protein variant was resuspended in buffer (100 mM KCl, 10 mM Tris-HCl, pH 7.6, 1 mM EDTA, 1 mM DTT) supplemented with 100 μM S -adenosyl-l -methionine (SAM) (New England Biolabs, Cat #B9003S), 4 μL end-labelled DNA trapping substrate (prepared as described above) and 160 ng/μL BSA in a total reaction volume of 200 μL. .. Bound-labelled DNA trapping substrate associated with each variant and wild-type DNMT1 protein was measured by fluorescence emission on a FLUOstar Optima microplate reader (BMG Labtech).

    Article Title: Genetic variation affecting DNA methylation and the human imprinting disorder, Beckwith-Wiedemann syndrome
    Article Snippet: Fifteen nanograms of each purified pull-down GFP-tagged DNMT1 protein (bead-bound) derived from each DNMT1 protein variant was resuspended in buffer (100 mM KCl, 10 mM Tris-HCl, pH 7.6, 1 mM EDTA, 1 mM DTT) supplemented with 100 μM S -adenosyl- l -methionine (SAM) (New England Biolabs, Cat #B9003S), 4 μL end-labelled DNA trapping substrate (prepared as described above) and 160 ng/μL BSA in a total reaction volume of 200 μL. .. Bound-labelled DNA trapping substrate associated with each variant and wild-type DNMT1 protein was measured by fluorescence emission on a FLUOstar Optima microplate reader (BMG Labtech).

    Methylation:

    Article Title: Alternative splicing regulates the expression of G9A and SUV39H2 methyltransferases, and dramatically changes SUV39H2 functions
    Article Snippet: For in vitro HMT assay, the purified Flag-V5-tagged proteins and 1 μg of recombinant histone H3.1 (NEB, #M2503S) were incubated in HMT buffer (1 mM of S-adenosylmethionine (NEB, #B9003S), 25 mM Tris pH 8, 10% glycerol) 1 h at 37°C. .. Then, in vitro reaction were analyzed by western blot to follow histone methylation levels as indicated in figure.

    Article Title: The Effect of PRMT1-Mediated Arginine Methylation on the Subcellular Localization, Stress Granules, and Detergent-Insoluble Aggregates of FUS/TLS
    Article Snippet: Paragraph title: In vitro and in vivo Methylation Assay ... Then 1 µg of recombinant PRMT1 (10 units) was combined with 1 µg GST-FUS or GST alone and 80 µM S -adenosyl- L-methionine (SAM)(New England Biolabs, #B9003S) in reaction buffer [20 mM Tris–HCl (pH 8.0), 200 mM NaCl, 0.4 mM EDTA], and reactions were incubated for 1 hour at 37°C.

    Article Title: NDRG2 gene copy number is not altered in colorectal carcinoma
    Article Snippet: .. A positive control with in vitro methylated (IVM) DNA was prepared by mixing 2 μL NEB2 buffer, 1 μL 20 x S-adenosylmethionine (New England Biolabs, B9003S), 200 ng reference human genomic DNA and 1 µL SssI methyltransferase (New England BioLabs, M0226S) in a total of 20 μL. .. Samples were incubated at 37 °C overnight with occasional addition of 2 μL 20 x S-adenosylmethionine to ensure sufficient methyl-donor substrate.

    Article Title: Increasing G9a automethylation sensitizes B acute lymphoblastic leukemia cells to glucocorticoid-induced death
    Article Snippet: .. In vitro methylation and demethylation assays For G9a methylation 1 μg of recombinant G9a protein (hG9a FL, Active Motif, #31410) was incubated with 1 mM unradiolabeled S -adenosylmethionine (SAM, New England Biolabs, B9003S) for 3 h at room temperature in methylation buffer (50 mM Tris-HCl pH 8.6, 0.02% Triton X-100, 2 mM MgCl2 , 1 mM TCEP (tris(2-carboxyethyl)phosphine)). .. For GLP methylation bacterially produced glutathione S -transferase (GST) fusion proteins (2 μg) of N-terminal fragments of GLP (GST-hGLP N) were incubated for 90 min at 30 °C with GST-hGLP ΔN in the presence of 1 mM of unradiolabeled SAM.

    Article Title: Base-resolution profiling of active DNA demethylation using methylase-assisted bisulfite sequencing (MAB-seq) and caMAB-seq
    Article Snippet: Sodium acetate buffer solution (3 M, pH 5.2±0.1; Sigma-Aldrich, cat. no. S7899) EDTA (0.5 M, pH8.0; Life Technologies, cat. no. 15575-020) EGTA (0.5 M, pH8.0; prepared from Sigma-Aldrich, cat. no. 03777) RNase A (10 mg/mL; Life Technologies, cat. no. EN0531) Anti-H3K4me1 (10 μg/mL; Abcam, cat. no. ab8895) TaqαI (20 U/μL; New England Biolabs, cat. no. R0149L) Klenow fragment (exo– , 5 U/μL; Thermo Scientific, cat. no. EP0422) T4 DNA ligase (2000 U/μL; New England Biolabs, cat. no. M0202M) CutSmart buffer (10×; New England Biolabs, cat. no. B7204S) ATP (100 mM; Thermo Scientific, cat. no. R0441) dNTP set 100 mM solutions (Life Technologies, cat. no. R0181) SPRIselect reagent kit (Beckman Coulter, cat. no. ) DNeasy blood & tissue kit (Qiagen, cat. no. 69504) Qiagen EpiTect DNA bisulfite kit (Qiagen, cat. no. 59104) QIAquick nucleotide removal kit (Qiagen, cat. no. 28304) MinElute PCR purification kit (Qiagen, cat. no. 28004) M.SssI (20 U/μL, New England Biolabs, M0226M) NEBuffer 2 (10x; cat. no. B7002S) S-adenosylmethionine (SAM) (32 mM; New England Biolabs, cat. no. B9003S) CRITICAL Always use SAM before its expiration date and make aliquots to avoid multiple cycles of freeze / thaw. .. KAPA HiFi Uracil+ HotStart ReadyMix (Kapa Biosystems, KK2801) NEBNext Multiplex Oligos for Illumina (Index Primers Set 1; New England Biolabs, cat. no. E7335L) NEBNext Multiplex Oligos for Illumina (Index Primers Set 2; New England Biolabs, cat. no. E7500L) NEBNext ultra DNA Library Prep Kit for Illumina (New England Biolabs, cat. no. E7370S) NEBNext DNA Library Prep Master Mix Set for Illumina (New England Biolabs, cat. no. E6040S) Custom methylated adapters (asterisk denotes phosphorothioate bond, all cytosines are modified as 5mC; Integrated DNA Technologies): Forward: 5′-ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3′ Reverse: 5′-/5Phos/GATCGGAAGAGCACACGTCTGAACTCCAGTC-3′ Custom 5hmC/5fC/5caC-modified oligo (X: 5hmC, 5fC or 5caC): Forward: 5′-AGCCXGXGCXGXGCXGGTXGAGXGGCXGCTCCXGCAGC-3′, Reverse: 5′-GCTGXGGGAGXGGCXGCTXGACXGGXGXGGXGXGGGCT-3′ CRITICAL Only CpG site of these oligos are modified, which is different from the methylated adaptor in which all cytosines are modified as 5mC.

    Article Title: A post‐translational modification switch controls coactivator function of histone methyltransferases G9a and GLP
    Article Snippet: Bacterially produced GST fusion proteins (2 μg) of N‐terminal fragments of G9a or GLP (GST‐hG9a N or GST‐hGLP N), mutant (GST‐hG9a N K185R or GST‐hGLP N K205R or GST‐hG9a N T186A), or GST alone were incubated 90 min at 30°C with GST‐hG9a ΔN or GST‐hGLP ΔN in the presence (or not) of 1 mM of unradiolabeled SAM (New England Biolabs, B9003S). .. Methylated products were analyzed by standard SDS gel electrophoresis followed by immunoblot.

    Article Title: CLDN18.1 attenuates malignancy and related signaling pathways of lung adenocarcinoma in vivo and in vitro
    Article Snippet: Paragraph title: Methylation, transient transfections and luciferase assays ... The plasmids pCpGL and pCpGL-300 (20 μg) were each incubated for 48 hours at 37°C with 50 units of methyltransferase Sss I (New England Biolabs, Ipswich, MA; #M0226L) and 160 μM S-adenosylmethionine (SAM) (New England Biolabs; #B9003S).

