rq1 dnase  (Promega)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 76
    Name:
    RQ1 RNase-Free DNase, 1,000u
    Description:

    Catalog Number:
    M6101
    Price:
    None
    Score:
    85
    Buy from Supplier


    Structured Review

    Promega rq1 dnase
    STM 1788 expression in wild-type and hya mutant cells. RNAs were extracted from wild-type and hya mutant cell cultures grown aerobically overnight in LB broth, using an Aurum Total RNA Mini kit (Bio-Rad). RNAs were digested with <t>RQ1</t> <t>DNase</t> (Promega) to

    https://www.bioz.com/result/rq1 dnase/product/Promega
    Average 76 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    rq1 dnase - by Bioz Stars, 2019-10
    76/100 stars

    Related Products / Commonly Used Together

    oligo
    rnase inhibitor
    superscrpit ii

    Images

    1) Product Images from "Salmonella enterica Serovar Typhimurium NiFe Uptake-Type Hydrogenases Are Differentially Expressed In Vivo"

    Article Title: Salmonella enterica Serovar Typhimurium NiFe Uptake-Type Hydrogenases Are Differentially Expressed In Vivo

    Journal:

    doi: 10.1128/IAI.00741-08

    STM 1788 expression in wild-type and hya mutant cells. RNAs were extracted from wild-type and hya mutant cell cultures grown aerobically overnight in LB broth, using an Aurum Total RNA Mini kit (Bio-Rad). RNAs were digested with RQ1 DNase (Promega) to
    Figure Legend Snippet: STM 1788 expression in wild-type and hya mutant cells. RNAs were extracted from wild-type and hya mutant cell cultures grown aerobically overnight in LB broth, using an Aurum Total RNA Mini kit (Bio-Rad). RNAs were digested with RQ1 DNase (Promega) to

    Techniques Used: Expressing, Mutagenesis

    2) Product Images from "miR482 Regulation of NBS-LRR Defense Genes during Fungal Pathogen Infection in Cotton"

    Article Title: miR482 Regulation of NBS-LRR Defense Genes during Fungal Pathogen Infection in Cotton

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0084390

    Expression analysis of ghr-miR482/miR482.2. A) Northern blot detection of ghr-miR482/482.2 in leaves collected from V. dahliae -infected and mock-treated cotton plants at one day-post-inoculation (1 dpi). Oligos antisense to ghr-miR482a and ghr-miR482e.2 were used together as probes. The values underneath the image are the relative signal intensity of ghr-miR482a/482e.2, which were determined using the MultiGauge V2.0 (Fuji Film) and normalized based on U6. V.d: V. dahliae -infected. B to H) Stem-loop qRT-PCR analysis of the expression level of individual members of the ghr-miR482 family. RQ1 DNase treated total RNA isolated from leaves and roots of 1-dpi plants was analysed using ghr-miR482/miR482.2 member specific stem-loop RT and PCR primers. Expression level was normalized to reference gene Histone 3. Error bars represent standard deviation of the expression ratio. * and ** denote significant relative to the corresponding mock-infected control at p
    Figure Legend Snippet: Expression analysis of ghr-miR482/miR482.2. A) Northern blot detection of ghr-miR482/482.2 in leaves collected from V. dahliae -infected and mock-treated cotton plants at one day-post-inoculation (1 dpi). Oligos antisense to ghr-miR482a and ghr-miR482e.2 were used together as probes. The values underneath the image are the relative signal intensity of ghr-miR482a/482e.2, which were determined using the MultiGauge V2.0 (Fuji Film) and normalized based on U6. V.d: V. dahliae -infected. B to H) Stem-loop qRT-PCR analysis of the expression level of individual members of the ghr-miR482 family. RQ1 DNase treated total RNA isolated from leaves and roots of 1-dpi plants was analysed using ghr-miR482/miR482.2 member specific stem-loop RT and PCR primers. Expression level was normalized to reference gene Histone 3. Error bars represent standard deviation of the expression ratio. * and ** denote significant relative to the corresponding mock-infected control at p

    Techniques Used: Expressing, Northern Blot, Infection, Quantitative RT-PCR, Isolation, Polymerase Chain Reaction, Standard Deviation

    3) Product Images from "Salmonella enterica Serovar Typhimurium NiFe Uptake-Type Hydrogenases Are Differentially Expressed In Vivo "

    Article Title: Salmonella enterica Serovar Typhimurium NiFe Uptake-Type Hydrogenases Are Differentially Expressed In Vivo

    Journal:

    doi: 10.1128/IAI.00741-08

    STM 1788 expression in wild-type and hya mutant cells. RNAs were extracted from wild-type and hya mutant cell cultures grown aerobically overnight in LB broth, using an Aurum Total RNA Mini kit (Bio-Rad). RNAs were digested with RQ1 DNase (Promega) to
    Figure Legend Snippet: STM 1788 expression in wild-type and hya mutant cells. RNAs were extracted from wild-type and hya mutant cell cultures grown aerobically overnight in LB broth, using an Aurum Total RNA Mini kit (Bio-Rad). RNAs were digested with RQ1 DNase (Promega) to

    Techniques Used: Expressing, Mutagenesis

    4) Product Images from "A DNase from a Fungal Phytopathogen Is a Virulence Factor Likely Deployed as Counter Defense against Host-Secreted Extracellular DNA"

    Article Title: A DNase from a Fungal Phytopathogen Is a Virulence Factor Likely Deployed as Counter Defense against Host-Secreted Extracellular DNA

    Journal: mBio

    doi: 10.1128/mBio.02805-18

    C. heterostrophus secretes DNases, and secretion is induced by plant tissue. WT, nuc1 mutant, nuc2 mutant, and nuc1 nuc2 double-mutant filtrates degrade intact λ DNA in the presence of plant material. The nuc1 single mutant and nuc1 nuc2 double mutant degrade lambda DNA less well than the WT or the nuc2 single mutant. This indicates that DNase(s) are secreted by the fungus, that the nuc1 mutant secretes a DNase that is important in DNA degradation, and that secretion is induced by host material. Left, size markers in kilobases. +, addition of corn leaf (CL) fragments, lambda DNA, or purified RQ1 RNase-free DNase. Culture filtrates examined were from WT strain C4, nuc1 mutant strains 144206-3-1 and 8-1, nuc2 mutant strains 149183-2-1 and 3-1, and nuc1 nuc2 double-mutant strains 144206/149183-4-1 and 8-1. The negative-control reaction with λ DNA did not degrade the DNA, while the positive-control reaction with λ DNA plus DNase did. Also note that λ DNA was not degraded by the CL material.
    Figure Legend Snippet: C. heterostrophus secretes DNases, and secretion is induced by plant tissue. WT, nuc1 mutant, nuc2 mutant, and nuc1 nuc2 double-mutant filtrates degrade intact λ DNA in the presence of plant material. The nuc1 single mutant and nuc1 nuc2 double mutant degrade lambda DNA less well than the WT or the nuc2 single mutant. This indicates that DNase(s) are secreted by the fungus, that the nuc1 mutant secretes a DNase that is important in DNA degradation, and that secretion is induced by host material. Left, size markers in kilobases. +, addition of corn leaf (CL) fragments, lambda DNA, or purified RQ1 RNase-free DNase. Culture filtrates examined were from WT strain C4, nuc1 mutant strains 144206-3-1 and 8-1, nuc2 mutant strains 149183-2-1 and 3-1, and nuc1 nuc2 double-mutant strains 144206/149183-4-1 and 8-1. The negative-control reaction with λ DNA did not degrade the DNA, while the positive-control reaction with λ DNA plus DNase did. Also note that λ DNA was not degraded by the CL material.

    Techniques Used: Mutagenesis, Lambda DNA Preparation, Purification, Negative Control, Positive Control

    5) Product Images from "A DNase from a Fungal Phytopathogen Is a Virulence Factor Likely Deployed as Counter Defense against Host-Secreted Extracellular DNA"

    Article Title: A DNase from a Fungal Phytopathogen Is a Virulence Factor Likely Deployed as Counter Defense against Host-Secreted Extracellular DNA

    Journal: mBio

    doi: 10.1128/mBio.02805-18

    C. heterostrophus secretes DNases, and secretion is induced by plant tissue. WT, nuc1 mutant, nuc2 mutant, and nuc1 nuc2 double-mutant filtrates degrade intact λ DNA in the presence of plant material. The nuc1 single mutant and nuc1 nuc2 double mutant degrade lambda DNA less well than the WT or the nuc2 single mutant. This indicates that DNase(s) are secreted by the fungus, that the nuc1 mutant secretes a DNase that is important in DNA degradation, and that secretion is induced by host material. Left, size markers in kilobases. +, addition of corn leaf (CL) fragments, lambda DNA, or purified RQ1 RNase-free DNase. Culture filtrates examined were from WT strain C4, nuc1 mutant strains 144206-3-1 and 8-1, nuc2 mutant strains 149183-2-1 and 3-1, and nuc1 nuc2 double-mutant strains 144206/149183-4-1 and 8-1. The negative-control reaction with λ DNA did not degrade the DNA, while the positive-control reaction with λ DNA plus DNase did. Also note that λ DNA was not degraded by the CL material.
    Figure Legend Snippet: C. heterostrophus secretes DNases, and secretion is induced by plant tissue. WT, nuc1 mutant, nuc2 mutant, and nuc1 nuc2 double-mutant filtrates degrade intact λ DNA in the presence of plant material. The nuc1 single mutant and nuc1 nuc2 double mutant degrade lambda DNA less well than the WT or the nuc2 single mutant. This indicates that DNase(s) are secreted by the fungus, that the nuc1 mutant secretes a DNase that is important in DNA degradation, and that secretion is induced by host material. Left, size markers in kilobases. +, addition of corn leaf (CL) fragments, lambda DNA, or purified RQ1 RNase-free DNase. Culture filtrates examined were from WT strain C4, nuc1 mutant strains 144206-3-1 and 8-1, nuc2 mutant strains 149183-2-1 and 3-1, and nuc1 nuc2 double-mutant strains 144206/149183-4-1 and 8-1. The negative-control reaction with λ DNA did not degrade the DNA, while the positive-control reaction with λ DNA plus DNase did. Also note that λ DNA was not degraded by the CL material.

    Techniques Used: Mutagenesis, Lambda DNA Preparation, Purification, Negative Control, Positive Control

    6) Product Images from "A DNase from a Fungal Phytopathogen Is a Virulence Factor Likely Deployed as Counter Defense against Host-Secreted Extracellular DNA"

    Article Title: A DNase from a Fungal Phytopathogen Is a Virulence Factor Likely Deployed as Counter Defense against Host-Secreted Extracellular DNA

    Journal: mBio

    doi: 10.1128/mBio.02805-18

    C. heterostrophus secretes DNases, and secretion is induced by plant tissue. WT, nuc1 mutant, nuc2 mutant, and nuc1 nuc2 double-mutant filtrates degrade intact λ DNA in the presence of plant material. The nuc1 single mutant and nuc1 nuc2 double mutant degrade lambda DNA less well than the WT or the nuc2 single mutant. This indicates that DNase(s) are secreted by the fungus, that the nuc1 mutant secretes a DNase that is important in DNA degradation, and that secretion is induced by host material. Left, size markers in kilobases. +, addition of corn leaf (CL) fragments, lambda DNA, or purified RQ1 RNase-free DNase. Culture filtrates examined were from WT strain C4, nuc1 mutant strains 144206-3-1 and 8-1, nuc2 mutant strains 149183-2-1 and 3-1, and nuc1 nuc2 double-mutant strains 144206/149183-4-1 and 8-1. The negative-control reaction with λ DNA did not degrade the DNA, while the positive-control reaction with λ DNA plus DNase did. Also note that λ DNA was not degraded by the CL material.
    Figure Legend Snippet: C. heterostrophus secretes DNases, and secretion is induced by plant tissue. WT, nuc1 mutant, nuc2 mutant, and nuc1 nuc2 double-mutant filtrates degrade intact λ DNA in the presence of plant material. The nuc1 single mutant and nuc1 nuc2 double mutant degrade lambda DNA less well than the WT or the nuc2 single mutant. This indicates that DNase(s) are secreted by the fungus, that the nuc1 mutant secretes a DNase that is important in DNA degradation, and that secretion is induced by host material. Left, size markers in kilobases. +, addition of corn leaf (CL) fragments, lambda DNA, or purified RQ1 RNase-free DNase. Culture filtrates examined were from WT strain C4, nuc1 mutant strains 144206-3-1 and 8-1, nuc2 mutant strains 149183-2-1 and 3-1, and nuc1 nuc2 double-mutant strains 144206/149183-4-1 and 8-1. The negative-control reaction with λ DNA did not degrade the DNA, while the positive-control reaction with λ DNA plus DNase did. Also note that λ DNA was not degraded by the CL material.