    Mutagenesis:

    Article Title: A post‐translational modification switch controls coactivator function of histone methyltransferases G9a and GLP
    Article Snippet: .. Bacterially produced GST fusion proteins (2 μg) of N‐terminal fragments of G9a or GLP (GST‐hG9a N or GST‐hGLP N), mutant (GST‐hG9a N K185R or GST‐hGLP N K205R or GST‐hG9a N T186A), or GST alone were incubated 90 min at 30°C with GST‐hG9a ΔN or GST‐hGLP ΔN in the presence (or not) of 1 mM of unradiolabeled SAM (New England Biolabs, B9003S). .. Methylated products were analyzed by standard SDS gel electrophoresis followed by immunoblot.

    Isolation:

    Article Title: Alternative splicing regulates the expression of G9A and SUV39H2 methyltransferases, and dramatically changes SUV39H2 functions
    Article Snippet: Finally, the isolated proteins were eluted twice with 50 μl of 100 μg/ml 3X FLAG peptides (Sigma, #F4799) with shaking, 15 min at room temperature. .. For in vitro HMT assay, the purified Flag-V5-tagged proteins and 1 μg of recombinant histone H3.1 (NEB, #M2503S) were incubated in HMT buffer (1 mM of S-adenosylmethionine (NEB, #B9003S), 25 mM Tris pH 8, 10% glycerol) 1 h at 37°C.

    Article Title: DNA methylation and chromatin accessibility profiling of mouse and human fetal germ cells
    Article Snippet: The nuclei was released, washed with DPBS, and spiked in with 0.1% unmodified lambda DNA (ThermoFisher #SD0011), and then subjected to the 15 U M.CviPI GpC Methyltransferase (NEB #M0227L) treatment for 1 h at 37 °C, supplemented with 160 nM fresh SAM (NEB #B9003S), then followed by a boost with an additional 15 U M.CviPI and 160 nM fresh SAM for another 2 h at 37 °C. .. Briefly, the isolated genomic DNA was first bisulfite converted using MethylCode Bisulfite Conversion Kit (ThermoFisher #MECOV-50), and first strand was synthesized using random nonamer primers with biotin-tagged truncated Illumina P5 adapter (5′-biotin-CTACACGACGCTCTTCCGATCTNNNNNNNNN-3′), and second strands were synthesized using random nonamer primers containing a truncated P7 Illumina adapter (5′-AGACGTGTGCTCTTCCGATCTNNNNNNNNN-3′), the final library was amplified with 4-6 cycles of PCR using 1 U Kapa HiFi HS DNA Polymerase (KAPA Biosystems), and then AMpure XP Beads (Beckman Coulter) purified, quantified and pooled on Illumina HiSeq 2500 platform with 100 or 150 bp paired-end mode (sequenced by Novogene).

    Article Title: Early-life gene expression in neurons modulates lasting epigenetic states
    Article Snippet: 100 ng of unmethylated lambda DNA (Promega D1521) was sonicated to 200 bp using a Covaris S2 and was incubated with 1 µg of full-length human DNMT3A (Abcam 170408) along with 5µM biotinylated histone H3 (amino acids 1–20; Epicypher 12-0001) and S-Adenosyl methionine (SAM) (NEB B9003S) in 0.5mg/mL BSA, 25mM Tris-Cl (pH 8). .. After the incubation, DNA was isolated by phenol-chloroform extraction followed by ethanol precipitation, and bisulfite sequencing libraries were prepared as described above.

    Purification:

    Article Title: Alternative splicing regulates the expression of G9A and SUV39H2 methyltransferases, and dramatically changes SUV39H2 functions
    Article Snippet: .. For in vitro HMT assay, the purified Flag-V5-tagged proteins and 1 μg of recombinant histone H3.1 (NEB, #M2503S) were incubated in HMT buffer (1 mM of S-adenosylmethionine (NEB, #B9003S), 25 mM Tris pH 8, 10% glycerol) 1 h at 37°C. .. Then, in vitro reaction were analyzed by western blot to follow histone methylation levels as indicated in figure.

    Article Title: DNA methylation and chromatin accessibility profiling of mouse and human fetal germ cells
    Article Snippet: The nuclei was released, washed with DPBS, and spiked in with 0.1% unmodified lambda DNA (ThermoFisher #SD0011), and then subjected to the 15 U M.CviPI GpC Methyltransferase (NEB #M0227L) treatment for 1 h at 37 °C, supplemented with 160 nM fresh SAM (NEB #B9003S), then followed by a boost with an additional 15 U M.CviPI and 160 nM fresh SAM for another 2 h at 37 °C. .. Briefly, the isolated genomic DNA was first bisulfite converted using MethylCode Bisulfite Conversion Kit (ThermoFisher #MECOV-50), and first strand was synthesized using random nonamer primers with biotin-tagged truncated Illumina P5 adapter (5′-biotin-CTACACGACGCTCTTCCGATCTNNNNNNNNN-3′), and second strands were synthesized using random nonamer primers containing a truncated P7 Illumina adapter (5′-AGACGTGTGCTCTTCCGATCTNNNNNNNNN-3′), the final library was amplified with 4-6 cycles of PCR using 1 U Kapa HiFi HS DNA Polymerase (KAPA Biosystems), and then AMpure XP Beads (Beckman Coulter) purified, quantified and pooled on Illumina HiSeq 2500 platform with 100 or 150 bp paired-end mode (sequenced by Novogene).

    Article Title: A Cotransformation Method To Identify a Restriction-Modification Enzyme That Reduces Conjugation Efficiency in Campylobacter jejuni
    Article Snippet: .. The assay for the endonuclease activity of rCjeI was performed in the volume of 50 μl composed of 2.25 μg of purified rCjeI, 3 μg of shuttle vector pRY107, 50 mM potassium acetate, 20 mM Tris-acetate (pH 7.9), 10 mM magnesium acetate, 1 mM dithiothreitol (DTT), 100 μg/ml bovine serum albumin (BSA; NEB), and 80 μM S -adenosyl-methionine (catalog no. B9003S; NEB). .. The reaction mixture was incubated at 37°C; samples were taken at different time points, followed by immediate heat inactivation of rCjeI at 65°C for 15 min.

    Article Title: The Effect of PRMT1-Mediated Arginine Methylation on the Subcellular Localization, Stress Granules, and Detergent-Insoluble Aggregates of FUS/TLS
    Article Snippet: GST fused-FUS/TLS (GST-FUS) or GST alone (control) was produced and purified as described by the manufacturer. .. Then 1 µg of recombinant PRMT1 (10 units) was combined with 1 µg GST-FUS or GST alone and 80 µM S -adenosyl- L-methionine (SAM)(New England Biolabs, #B9003S) in reaction buffer [20 mM Tris–HCl (pH 8.0), 200 mM NaCl, 0.4 mM EDTA], and reactions were incubated for 1 hour at 37°C.

    Article Title: Base-resolution profiling of active DNA demethylation using methylase-assisted bisulfite sequencing (MAB-seq) and caMAB-seq
    Article Snippet: .. Sodium acetate buffer solution (3 M, pH 5.2±0.1; Sigma-Aldrich, cat. no. S7899) EDTA (0.5 M, pH8.0; Life Technologies, cat. no. 15575-020) EGTA (0.5 M, pH8.0; prepared from Sigma-Aldrich, cat. no. 03777) RNase A (10 mg/mL; Life Technologies, cat. no. EN0531) Anti-H3K4me1 (10 μg/mL; Abcam, cat. no. ab8895) TaqαI (20 U/μL; New England Biolabs, cat. no. R0149L) Klenow fragment (exo– , 5 U/μL; Thermo Scientific, cat. no. EP0422) T4 DNA ligase (2000 U/μL; New England Biolabs, cat. no. M0202M) CutSmart buffer (10×; New England Biolabs, cat. no. B7204S) ATP (100 mM; Thermo Scientific, cat. no. R0441) dNTP set 100 mM solutions (Life Technologies, cat. no. R0181) SPRIselect reagent kit (Beckman Coulter, cat. no. ) DNeasy blood & tissue kit (Qiagen, cat. no. 69504) Qiagen EpiTect DNA bisulfite kit (Qiagen, cat. no. 59104) QIAquick nucleotide removal kit (Qiagen, cat. no. 28304) MinElute PCR purification kit (Qiagen, cat. no. 28004) M.SssI (20 U/μL, New England Biolabs, M0226M) NEBuffer 2 (10x; cat. no. B7002S) S-adenosylmethionine (SAM) (32 mM; New England Biolabs, cat. no. B9003S) CRITICAL Always use SAM before its expiration date and make aliquots to avoid multiple cycles of freeze / thaw. .. KAPA HiFi Uracil+ HotStart ReadyMix (Kapa Biosystems, KK2801) NEBNext Multiplex Oligos for Illumina (Index Primers Set 1; New England Biolabs, cat. no. E7335L) NEBNext Multiplex Oligos for Illumina (Index Primers Set 2; New England Biolabs, cat. no. E7500L) NEBNext ultra DNA Library Prep Kit for Illumina (New England Biolabs, cat. no. E7370S) NEBNext DNA Library Prep Master Mix Set for Illumina (New England Biolabs, cat. no. E6040S) Custom methylated adapters (asterisk denotes phosphorothioate bond, all cytosines are modified as 5mC; Integrated DNA Technologies): Forward: 5′-ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3′ Reverse: 5′-/5Phos/GATCGGAAGAGCACACGTCTGAACTCCAGTC-3′ Custom 5hmC/5fC/5caC-modified oligo (X: 5hmC, 5fC or 5caC): Forward: 5′-AGCCXGXGCXGXGCXGGTXGAGXGGCXGCTCCXGCAGC-3′, Reverse: 5′-GCTGXGGGAGXGGCXGCTXGACXGGXGXGGXGXGGGCT-3′ CRITICAL Only CpG site of these oligos are modified, which is different from the methylated adaptor in which all cytosines are modified as 5mC.