    Techniques Used: Mutagenesis, Lambda DNA Preparation, Purification, Negative Control, Positive Control

    7) Product Images from "snRNA-specific role of SMN in trypanosome snRNP biogenesis in vivo"

    Article Title: snRNA-specific role of SMN in trypanosome snRNP biogenesis in vivo

    Journal:

    doi: 10.4161/rna.8.1.13985

    Nuclear accumulation of SL RNA and Sm proteins during SMN knockdown. (A) T. brucei cells without (t0) and after one, two and three days of RNAi-mediated SMN knockdown (t1–t3) were fixed, treated with RQ1-DNase (brightfield) and stained with DAPI
    Figure Legend Snippet: Nuclear accumulation of SL RNA and Sm proteins during SMN knockdown. (A) T. brucei cells without (t0) and after one, two and three days of RNAi-mediated SMN knockdown (t1–t3) were fixed, treated with RQ1-DNase (brightfield) and stained with DAPI

    Techniques Used: Staining

    SMN protein largely colocalizes with the SL RNA transcripts in the nucleus. (A and B) T. brucei cells stably expressing SMN-PTP were fixed, permeabilized and treated with RQ1-DNase to degrade cellular DNA (brightfield); for control, see DAPI staining
    Figure Legend Snippet: SMN protein largely colocalizes with the SL RNA transcripts in the nucleus. (A and B) T. brucei cells stably expressing SMN-PTP were fixed, permeabilized and treated with RQ1-DNase to degrade cellular DNA (brightfield); for control, see DAPI staining

    Techniques Used: Stable Transfection, Expressing, Staining

    8) Product Images from "A DNase from a Fungal Phytopathogen Is a Virulence Factor Likely Deployed as Counter Defense against Host-Secreted Extracellular DNA"

    Article Title: A DNase from a Fungal Phytopathogen Is a Virulence Factor Likely Deployed as Counter Defense against Host-Secreted Extracellular DNA

    Journal: mBio

    doi: 10.1128/mBio.02805-18

    C. heterostrophus secretes DNases, and secretion is induced by plant tissue. WT, nuc1 mutant, nuc2 mutant, and nuc1 nuc2 double-mutant filtrates degrade intact λ DNA in the presence of plant material. The nuc1 single mutant and nuc1 nuc2 double mutant degrade lambda DNA less well than the WT or the nuc2 single mutant. This indicates that DNase(s) are secreted by the fungus, that the nuc1 mutant secretes a DNase that is important in DNA degradation, and that secretion is induced by host material. Left, size markers in kilobases. +, addition of corn leaf (CL) fragments, lambda DNA, or purified RQ1 RNase-free DNase. Culture filtrates examined were from WT strain C4, nuc1 mutant strains 144206-3-1 and 8-1, nuc2 mutant strains 149183-2-1 and 3-1, and nuc1 nuc2 double-mutant strains 144206/149183-4-1 and 8-1. The negative-control reaction with λ DNA did not degrade the DNA, while the positive-control reaction with λ DNA plus DNase did. Also note that λ DNA was not degraded by the CL material.
    Figure Legend Snippet: C. heterostrophus secretes DNases, and secretion is induced by plant tissue. WT, nuc1 mutant, nuc2 mutant, and nuc1 nuc2 double-mutant filtrates degrade intact λ DNA in the presence of plant material. The nuc1 single mutant and nuc1 nuc2 double mutant degrade lambda DNA less well than the WT or the nuc2 single mutant. This indicates that DNase(s) are secreted by the fungus, that the nuc1 mutant secretes a DNase that is important in DNA degradation, and that secretion is induced by host material. Left, size markers in kilobases. +, addition of corn leaf (CL) fragments, lambda DNA, or purified RQ1 RNase-free DNase. Culture filtrates examined were from WT strain C4, nuc1 mutant strains 144206-3-1 and 8-1, nuc2 mutant strains 149183-2-1 and 3-1, and nuc1 nuc2 double-mutant strains 144206/149183-4-1 and 8-1. The negative-control reaction with λ DNA did not degrade the DNA, while the positive-control reaction with λ DNA plus DNase did. Also note that λ DNA was not degraded by the CL material.

    Techniques Used: Mutagenesis, Lambda DNA Preparation, Purification, Negative Control, Positive Control

    9) Product Images from "TcTASV: A Novel Protein Family in Trypanosoma cruzi Identified from a Subtractive Trypomastigote cDNA Library"

    Article Title: TcTASV: A Novel Protein Family in Trypanosoma cruzi Identified from a Subtractive Trypomastigote cDNA Library

    Journal: PLoS Neglected Tropical Diseases

    doi: 10.1371/journal.pntd.0000841

    The TcT-E element (TcT-E elem ) is present in multiple copies in the T. cruzi genome and is associated with different coding regions. (A) Identification of an enriched 280-bp element in the TcT-E library. In silico screening of the TcT-E library using the FL-160-2 3′ UTR as bait depicted a large number of clones displaying homology with nucleotides 372–472. After analyzing a multiple sequence alignment of the identified TcT-E clones, a 280-bp consensus sequence with 3′ and 5′ polypyrimidine tracts (bold) and a variable number of TAA repeats (bold underlined) was obtained, and defined as TcT-Eelement (TcT-E elem ). (B) Analysis of TcT-E elem copy number. T. cruzi genomic DNA (CL-Brener strain) was digested with restriction enzymes having no internal site within the TcT-E elem , electrophoresed on TAE-agarose gel and transferred by standard procedures. A probe specific for the TcT-E elem was synthesized and labelled by PCR with 32 P. (C) The mRNA of the CDSs located upstream of the TcT-E are preferentially expressed in trypomastigotes. Northern blots probed with the complete ORF Tcruzi_1863-4-1211-93 ( http://TriTrypDB.org ). (D) The TcT-E elem is present 30–70 bp downstream of a stop codon in many coding sequences in T.cruzi . The consensus sequence of TcT-E elem was used as bait to search the T. cruzi database; WGSs with more than 80% identity to TcT-E elem and longer than 1000 bp were retrieved and analyzed. The schematic map of the relative position of TcT-E elem in relation to coding sequences in T. cruzi genome is shown. (E) Mature mRNA transcripts contain both the TcT-E elem and different CDSs. Total RNA from trypomastigotes (T) and epimastigotes (E) was purified and treated with RQ1 DNase. First strand cDNA was synthesized by RT using an oligo dT primer. PCR was performed using a 5′ primer specific for the T. cruzi miniexon (ME) and a 3′ antisense primer corresponding to the 3′ region of the TcT-E elem . Alternatively, PCR was performed with primers corresponding to the 5′ and 3′ conserved regions of most CDSs (CDS-L and CDS-R) or with a 5′primer specific for the CDS and a 3′ primer specific for the TcT-E elem . The relative position of the primers is indicated in Fig. 2D . PCR- and RT- denote the negative controls for each reaction.
    Figure Legend Snippet: The TcT-E element (TcT-E elem ) is present in multiple copies in the T. cruzi genome and is associated with different coding regions. (A) Identification of an enriched 280-bp element in the TcT-E library. In silico screening of the TcT-E library using the FL-160-2 3′ UTR as bait depicted a large number of clones displaying homology with nucleotides 372–472. After analyzing a multiple sequence alignment of the identified TcT-E clones, a 280-bp consensus sequence with 3′ and 5′ polypyrimidine tracts (bold) and a variable number of TAA repeats (bold underlined) was obtained, and defined as TcT-Eelement (TcT-E elem ). (B) Analysis of TcT-E elem copy number. T. cruzi genomic DNA (CL-Brener strain) was digested with restriction enzymes having no internal site within the TcT-E elem , electrophoresed on TAE-agarose gel and transferred by standard procedures. A probe specific for the TcT-E elem was synthesized and labelled by PCR with 32 P. (C) The mRNA of the CDSs located upstream of the TcT-E are preferentially expressed in trypomastigotes. Northern blots probed with the complete ORF Tcruzi_1863-4-1211-93 ( http://TriTrypDB.org ). (D) The TcT-E elem is present 30–70 bp downstream of a stop codon in many coding sequences in T.cruzi . The consensus sequence of TcT-E elem was used as bait to search the T. cruzi database; WGSs with more than 80% identity to TcT-E elem and longer than 1000 bp were retrieved and analyzed. The schematic map of the relative position of TcT-E elem in relation to coding sequences in T. cruzi genome is shown. (E) Mature mRNA transcripts contain both the TcT-E elem and different CDSs. Total RNA from trypomastigotes (T) and epimastigotes (E) was purified and treated with RQ1 DNase. First strand cDNA was synthesized by RT using an oligo dT primer. PCR was performed using a 5′ primer specific for the T. cruzi miniexon (ME) and a 3′ antisense primer corresponding to the 3′ region of the TcT-E elem . Alternatively, PCR was performed with primers corresponding to the 5′ and 3′ conserved regions of most CDSs (CDS-L and CDS-R) or with a 5′primer specific for the CDS and a 3′ primer specific for the TcT-E elem . The relative position of the primers is indicated in Fig. 2D . PCR- and RT- denote the negative controls for each reaction.

    Techniques Used: In Silico, Clone Assay, Sequencing, Agarose Gel Electrophoresis, Synthesized, Polymerase Chain Reaction, Northern Blot, Purification

    10) Product Images from "miR482 Regulation of NBS-LRR Defense Genes during Fungal Pathogen Infection in Cotton"

    Article Title: miR482 Regulation of NBS-LRR Defense Genes during Fungal Pathogen Infection in Cotton

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0084390

    Expression analysis of ghr-miR482/miR482.2. A) Northern blot detection of ghr-miR482/482.2 in leaves collected from V. dahliae -infected and mock-treated cotton plants at one day-post-inoculation (1 dpi). Oligos antisense to ghr-miR482a and ghr-miR482e.2 were used together as probes. The values underneath the image are the relative signal intensity of ghr-miR482a/482e.2, which were determined using the MultiGauge V2.0 (Fuji Film) and normalized based on U6. V.d: V. dahliae -infected. B to H) Stem-loop qRT-PCR analysis of the expression level of individual members of the ghr-miR482 family. RQ1 DNase treated total RNA isolated from leaves and roots of 1-dpi plants was analysed using ghr-miR482/miR482.2 member specific stem-loop RT and PCR primers. Expression level was normalized to reference gene Histone 3. Error bars represent standard deviation of the expression ratio. * and ** denote significant relative to the corresponding mock-infected control at p
    Figure Legend Snippet: Expression analysis of ghr-miR482/miR482.2. A) Northern blot detection of ghr-miR482/482.2 in leaves collected from V. dahliae -infected and mock-treated cotton plants at one day-post-inoculation (1 dpi). Oligos antisense to ghr-miR482a and ghr-miR482e.2 were used together as probes. The values underneath the image are the relative signal intensity of ghr-miR482a/482e.2, which were determined using the MultiGauge V2.0 (Fuji Film) and normalized based on U6. V.d: V. dahliae -infected. B to H) Stem-loop qRT-PCR analysis of the expression level of individual members of the ghr-miR482 family. RQ1 DNase treated total RNA isolated from leaves and roots of 1-dpi plants was analysed using ghr-miR482/miR482.2 member specific stem-loop RT and PCR primers. Expression level was normalized to reference gene Histone 3. Error bars represent standard deviation of the expression ratio. * and ** denote significant relative to the corresponding mock-infected control at p

    Techniques Used: Expressing, Northern Blot, Infection, Quantitative RT-PCR, Isolation, Polymerase Chain Reaction, Standard Deviation

    Related Articles

    Clone Assay:

    Article Title: TcTASV: A Novel Protein Family in Trypanosoma cruzi Identified from a Subtractive Trypomastigote cDNA Library
    Article Snippet: RNA was treated with RQ1 DNase (Promega Corp., Madison, USA) and first strand cDNA synthesized using an oligo dT primer. .. PCR was performed using a 5′ primer specific for the T. cruzi miniexon containing an EcoRI site ( ccc gaattc aacgctattattgatacagtttctgt ) and a 3′ antisense primer corresponding to the 3′ region of the TcT-Eelem (TcT-Ee_int_R: aagaaatgattcggcaggaa ).

    Article Title: A DNase from a Fungal Phytopathogen Is a Virulence Factor Likely Deployed as Counter Defense against Host-Secreted Extracellular DNA
    Article Snippet: Plasmids with cloned inserts were digested with EcoRI, and fragments were cloned into the pETMAL expression vector. .. Lysozyme (final concentration, 0.1 mg/ml; catalog no. L-6878; Sigma) and RQ1 DNase (final concentration, 2 U/ml, catalog no. M610A; Promega) were added and the mixtures incubated at 37°C for 30 min for cell lysis.

    Article Title: miR482 Regulation of NBS-LRR Defense Genes during Fungal Pathogen Infection in Cotton
    Article Snippet: Briefly, ∼2 µg of RQ1 DNase (Promega) treated total RNA isolated from Sicot71 was ligated with 100 pmol of the 5′ adaptor (5' AACAGACGCGUGGUUACAGUCUUG 3') using T4 RNA ligase (NEB) in the presence of 1 mM of ATP and 1 µl of RNaseOUT (Invitrogen). .. Bands with an expected size were gel purified using the MinElute® Gel Extraction Kit (Qiagen) and inserted into pCR®4-TOPO® vector (Invitrogen).

    Centrifugation:

    Article Title: A DNase from a Fungal Phytopathogen Is a Virulence Factor Likely Deployed as Counter Defense against Host-Secreted Extracellular DNA
    Article Snippet: The cells were harvested by centrifugation at 4,000 × g and 4°C for 20 min, and the cell pellets were resuspended in 2.5 ml of column buffer (20 mM Tris-HCl [pH 7.4], 0.2 mM NaCl, and 1 mM EDTA). .. Lysozyme (final concentration, 0.1 mg/ml; catalog no. L-6878; Sigma) and RQ1 DNase (final concentration, 2 U/ml, catalog no. M610A; Promega) were added and the mixtures incubated at 37°C for 30 min for cell lysis.

    Amplification:

    Article Title: A Short Tandem Repeat-Enriched RNA Assembles a Nuclear Compartment to Control Alternative Splicing and Promote Cell Survival
    Article Snippet: Unlabeled probes used in EMSA competition assays were produced by transcribing pEM1380 cut with EcoRI (PNCTR fragment) or a PCR fragment amplified from pcDNA3 using KAPA HiFi polymerase (Kapa Biosystems; cat#KK2102) and EMSA_control_F/EMSA_control_R primers ( ; control fragment) using the mMESSAGE mMACHINE T7 RNA polymerase kit. .. Both radiolabeled- and unlabeled reactions were treated with 2 units of RQ1 DNase (Promega; cat#M6101) for 15 min at 37°C, extracted with acidic phenol-chloroform mixture (1:1), precipitated with 100% ethanol and 3 M sodium acetate, washed with 70% ethanol and re-suspended with DEPC-treated water.

    Positive Control:

    Article Title: A DNase from a Fungal Phytopathogen Is a Virulence Factor Likely Deployed as Counter Defense against Host-Secreted Extracellular DNA
    Article Snippet: The assay reaction mixture containing 2.5 µg of λ DNA (catalog no. N3011S; New England BioLabs, Inc.) and 5 µl of culture supernatant was incubated for 10 min at 37°C. .. Reactions were run on 1% agarose gels at 100 V for 15 min. As a positive control for λ DNA degradation, 1 unit of RQ1 DNase (catalog no. M610A; Promega) was used. .. To test DNase activity of recombinant Nuc1 and Nuc2 proteins (purification described below), reaction mixtures contained 2.5 µg of λ DNA and 0.84 to 2.6 µg of the purified Nuc1 or 0.28 to 0.87 µg of Nuc2 MBP-fusion proteins.

    Synthesized:

    Article Title: Mitochondrial 16S rRNA Is Methylated by tRNA Methyltransferase TRMT61B in All Vertebrates
    Article Snippet: Total RNA (2 μg) extracted from the knockdown cells was treated with 2 U of RQ1 DNase (Promega) to remove genomic DNA in a 20 μl 1×Reaction Buffer (Promega) at 37°C for 30 min, followed by adding RQ1 DNase stop solution (Promega) and incubated at 65°C for 15 min. .. Total RNA (2 μg) extracted from the knockdown cells was treated with 2 U of RQ1 DNase (Promega) to remove genomic DNA in a 20 μl 1×Reaction Buffer (Promega) at 37°C for 30 min, followed by adding RQ1 DNase stop solution (Promega) and incubated at 65°C for 15 min.

    Article Title: TcTASV: A Novel Protein Family in Trypanosoma cruzi Identified from a Subtractive Trypomastigote cDNA Library
    Article Snippet: Mature mRNA transcripts containing both the TcT-Eelem and the different upstream open reading frames (ORFs) were identified by RT-PCR and sequencing in the CL-Brener strain. .. RNA was treated with RQ1 DNase (Promega Corp., Madison, USA) and first strand cDNA synthesized using an oligo dT primer. .. PCR was performed using a 5′ primer specific for the T. cruzi miniexon containing an EcoRI site ( ccc gaattc aacgctattattgatacagtttctgt ) and a 3′ antisense primer corresponding to the 3′ region of the TcT-Eelem (TcT-Ee_int_R: aagaaatgattcggcaggaa ).

    Article Title: Salmonella enterica Serovar Typhimurium NiFe Uptake-Type Hydrogenases Are Differentially Expressed In Vivo
    Article Snippet: Total RNAs from bacteria and macrophages were isolated using TRIzol (Invitrogen) or an Aurum Total RNA Mini kit (Bio-Rad) immediately after infection and at 2 h, 4 h, 12 h, and 24 h postinfection (p.i.). .. RNAs were digested with RQ1 DNase (Promega) to remove contaminating genomic DNA. cDNA was then synthesized using 0.5 to 1 μg RNA and an iScript Select cDNA synthesis kit (Bio-Rad). .. Quantitative PCR was performed with Platinum SYBR Green qPCR SuperMix UDG (Invitrogen) and an iCycler iQ PCR detection system (Bio-Rad).

    Quantitative RT-PCR:

    Article Title: Mitochondrial 16S rRNA Is Methylated by tRNA Methyltransferase TRMT61B in All Vertebrates
    Article Snippet: Paragraph title: RNA Interference and Real-Time RT-PCR ... Total RNA (2 μg) extracted from the knockdown cells was treated with 2 U of RQ1 DNase (Promega) to remove genomic DNA in a 20 μl 1×Reaction Buffer (Promega) at 37°C for 30 min, followed by adding RQ1 DNase stop solution (Promega) and incubated at 65°C for 15 min.

    Article Title: miR482 Regulation of NBS-LRR Defense Genes during Fungal Pathogen Infection in Cotton
    Article Snippet: Paragraph title: Northern Blot and qRT-PCR ... Briefly, reverse transcription was performed using 1 µg of RQ1 DNase (Promega) treated total RNA, random primer or stem-loop RT primer, and SuperScript III reverse transcriptase (Invitrogen).

    Article Title: Rapid induction of inflammatory lipid mediators by the inflammasome in vivo
    Article Snippet: Paragraph title: Quantitative RT-PCR ... RNA samples were treated with RQ1 DNase (Promega) prior to reverse transcription with Superscript III (Invitrogen). cDNA reactions were primed with poly dT for measurement of mature transcripts.

    Article Title: Auto-regulation of miRNA biogenesis by let-7 and Argonaute
    Article Snippet: RNA was extracted using standard Trizol (Invitrogen) procedure and treated with RQ1 DNAse (Promega). cDNA synthesis was performed with Superscript II or III reverse transcriptase (Invitrogen) using random hexamers. .. Standard PCR was performed with the primers listed in and the products were resolved on agarose gels.

    Real-time Polymerase Chain Reaction:

    Article Title: piRNA-mediated regulation of transposon alternative splicing in soma and germline
    Article Snippet: Contaminating DNA was removed using RQ1 DNAse (Promega). .. Contaminating DNA was removed using RQ1 DNAse (Promega).

    Article Title: Salmonella enterica Serovar Typhimurium NiFe Uptake-Type Hydrogenases Are Differentially Expressed In Vivo
    Article Snippet: Paragraph title: Real-time PCR. ... RNAs were digested with RQ1 DNase (Promega) to remove contaminating genomic DNA. cDNA was then synthesized using 0.5 to 1 μg RNA and an iScript Select cDNA synthesis kit (Bio-Rad).

    Article Title: Auto-regulation of miRNA biogenesis by let-7 and Argonaute
    Article Snippet: RNA was extracted using standard Trizol (Invitrogen) procedure and treated with RQ1 DNAse (Promega). cDNA synthesis was performed with Superscript II or III reverse transcriptase (Invitrogen) using random hexamers. .. Standard PCR was performed with the primers listed in and the products were resolved on agarose gels.

    Incubation:

    Article Title: Mitochondrial 16S rRNA Is Methylated by tRNA Methyltransferase TRMT61B in All Vertebrates
    Article Snippet: The RNAi efficiency was checked by real-time RT-qPCR with a set of primers listed in . .. Total RNA (2 μg) extracted from the knockdown cells was treated with 2 U of RQ1 DNase (Promega) to remove genomic DNA in a 20 μl 1×Reaction Buffer (Promega) at 37°C for 30 min, followed by adding RQ1 DNase stop solution (Promega) and incubated at 65°C for 15 min. .. The DNase-treated total RNA (2 μg) was incubated at 65°C for 5 min in a 10 μL solution containing 2.5 μM oligo(dT18) primer, 60 μM random N6 primer, and 1 mM dNTPs, then cooled on ice.

    Article Title: A DNase from a Fungal Phytopathogen Is a Virulence Factor Likely Deployed as Counter Defense against Host-Secreted Extracellular DNA
    Article Snippet: Reactions were run on 1% agarose gels at 100 V for 15 min. As a positive control for λ DNA degradation, 1 unit of RQ1 DNase (catalog no. M610A; Promega) was used. .. Reactions were run on 1% agarose gels at 100 V for 15 min. As a positive control for λ DNA degradation, 1 unit of RQ1 DNase (catalog no. M610A; Promega) was used.

    Article Title: A DNase from a Fungal Phytopathogen Is a Virulence Factor Likely Deployed as Counter Defense against Host-Secreted Extracellular DNA
    Article Snippet: DNase, RQ1 DNase (catalog no. M610A; Promega); Elu buffer, elution buffer fraction; MBP-144206 and MBP-149183 W3, third washing fraction of column. (B) The purified proteins were assayed for Mg2+ dependency. .. DNase, RQ1 DNase (catalog no. M610A; Promega); Elu buffer, elution buffer fraction; MBP-144206 and MBP-149183 W3, third washing fraction of column. (B) The purified proteins were assayed for Mg2+ dependency.

    Article Title: A DNase from a Fungal Phytopathogen Is a Virulence Factor Likely Deployed as Counter Defense against Host-Secreted Extracellular DNA
    Article Snippet: To detect DNA secretion from roots, seedlings were placed on glass slides and root tips treated with 10 to 20 µl of staining solution (100 µl of sodium acetate buffer [pH 5.5] containing 1 µl of Sytox green nucleic acid stain dye [5 mM solution in dimethyl sulfoxide {DMSO}, catalog no. S7020; Invitrogen]) with or without RQ1 DNase (catalog no. M6101; Promega). .. To detect DNA secretion from roots, seedlings were placed on glass slides and root tips treated with 10 to 20 µl of staining solution (100 µl of sodium acetate buffer [pH 5.5] containing 1 µl of Sytox green nucleic acid stain dye [5 mM solution in dimethyl sulfoxide {DMSO}, catalog no. S7020; Invitrogen]) with or without RQ1 DNase (catalog no. M6101; Promega).

    Article Title: A DNase from a Fungal Phytopathogen Is a Virulence Factor Likely Deployed as Counter Defense against Host-Secreted Extracellular DNA
    Article Snippet: The cells were harvested by centrifugation at 4,000 × g and 4°C for 20 min, and the cell pellets were resuspended in 2.5 ml of column buffer (20 mM Tris-HCl [pH 7.4], 0.2 mM NaCl, and 1 mM EDTA). .. Lysozyme (final concentration, 0.1 mg/ml; catalog no. L-6878; Sigma) and RQ1 DNase (final concentration, 2 U/ml, catalog no. M610A; Promega) were added and the mixtures incubated at 37°C for 30 min for cell lysis. .. The cell lysates were centrifuged at 12,000 × g for 20 min at 4°C, and the supernatant (cell extract) was loaded on a column containing amylose-resin (catalog no. E8021S; NEB), which was preequilibrated 5 times with column buffer.

    Article Title: The helicase Ded1p controls use of near-cognate translation initiation codons in 5′UTRs
    Article Snippet: Gels were subsequently blotted with nitrocellulose membranes (Amersham™ Protran™, GE Healthcare) and exposed to X-ray film. .. RNA was then liberated by Proteinase K treatment as described.37 The purified RNAs were re-suspended in 89 μl RNase- free water, 11 μl 10 x DNase I Buffer, 5 μl RNasin, 5 μl RQ1 DNase (all Promega) and incubated for 20 min at 37°C. .. The reaction was stopped by standard phenol-chloroform extraction and RNA was ethanol-precipitated overnight.

    Article Title: RNA-dependent chromatin targeting of TET2 for endogenous retrovirus control in pluripotent stem cells
    Article Snippet: Cells were harvested, pelleted and lysed in PXL lysis buffer (1× PBS, 0.1% SDS, 0.5% NP-40 and 0.5% sodium deoxycholate) supplemented with proteinase and RNase inhibitors and RQ1 DNase (Promega #M6101). .. Cells were harvested, pelleted and lysed in PXL lysis buffer (1× PBS, 0.1% SDS, 0.5% NP-40 and 0.5% sodium deoxycholate) supplemented with proteinase and RNase inhibitors and RQ1 DNase (Promega #M6101).

    Article Title: A Short Tandem Repeat-Enriched RNA Assembles a Nuclear Compartment to Control Alternative Splicing and Promote Cell Survival
    Article Snippet: In this case, 20 μL reactions containing 1 × reaction buffer, 7.5 mM each of UTP, ATP and CTP, 1.5 mM GTP, 6 mM of the cap analog, 1 μL of the T7 enzyme mix and 1-2 μg of an appropriate DNA template were incubated for 3 h at 37°C. .. Both radiolabeled- and unlabeled reactions were treated with 2 units of RQ1 DNase (Promega; cat#M6101) for 15 min at 37°C, extracted with acidic phenol-chloroform mixture (1:1), precipitated with 100% ethanol and 3 M sodium acetate, washed with 70% ethanol and re-suspended with DEPC-treated water.

    Article Title: microRNA-122 amplifies hepatitis C virus translation by shaping the structure of the internal ribosomal entry site
    Article Snippet: Briefly, RNA was in vitro transcribed by runoff transcription with T7 RNA polymerase followed by treatment with RQ1 DNase (Promega). .. For DMS probing, DMS was added for a final concentration of 0.4%, or an equivalent volume of EtOH was added for unmodified control samples.

    Activity Assay:

    Article Title: A DNase from a Fungal Phytopathogen Is a Virulence Factor Likely Deployed as Counter Defense against Host-Secreted Extracellular DNA
    Article Snippet: Paragraph title: Activity assays of native and purified DNase. ... Reactions were run on 1% agarose gels at 100 V for 15 min. As a positive control for λ DNA degradation, 1 unit of RQ1 DNase (catalog no. M610A; Promega) was used.

    Infection:

    Article Title: miR482 Regulation of NBS-LRR Defense Genes during Fungal Pathogen Infection in Cotton
    Article Snippet: The expression levels of NBS-LRR genes in V. dahliae infected and mock-treated cotton leaves and roots were analysed as previously described . .. Briefly, reverse transcription was performed using 1 µg of RQ1 DNase (Promega) treated total RNA, random primer or stem-loop RT primer, and SuperScript III reverse transcriptase (Invitrogen).

    Article Title: Salmonella enterica Serovar Typhimurium NiFe Uptake-Type Hydrogenases Are Differentially Expressed In Vivo
    Article Snippet: Total RNAs from bacteria and macrophages were isolated using TRIzol (Invitrogen) or an Aurum Total RNA Mini kit (Bio-Rad) immediately after infection and at 2 h, 4 h, 12 h, and 24 h postinfection (p.i.). .. RNAs were digested with RQ1 DNase (Promega) to remove contaminating genomic DNA. cDNA was then synthesized using 0.5 to 1 μg RNA and an iScript Select cDNA synthesis kit (Bio-Rad).