    Article Title: Genetic variation affecting DNA methylation and the human imprinting disorder, Beckwith-Wiedemann syndrome
    Article Snippet: .. Fifteen nanograms of each purified pull-down GFP-tagged DNMT1 protein (bead-bound) derived from each DNMT1 protein variant was resuspended in buffer (100 mM KCl, 10 mM Tris-HCl, pH 7.6, 1 mM EDTA, 1 mM DTT) supplemented with 100 μM S -adenosyl-l -methionine (SAM) (New England Biolabs, Cat #B9003S), 4 μL end-labelled DNA trapping substrate (prepared as described above) and 160 ng/μL BSA in a total reaction volume of 200 μL. .. For determination of DNA methyltransferase activity, trapping was performed at 37 °C for 90 min with constant mixing.

    Article Title: Genetic variation affecting DNA methylation and the human imprinting disorder, Beckwith-Wiedemann syndrome
    Article Snippet: .. Fifteen nanograms of each purified pull-down GFP-tagged DNMT1 protein (bead-bound) derived from each DNMT1 protein variant was resuspended in buffer (100 mM KCl, 10 mM Tris-HCl, pH 7.6, 1 mM EDTA, 1 mM DTT) supplemented with 100 μM S -adenosyl- l -methionine (SAM) (New England Biolabs, Cat #B9003S), 4 μL end-labelled DNA trapping substrate (prepared as described above) and 160 ng/μL BSA in a total reaction volume of 200 μL. .. For determination of DNA methyltransferase activity, trapping was performed at 37 °C for 90 min with constant mixing.

    Polymerase Chain Reaction:

    Article Title: Fitness Analyses of All Possible Point-Mutants for Regions of Genes in Yeast
    Article Snippet: .. BsaI restriction endonuclease (New England Biolabs, cat. no.R0535) SphI restriction endonuclease (New Englan Biolabs, cat. no.R0182) MmeI restriction endonuclease (New England Biolabs, cat. no. R0637L) S-adenosyl methionine (SAM; New England Biolabs, cat. no. B9003S) NEB3 buffer (10× with 100× BSA; New England Biolabs, cat. no.B7003) NEB4 buffer (10×; New England Biolabs, cat. no. B7004S) Agarose, PCR grade (Fisher Bioreagents, cat. no. 9012-36-6) Ethidium bromide (Sigma, cat. no. E1510) ! ..

    Article Title: DNA methylation and chromatin accessibility profiling of mouse and human fetal germ cells
    Article Snippet: The nuclei was released, washed with DPBS, and spiked in with 0.1% unmodified lambda DNA (ThermoFisher #SD0011), and then subjected to the 15 U M.CviPI GpC Methyltransferase (NEB #M0227L) treatment for 1 h at 37 °C, supplemented with 160 nM fresh SAM (NEB #B9003S), then followed by a boost with an additional 15 U M.CviPI and 160 nM fresh SAM for another 2 h at 37 °C. .. Briefly, the isolated genomic DNA was first bisulfite converted using MethylCode Bisulfite Conversion Kit (ThermoFisher #MECOV-50), and first strand was synthesized using random nonamer primers with biotin-tagged truncated Illumina P5 adapter (5′-biotin-CTACACGACGCTCTTCCGATCTNNNNNNNNN-3′), and second strands were synthesized using random nonamer primers containing a truncated P7 Illumina adapter (5′-AGACGTGTGCTCTTCCGATCTNNNNNNNNN-3′), the final library was amplified with 4-6 cycles of PCR using 1 U Kapa HiFi HS DNA Polymerase (KAPA Biosystems), and then AMpure XP Beads (Beckman Coulter) purified, quantified and pooled on Illumina HiSeq 2500 platform with 100 or 150 bp paired-end mode (sequenced by Novogene).

    Article Title: NDRG2 gene copy number is not altered in colorectal carcinoma
    Article Snippet: Bisulfite treatment and sequencing Bisulfite treatment of genomic DNA was performed as previously described[ ], using glycogen as carrier, and the precipitated DNA was redissolved in TE buffer, amplified by PCR and sequenced directly. .. A positive control with in vitro methylated (IVM) DNA was prepared by mixing 2 μL NEB2 buffer, 1 μL 20 x S-adenosylmethionine (New England Biolabs, B9003S), 200 ng reference human genomic DNA and 1 µL SssI methyltransferase (New England BioLabs, M0226S) in a total of 20 μL.

    Article Title: Base-resolution profiling of active DNA demethylation using methylase-assisted bisulfite sequencing (MAB-seq) and caMAB-seq
    Article Snippet: .. Sodium acetate buffer solution (3 M, pH 5.2±0.1; Sigma-Aldrich, cat. no. S7899) EDTA (0.5 M, pH8.0; Life Technologies, cat. no. 15575-020) EGTA (0.5 M, pH8.0; prepared from Sigma-Aldrich, cat. no. 03777) RNase A (10 mg/mL; Life Technologies, cat. no. EN0531) Anti-H3K4me1 (10 μg/mL; Abcam, cat. no. ab8895) TaqαI (20 U/μL; New England Biolabs, cat. no. R0149L) Klenow fragment (exo– , 5 U/μL; Thermo Scientific, cat. no. EP0422) T4 DNA ligase (2000 U/μL; New England Biolabs, cat. no. M0202M) CutSmart buffer (10×; New England Biolabs, cat. no. B7204S) ATP (100 mM; Thermo Scientific, cat. no. R0441) dNTP set 100 mM solutions (Life Technologies, cat. no. R0181) SPRIselect reagent kit (Beckman Coulter, cat. no. ) DNeasy blood & tissue kit (Qiagen, cat. no. 69504) Qiagen EpiTect DNA bisulfite kit (Qiagen, cat. no. 59104) QIAquick nucleotide removal kit (Qiagen, cat. no. 28304) MinElute PCR purification kit (Qiagen, cat. no. 28004) M.SssI (20 U/μL, New England Biolabs, M0226M) NEBuffer 2 (10x; cat. no. B7002S) S-adenosylmethionine (SAM) (32 mM; New England Biolabs, cat. no. B9003S) CRITICAL Always use SAM before its expiration date and make aliquots to avoid multiple cycles of freeze / thaw. .. KAPA HiFi Uracil+ HotStart ReadyMix (Kapa Biosystems, KK2801) NEBNext Multiplex Oligos for Illumina (Index Primers Set 1; New England Biolabs, cat. no. E7335L) NEBNext Multiplex Oligos for Illumina (Index Primers Set 2; New England Biolabs, cat. no. E7500L) NEBNext ultra DNA Library Prep Kit for Illumina (New England Biolabs, cat. no. E7370S) NEBNext DNA Library Prep Master Mix Set for Illumina (New England Biolabs, cat. no. E6040S) Custom methylated adapters (asterisk denotes phosphorothioate bond, all cytosines are modified as 5mC; Integrated DNA Technologies): Forward: 5′-ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3′ Reverse: 5′-/5Phos/GATCGGAAGAGCACACGTCTGAACTCCAGTC-3′ Custom 5hmC/5fC/5caC-modified oligo (X: 5hmC, 5fC or 5caC): Forward: 5′-AGCCXGXGCXGXGCXGGTXGAGXGGCXGCTCCXGCAGC-3′, Reverse: 5′-GCTGXGGGAGXGGCXGCTXGACXGGXGXGGXGXGGGCT-3′ CRITICAL Only CpG site of these oligos are modified, which is different from the methylated adaptor in which all cytosines are modified as 5mC.