    Expressing:

    Article Title: A DNase from a Fungal Phytopathogen Is a Virulence Factor Likely Deployed as Counter Defense against Host-Secreted Extracellular DNA
    Article Snippet: Paragraph title: DNase expression plasmid construction and enzyme purification. ... Lysozyme (final concentration, 0.1 mg/ml; catalog no. L-6878; Sigma) and RQ1 DNase (final concentration, 2 U/ml, catalog no. M610A; Promega) were added and the mixtures incubated at 37°C for 30 min for cell lysis.

    Article Title: piRNA-mediated regulation of transposon alternative splicing in soma and germline
    Article Snippet: Contaminating DNA was removed using RQ1 DNAse (Promega). .. Transcript levels were assessed by quantitative PCR (qPCR) using LightCycler® 480 SYBR Green I Master 2× (Roche) in a Roche LightCycler® 480 machine.

    Article Title: miR482 Regulation of NBS-LRR Defense Genes during Fungal Pathogen Infection in Cotton
    Article Snippet: The expression levels of NBS-LRR genes in V. dahliae infected and mock-treated cotton leaves and roots were analysed as previously described . .. Briefly, reverse transcription was performed using 1 µg of RQ1 DNase (Promega) treated total RNA, random primer or stem-loop RT primer, and SuperScript III reverse transcriptase (Invitrogen).

    Article Title: RNA-dependent chromatin targeting of TET2 for endogenous retrovirus control in pluripotent stem cells
    Article Snippet: Briefly, J1 mouse ESCs expressing a 3xFLAG-biotin tagged PSPC1 construct were crosslinked in PBS with UV type C (254 nm) at 600 mJ per cm2 on ice. .. Cells were harvested, pelleted and lysed in PXL lysis buffer (1× PBS, 0.1% SDS, 0.5% NP-40 and 0.5% sodium deoxycholate) supplemented with proteinase and RNase inhibitors and RQ1 DNase (Promega #M6101).

    Article Title: Auto-regulation of miRNA biogenesis by let-7 and Argonaute
    Article Snippet: RNA was extracted using standard Trizol (Invitrogen) procedure and treated with RQ1 DNAse (Promega). cDNA synthesis was performed with Superscript II or III reverse transcriptase (Invitrogen) using random hexamers. .. Quantification of wildtype mature let-7 or let-7(n2853) miRNA at the L4 stage was performed with Taqman Small RNA Assays (Applied Biosystems) following the manufacturer’s instructions using the hsa-let-7a RT primer and Taqman probe or a custom-made RT primer and Taqman probe specific for the let-7(n2853) sequence, respectively.

    Modification:

    Article Title: microRNA-122 amplifies hepatitis C virus translation by shaping the structure of the internal ribosomal entry site
    Article Snippet: Briefly, RNA was in vitro transcribed by runoff transcription with T7 RNA polymerase followed by treatment with RQ1 DNase (Promega). .. For DMS probing, DMS was added for a final concentration of 0.4%, or an equivalent volume of EtOH was added for unmodified control samples.

    Transformation Assay:

    Article Title: A DNase from a Fungal Phytopathogen Is a Virulence Factor Likely Deployed as Counter Defense against Host-Secreted Extracellular DNA
    Article Snippet: Lysozyme (final concentration, 0.1 mg/ml; catalog no. L-6878; Sigma) and RQ1 DNase (final concentration, 2 U/ml, catalog no. M610A; Promega) were added and the mixtures incubated at 37°C for 30 min for cell lysis. .. Lysozyme (final concentration, 0.1 mg/ml; catalog no. L-6878; Sigma) and RQ1 DNase (final concentration, 2 U/ml, catalog no. M610A; Promega) were added and the mixtures incubated at 37°C for 30 min for cell lysis.

    Derivative Assay:

    Article Title: Rapid induction of inflammatory lipid mediators by the inflammasome in vivo
    Article Snippet: Bone marrow derived macrophages are > 95% CD11b/F4-80hi and were used without sorting. .. RNA samples were treated with RQ1 DNase (Promega) prior to reverse transcription with Superscript III (Invitrogen). cDNA reactions were primed with poly dT for measurement of mature transcripts.

    RAST Test:

    Article Title: Environmental Breviatea harbor mutualisticArcobacter epibionts
    Article Snippet: For the Arcobacter genome gene predictions and functional annotations were performed using the online annotation-pipeline RAST . .. Extracted RNA was treated with RQ1 DNase (Promega), purified with RNeasy MinElute columns (Qiagen) and stored in TE buffer at -80° C. Approximataly 1 µg of total RNA was used for preparation of an mRNA sequencing library following the Illumina TruSeq RNA Sample Preparation v2 Guide, using poly-T oligo-attached magnetic beads to enrich eukaryotic mRNA.

    Ligation:

    Article Title: miR482 Regulation of NBS-LRR Defense Genes during Fungal Pathogen Infection in Cotton
    Article Snippet: Briefly, ∼2 µg of RQ1 DNase (Promega) treated total RNA isolated from Sicot71 was ligated with 100 pmol of the 5′ adaptor (5' AACAGACGCGUGGUUACAGUCUUG 3') using T4 RNA ligase (NEB) in the presence of 1 mM of ATP and 1 µl of RNaseOUT (Invitrogen). .. Bands with an expected size were gel purified using the MinElute® Gel Extraction Kit (Qiagen) and inserted into pCR®4-TOPO® vector (Invitrogen).

    Northern Blot:

    Article Title: snRNA-specific role of SMN in trypanosome snRNP biogenesis in vivo
    Article Snippet: Paragraph title: Steady-state RNA analysis, northern blotting and primer-extension analysis. ... 5 µg of total RNA from each time point was treated with 5 U of RQ1-DNase (Promega) for 30 min at 37°C, phenolized and ethanol precipitated.

    Article Title: miR482 Regulation of NBS-LRR Defense Genes during Fungal Pathogen Infection in Cotton
    Article Snippet: Paragraph title: Northern Blot and qRT-PCR ... Briefly, reverse transcription was performed using 1 µg of RQ1 DNase (Promega) treated total RNA, random primer or stem-loop RT primer, and SuperScript III reverse transcriptase (Invitrogen).

    Cell Culture:

    Article Title: A DNase from a Fungal Phytopathogen Is a Virulence Factor Likely Deployed as Counter Defense against Host-Secreted Extracellular DNA
    Article Snippet: Lysozyme (final concentration, 0.1 mg/ml; catalog no. L-6878; Sigma) and RQ1 DNase (final concentration, 2 U/ml, catalog no. M610A; Promega) were added and the mixtures incubated at 37°C for 30 min for cell lysis. .. Lysozyme (final concentration, 0.1 mg/ml; catalog no. L-6878; Sigma) and RQ1 DNase (final concentration, 2 U/ml, catalog no. M610A; Promega) were added and the mixtures incubated at 37°C for 30 min for cell lysis.

    Generated:

    Article Title: A Short Tandem Repeat-Enriched RNA Assembles a Nuclear Compartment to Control Alternative Splicing and Promote Cell Survival
    Article Snippet: Radiolabeled PNCTR RNA fragments used in electrophoretic mobility shift assays (EMSA) were generated by in vitro transcription with T7 RNA polymerase (Promega; cat#P2075), as recommended. .. Both radiolabeled- and unlabeled reactions were treated with 2 units of RQ1 DNase (Promega; cat#M6101) for 15 min at 37°C, extracted with acidic phenol-chloroform mixture (1:1), precipitated with 100% ethanol and 3 M sodium acetate, washed with 70% ethanol and re-suspended with DEPC-treated water.

    Polymerase Chain Reaction:

    Article Title: Mitochondrial 16S rRNA Is Methylated by tRNA Methyltransferase TRMT61B in All Vertebrates
    Article Snippet: Total RNA (2 μg) extracted from the knockdown cells was treated with 2 U of RQ1 DNase (Promega) to remove genomic DNA in a 20 μl 1×Reaction Buffer (Promega) at 37°C for 30 min, followed by adding RQ1 DNase stop solution (Promega) and incubated at 65°C for 15 min. .. The cDNAs were synthesized in the mixture by sequential incubation at 25°C for 10 min, at 55°C for 30 min, and at 85°C for 5 min.

    Article Title: TcTASV: A Novel Protein Family in Trypanosoma cruzi Identified from a Subtractive Trypomastigote cDNA Library
    Article Snippet: The complete TcT-E element (TcT-Eelem ) was obtained from CL-Brener genomic DNA by PCR using Pfu DNA polymerase and the primers TcT-Ee_pp_Hind ( ta aagctt ccgggcaggtacagtat ) and TcT-Ee_pp_Xho ( at ctcgag tgagaatcccgcaggact ). .. RNA was treated with RQ1 DNase (Promega Corp., Madison, USA) and first strand cDNA synthesized using an oligo dT primer.

    Article Title: piRNA-mediated regulation of transposon alternative splicing in soma and germline
    Article Snippet: Contaminating DNA was removed using RQ1 DNAse (Promega). .. Results were normalized to the mean value obtained for three control genes (CG7939 [Rp49, also known as RpL32]; CG8187; CG8269 [Dmn]) with invariant expression in a range of tissues and developmental stages, as previously described .

    Article Title: miR482 Regulation of NBS-LRR Defense Genes during Fungal Pathogen Infection in Cotton
    Article Snippet: Briefly, ∼2 µg of RQ1 DNase (Promega) treated total RNA isolated from Sicot71 was ligated with 100 pmol of the 5′ adaptor (5' AACAGACGCGUGGUUACAGUCUUG 3') using T4 RNA ligase (NEB) in the presence of 1 mM of ATP and 1 µl of RNaseOUT (Invitrogen). .. Briefly, ∼2 µg of RQ1 DNase (Promega) treated total RNA isolated from Sicot71 was ligated with 100 pmol of the 5′ adaptor (5' AACAGACGCGUGGUUACAGUCUUG 3') using T4 RNA ligase (NEB) in the presence of 1 mM of ATP and 1 µl of RNaseOUT (Invitrogen).

    Article Title: Salmonella enterica Serovar Typhimurium NiFe Uptake-Type Hydrogenases Are Differentially Expressed In Vivo
    Article Snippet: RNAs were extracted using an Aurum Total RNA Mini kit (Bio-Rad) and were digested with RQ1 DNase (Promega) to remove contaminating genomic DNA. .. The digested RNAs were the template to generate cDNA, using an iScript select cDNA synthesis kit (Bio-Rad) and primers UPST1788 (5′-ATGTTGGTACTGATGGTAAC-3′) and REVST1788 (5′-AATAGCGGTTGCCGACACAG-3′), which amplified 178 bp from the gene directly downstream (STM 1788) of the deleted hya genes.

    Article Title: A Short Tandem Repeat-Enriched RNA Assembles a Nuclear Compartment to Control Alternative Splicing and Promote Cell Survival
    Article Snippet: Unlabeled probes used in EMSA competition assays were produced by transcribing pEM1380 cut with EcoRI (PNCTR fragment) or a PCR fragment amplified from pcDNA3 using KAPA HiFi polymerase (Kapa Biosystems; cat#KK2102) and EMSA_control_F/EMSA_control_R primers ( ; control fragment) using the mMESSAGE mMACHINE T7 RNA polymerase kit. .. Both radiolabeled- and unlabeled reactions were treated with 2 units of RQ1 DNase (Promega; cat#M6101) for 15 min at 37°C, extracted with acidic phenol-chloroform mixture (1:1), precipitated with 100% ethanol and 3 M sodium acetate, washed with 70% ethanol and re-suspended with DEPC-treated water.

    Injection:

    Article Title: Rapid induction of inflammatory lipid mediators by the inflammasome in vivo
    Article Snippet: CD11b/F4-80hi cells were sorted from total peritoneal cells lavaged from naive or thioglycollate-injected (2 ml injected intraperitoneally four days in advance) mice. .. RNA samples were treated with RQ1 DNase (Promega) prior to reverse transcription with Superscript III (Invitrogen). cDNA reactions were primed with poly dT for measurement of mature transcripts.

    Recombinant:

    Article Title: A DNase from a Fungal Phytopathogen Is a Virulence Factor Likely Deployed as Counter Defense against Host-Secreted Extracellular DNA
    Article Snippet: 10.1128/mBio.02805-18.5 FIG S5 DNase assay of recombinant Nuc1 and Nuc2 proteins. (A) The purified MBP-fusion proteins ( ) were tested for DNase activity. .. DNase, RQ1 DNase (catalog no. M610A; Promega); Elu buffer, elution buffer fraction; MBP-144206 and MBP-149183 W3, third washing fraction of column. (B) The purified proteins were assayed for Mg2+ dependency.

    Staining:

    Article Title: A DNase from a Fungal Phytopathogen Is a Virulence Factor Likely Deployed as Counter Defense against Host-Secreted Extracellular DNA
    Article Snippet: Corn seeds were sterilized with 5% bleach solution, rinsed 7 times with sterilized water, and then allowed to imbibe sterilized water for 2 h. Imbibed seeds were placed on sterilized filter paper on top of 1% water agar in petri dishes and then incubated in the dark for 2 to 3 days. .. To detect DNA secretion from roots, seedlings were placed on glass slides and root tips treated with 10 to 20 µl of staining solution (100 µl of sodium acetate buffer [pH 5.5] containing 1 µl of Sytox green nucleic acid stain dye [5 mM solution in dimethyl sulfoxide {DMSO}, catalog no. S7020; Invitrogen]) with or without RQ1 DNase (catalog no. M6101; Promega). .. After 10 to 20 min, roots were carefully removed, and the remaining solution was examined under a fluorescence microscope (Leica DM5500) or SP5 Leica confocal microscope.

    Magnetic Beads:

    Article Title: Environmental Breviatea harbor mutualisticArcobacter epibionts
    Article Snippet: For mRNA sequencing, RNA was preserved in RNA-later and was extracted as previously described . .. Extracted RNA was treated with RQ1 DNase (Promega), purified with RNeasy MinElute columns (Qiagen) and stored in TE buffer at -80° C. Approximataly 1 µg of total RNA was used for preparation of an mRNA sequencing library following the Illumina TruSeq RNA Sample Preparation v2 Guide, using poly-T oligo-attached magnetic beads to enrich eukaryotic mRNA. .. The RNA library was sequenced on a MiSeq instrument in a 2x250 bp paired-end run.

    Mutagenesis:

    Article Title: Salmonella enterica Serovar Typhimurium NiFe Uptake-Type Hydrogenases Are Differentially Expressed In Vivo
    Article Snippet: In order to confirm the nonpolar nature of the hya mutation, reverse transcription-PCR (RT-PCR) was performed on wild-type and hya mutant strains. .. RNAs were extracted using an Aurum Total RNA Mini kit (Bio-Rad) and were digested with RQ1 DNase (Promega) to remove contaminating genomic DNA.

    Isolation:

    Article Title: piRNA-mediated regulation of transposon alternative splicing in soma and germline
    Article Snippet: Paragraph title: RNA isolation and analyses ... Contaminating DNA was removed using RQ1 DNAse (Promega).

    Article Title: miR482 Regulation of NBS-LRR Defense Genes during Fungal Pathogen Infection in Cotton
    Article Snippet: Approximately 25 µg of total RNA isolated using the hot borate approach was used in small RNA northern blot analysis as previously described . .. Briefly, reverse transcription was performed using 1 µg of RQ1 DNase (Promega) treated total RNA, random primer or stem-loop RT primer, and SuperScript III reverse transcriptase (Invitrogen).

    Article Title: miR482 Regulation of NBS-LRR Defense Genes during Fungal Pathogen Infection in Cotton
    Article Snippet: Confirmation of ghr-miR482/miR482.2-mediated cleavage of NBS-LRR genes was carried out using total RNA by 5′ RACE (rapid amplification of cDNA ends) as previously described . .. Briefly, ∼2 µg of RQ1 DNase (Promega) treated total RNA isolated from Sicot71 was ligated with 100 pmol of the 5′ adaptor (5' AACAGACGCGUGGUUACAGUCUUG 3') using T4 RNA ligase (NEB) in the presence of 1 mM of ATP and 1 µl of RNaseOUT (Invitrogen). .. Two rounds (primary and nested) of PCR were performed using gene specific reverse primers and a universal forward primer (GUS_RACEf; ) that annealing to the 5′ adaptor.

    Article Title: Salmonella enterica Serovar Typhimurium NiFe Uptake-Type Hydrogenases Are Differentially Expressed In Vivo
    Article Snippet: Total RNAs from bacteria and macrophages were isolated using TRIzol (Invitrogen) or an Aurum Total RNA Mini kit (Bio-Rad) immediately after infection and at 2 h, 4 h, 12 h, and 24 h postinfection (p.i.). .. RNAs were digested with RQ1 DNase (Promega) to remove contaminating genomic DNA. cDNA was then synthesized using 0.5 to 1 μg RNA and an iScript Select cDNA synthesis kit (Bio-Rad).

    Sequencing:

    Article Title: TcTASV: A Novel Protein Family in Trypanosoma cruzi Identified from a Subtractive Trypomastigote cDNA Library
    Article Snippet: Mature mRNA transcripts containing both the TcT-Eelem and the different upstream open reading frames (ORFs) were identified by RT-PCR and sequencing in the CL-Brener strain. .. RNA was treated with RQ1 DNase (Promega Corp., Madison, USA) and first strand cDNA synthesized using an oligo dT primer.

    Article Title: RNA-dependent chromatin targeting of TET2 for endogenous retrovirus control in pluripotent stem cells
    Article Snippet: Paragraph title: Crosslinking immunoprecipitation and massive parallel sequencing (CLIP-seq) ... Cells were harvested, pelleted and lysed in PXL lysis buffer (1× PBS, 0.1% SDS, 0.5% NP-40 and 0.5% sodium deoxycholate) supplemented with proteinase and RNase inhibitors and RQ1 DNase (Promega #M6101).

    Article Title: Environmental Breviatea harbor mutualisticArcobacter epibionts
    Article Snippet: For mRNA sequencing, RNA was preserved in RNA-later and was extracted as previously described . .. Extracted RNA was treated with RQ1 DNase (Promega), purified with RNeasy MinElute columns (Qiagen) and stored in TE buffer at -80° C. Approximataly 1 µg of total RNA was used for preparation of an mRNA sequencing library following the Illumina TruSeq RNA Sample Preparation v2 Guide, using poly-T oligo-attached magnetic beads to enrich eukaryotic mRNA. .. The RNA library was sequenced on a MiSeq instrument in a 2x250 bp paired-end run.

    Article Title: Auto-regulation of miRNA biogenesis by let-7 and Argonaute
    Article Snippet: RNA was extracted using standard Trizol (Invitrogen) procedure and treated with RQ1 DNAse (Promega). cDNA synthesis was performed with Superscript II or III reverse transcriptase (Invitrogen) using random hexamers. .. Quantitative Real Time-PCR (qRT-PCR) was performed using SYBR Green or Fast SYBR Green (Applied Biosystems) on ABI Prism 7000 Real Time PCR or StepOne instruments.

    Electrophoretic Mobility Shift Assay:

    Article Title: A Short Tandem Repeat-Enriched RNA Assembles a Nuclear Compartment to Control Alternative Splicing and Promote Cell Survival
    Article Snippet: Radiolabeled PNCTR RNA fragments used in electrophoretic mobility shift assays (EMSA) were generated by in vitro transcription with T7 RNA polymerase (Promega; cat#P2075), as recommended. .. Both radiolabeled- and unlabeled reactions were treated with 2 units of RQ1 DNase (Promega; cat#M6101) for 15 min at 37°C, extracted with acidic phenol-chloroform mixture (1:1), precipitated with 100% ethanol and 3 M sodium acetate, washed with 70% ethanol and re-suspended with DEPC-treated water.

    Mouse Assay:

    Article Title: Rapid induction of inflammatory lipid mediators by the inflammasome in vivo
    Article Snippet: CD11b/F4-80hi cells were sorted from total peritoneal cells lavaged from naive or thioglycollate-injected (2 ml injected intraperitoneally four days in advance) mice. .. RNA samples were treated with RQ1 DNase (Promega) prior to reverse transcription with Superscript III (Invitrogen). cDNA reactions were primed with poly dT for measurement of mature transcripts.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: TcTASV: A Novel Protein Family in Trypanosoma cruzi Identified from a Subtractive Trypomastigote cDNA Library
    Article Snippet: Mature mRNA transcripts containing both the TcT-Eelem and the different upstream open reading frames (ORFs) were identified by RT-PCR and sequencing in the CL-Brener strain. .. RNA was treated with RQ1 DNase (Promega Corp., Madison, USA) and first strand cDNA synthesized using an oligo dT primer.

    Article Title: Salmonella enterica Serovar Typhimurium NiFe Uptake-Type Hydrogenases Are Differentially Expressed In Vivo
    Article Snippet: Paragraph title: RT-PCR. ... RNAs were extracted using an Aurum Total RNA Mini kit (Bio-Rad) and were digested with RQ1 DNase (Promega) to remove contaminating genomic DNA.

    Article Title: Auto-regulation of miRNA biogenesis by let-7 and Argonaute
    Article Snippet: Paragraph title: Reverse Transcription – Polymerase Chain Reaction (RT-PCR) assays ... RNA was extracted using standard Trizol (Invitrogen) procedure and treated with RQ1 DNAse (Promega). cDNA synthesis was performed with Superscript II or III reverse transcriptase (Invitrogen) using random hexamers.

    Construct:

    Article Title: RNA-dependent chromatin targeting of TET2 for endogenous retrovirus control in pluripotent stem cells
    Article Snippet: Briefly, J1 mouse ESCs expressing a 3xFLAG-biotin tagged PSPC1 construct were crosslinked in PBS with UV type C (254 nm) at 600 mJ per cm2 on ice. .. Cells were harvested, pelleted and lysed in PXL lysis buffer (1× PBS, 0.1% SDS, 0.5% NP-40 and 0.5% sodium deoxycholate) supplemented with proteinase and RNase inhibitors and RQ1 DNase (Promega #M6101).

    Polyacrylamide Gel Electrophoresis:

    Article Title: The helicase Ded1p controls use of near-cognate translation initiation codons in 5′UTRs
    Article Snippet: Beads were subsequently mixed with SDS loading dye and subjected to PAGE on a 10% NEXT gel (Amresco) according to the manufacturer’s conditions. .. RNA was then liberated by Proteinase K treatment as described.37 The purified RNAs were re-suspended in 89 μl RNase- free water, 11 μl 10 x DNase I Buffer, 5 μl RNasin, 5 μl RQ1 DNase (all Promega) and incubated for 20 min at 37°C.

    FACS:

    Article Title: piRNA-mediated regulation of transposon alternative splicing in soma and germline
    Article Snippet: Total RNA from FACS sorted germ cells or dissected adult ovaries was isolated using Trizol reagent (Invitrogen) and quantified by Qubit (Invitrogen). .. Contaminating DNA was removed using RQ1 DNAse (Promega).

    Concentration Assay:

    Article Title: A DNase from a Fungal Phytopathogen Is a Virulence Factor Likely Deployed as Counter Defense against Host-Secreted Extracellular DNA
    Article Snippet: Conidia were resuspended in MMX at a concentration of 1 × 105 conidia/ml. .. Reactions were run on 1% agarose gels at 100 V for 15 min. As a positive control for λ DNA degradation, 1 unit of RQ1 DNase (catalog no. M610A; Promega) was used.

    Article Title: A DNase from a Fungal Phytopathogen Is a Virulence Factor Likely Deployed as Counter Defense against Host-Secreted Extracellular DNA
    Article Snippet: DNase, RQ1 DNase (catalog no. M610A; Promega); Elu buffer, elution buffer fraction; MBP-144206 and MBP-149183 W3, third washing fraction of column. (B) The purified proteins were assayed for Mg2+ dependency. .. The 144206 fusion protein (1.68 µg) and 0.56 µg of 149183 fusion protein were used for the assay and incubated for 1 h and 2 h. Samples without added Mg2+ did not show activity.

    Article Title: A DNase from a Fungal Phytopathogen Is a Virulence Factor Likely Deployed as Counter Defense against Host-Secreted Extracellular DNA
    Article Snippet: The cells were harvested by centrifugation at 4,000 × g and 4°C for 20 min, and the cell pellets were resuspended in 2.5 ml of column buffer (20 mM Tris-HCl [pH 7.4], 0.2 mM NaCl, and 1 mM EDTA). .. Lysozyme (final concentration, 0.1 mg/ml; catalog no. L-6878; Sigma) and RQ1 DNase (final concentration, 2 U/ml, catalog no. M610A; Promega) were added and the mixtures incubated at 37°C for 30 min for cell lysis. .. The cell lysates were centrifuged at 12,000 × g for 20 min at 4°C, and the supernatant (cell extract) was loaded on a column containing amylose-resin (catalog no. E8021S; NEB), which was preequilibrated 5 times with column buffer.

    Article Title: microRNA-122 amplifies hepatitis C virus translation by shaping the structure of the internal ribosomal entry site
    Article Snippet: Briefly, RNA was in vitro transcribed by runoff transcription with T7 RNA polymerase followed by treatment with RQ1 DNase (Promega). .. Briefly, RNA was in vitro transcribed by runoff transcription with T7 RNA polymerase followed by treatment with RQ1 DNase (Promega).

    Agarose Gel Electrophoresis:

    Article Title: piRNA-mediated regulation of transposon alternative splicing in soma and germline
    Article Snippet: Contaminating DNA was removed using RQ1 DNAse (Promega). .. Results were normalized to the mean value obtained for three control genes (CG7939 [Rp49, also known as RpL32]; CG8187; CG8269 [Dmn]) with invariant expression in a range of tissues and developmental stages, as previously described .

    Chloramphenicol Acetyltransferase Assay:

    Article Title: A Short Tandem Repeat-Enriched RNA Assembles a Nuclear Compartment to Control Alternative Splicing and Promote Cell Survival
    Article Snippet: In this case, 20 μL reactions containing 1 × reaction buffer, 7.5 mM each of UTP, ATP and CTP, 1.5 mM GTP, 6 mM of the cap analog, 1 μL of the T7 enzyme mix and 1-2 μg of an appropriate DNA template were incubated for 3 h at 37°C. .. Both radiolabeled- and unlabeled reactions were treated with 2 units of RQ1 DNase (Promega; catM6101) for 15 min at 37°C, extracted with acidic phenol-chloroform mixture (1:1), precipitated with 100% ethanol and 3 M sodium acetate, washed with 70% ethanol and re-suspended with DEPC-treated water. .. To obtain PNCTR RNA fragment used to prepare a standard curve for qRT-PCR quantification, 20 μl reactions containing 1 × RNAPol reaction buffer, 0.5 mM NTP mix, 1 unit of murine RNase inhibitor (New England Biolabs; cat# M0314), 5 mM DTT (Thermo Fisher Scientific; cat# 15508013), 100 units of T7 RNA polymerase (New England Biolabs; cat#M0251S) and 1 μg of pML154 linearized by EcoRI were incubated for 2 hours at 37°C.

    Purification:

    Article Title: A DNase from a Fungal Phytopathogen Is a Virulence Factor Likely Deployed as Counter Defense against Host-Secreted Extracellular DNA
    Article Snippet: Paragraph title: Activity assays of native and purified DNase. ... Reactions were run on 1% agarose gels at 100 V for 15 min. As a positive control for λ DNA degradation, 1 unit of RQ1 DNase (catalog no. M610A; Promega) was used.