    Concentration Assay:

    Article Title: Tumor Necrosis Factor (TNF)-α Induction of CXCL10 in Endothelial Cells Requires Protein Arginine Methyltransferase 5 (PRMT5)-mediated Nuclear Factor (NF)-κB p65 Methylation *
    Article Snippet: Active, recombinant human PRMT5 expressed in HEK293 (Sigma-Aldrich, SRP0145), full-length recombinant human p65 produced in HEK293 (OriGene, TA301086), and the methyl donor S -adenosylmethionine (New England Biolabs, B9003S) were incubated for 90 min at 37 °C in a 30-μl volume according to published methods ( ). .. In each reaction, 0.3 μg of PRMT5, 1.0 μg of p65, and S -adenosylmethionine was added to a final concentration of 80 μ m .

    Article Title: Uremic Toxin Lanthionine Interferes with the Transsulfuration Pathway, Angiogenetic Signaling and Increases Intracellular Calcium
    Article Snippet: Cells treatments under stimulating conditions (referred to as “stimulated”) were performed by supplying cells in the presence of final concentrations of the following compounds: 1mM DL-cysteine (Cys, 861677, Aldrich, St.Louis, MO, USA), 1 mM pyridoxine hydrochloride (B6, P6280, Sigma, St.Louis, MO, USA) and 5 μM S-adenosyl-L-methionine (SAM, B9003S, New England Biolabs Inc, Ipswich, MA, USA). .. The concentration of lanthionine was based on the actual concentration detected in uremic serum [ ].

    Demethylation Assay:

    Article Title: Increasing G9a automethylation sensitizes B acute lymphoblastic leukemia cells to glucocorticoid-induced death
    Article Snippet: In vitro methylation and demethylation assays For G9a methylation 1 μg of recombinant G9a protein (hG9a FL, Active Motif, #31410) was incubated with 1 mM unradiolabeled S -adenosylmethionine (SAM, New England Biolabs, B9003S) for 3 h at room temperature in methylation buffer (50 mM Tris-HCl pH 8.6, 0.02% Triton X-100, 2 mM MgCl2 , 1 mM TCEP (tris(2-carboxyethyl)phosphine)). .. For in vitro demethylation assay, previously methylated hG9a FL or GST-hGLP N were separated from residual SAM using the Amicon Ultra Centrifugal Filter Units (Millipore).

    Plasmid Preparation:

    Article Title: Fitness Analyses of All Possible Point-Mutants for Regions of Genes in Yeast
    Article Snippet: The pRNDM plasmid will be provided on request. .. BsaI restriction endonuclease (New England Biolabs, cat. no.R0535) SphI restriction endonuclease (New Englan Biolabs, cat. no.R0182) MmeI restriction endonuclease (New England Biolabs, cat. no. R0637L) S-adenosyl methionine (SAM; New England Biolabs, cat. no. B9003S) NEB3 buffer (10× with 100× BSA; New England Biolabs, cat. no.B7003) NEB4 buffer (10×; New England Biolabs, cat. no. B7004S) Agarose, PCR grade (Fisher Bioreagents, cat. no. 9012-36-6) Ethidium bromide (Sigma, cat. no. E1510) !

    Article Title: A Cotransformation Method To Identify a Restriction-Modification Enzyme That Reduces Conjugation Efficiency in Campylobacter jejuni
    Article Snippet: .. The assay for the endonuclease activity of rCjeI was performed in the volume of 50 μl composed of 2.25 μg of purified rCjeI, 3 μg of shuttle vector pRY107, 50 mM potassium acetate, 20 mM Tris-acetate (pH 7.9), 10 mM magnesium acetate, 1 mM dithiothreitol (DTT), 100 μg/ml bovine serum albumin (BSA; NEB), and 80 μM S -adenosyl-methionine (catalog no. B9003S; NEB). .. The reaction mixture was incubated at 37°C; samples were taken at different time points, followed by immediate heat inactivation of rCjeI at 65°C for 15 min.

    Article Title: The Effect of PRMT1-Mediated Arginine Methylation on the Subcellular Localization, Stress Granules, and Detergent-Insoluble Aggregates of FUS/TLS
    Article Snippet: Full-length FUS/TLS cDNA was subcloned into the pGEX-5X (GE Healthcare) bacterial expression vector to produce glutathione S -transferase (GST) fusion proteins for assay. .. Then 1 µg of recombinant PRMT1 (10 units) was combined with 1 µg GST-FUS or GST alone and 80 µM S -adenosyl- L-methionine (SAM)(New England Biolabs, #B9003S) in reaction buffer [20 mM Tris–HCl (pH 8.0), 200 mM NaCl, 0.4 mM EDTA], and reactions were incubated for 1 hour at 37°C.

    Article Title: CLDN18.1 attenuates malignancy and related signaling pathways of lung adenocarcinoma in vivo and in vitro
    Article Snippet: The plasmids pCpGL and pCpGL-300 (20 μg) were each incubated for 48 hours at 37°C with 50 units of methyltransferase Sss I (New England Biolabs, Ipswich, MA; #M0226L) and 160 μM S-adenosylmethionine (SAM) (New England Biolabs; #B9003S). .. Completeness of methylation was verified using the methylation-sensitive restriction enzyme Hha I. MLE-15 cells were seeded in 24-well plates (6x104 cells/well) and transfected after 24 hours with 0.75 μg/well of either methylated or unmethylated pCpGL or pCpGL-300 firefly luciferase plasmids, along with 50 ng Renilla luciferase control vector using Superfect reagent (Qiagen, Valencia, CA; #301307).

    Software:

    Article Title: Fitness Analyses of All Possible Point-Mutants for Regions of Genes in Yeast
    Article Snippet: BsaI restriction endonuclease (New England Biolabs, cat. no.R0535) SphI restriction endonuclease (New Englan Biolabs, cat. no.R0182) MmeI restriction endonuclease (New England Biolabs, cat. no. R0637L) S-adenosyl methionine (SAM; New England Biolabs, cat. no. B9003S) NEB3 buffer (10× with 100× BSA; New England Biolabs, cat. no.B7003) NEB4 buffer (10×; New England Biolabs, cat. no. B7004S) Agarose, PCR grade (Fisher Bioreagents, cat. no. 9012-36-6) Ethidium bromide (Sigma, cat. no. E1510) ! .. SYBR Green I (10000×; Invitrogen, cat. no. S-7563) Tris Base (Fisher Bioreagents, cat. no. BP152-500) Acetic acid, glacial (Fisher Scientific, cat. no. A38-500) Bromophenol Blue (Sigma-Aldrich, cat. no. B0126) Ethylenediaminetetraacetic acid (EDTA; Sigma-Aldrich, cat. no. E6758) DNA ladder – 1 KB (New England Biolabs, cat. no. N3232) DNA ladder – 100 BP(New England Biolabs, cat. no. N3231) Zymoclean Gel DNA Recovery Kit (Zymoresearch, cat. no. D4001) ZR Plasmid Miniprep Kit (Zymoresearch, cat. no. D4015) OmniMax competent E. coli strain (Invitrogen, cat. no. C854003) Kanamycin-A monosulfate (or bacterial antibiotic matching vector marker)(Sigma-Aldrich, cat. no. K4000) Ampicillin sodium salt (Sigma-Aldrich, cat. no. A9518-100G) G418 disulfate salt (Sigma-Aldrich, cat. no. A1720) Polyethylene Glycol 3350 (PEG 3350; Hampton Research cat. no. HR2-591) Lithium acetate dihydrate (Sigma-Aldrich, cat. no. L4158) Salmon Sperm DNA (Sigma-Aldrich, cat. no. D1626) Yeast nitrogenous base without Amino Acids (VWR, cat. no. 61000-200) Ammonium Sulfate (Sigma-Aldrich, cat. no. A5132) Sodium Chloride (Fisher Bioreagents, cat. no. 5271-3) Zymolyase (Zymoresearch, cat. No E1004) Bacto- Tryptone (Becton Dickison, cat. no. 211705) Bacto- Peptone (Becton Dickison, cat. no. 211677) Bacto- Yeast Extract (Becton Dickison, cat. no. 212750) Bacto- Agar (Becton Dickison, cat. no. 214010) Adenine Hemisulfate (Sigma-Aldrich, cat. no. A9126-100g) L-Aspartic acid (Sigma-Aldrich, cat. no. A8949) L-Arginine (Sigma-Aldrich, cat. no. A5006) L-Valine (Sigma-Aldrich, cat. no. V0513) L-Glutamic Acid (Sigma-Aldrich, cat. no. G1251) L-Serine (Sigma-Aldrich, cat. no. S4311) L-Threonine (Sigma-Aldrich, cat. no. T8625) L-Isoleucine (Sigma-Aldrich, cat. no. I2752) L-Phenylalanine (Sigma-Aldrich, cat. no. P2126) L-Tyrosine (Sigma-Aldrich, cat. no. T8566) L-Histidine (Sigma-Aldrich, cat. no. H8000) L-Methionine (Sigma-Aldrich, cat. no. M5308) L-Leucine (Sigma-Aldrich, cat. no. L8000) L-Lysine (Sigma-Aldrich, cat. no. L5501) Oligonucleotides (IDT DNA Technologies) see for oligonucleotides used to study a 10 amino acid sequence of Hsp90 (DNA sequence: 5’ GCTAGTGAAACTTTTGAATTTCAAGCTGAA 3’) in pRNDM Custom bio-informatics software (available from ).