    Article Title: A DNase from a Fungal Phytopathogen Is a Virulence Factor Likely Deployed as Counter Defense against Host-Secreted Extracellular DNA
    Article Snippet: The 144206 (0.84, 1.68, and 2.6 µg) and 149183 (0.28, 0.56, and 0.87 µg) purified proteins were used for the assay. .. DNase, RQ1 DNase (catalog no. M610A; Promega); Elu buffer, elution buffer fraction; MBP-144206 and MBP-149183 W3, third washing fraction of column. (B) The purified proteins were assayed for Mg2+ dependency. .. MgSO4 concentrations of 0, 5, 10, 25, and 50 mM were tested.

    Article Title: TcTASV: A Novel Protein Family in Trypanosoma cruzi Identified from a Subtractive Trypomastigote cDNA Library
    Article Snippet: RNA was treated with RQ1 DNase (Promega Corp., Madison, USA) and first strand cDNA synthesized using an oligo dT primer. .. PCR was performed using a 5′ primer specific for the T. cruzi miniexon containing an EcoRI site ( ccc gaattc aacgctattattgatacagtttctgt ) and a 3′ antisense primer corresponding to the 3′ region of the TcT-Eelem (TcT-Ee_int_R: aagaaatgattcggcaggaa ).

    Article Title: miR482 Regulation of NBS-LRR Defense Genes during Fungal Pathogen Infection in Cotton
    Article Snippet: Briefly, ∼2 µg of RQ1 DNase (Promega) treated total RNA isolated from Sicot71 was ligated with 100 pmol of the 5′ adaptor (5' AACAGACGCGUGGUUACAGUCUUG 3') using T4 RNA ligase (NEB) in the presence of 1 mM of ATP and 1 µl of RNaseOUT (Invitrogen). .. Briefly, ∼2 µg of RQ1 DNase (Promega) treated total RNA isolated from Sicot71 was ligated with 100 pmol of the 5′ adaptor (5' AACAGACGCGUGGUUACAGUCUUG 3') using T4 RNA ligase (NEB) in the presence of 1 mM of ATP and 1 µl of RNaseOUT (Invitrogen).

    Article Title: The helicase Ded1p controls use of near-cognate translation initiation codons in 5′UTRs
    Article Snippet: Gels were subsequently blotted with nitrocellulose membranes (Amersham™ Protran™, GE Healthcare) and exposed to X-ray film. .. RNA was then liberated by Proteinase K treatment as described.37 The purified RNAs were re-suspended in 89 μl RNase- free water, 11 μl 10 x DNase I Buffer, 5 μl RNasin, 5 μl RQ1 DNase (all Promega) and incubated for 20 min at 37°C. .. The reaction was stopped by standard phenol-chloroform extraction and RNA was ethanol-precipitated overnight.

    Article Title: Environmental Breviatea harbor mutualisticArcobacter epibionts
    Article Snippet: For mRNA sequencing, RNA was preserved in RNA-later and was extracted as previously described . .. Extracted RNA was treated with RQ1 DNase (Promega), purified with RNeasy MinElute columns (Qiagen) and stored in TE buffer at -80° C. Approximataly 1 µg of total RNA was used for preparation of an mRNA sequencing library following the Illumina TruSeq RNA Sample Preparation v2 Guide, using poly-T oligo-attached magnetic beads to enrich eukaryotic mRNA. .. The RNA library was sequenced on a MiSeq instrument in a 2x250 bp paired-end run.

    Article Title: microRNAs stimulate translation initiation mediated by HCV-like IRESes
    Article Snippet: Tris-Reagent (Sigma-Aldrich, St Louis, MO, USA) was added to the lysate and cytoplasmic RNAs were extracted following the protocol provided by the manufacturer. .. Cytoplasmic RNAs were treated with RQ1 DNase (Promega Co., Madison, WI, USA) to avoid DNA contamination and purified with isopropanol and washed with 70% EtOH. .. Reverse transcription of 200 ng of cytoplasmic RNAs was performed using qScript kit (Quanta Biosciences, Gaithersburg, MD, USA). mRNA quantification was performed by quantitative PCR using a 20 μl reaction, which was prepared with 5 μl of template cDNA (1/10 diluted first), 10 μl of Fast Start Universal SYBR Green Premix (Roche, Bâle, Suisse), 0.2 μM of each primer and subjected to amplification using a StepOne fluorescence thermocycler (Applied Biosystems, Foster City, CA, USA) under the following conditions: 10 min at 94°C for initial denaturation, followed by 40 cycles of denaturation at 95°C for 15 s, annealing at 60°C for 15 s and elongation at 72°C for 30 s. This program was followed by a melting curve analysis in order to verify the specificity of the PCR product.

    Article Title: microRNA-122 amplifies hepatitis C virus translation by shaping the structure of the internal ribosomal entry site
    Article Snippet: For SHAPE, dimethyl sulfate (DMS) and nicotinoyl azide (NAz) probing of the full-length HCV genome, RNA was transcribed, purified, and folded as previously described . .. Briefly, RNA was in vitro transcribed by runoff transcription with T7 RNA polymerase followed by treatment with RQ1 DNase (Promega).

    Plasmid Preparation:

    Article Title: A DNase from a Fungal Phytopathogen Is a Virulence Factor Likely Deployed as Counter Defense against Host-Secreted Extracellular DNA
    Article Snippet: Paragraph title: DNase expression plasmid construction and enzyme purification. ... Lysozyme (final concentration, 0.1 mg/ml; catalog no. L-6878; Sigma) and RQ1 DNase (final concentration, 2 U/ml, catalog no. M610A; Promega) were added and the mixtures incubated at 37°C for 30 min for cell lysis.

    Article Title: miR482 Regulation of NBS-LRR Defense Genes during Fungal Pathogen Infection in Cotton
    Article Snippet: Briefly, ∼2 µg of RQ1 DNase (Promega) treated total RNA isolated from Sicot71 was ligated with 100 pmol of the 5′ adaptor (5' AACAGACGCGUGGUUACAGUCUUG 3') using T4 RNA ligase (NEB) in the presence of 1 mM of ATP and 1 µl of RNaseOUT (Invitrogen). .. Briefly, ∼2 µg of RQ1 DNase (Promega) treated total RNA isolated from Sicot71 was ligated with 100 pmol of the 5′ adaptor (5' AACAGACGCGUGGUUACAGUCUUG 3') using T4 RNA ligase (NEB) in the presence of 1 mM of ATP and 1 µl of RNaseOUT (Invitrogen).

    Article Title: A Short Tandem Repeat-Enriched RNA Assembles a Nuclear Compartment to Control Alternative Splicing and Promote Cell Survival
    Article Snippet: Briefly, 40 μL reaction mixtures containing 1 × transcription buffer, 10 mM DTT, 0.8 unit/μl rRNasin (Promega; cat#N2111), 0.5 mM ATP, 0.5 mM CTP, 0.2 mM GTP, 0.02 mM UTP, 40 μCi of [α-32 P]-UTP, 0.8 mM Ribo m7G Cap analog, 0.8 unit/μl T7 RNA polymerase and 1-2 μg of pEM1380 plasmid linearized with EcoRI were incubated for 1 h at 37°C. .. Both radiolabeled- and unlabeled reactions were treated with 2 units of RQ1 DNase (Promega; cat#M6101) for 15 min at 37°C, extracted with acidic phenol-chloroform mixture (1:1), precipitated with 100% ethanol and 3 M sodium acetate, washed with 70% ethanol and re-suspended with DEPC-treated water.

    SYBR Green Assay:

    Article Title: piRNA-mediated regulation of transposon alternative splicing in soma and germline
    Article Snippet: Contaminating DNA was removed using RQ1 DNAse (Promega). .. Contaminating DNA was removed using RQ1 DNAse (Promega).

    Article Title: Auto-regulation of miRNA biogenesis by let-7 and Argonaute
    Article Snippet: RNA was extracted using standard Trizol (Invitrogen) procedure and treated with RQ1 DNAse (Promega). cDNA synthesis was performed with Superscript II or III reverse transcriptase (Invitrogen) using random hexamers. .. Standard PCR was performed with the primers listed in and the products were resolved on agarose gels.

    Functional Assay:

    Article Title: Environmental Breviatea harbor mutualisticArcobacter epibionts
    Article Snippet: For the Arcobacter genome gene predictions and functional annotations were performed using the online annotation-pipeline RAST . .. Extracted RNA was treated with RQ1 DNase (Promega), purified with RNeasy MinElute columns (Qiagen) and stored in TE buffer at -80° C. Approximataly 1 µg of total RNA was used for preparation of an mRNA sequencing library following the Illumina TruSeq RNA Sample Preparation v2 Guide, using poly-T oligo-attached magnetic beads to enrich eukaryotic mRNA.

    Sample Prep:

    Article Title: Environmental Breviatea harbor mutualisticArcobacter epibionts
    Article Snippet: For mRNA sequencing, RNA was preserved in RNA-later and was extracted as previously described . .. Extracted RNA was treated with RQ1 DNase (Promega), purified with RNeasy MinElute columns (Qiagen) and stored in TE buffer at -80° C. Approximataly 1 µg of total RNA was used for preparation of an mRNA sequencing library following the Illumina TruSeq RNA Sample Preparation v2 Guide, using poly-T oligo-attached magnetic beads to enrich eukaryotic mRNA. .. The RNA library was sequenced on a MiSeq instrument in a 2x250 bp paired-end run.

    In Vitro:

    Article Title: A Short Tandem Repeat-Enriched RNA Assembles a Nuclear Compartment to Control Alternative Splicing and Promote Cell Survival
    Article Snippet: Radiolabeled PNCTR RNA fragments used in electrophoretic mobility shift assays (EMSA) were generated by in vitro transcription with T7 RNA polymerase (Promega; cat#P2075), as recommended. .. Both radiolabeled- and unlabeled reactions were treated with 2 units of RQ1 DNase (Promega; cat#M6101) for 15 min at 37°C, extracted with acidic phenol-chloroform mixture (1:1), precipitated with 100% ethanol and 3 M sodium acetate, washed with 70% ethanol and re-suspended with DEPC-treated water.

    Article Title: microRNA-122 amplifies hepatitis C virus translation by shaping the structure of the internal ribosomal entry site
    Article Snippet: For SHAPE, dimethyl sulfate (DMS) and nicotinoyl azide (NAz) probing of the full-length HCV genome, RNA was transcribed, purified, and folded as previously described . .. Briefly, RNA was in vitro transcribed by runoff transcription with T7 RNA polymerase followed by treatment with RQ1 DNase (Promega). .. The RNA was then purified using RNeasy columns (QIAGEN) according to manufacturer’s protocol and eluted in ME buffer (8 mM MOPS pH 6.5, 0.1 mM EDTA).

    Ethanol Precipitation:

    Article Title: snRNA-specific role of SMN in trypanosome snRNP biogenesis in vivo
    Article Snippet: 5 µg of total RNA from each time point was treated with 5 U of RQ1-DNase (Promega) for 30 min at 37°C, phenolized and ethanol precipitated. .. 5 µg of total RNA from each time point was treated with 5 U of RQ1-DNase (Promega) for 30 min at 37°C, phenolized and ethanol precipitated.

    Next-Generation Sequencing:

    Article Title: Environmental Breviatea harbor mutualisticArcobacter epibionts
    Article Snippet: Paragraph title: Next generation sequencing and in silico procedures ... Extracted RNA was treated with RQ1 DNase (Promega), purified with RNeasy MinElute columns (Qiagen) and stored in TE buffer at -80° C. Approximataly 1 µg of total RNA was used for preparation of an mRNA sequencing library following the Illumina TruSeq RNA Sample Preparation v2 Guide, using poly-T oligo-attached magnetic beads to enrich eukaryotic mRNA.

    Produced:

    Article Title: A Short Tandem Repeat-Enriched RNA Assembles a Nuclear Compartment to Control Alternative Splicing and Promote Cell Survival
    Article Snippet: Unlabeled probes used in EMSA competition assays were produced by transcribing pEM1380 cut with EcoRI (PNCTR fragment) or a PCR fragment amplified from pcDNA3 using KAPA HiFi polymerase (Kapa Biosystems; cat#KK2102) and EMSA_control_F/EMSA_control_R primers ( ; control fragment) using the mMESSAGE mMACHINE T7 RNA polymerase kit. .. Both radiolabeled- and unlabeled reactions were treated with 2 units of RQ1 DNase (Promega; cat#M6101) for 15 min at 37°C, extracted with acidic phenol-chloroform mixture (1:1), precipitated with 100% ethanol and 3 M sodium acetate, washed with 70% ethanol and re-suspended with DEPC-treated water.

    Immunoprecipitation:

    Article Title: RNA-dependent chromatin targeting of TET2 for endogenous retrovirus control in pluripotent stem cells
    Article Snippet: UV-crosslinking and immunoprecipitation were performed as previously described with some modifications. .. Cells were harvested, pelleted and lysed in PXL lysis buffer (1× PBS, 0.1% SDS, 0.5% NP-40 and 0.5% sodium deoxycholate) supplemented with proteinase and RNase inhibitors and RQ1 DNase (Promega #M6101).

    Rapid Amplification of cDNA Ends:

    Article Title: miR482 Regulation of NBS-LRR Defense Genes during Fungal Pathogen Infection in Cotton
    Article Snippet: Confirmation of ghr-miR482/miR482.2-mediated cleavage of NBS-LRR genes was carried out using total RNA by 5′ RACE (rapid amplification of cDNA ends) as previously described . .. Briefly, ∼2 µg of RQ1 DNase (Promega) treated total RNA isolated from Sicot71 was ligated with 100 pmol of the 5′ adaptor (5' AACAGACGCGUGGUUACAGUCUUG 3') using T4 RNA ligase (NEB) in the presence of 1 mM of ATP and 1 µl of RNaseOUT (Invitrogen).