    SDS-Gel:

    Article Title: A post‐translational modification switch controls coactivator function of histone methyltransferases G9a and GLP
    Article Snippet: Bacterially produced GST fusion proteins (2 μg) of N‐terminal fragments of G9a or GLP (GST‐hG9a N or GST‐hGLP N), mutant (GST‐hG9a N K185R or GST‐hGLP N K205R or GST‐hG9a N T186A), or GST alone were incubated 90 min at 30°C with GST‐hG9a ΔN or GST‐hGLP ΔN in the presence (or not) of 1 mM of unradiolabeled SAM (New England Biolabs, B9003S). .. Methylated products were analyzed by standard SDS gel electrophoresis followed by immunoblot.

    Multiplex Assay:

    Article Title: Base-resolution profiling of active DNA demethylation using methylase-assisted bisulfite sequencing (MAB-seq) and caMAB-seq
    Article Snippet: Sodium acetate buffer solution (3 M, pH 5.2±0.1; Sigma-Aldrich, cat. no. S7899) EDTA (0.5 M, pH8.0; Life Technologies, cat. no. 15575-020) EGTA (0.5 M, pH8.0; prepared from Sigma-Aldrich, cat. no. 03777) RNase A (10 mg/mL; Life Technologies, cat. no. EN0531) Anti-H3K4me1 (10 μg/mL; Abcam, cat. no. ab8895) TaqαI (20 U/μL; New England Biolabs, cat. no. R0149L) Klenow fragment (exo– , 5 U/μL; Thermo Scientific, cat. no. EP0422) T4 DNA ligase (2000 U/μL; New England Biolabs, cat. no. M0202M) CutSmart buffer (10×; New England Biolabs, cat. no. B7204S) ATP (100 mM; Thermo Scientific, cat. no. R0441) dNTP set 100 mM solutions (Life Technologies, cat. no. R0181) SPRIselect reagent kit (Beckman Coulter, cat. no. ) DNeasy blood & tissue kit (Qiagen, cat. no. 69504) Qiagen EpiTect DNA bisulfite kit (Qiagen, cat. no. 59104) QIAquick nucleotide removal kit (Qiagen, cat. no. 28304) MinElute PCR purification kit (Qiagen, cat. no. 28004) M.SssI (20 U/μL, New England Biolabs, M0226M) NEBuffer 2 (10x; cat. no. B7002S) S-adenosylmethionine (SAM) (32 mM; New England Biolabs, cat. no. B9003S) CRITICAL Always use SAM before its expiration date and make aliquots to avoid multiple cycles of freeze / thaw. .. KAPA HiFi Uracil+ HotStart ReadyMix (Kapa Biosystems, KK2801) NEBNext Multiplex Oligos for Illumina (Index Primers Set 1; New England Biolabs, cat. no. E7335L) NEBNext Multiplex Oligos for Illumina (Index Primers Set 2; New England Biolabs, cat. no. E7500L) NEBNext ultra DNA Library Prep Kit for Illumina (New England Biolabs, cat. no. E7370S) NEBNext DNA Library Prep Master Mix Set for Illumina (New England Biolabs, cat. no. E6040S) Custom methylated adapters (asterisk denotes phosphorothioate bond, all cytosines are modified as 5mC; Integrated DNA Technologies): Forward: 5′-ACACTCTTTCCCTACACGACGCTCTTCCGATC*T-3′ Reverse: 5′-/5Phos/GATCGGAAGAGCACACGTCTGAACTCCAGTC-3′ Custom 5hmC/5fC/5caC-modified oligo (X: 5hmC, 5fC or 5caC): Forward: 5′-AGCCXGXGCXGXGCXGGTXGAGXGGCXGCTCCXGCAGC-3′, Reverse: 5′-GCTGXGGGAGXGGCXGCTXGACXGGXGXGGXGXGGGCT-3′ CRITICAL Only CpG site of these oligos are modified, which is different from the methylated adaptor in which all cytosines are modified as 5mC.

    Agarose Gel Electrophoresis:

    Article Title: A Cotransformation Method To Identify a Restriction-Modification Enzyme That Reduces Conjugation Efficiency in Campylobacter jejuni
    Article Snippet: The assay for the endonuclease activity of rCjeI was performed in the volume of 50 μl composed of 2.25 μg of purified rCjeI, 3 μg of shuttle vector pRY107, 50 mM potassium acetate, 20 mM Tris-acetate (pH 7.9), 10 mM magnesium acetate, 1 mM dithiothreitol (DTT), 100 μg/ml bovine serum albumin (BSA; NEB), and 80 μM S -adenosyl-methionine (catalog no. B9003S; NEB). .. The samples were subjected to agarose gel electrophoresis for examination of hydrolysis of pRY107 by rCjeI.

    In Vitro:

    Article Title: Alternative splicing regulates the expression of G9A and SUV39H2 methyltransferases, and dramatically changes SUV39H2 functions
    Article Snippet: .. For in vitro HMT assay, the purified Flag-V5-tagged proteins and 1 μg of recombinant histone H3.1 (NEB, #M2503S) were incubated in HMT buffer (1 mM of S-adenosylmethionine (NEB, #B9003S), 25 mM Tris pH 8, 10% glycerol) 1 h at 37°C. .. Then, in vitro reaction were analyzed by western blot to follow histone methylation levels as indicated in figure.

    Article Title: Tumor Necrosis Factor (TNF)-α Induction of CXCL10 in Endothelial Cells Requires Protein Arginine Methyltransferase 5 (PRMT5)-mediated Nuclear Factor (NF)-κB p65 Methylation *
    Article Snippet: Paragraph title: In Vitro Methyltransferase Assay ... Active, recombinant human PRMT5 expressed in HEK293 (Sigma-Aldrich, SRP0145), full-length recombinant human p65 produced in HEK293 (OriGene, TA301086), and the methyl donor S -adenosylmethionine (New England Biolabs, B9003S) were incubated for 90 min at 37 °C in a 30-μl volume according to published methods ( ).

    Article Title: The Effect of PRMT1-Mediated Arginine Methylation on the Subcellular Localization, Stress Granules, and Detergent-Insoluble Aggregates of FUS/TLS
    Article Snippet: Paragraph title: In vitro and in vivo Methylation Assay ... Then 1 µg of recombinant PRMT1 (10 units) was combined with 1 µg GST-FUS or GST alone and 80 µM S -adenosyl- L-methionine (SAM)(New England Biolabs, #B9003S) in reaction buffer [20 mM Tris–HCl (pH 8.0), 200 mM NaCl, 0.4 mM EDTA], and reactions were incubated for 1 hour at 37°C.

    Article Title: NDRG2 gene copy number is not altered in colorectal carcinoma
    Article Snippet: .. A positive control with in vitro methylated (IVM) DNA was prepared by mixing 2 μL NEB2 buffer, 1 μL 20 x S-adenosylmethionine (New England Biolabs, B9003S), 200 ng reference human genomic DNA and 1 µL SssI methyltransferase (New England BioLabs, M0226S) in a total of 20 μL. .. Samples were incubated at 37 °C overnight with occasional addition of 2 μL 20 x S-adenosylmethionine to ensure sufficient methyl-donor substrate.

    Article Title: Increasing G9a automethylation sensitizes B acute lymphoblastic leukemia cells to glucocorticoid-induced death
    Article Snippet: .. In vitro methylation and demethylation assays For G9a methylation 1 μg of recombinant G9a protein (hG9a FL, Active Motif, #31410) was incubated with 1 mM unradiolabeled S -adenosylmethionine (SAM, New England Biolabs, B9003S) for 3 h at room temperature in methylation buffer (50 mM Tris-HCl pH 8.6, 0.02% Triton X-100, 2 mM MgCl2 , 1 mM TCEP (tris(2-carboxyethyl)phosphine)). .. For GLP methylation bacterially produced glutathione S -transferase (GST) fusion proteins (2 μg) of N-terminal fragments of GLP (GST-hGLP N) were incubated for 90 min at 30 °C with GST-hGLP ΔN in the presence of 1 mM of unradiolabeled SAM.

    Article Title: Genetic variation affecting DNA methylation and the human imprinting disorder, Beckwith-Wiedemann syndrome
    Article Snippet: This preparation of trapping substrate was used immediately in the in vitro DNMT1 trapping assay described below. .. Fifteen nanograms of each purified pull-down GFP-tagged DNMT1 protein (bead-bound) derived from each DNMT1 protein variant was resuspended in buffer (100 mM KCl, 10 mM Tris-HCl, pH 7.6, 1 mM EDTA, 1 mM DTT) supplemented with 100 μM S -adenosyl-l -methionine (SAM) (New England Biolabs, Cat #B9003S), 4 μL end-labelled DNA trapping substrate (prepared as described above) and 160 ng/μL BSA in a total reaction volume of 200 μL.

    Article Title: Early-life gene expression in neurons modulates lasting epigenetic states
    Article Snippet: Paragraph title: In vitro DNA methyltransferase activity assay ... 100 ng of unmethylated lambda DNA (Promega D1521) was sonicated to 200 bp using a Covaris S2 and was incubated with 1 µg of full-length human DNMT3A (Abcam 170408) along with 5µM biotinylated histone H3 (amino acids 1–20; Epicypher 12-0001) and S-Adenosyl methionine (SAM) (NEB B9003S) in 0.5mg/mL BSA, 25mM Tris-Cl (pH 8).

    Article Title: Genetic variation affecting DNA methylation and the human imprinting disorder, Beckwith-Wiedemann syndrome
    Article Snippet: This preparation of trapping substrate was used immediately in the in vitro DNMT1 trapping assay described below. .. Fifteen nanograms of each purified pull-down GFP-tagged DNMT1 protein (bead-bound) derived from each DNMT1 protein variant was resuspended in buffer (100 mM KCl, 10 mM Tris-HCl, pH 7.6, 1 mM EDTA, 1 mM DTT) supplemented with 100 μM S -adenosyl- l -methionine (SAM) (New England Biolabs, Cat #B9003S), 4 μL end-labelled DNA trapping substrate (prepared as described above) and 160 ng/μL BSA in a total reaction volume of 200 μL.

    Electrophoresis:

    Article Title: A post‐translational modification switch controls coactivator function of histone methyltransferases G9a and GLP
    Article Snippet: Bacterially produced GST fusion proteins (2 μg) of N‐terminal fragments of G9a or GLP (GST‐hG9a N or GST‐hGLP N), mutant (GST‐hG9a N K185R or GST‐hGLP N K205R or GST‐hG9a N T186A), or GST alone were incubated 90 min at 30°C with GST‐hG9a ΔN or GST‐hGLP ΔN in the presence (or not) of 1 mM of unradiolabeled SAM (New England Biolabs, B9003S). .. Methylated products were analyzed by standard SDS gel electrophoresis followed by immunoblot.

    Ethanol Precipitation:

    Article Title: Early-life gene expression in neurons modulates lasting epigenetic states
    Article Snippet: 100 ng of unmethylated lambda DNA (Promega D1521) was sonicated to 200 bp using a Covaris S2 and was incubated with 1 µg of full-length human DNMT3A (Abcam 170408) along with 5µM biotinylated histone H3 (amino acids 1–20; Epicypher 12-0001) and S-Adenosyl methionine (SAM) (NEB B9003S) in 0.5mg/mL BSA, 25mM Tris-Cl (pH 8). .. After the incubation, DNA was isolated by phenol-chloroform extraction followed by ethanol precipitation, and bisulfite sequencing libraries were prepared as described above.

    Gel Permeation Chromatography:

    Article Title: DNA methylation and chromatin accessibility profiling of mouse and human fetal germ cells
    Article Snippet: .. The nuclei was released, washed with DPBS, and spiked in with 0.1% unmodified lambda DNA (ThermoFisher #SD0011), and then subjected to the 15 U M.CviPI GpC Methyltransferase (NEB #M0227L) treatment for 1 h at 37 °C, supplemented with 160 nM fresh SAM (NEB #B9003S), then followed by a boost with an additional 15 U M.CviPI and 160 nM fresh SAM for another 2 h at 37 °C. ..

    Produced:

    Article Title: Tumor Necrosis Factor (TNF)-α Induction of CXCL10 in Endothelial Cells Requires Protein Arginine Methyltransferase 5 (PRMT5)-mediated Nuclear Factor (NF)-κB p65 Methylation *
    Article Snippet: .. Active, recombinant human PRMT5 expressed in HEK293 (Sigma-Aldrich, SRP0145), full-length recombinant human p65 produced in HEK293 (OriGene, TA301086), and the methyl donor S -adenosylmethionine (New England Biolabs, B9003S) were incubated for 90 min at 37 °C in a 30-μl volume according to published methods ( ). .. In each reaction, 0.3 μg of PRMT5, 1.0 μg of p65, and S -adenosylmethionine was added to a final concentration of 80 μ m .

    Article Title: The Effect of PRMT1-Mediated Arginine Methylation on the Subcellular Localization, Stress Granules, and Detergent-Insoluble Aggregates of FUS/TLS
    Article Snippet: GST fused-FUS/TLS (GST-FUS) or GST alone (control) was produced and purified as described by the manufacturer. .. Then 1 µg of recombinant PRMT1 (10 units) was combined with 1 µg GST-FUS or GST alone and 80 µM S -adenosyl- L-methionine (SAM)(New England Biolabs, #B9003S) in reaction buffer [20 mM Tris–HCl (pH 8.0), 200 mM NaCl, 0.4 mM EDTA], and reactions were incubated for 1 hour at 37°C.

    Article Title: Base-resolution profiling of active DNA demethylation using methylase-assisted bisulfite sequencing (MAB-seq) and caMAB-seq
    Article Snippet: Hydrogen gas is produced when NaBH4 reacts with water. .. Sodium acetate buffer solution (3 M, pH 5.2±0.1; Sigma-Aldrich, cat. no. S7899) EDTA (0.5 M, pH8.0; Life Technologies, cat. no. 15575-020) EGTA (0.5 M, pH8.0; prepared from Sigma-Aldrich, cat. no. 03777) RNase A (10 mg/mL; Life Technologies, cat. no. EN0531) Anti-H3K4me1 (10 μg/mL; Abcam, cat. no. ab8895) TaqαI (20 U/μL; New England Biolabs, cat. no. R0149L) Klenow fragment (exo– , 5 U/μL; Thermo Scientific, cat. no. EP0422) T4 DNA ligase (2000 U/μL; New England Biolabs, cat. no. M0202M) CutSmart buffer (10×; New England Biolabs, cat. no. B7204S) ATP (100 mM; Thermo Scientific, cat. no. R0441) dNTP set 100 mM solutions (Life Technologies, cat. no. R0181) SPRIselect reagent kit (Beckman Coulter, cat. no. ) DNeasy blood & tissue kit (Qiagen, cat. no. 69504) Qiagen EpiTect DNA bisulfite kit (Qiagen, cat. no. 59104) QIAquick nucleotide removal kit (Qiagen, cat. no. 28304) MinElute PCR purification kit (Qiagen, cat. no. 28004) M.SssI (20 U/μL, New England Biolabs, M0226M) NEBuffer 2 (10x; cat. no. B7002S) S-adenosylmethionine (SAM) (32 mM; New England Biolabs, cat. no. B9003S) CRITICAL Always use SAM before its expiration date and make aliquots to avoid multiple cycles of freeze / thaw.

    Article Title: A post‐translational modification switch controls coactivator function of histone methyltransferases G9a and GLP
    Article Snippet: .. Bacterially produced GST fusion proteins (2 μg) of N‐terminal fragments of G9a or GLP (GST‐hG9a N or GST‐hGLP N), mutant (GST‐hG9a N K185R or GST‐hGLP N K205R or GST‐hG9a N T186A), or GST alone were incubated 90 min at 30°C with GST‐hG9a ΔN or GST‐hGLP ΔN in the presence (or not) of 1 mM of unradiolabeled SAM (New England Biolabs, B9003S). .. Methylated products were analyzed by standard SDS gel electrophoresis followed by immunoblot.