    Lysis:

    Article Title: A DNase from a Fungal Phytopathogen Is a Virulence Factor Likely Deployed as Counter Defense against Host-Secreted Extracellular DNA
    Article Snippet: The last washing fractions from the column were tested and shown not to degrade λ DNA (W3, right two lanes), confirming that the RQ1 DNase was effective in degrading E. coli host genomic DNA released during cell lysis. .. DNase, RQ1 DNase (catalog no. M610A; Promega); Elu buffer, elution buffer fraction; MBP-144206 and MBP-149183 W3, third washing fraction of column. (B) The purified proteins were assayed for Mg2+ dependency.

    Article Title: A DNase from a Fungal Phytopathogen Is a Virulence Factor Likely Deployed as Counter Defense against Host-Secreted Extracellular DNA
    Article Snippet: The cells were harvested by centrifugation at 4,000 × g and 4°C for 20 min, and the cell pellets were resuspended in 2.5 ml of column buffer (20 mM Tris-HCl [pH 7.4], 0.2 mM NaCl, and 1 mM EDTA). .. Lysozyme (final concentration, 0.1 mg/ml; catalog no. L-6878; Sigma) and RQ1 DNase (final concentration, 2 U/ml, catalog no. M610A; Promega) were added and the mixtures incubated at 37°C for 30 min for cell lysis. .. The cell lysates were centrifuged at 12,000 × g for 20 min at 4°C, and the supernatant (cell extract) was loaded on a column containing amylose-resin (catalog no. E8021S; NEB), which was preequilibrated 5 times with column buffer.

    Article Title: RNA-dependent chromatin targeting of TET2 for endogenous retrovirus control in pluripotent stem cells
    Article Snippet: Briefly, J1 mouse ESCs expressing a 3xFLAG-biotin tagged PSPC1 construct were crosslinked in PBS with UV type C (254 nm) at 600 mJ per cm2 on ice. .. Cells were harvested, pelleted and lysed in PXL lysis buffer (1× PBS, 0.1% SDS, 0.5% NP-40 and 0.5% sodium deoxycholate) supplemented with proteinase and RNase inhibitors and RQ1 DNase (Promega #M6101). .. For immunoprecipitation, the supernatant was incubated with beads prebound with 4 μg of anti-FLAG antibody conjugated with 30 μl Protein G Dynabeads overnight at 4°C.

    Gel Extraction:

    Article Title: miR482 Regulation of NBS-LRR Defense Genes during Fungal Pathogen Infection in Cotton
    Article Snippet: Briefly, ∼2 µg of RQ1 DNase (Promega) treated total RNA isolated from Sicot71 was ligated with 100 pmol of the 5′ adaptor (5' AACAGACGCGUGGUUACAGUCUUG 3') using T4 RNA ligase (NEB) in the presence of 1 mM of ATP and 1 µl of RNaseOUT (Invitrogen). .. Briefly, ∼2 µg of RQ1 DNase (Promega) treated total RNA isolated from Sicot71 was ligated with 100 pmol of the 5′ adaptor (5' AACAGACGCGUGGUUACAGUCUUG 3') using T4 RNA ligase (NEB) in the presence of 1 mM of ATP and 1 µl of RNaseOUT (Invitrogen).

    Cross-linking Immunoprecipitation:

    Article Title: RNA-dependent chromatin targeting of TET2 for endogenous retrovirus control in pluripotent stem cells
    Article Snippet: Paragraph title: Crosslinking immunoprecipitation and massive parallel sequencing (CLIP-seq) ... Cells were harvested, pelleted and lysed in PXL lysis buffer (1× PBS, 0.1% SDS, 0.5% NP-40 and 0.5% sodium deoxycholate) supplemented with proteinase and RNase inhibitors and RQ1 DNase (Promega #M6101).

    In Silico:

    Article Title: Environmental Breviatea harbor mutualisticArcobacter epibionts
    Article Snippet: Paragraph title: Next generation sequencing and in silico procedures ... Extracted RNA was treated with RQ1 DNase (Promega), purified with RNeasy MinElute columns (Qiagen) and stored in TE buffer at -80° C. Approximataly 1 µg of total RNA was used for preparation of an mRNA sequencing library following the Illumina TruSeq RNA Sample Preparation v2 Guide, using poly-T oligo-attached magnetic beads to enrich eukaryotic mRNA.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Promega rnase free dnase rq1
    Analysis of hormone-regulated Star NAT expression by <t>RNase</t> protection assay (RPA). A . MA-10 cells were incubated with 8Br-cAMP (1 mM) for the indicated times. Total RNA was extracted and then treated with <t>DNase</t> I. Single-chain Star sense and Star NAT RNA probes were synthesized by in vitro transcription and labeled with [ 32 P] UTP. A schematic diagram illustrates the riboprobes used and their complementarity to the corresponding transcript. B . RPA was performed using simultaneously two probes: the sense- Star RNA probe (Sense probe) that was complementary to 566 bp of the coding region of sense transcripts, and the NAT- Star RNA probe (NAT probe 1) that was complementary to 719 bp of Star NAT. A representative autoradiograph is shown. The negative control (tRNA (+) RNase) consisted of yeast tRNA instead of MA-10 RNA. The tRNA (−) RNase control consisted of yeast tRNA without RNase treatment and was used to visualize the full-length probes. C . RPA was performed using another Star NAT probe (NAT probe 2) that was synthesized to be complementary to 590 bp of Star NAT sequence in a region different from the probe used in (B). A representative autoradiograph is shown. D . Graphs show the quantification (OD) of Star sense and NAT expression levels for each time point expressed in arbitrary units. Data are presented as an average ± SD of three independent experiments. * P
    Rnase Free Dnase Rq1, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 481 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rnase free dnase rq1/product/Promega
    Average 99 stars, based on 481 article reviews
    Price from $9.99 to $1999.99
    rnase free dnase rq1 - by Bioz Stars, 2019-10
    99/100 stars
      Buy from Supplier

    77
    Promega dnase i
    Fitting curves of the DNase I-PCR results for the selected genomic regions. PCR products as shown in  were quantified using an Agilent Bioanalyzer. The measurements were normalized to the input values and fitted to an exponential decay model.
    Dnase I, supplied by Promega, used in various techniques. Bioz Stars score: 77/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dnase i/product/Promega
    Average 77 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    dnase i - by Bioz Stars, 2019-10
    77/100 stars
      Buy from Supplier

    Image Search Results


    Analysis of hormone-regulated Star NAT expression by RNase protection assay (RPA). A . MA-10 cells were incubated with 8Br-cAMP (1 mM) for the indicated times. Total RNA was extracted and then treated with DNase I. Single-chain Star sense and Star NAT RNA probes were synthesized by in vitro transcription and labeled with [ 32 P] UTP. A schematic diagram illustrates the riboprobes used and their complementarity to the corresponding transcript. B . RPA was performed using simultaneously two probes: the sense- Star RNA probe (Sense probe) that was complementary to 566 bp of the coding region of sense transcripts, and the NAT- Star RNA probe (NAT probe 1) that was complementary to 719 bp of Star NAT. A representative autoradiograph is shown. The negative control (tRNA (+) RNase) consisted of yeast tRNA instead of MA-10 RNA. The tRNA (−) RNase control consisted of yeast tRNA without RNase treatment and was used to visualize the full-length probes. C . RPA was performed using another Star NAT probe (NAT probe 2) that was synthesized to be complementary to 590 bp of Star NAT sequence in a region different from the probe used in (B). A representative autoradiograph is shown. D . Graphs show the quantification (OD) of Star sense and NAT expression levels for each time point expressed in arbitrary units. Data are presented as an average ± SD of three independent experiments. * P

    Journal: PLoS ONE

    Article Title: Hormone-Dependent Expression of a Steroidogenic Acute Regulatory Protein Natural Antisense Transcript in MA-10 Mouse Tumor Leydig Cells

    doi: 10.1371/journal.pone.0022822

    Figure Lengend Snippet: Analysis of hormone-regulated Star NAT expression by RNase protection assay (RPA). A . MA-10 cells were incubated with 8Br-cAMP (1 mM) for the indicated times. Total RNA was extracted and then treated with DNase I. Single-chain Star sense and Star NAT RNA probes were synthesized by in vitro transcription and labeled with [ 32 P] UTP. A schematic diagram illustrates the riboprobes used and their complementarity to the corresponding transcript. B . RPA was performed using simultaneously two probes: the sense- Star RNA probe (Sense probe) that was complementary to 566 bp of the coding region of sense transcripts, and the NAT- Star RNA probe (NAT probe 1) that was complementary to 719 bp of Star NAT. A representative autoradiograph is shown. The negative control (tRNA (+) RNase) consisted of yeast tRNA instead of MA-10 RNA. The tRNA (−) RNase control consisted of yeast tRNA without RNase treatment and was used to visualize the full-length probes. C . RPA was performed using another Star NAT probe (NAT probe 2) that was synthesized to be complementary to 590 bp of Star NAT sequence in a region different from the probe used in (B). A representative autoradiograph is shown. D . Graphs show the quantification (OD) of Star sense and NAT expression levels for each time point expressed in arbitrary units. Data are presented as an average ± SD of three independent experiments. * P

    Article Snippet: M-MLV reverse transcriptase (RT), T7 RNA polymerase, GoTaq® DNA polymerase, pGEM®-T Easy vector, RNAsin® inhibitor, RNase-free DNase RQ1, and other molecular biology reagents were purchased from Promega (Madison, WI).

    Techniques: Expressing, Rnase Protection Assay, Recombinase Polymerase Amplification, Incubation, Synthesized, In Vitro, Labeling, Autoradiography, Negative Control, Sequencing

    Star NAT 3′ end characterization. A . Total RNA was isolated from MA-10 cells and treated with DNase I. 3′ RACE was performed using two sequence-specific primers for PCR and nested PCR amplifications. Following agarose gel electrophoresis, bands were eluted, and cloned into the pGEM®-T Easy vector for sequencing. The results were analyzed by BLAST and Vector NTITM Suite 8 software. Left panel. Schematic diagram showing the relative location of the sequence-specific primers used. Right panel. Representative image of the nested PCR product generated. MW, DNA molecular weight ladder: -RT, no reverse transcriptase RT-PCR control. Arrows indicate the apparent sizes in bp. B . Total RNA extracted from MA-10 cells was treated with DNase or RNase prior to sequence-specific reverse transcription, followed by PCR/nested PCR and sequencing. Upper panel. Schematic diagram showing the RT primer (Rv.RT), PCR primers (Fw.1 and Rv.1), and nested PCR primers (Fw.2 and Rv.2) used in these experiments. A schematic representation of the full Star NAT sequence obtained after sequencing the PCR product is shown. Lower panel. Representative image of the RT-nested PCR product. +R, RNase-treated RNA control; -RT, no reverse transcriptase RT-PCR control; -p, RT reaction in the absence of primer; pi, RT reaction in the presence of a non-specific primer; MW, DNA molecular weight ladder. Arrows indicate apparent sizes in bp.

    Journal: PLoS ONE

    Article Title: Hormone-Dependent Expression of a Steroidogenic Acute Regulatory Protein Natural Antisense Transcript in MA-10 Mouse Tumor Leydig Cells

    doi: 10.1371/journal.pone.0022822

    Figure Lengend Snippet: Star NAT 3′ end characterization. A . Total RNA was isolated from MA-10 cells and treated with DNase I. 3′ RACE was performed using two sequence-specific primers for PCR and nested PCR amplifications. Following agarose gel electrophoresis, bands were eluted, and cloned into the pGEM®-T Easy vector for sequencing. The results were analyzed by BLAST and Vector NTITM Suite 8 software. Left panel. Schematic diagram showing the relative location of the sequence-specific primers used. Right panel. Representative image of the nested PCR product generated. MW, DNA molecular weight ladder: -RT, no reverse transcriptase RT-PCR control. Arrows indicate the apparent sizes in bp. B . Total RNA extracted from MA-10 cells was treated with DNase or RNase prior to sequence-specific reverse transcription, followed by PCR/nested PCR and sequencing. Upper panel. Schematic diagram showing the RT primer (Rv.RT), PCR primers (Fw.1 and Rv.1), and nested PCR primers (Fw.2 and Rv.2) used in these experiments. A schematic representation of the full Star NAT sequence obtained after sequencing the PCR product is shown. Lower panel. Representative image of the RT-nested PCR product. +R, RNase-treated RNA control; -RT, no reverse transcriptase RT-PCR control; -p, RT reaction in the absence of primer; pi, RT reaction in the presence of a non-specific primer; MW, DNA molecular weight ladder. Arrows indicate apparent sizes in bp.

    Article Snippet: M-MLV reverse transcriptase (RT), T7 RNA polymerase, GoTaq® DNA polymerase, pGEM®-T Easy vector, RNAsin® inhibitor, RNase-free DNase RQ1, and other molecular biology reagents were purchased from Promega (Madison, WI).

    Techniques: Isolation, Sequencing, Polymerase Chain Reaction, Nested PCR, Agarose Gel Electrophoresis, Clone Assay, Plasmid Preparation, Software, Generated, Molecular Weight, Reverse Transcription Polymerase Chain Reaction

    Star NAT expression in MA-10 cells. Total RNA was extracted from MA-10 cells and treated with DNase or RNase prior to sequence-specific reverse transcription, followed by PCR/nested PCR and sequencing. A . Schematic diagram showing the RT primer (G3.1), PCR primers (Fw.1 and G3.2), and nested PCR primers (Fw.2 and G3.3) used in these experiments. A schematic representation of the full Star NAT sequence obtained after sequencing the PCR products is shown. B . Representative image of the RT-nested PCR product, the identity of which was confirmed by sequencing. +R, RNase-treated RNA control; -RT, no reverse transcriptase RT-PCR control; -p, RT reaction in the absence of primer; pi, RT reaction in the presence of a non-specific primer; MW, DNA molecular weight ladder. Arrows indicate apparent sizes in bp. C . Poly (A) + RNA was purified from total MA-10 cells RNA using oligo(dT) cellulose chromatography. After DNase I treatment, specific RT, PCR and nested PCR were conducted as indicated above. A representative image of the PCR product is shown.