    Immunoprecipitation:

    Article Title: The Effect of PRMT1-Mediated Arginine Methylation on the Subcellular Localization, Stress Granules, and Detergent-Insoluble Aggregates of FUS/TLS
    Article Snippet: Then 1 µg of recombinant PRMT1 (10 units) was combined with 1 µg GST-FUS or GST alone and 80 µM S -adenosyl- L-methionine (SAM)(New England Biolabs, #B9003S) in reaction buffer [20 mM Tris–HCl (pH 8.0), 200 mM NaCl, 0.4 mM EDTA], and reactions were incubated for 1 hour at 37°C. .. For in vivo methylation assay, FUS/TLS protein was obtained by the immunoprecipitation with anti-FUS/TLS antibody in lysates of HEK293 cells, and then resolved by SDS-PAGE.

    Article Title: Base-resolution profiling of active DNA demethylation using methylase-assisted bisulfite sequencing (MAB-seq) and caMAB-seq
    Article Snippet: Sodium acetate buffer solution (3 M, pH 5.2±0.1; Sigma-Aldrich, cat. no. S7899) EDTA (0.5 M, pH8.0; Life Technologies, cat. no. 15575-020) EGTA (0.5 M, pH8.0; prepared from Sigma-Aldrich, cat. no. 03777) RNase A (10 mg/mL; Life Technologies, cat. no. EN0531) Anti-H3K4me1 (10 μg/mL; Abcam, cat. no. ab8895) TaqαI (20 U/μL; New England Biolabs, cat. no. R0149L) Klenow fragment (exo– , 5 U/μL; Thermo Scientific, cat. no. EP0422) T4 DNA ligase (2000 U/μL; New England Biolabs, cat. no. M0202M) CutSmart buffer (10×; New England Biolabs, cat. no. B7204S) ATP (100 mM; Thermo Scientific, cat. no. R0441) dNTP set 100 mM solutions (Life Technologies, cat. no. R0181) SPRIselect reagent kit (Beckman Coulter, cat. no. ) DNeasy blood & tissue kit (Qiagen, cat. no. 69504) Qiagen EpiTect DNA bisulfite kit (Qiagen, cat. no. 59104) QIAquick nucleotide removal kit (Qiagen, cat. no. 28304) MinElute PCR purification kit (Qiagen, cat. no. 28004) M.SssI (20 U/μL, New England Biolabs, M0226M) NEBuffer 2 (10x; cat. no. B7002S) S-adenosylmethionine (SAM) (32 mM; New England Biolabs, cat. no. B9003S) CRITICAL Always use SAM before its expiration date and make aliquots to avoid multiple cycles of freeze / thaw. .. Unmethylated Lambda DNA (Promega, cat. no. D1521) Agilent High Sensitivity DNA Kit (Agilent Technologies, cat. no. 5067-4626) cOmplete EDTA-free proteinase inhibitor (Roche, cat. no. 11873580001) Dynabeads Protein G for Immunoprecipitation (ThermoFisher Scientific, cat. no. 10004D) RNase A (Life Technologies, cat. no. 12091-201) Proteinase K (New England Biolabs, cat. no. P8107S) Glycogen (Roche Life Science, cat. no. 10901393001) 5 PRIME Phase Lock Gel heavy 2 mL (Fisher Scientific, cat. no. FP2302830) Phenol - chloroform - isoamyl alcohol mixture (Sigma-Aldrich, cat. no. 77617) !

    Marker:

    Article Title: Fitness Analyses of All Possible Point-Mutants for Regions of Genes in Yeast
    Article Snippet: BsaI restriction endonuclease (New England Biolabs, cat. no.R0535) SphI restriction endonuclease (New Englan Biolabs, cat. no.R0182) MmeI restriction endonuclease (New England Biolabs, cat. no. R0637L) S-adenosyl methionine (SAM; New England Biolabs, cat. no. B9003S) NEB3 buffer (10× with 100× BSA; New England Biolabs, cat. no.B7003) NEB4 buffer (10×; New England Biolabs, cat. no. B7004S) Agarose, PCR grade (Fisher Bioreagents, cat. no. 9012-36-6) Ethidium bromide (Sigma, cat. no. E1510) ! .. SYBR Green I (10000×; Invitrogen, cat. no. S-7563) Tris Base (Fisher Bioreagents, cat. no. BP152-500) Acetic acid, glacial (Fisher Scientific, cat. no. A38-500) Bromophenol Blue (Sigma-Aldrich, cat. no. B0126) Ethylenediaminetetraacetic acid (EDTA; Sigma-Aldrich, cat. no. E6758) DNA ladder – 1 KB (New England Biolabs, cat. no. N3232) DNA ladder – 100 BP(New England Biolabs, cat. no. N3231) Zymoclean Gel DNA Recovery Kit (Zymoresearch, cat. no. D4001) ZR Plasmid Miniprep Kit (Zymoresearch, cat. no. D4015) OmniMax competent E. coli strain (Invitrogen, cat. no. C854003) Kanamycin-A monosulfate (or bacterial antibiotic matching vector marker)(Sigma-Aldrich, cat. no. K4000) Ampicillin sodium salt (Sigma-Aldrich, cat. no. A9518-100G) G418 disulfate salt (Sigma-Aldrich, cat. no. A1720) Polyethylene Glycol 3350 (PEG 3350; Hampton Research cat. no. HR2-591) Lithium acetate dihydrate (Sigma-Aldrich, cat. no. L4158) Salmon Sperm DNA (Sigma-Aldrich, cat. no. D1626) Yeast nitrogenous base without Amino Acids (VWR, cat. no. 61000-200) Ammonium Sulfate (Sigma-Aldrich, cat. no. A5132) Sodium Chloride (Fisher Bioreagents, cat. no. 5271-3) Zymolyase (Zymoresearch, cat. No E1004) Bacto- Tryptone (Becton Dickison, cat. no. 211705) Bacto- Peptone (Becton Dickison, cat. no. 211677) Bacto- Yeast Extract (Becton Dickison, cat. no. 212750) Bacto- Agar (Becton Dickison, cat. no. 214010) Adenine Hemisulfate (Sigma-Aldrich, cat. no. A9126-100g) L-Aspartic acid (Sigma-Aldrich, cat. no. A8949) L-Arginine (Sigma-Aldrich, cat. no. A5006) L-Valine (Sigma-Aldrich, cat. no. V0513) L-Glutamic Acid (Sigma-Aldrich, cat. no. G1251) L-Serine (Sigma-Aldrich, cat. no. S4311) L-Threonine (Sigma-Aldrich, cat. no. T8625) L-Isoleucine (Sigma-Aldrich, cat. no. I2752) L-Phenylalanine (Sigma-Aldrich, cat. no. P2126) L-Tyrosine (Sigma-Aldrich, cat. no. T8566) L-Histidine (Sigma-Aldrich, cat. no. H8000) L-Methionine (Sigma-Aldrich, cat. no. M5308) L-Leucine (Sigma-Aldrich, cat. no. L8000) L-Lysine (Sigma-Aldrich, cat. no. L5501) Oligonucleotides (IDT DNA Technologies) see for oligonucleotides used to study a 10 amino acid sequence of Hsp90 (DNA sequence: 5’ GCTAGTGAAACTTTTGAATTTCAAGCTGAA 3’) in pRNDM Custom bio-informatics software (available from ).

    Lysis:

    Article Title: DNA methylation and chromatin accessibility profiling of mouse and human fetal germ cells
    Article Snippet: Briefly, cell pellet was first lysed in 1× lysis buffer (part of the NOMe-Seq Kit, Active motif #54000) with Protease inhibitor and PMSF (part of the NOMe-Seq Kit, Active motif #54000) on ice for 1 h with intermittent vortex. .. The nuclei was released, washed with DPBS, and spiked in with 0.1% unmodified lambda DNA (ThermoFisher #SD0011), and then subjected to the 15 U M.CviPI GpC Methyltransferase (NEB #M0227L) treatment for 1 h at 37 °C, supplemented with 160 nM fresh SAM (NEB #B9003S), then followed by a boost with an additional 15 U M.CviPI and 160 nM fresh SAM for another 2 h at 37 °C.

    Variant Assay:

    Article Title: Genetic variation affecting DNA methylation and the human imprinting disorder, Beckwith-Wiedemann syndrome
    Article Snippet: .. Fifteen nanograms of each purified pull-down GFP-tagged DNMT1 protein (bead-bound) derived from each DNMT1 protein variant was resuspended in buffer (100 mM KCl, 10 mM Tris-HCl, pH 7.6, 1 mM EDTA, 1 mM DTT) supplemented with 100 μM S -adenosyl-l -methionine (SAM) (New England Biolabs, Cat #B9003S), 4 μL end-labelled DNA trapping substrate (prepared as described above) and 160 ng/μL BSA in a total reaction volume of 200 μL. .. For determination of DNA methyltransferase activity, trapping was performed at 37 °C for 90 min with constant mixing.

    Article Title: Genetic variation affecting DNA methylation and the human imprinting disorder, Beckwith-Wiedemann syndrome
    Article Snippet: .. Fifteen nanograms of each purified pull-down GFP-tagged DNMT1 protein (bead-bound) derived from each DNMT1 protein variant was resuspended in buffer (100 mM KCl, 10 mM Tris-HCl, pH 7.6, 1 mM EDTA, 1 mM DTT) supplemented with 100 μM S -adenosyl- l -methionine (SAM) (New England Biolabs, Cat #B9003S), 4 μL end-labelled DNA trapping substrate (prepared as described above) and 160 ng/μL BSA in a total reaction volume of 200 μL. .. For determination of DNA methyltransferase activity, trapping was performed at 37 °C for 90 min with constant mixing.

    HMT Assay:

    Article Title: Alternative splicing regulates the expression of G9A and SUV39H2 methyltransferases, and dramatically changes SUV39H2 functions
    Article Snippet: .. For in vitro HMT assay, the purified Flag-V5-tagged proteins and 1 μg of recombinant histone H3.1 (NEB, #M2503S) were incubated in HMT buffer (1 mM of S-adenosylmethionine (NEB, #B9003S), 25 mM Tris pH 8, 10% glycerol) 1 h at 37°C. .. Then, in vitro reaction were analyzed by western blot to follow histone methylation levels as indicated in figure.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    New England Biolabs s adenosylmethionine sam 32mm
    G9a and GLP are methylated on their N‐terminal domain in cells Schematic representation of the related proteins GLP (EHMT1) and G9a (EHMT2). N: N‐terminal coactivator domain, E: polyglutamate domain, Cys: cysteine‐rich region, ANK: six ankyrin repeats, SET: SET‐domain containing methyltransferase activity. Partial protein sequence of hG9a and hGLP homologs shows the hypothetical methylated lysine residues (K) in red. After protein methylation reactions, in vitro methylated proteins were detected by immunoblot with pan‐methyllysine antibody (pan met‐K). The corresponding Coomassie‐stained gels are shown as loading controls. <t>SAM,</t> <t>S‐adenosylmethionine.</t> Cos‐7 cells were transfected with plasmids encoding full‐length HA‐hG9a wild type or K185R mutant, or full‐length HA‐hGLP wild type or K205R mutant. Lysates were immunoprecipitated (IP) with pan met‐K antibody and immunoblotted with HA antibody (top), or the usage of the two antibodies was reversed (bottom). Expression of HA‐tagged proteins and β‐actin (loading control) in the unfractionated extracts is shown at the bottom (Input). Cos‐7 cells were transfected with a plasmid encoding full‐length HA‐hG9a and treated with 2 μM UNC0646 or vehicle DMSO for 24 h. Lysates were immunoprecipitated with pan met‐K antibody and immunoblotted with HA antibody (top), or the usage of the two antibodies was reversed (bottom). Methylation and phosphorylation of endogenous G9a and GLP in A549 cells treated with 100 nM dex for 4 h were analyzed by immunoprecipitation with control IgG antibody, anti‐G9a (top), or anti‐GLP (bottom), followed by immunoblot with antibodies listed. Expression of G9a, GLP, and β‐actin (loading control) in the unfractionated extracts is shown at the bottom (Input).
    S Adenosylmethionine Sam 32mm, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 13 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/s adenosylmethionine sam 32mm/product/New England Biolabs
    Average 90 stars, based on 13 article reviews
    Price from $9.99 to $1999.99
    s adenosylmethionine sam 32mm - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    Image Search Results


    G9a and GLP are methylated on their N‐terminal domain in cells Schematic representation of the related proteins GLP (EHMT1) and G9a (EHMT2). N: N‐terminal coactivator domain, E: polyglutamate domain, Cys: cysteine‐rich region, ANK: six ankyrin repeats, SET: SET‐domain containing methyltransferase activity. Partial protein sequence of hG9a and hGLP homologs shows the hypothetical methylated lysine residues (K) in red. After protein methylation reactions, in vitro methylated proteins were detected by immunoblot with pan‐methyllysine antibody (pan met‐K). The corresponding Coomassie‐stained gels are shown as loading controls. SAM, S‐adenosylmethionine. Cos‐7 cells were transfected with plasmids encoding full‐length HA‐hG9a wild type or K185R mutant, or full‐length HA‐hGLP wild type or K205R mutant. Lysates were immunoprecipitated (IP) with pan met‐K antibody and immunoblotted with HA antibody (top), or the usage of the two antibodies was reversed (bottom). Expression of HA‐tagged proteins and β‐actin (loading control) in the unfractionated extracts is shown at the bottom (Input). Cos‐7 cells were transfected with a plasmid encoding full‐length HA‐hG9a and treated with 2 μM UNC0646 or vehicle DMSO for 24 h. Lysates were immunoprecipitated with pan met‐K antibody and immunoblotted with HA antibody (top), or the usage of the two antibodies was reversed (bottom). Methylation and phosphorylation of endogenous G9a and GLP in A549 cells treated with 100 nM dex for 4 h were analyzed by immunoprecipitation with control IgG antibody, anti‐G9a (top), or anti‐GLP (bottom), followed by immunoblot with antibodies listed. Expression of G9a, GLP, and β‐actin (loading control) in the unfractionated extracts is shown at the bottom (Input).

    Journal: EMBO Reports

    Article Title: A post‐translational modification switch controls coactivator function of histone methyltransferases G9a and GLP

    doi: 10.15252/embr.201744060

    Figure Lengend Snippet: G9a and GLP are methylated on their N‐terminal domain in cells Schematic representation of the related proteins GLP (EHMT1) and G9a (EHMT2). N: N‐terminal coactivator domain, E: polyglutamate domain, Cys: cysteine‐rich region, ANK: six ankyrin repeats, SET: SET‐domain containing methyltransferase activity. Partial protein sequence of hG9a and hGLP homologs shows the hypothetical methylated lysine residues (K) in red. After protein methylation reactions, in vitro methylated proteins were detected by immunoblot with pan‐methyllysine antibody (pan met‐K). The corresponding Coomassie‐stained gels are shown as loading controls. SAM, S‐adenosylmethionine. Cos‐7 cells were transfected with plasmids encoding full‐length HA‐hG9a wild type or K185R mutant, or full‐length HA‐hGLP wild type or K205R mutant. Lysates were immunoprecipitated (IP) with pan met‐K antibody and immunoblotted with HA antibody (top), or the usage of the two antibodies was reversed (bottom). Expression of HA‐tagged proteins and β‐actin (loading control) in the unfractionated extracts is shown at the bottom (Input). Cos‐7 cells were transfected with a plasmid encoding full‐length HA‐hG9a and treated with 2 μM UNC0646 or vehicle DMSO for 24 h. Lysates were immunoprecipitated with pan met‐K antibody and immunoblotted with HA antibody (top), or the usage of the two antibodies was reversed (bottom). Methylation and phosphorylation of endogenous G9a and GLP in A549 cells treated with 100 nM dex for 4 h were analyzed by immunoprecipitation with control IgG antibody, anti‐G9a (top), or anti‐GLP (bottom), followed by immunoblot with antibodies listed. Expression of G9a, GLP, and β‐actin (loading control) in the unfractionated extracts is shown at the bottom (Input).

    Article Snippet: Bacterially produced GST fusion proteins (2 μg) of N‐terminal fragments of G9a or GLP (GST‐hG9a N or GST‐hGLP N), mutant (GST‐hG9a N K185R or GST‐hGLP N K205R or GST‐hG9a N T186A), or GST alone were incubated 90 min at 30°C with GST‐hG9a ΔN or GST‐hGLP ΔN in the presence (or not) of 1 mM of unradiolabeled SAM (New England Biolabs, B9003S).

    Techniques: Methylation, Activity Assay, Sequencing, In Vitro, Staining, Transfection, Mutagenesis, Immunoprecipitation, Expressing, Plasmid Preparation