    Journal: PLoS ONE

    Article Title: Hormone-Dependent Expression of a Steroidogenic Acute Regulatory Protein Natural Antisense Transcript in MA-10 Mouse Tumor Leydig Cells

    doi: 10.1371/journal.pone.0022822

    Figure Lengend Snippet: Star NAT expression in MA-10 cells. Total RNA was extracted from MA-10 cells and treated with DNase or RNase prior to sequence-specific reverse transcription, followed by PCR/nested PCR and sequencing. A . Schematic diagram showing the RT primer (G3.1), PCR primers (Fw.1 and G3.2), and nested PCR primers (Fw.2 and G3.3) used in these experiments. A schematic representation of the full Star NAT sequence obtained after sequencing the PCR products is shown. B . Representative image of the RT-nested PCR product, the identity of which was confirmed by sequencing. +R, RNase-treated RNA control; -RT, no reverse transcriptase RT-PCR control; -p, RT reaction in the absence of primer; pi, RT reaction in the presence of a non-specific primer; MW, DNA molecular weight ladder. Arrows indicate apparent sizes in bp. C . Poly (A) + RNA was purified from total MA-10 cells RNA using oligo(dT) cellulose chromatography. After DNase I treatment, specific RT, PCR and nested PCR were conducted as indicated above. A representative image of the PCR product is shown.

    Article Snippet: M-MLV reverse transcriptase (RT), T7 RNA polymerase, GoTaq® DNA polymerase, pGEM®-T Easy vector, RNAsin® inhibitor, RNase-free DNase RQ1, and other molecular biology reagents were purchased from Promega (Madison, WI).

    Techniques: Expressing, Sequencing, Polymerase Chain Reaction, Nested PCR, Reverse Transcription Polymerase Chain Reaction, Molecular Weight, Purification, Chromatography

    Nuclear accumulation of SL RNA and Sm proteins during SMN knockdown. (A) T. brucei cells without (t0) and after one, two and three days of RNAi-mediated SMN knockdown (t1–t3) were fixed, treated with RQ1-DNase (brightfield) and stained with DAPI

    Journal:

    Article Title: snRNA-specific role of SMN in trypanosome snRNP biogenesis in vivo

    doi: 10.4161/rna.8.1.13985

    Figure Lengend Snippet: Nuclear accumulation of SL RNA and Sm proteins during SMN knockdown. (A) T. brucei cells without (t0) and after one, two and three days of RNAi-mediated SMN knockdown (t1–t3) were fixed, treated with RQ1-DNase (brightfield) and stained with DAPI

    Article Snippet: Optional RQ1-DNase treatment was done, using 6 U of RQ1 RNase-free DNase (Promega) for 1 h at 37°C to exclude the possibility of hybridization with DNA.

    Techniques: Staining

    SMN protein largely colocalizes with the SL RNA transcripts in the nucleus. (A and B) T. brucei cells stably expressing SMN-PTP were fixed, permeabilized and treated with RQ1-DNase to degrade cellular DNA (brightfield); for control, see DAPI staining

    Journal:

    Article Title: snRNA-specific role of SMN in trypanosome snRNP biogenesis in vivo

    doi: 10.4161/rna.8.1.13985

    Figure Lengend Snippet: SMN protein largely colocalizes with the SL RNA transcripts in the nucleus. (A and B) T. brucei cells stably expressing SMN-PTP were fixed, permeabilized and treated with RQ1-DNase to degrade cellular DNA (brightfield); for control, see DAPI staining

    Article Snippet: Optional RQ1-DNase treatment was done, using 6 U of RQ1 RNase-free DNase (Promega) for 1 h at 37°C to exclude the possibility of hybridization with DNA.

    Techniques: Stable Transfection, Expressing, Staining

    Fitting curves of the DNase I-PCR results for the selected genomic regions. PCR products as shown in  were quantified using an Agilent Bioanalyzer. The measurements were normalized to the input values and fitted to an exponential decay model.

    Journal:

    Article Title: Measuring Arabidopsis Chromatin Accessibility Using DNase I-Polymerase Chain Reaction and DNase I-Chip Assays

    doi: 10.1104/pp.113.220400

    Figure Lengend Snippet: Fitting curves of the DNase I-PCR results for the selected genomic regions. PCR products as shown in were quantified using an Agilent Bioanalyzer. The measurements were normalized to the input values and fitted to an exponential decay model.

    Article Snippet: A DNase I (RQ1 RNase-Free DNase; Promega) dilution series was prepared by step-wise dilution using digestion buffer to establish the following concentrations: 0, 0.125, 1.25, 2.5, and 5 units mL−1 .

    Techniques: Polymerase Chain Reaction

    Quantitative PCR confirmation of the enrichment of hyposensitive over hypersensitive DNA regions in different size fractions after controlled DNase I digestion of nuclei. DNA fractions of four size ranges (more than 17 kb, 6–17 kb, 3–6

    Journal:

    Article Title: Measuring Arabidopsis Chromatin Accessibility Using DNase I-Polymerase Chain Reaction and DNase I-Chip Assays

    doi: 10.1104/pp.113.220400

    Figure Lengend Snippet: Quantitative PCR confirmation of the enrichment of hyposensitive over hypersensitive DNA regions in different size fractions after controlled DNase I digestion of nuclei. DNA fractions of four size ranges (more than 17 kb, 6–17 kb, 3–6

    Article Snippet: A DNase I (RQ1 RNase-Free DNase; Promega) dilution series was prepared by step-wise dilution using digestion buffer to establish the following concentrations: 0, 0.125, 1.25, 2.5, and 5 units mL−1 .

    Techniques: Real-time Polymerase Chain Reaction

    Principle of using PCR to detect the accessibility of DNA fragments in chromatin. After a limited DNase I digest of native chromatin, more accessible chromatin is cleaved more frequently within a short distance, resulting in fragmentation of the DNA and

    Journal:

    Article Title: Measuring Arabidopsis Chromatin Accessibility Using DNase I-Polymerase Chain Reaction and DNase I-Chip Assays

    doi: 10.1104/pp.113.220400

    Figure Lengend Snippet: Principle of using PCR to detect the accessibility of DNA fragments in chromatin. After a limited DNase I digest of native chromatin, more accessible chromatin is cleaved more frequently within a short distance, resulting in fragmentation of the DNA and

    Article Snippet: A DNase I (RQ1 RNase-Free DNase; Promega) dilution series was prepared by step-wise dilution using digestion buffer to establish the following concentrations: 0, 0.125, 1.25, 2.5, and 5 units mL−1 .

    Techniques: Polymerase Chain Reaction

    RNAi-depletion of K5 during lytic replication suppresses KSHV particle release. ( A ) Three shRNA hairpins were designed to target K5 and co-expressed with K5-HA in 293T cells. The efficiency of reduction of K5 expression was assessed 48 hours later by western blot of total cell lysates detecting the HA tag. Stripped blots were re-probed for alpha tubulin to demonstrate equal loading. ( B C ) r219-HeLa cells were transduced by lentiviral vectors encoding K5 shRNAs at an MOI of 5, reseeded 72 hours later and transfected with RTA expression plasmid the following day. Supernatants were harvested 48 hours post-RTA transfection and KSHV titer expressed as infectious unit/ml ( B ) and DNase-I resistant genome copies/ml ( C ) were determined as in Figure 1 . At the time of harvest (48 hours post RTA transfection), ORF37 and GAPDH mRNA were measured in the cell lysates by Taqman Q-RT-PCR to assess effect of the hairpins on KSHV reactivation and ORF37 expression ( D ). At the time of harvest, cells were also kept to assess the effect of the hairpins on genome replication. Cellular DNA was extracted and KSHV episomes measured by QPCR for ORF37 ( E ). Results are expressed as KSHV genomes per nanogram of total cellular DNA. Results are the mean of 2 independent experiments and errors are standard error of the mean.

    Journal: PLoS Pathogens

    Article Title: The RING-CH Ligase K5 Antagonizes Restriction of KSHV and HIV-1 Particle Release by Mediating Ubiquitin-Dependent Endosomal Degradation of Tetherin

    doi: 10.1371/journal.ppat.1000843

    Figure Lengend Snippet: RNAi-depletion of K5 during lytic replication suppresses KSHV particle release. ( A ) Three shRNA hairpins were designed to target K5 and co-expressed with K5-HA in 293T cells. The efficiency of reduction of K5 expression was assessed 48 hours later by western blot of total cell lysates detecting the HA tag. Stripped blots were re-probed for alpha tubulin to demonstrate equal loading. ( B C ) r219-HeLa cells were transduced by lentiviral vectors encoding K5 shRNAs at an MOI of 5, reseeded 72 hours later and transfected with RTA expression plasmid the following day. Supernatants were harvested 48 hours post-RTA transfection and KSHV titer expressed as infectious unit/ml ( B ) and DNase-I resistant genome copies/ml ( C ) were determined as in Figure 1 . At the time of harvest (48 hours post RTA transfection), ORF37 and GAPDH mRNA were measured in the cell lysates by Taqman Q-RT-PCR to assess effect of the hairpins on KSHV reactivation and ORF37 expression ( D ). At the time of harvest, cells were also kept to assess the effect of the hairpins on genome replication. Cellular DNA was extracted and KSHV episomes measured by QPCR for ORF37 ( E ). Results are expressed as KSHV genomes per nanogram of total cellular DNA. Results are the mean of 2 independent experiments and errors are standard error of the mean.

    Article Snippet: KSHV genomes were quantified by extracting total DNA (QIAamp, QIAGEN) from DNAse-I treated supernatant (70 units/ml for 2 hours, RQ1 Promega, UK) with 40µg of salmon sperm DNA as a carrier (Sigma, Poole UK).

    Techniques: shRNA, Hemagglutination Assay, Expressing, Western Blot, Transfection, Plasmid Preparation, Reverse Transcription Polymerase Chain Reaction, Real-time Polymerase Chain Reaction

    Over-expression of human tetherin restricts KSHV particle release. HeLa KSHV cells were transfected with an expression vector encoding the KSHV early transcriptional activator RTA and increasing doses of pCR3.1 encoding human tetherin. Plasmid dose was kept constant using pcDNA3.1. 48 hours after transfection supernatants were harvested, filtered and used to infect 293T cells ( A ) and infectious virus titer determined by GFP expression in the target cells by flow cytometry. Values are presented as infectious units/ml. ( B ) Parallel supernatants were treated for 2 hours with DNase-I and viral genomic DNA isolated and supernatant genome copy number enumerated by quantitative Taqman PCR specific for ORF37. Values are presented as copies/ml. ( C ) Western blot analysis for RTA protein (top panel) performed on r219-HeLa cells after virus collection indicates that RTA expression levels were equivalent in each sample. Blots were stripped and detection of tetherin using an anti-HA antibody performed (middle panel) shows increasing tetherin levels across samples, as expected. Alpha tubulin was detected concomitantly to RTA to demonstrate equal loading (bottom panel). ( D ) KSHV reactivation was equivalent in all samples as evidenced by measurement of ORF37 mRNA levels by quantitative Taqman PCR and after normalization to GAPDH levels. ( E ) KSHV genome levels remained constant in all samples as evidenced by equivalent numbers of intracellular KSHV episomes per nanogram of total cellular DNA. Results are the mean of 2 independent experiments and errors are standard error of the mean.

    Journal: PLoS Pathogens

    Article Title: The RING-CH Ligase K5 Antagonizes Restriction of KSHV and HIV-1 Particle Release by Mediating Ubiquitin-Dependent Endosomal Degradation of Tetherin

    doi: 10.1371/journal.ppat.1000843

    Figure Lengend Snippet: Over-expression of human tetherin restricts KSHV particle release. HeLa KSHV cells were transfected with an expression vector encoding the KSHV early transcriptional activator RTA and increasing doses of pCR3.1 encoding human tetherin. Plasmid dose was kept constant using pcDNA3.1. 48 hours after transfection supernatants were harvested, filtered and used to infect 293T cells ( A ) and infectious virus titer determined by GFP expression in the target cells by flow cytometry. Values are presented as infectious units/ml. ( B ) Parallel supernatants were treated for 2 hours with DNase-I and viral genomic DNA isolated and supernatant genome copy number enumerated by quantitative Taqman PCR specific for ORF37. Values are presented as copies/ml. ( C ) Western blot analysis for RTA protein (top panel) performed on r219-HeLa cells after virus collection indicates that RTA expression levels were equivalent in each sample. Blots were stripped and detection of tetherin using an anti-HA antibody performed (middle panel) shows increasing tetherin levels across samples, as expected. Alpha tubulin was detected concomitantly to RTA to demonstrate equal loading (bottom panel). ( D ) KSHV reactivation was equivalent in all samples as evidenced by measurement of ORF37 mRNA levels by quantitative Taqman PCR and after normalization to GAPDH levels. ( E ) KSHV genome levels remained constant in all samples as evidenced by equivalent numbers of intracellular KSHV episomes per nanogram of total cellular DNA. Results are the mean of 2 independent experiments and errors are standard error of the mean.

    Article Snippet: KSHV genomes were quantified by extracting total DNA (QIAamp, QIAGEN) from DNAse-I treated supernatant (70 units/ml for 2 hours, RQ1 Promega, UK) with 40µg of salmon sperm DNA as a carrier (Sigma, Poole UK).

    Techniques: Over Expression, Transfection, Expressing, Plasmid Preparation, Flow Cytometry, Cytometry, Isolation, Polymerase Chain Reaction, Western Blot, Hemagglutination Assay