Structured Review

Millipore rosetta2
Rosetta2, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 105 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rosetta2/product/Millipore
Average 99 stars, based on 105 article reviews
Price from $9.99 to $1999.99
rosetta2 - by Bioz Stars, 2020-04
99/100 stars

Images

Related Articles

Clone Assay:

Article Title: Cell-type–restricted anti-cytokine therapy: TNF inhibition from one pathogenic source
Article Snippet: To obtain control antibody, the STI-1 gene encoding the mutated anti-F4/80 scFv part was synthesized de novo (Geneart) and cloned into position of the original anti-F4/80 scFv sequence. .. Expression vectors carrying MYSTI-1 and STI-1 genes were used to transform Rosetta2( DE3 )pLysS cells (Novagen).

Article Title: The human CTF4-orthologue AND-1 interacts with DNA polymerase α/primase via its unique C-terminal HMG box
Article Snippet: Paragraph title: Protein cloning, expression and purification ... His6 -GST-tagged proteins were expressed in Rosetta2(DE3) cells (Novagen), and purified using Ni-NTA agarose (Qiagen).

Article Title: Identification and evolution of fungal mitochondrial tyrosyl-tRNA synthetases with group I intron splicing activity
Article Snippet: Paragraph title: Cloning, Expression, and Purification of Fungal mtTyrRSs. ... Proteins were expressed via autoinduction ( ) in either E. coli BL21(DE3) (CYT-18, An mtTyrRS) or Rosetta2(DE3) (Novagen; Cp mtTyrRS, Hc mtTyrRS, and Sc mtTyrRS).

Article Title: Phosphatidic acid sequesters Sec18p from cis-SNARE complexes to inhibit priming
Article Snippet: The amplified gene was inserted into pET His6 Sumo TEV LIC cloning vector (2S-T) (Addgene plasmid #29711) using the restriction enzyme SspI and the LIC method previously described to create the plasmid pSP1 ( ). .. Three liters of Rosetta2(DE3)pLysS (EMD Millipore) cells transformed with pSP1 were grown in auto-inducing media supplemented with 2 mM MgSO4 at 37°C to an OD600 of 4.0, and cells were harvested by centrifugation ( ).

Centrifugation:

Article Title: Structural studies on KijD1, a sugar C‐3′‐methyltransferase
Article Snippet: The pET28t‐ kijD1 plasmid was used to transform Rosetta2(DE3) E. coli cells (Novagen). .. The flasks were cooled in an ice bath, and the cells were induced with 1 mM IPTG and allowed to express protein at 20°C for 24 h. The cells were harvested by centrifugation and disrupted by sonication on ice.

Article Title: The structure of RbmB from Streptomyces ribosidificus, an aminotransferase involved in the biosynthesis of ribostamycin
Article Snippet: The pET28t‐ rbmB or pET28t‐ btrR plasmids were used to transform Rosetta2(DE3) E. coli cells (Novagen). .. The flasks were cooled in an ice bath, and the cells were induced with 1 m M isopropyl β‐ d ‐1‐thiogalactopyranoside and allowed to express protein at 21°C for 24 h. The cells were harvested by centrifugation and disrupted by sonication on ice.

Article Title: Phosphatidic acid sequesters Sec18p from cis-SNARE complexes to inhibit priming
Article Snippet: .. Three liters of Rosetta2(DE3)pLysS (EMD Millipore) cells transformed with pSP1 were grown in auto-inducing media supplemented with 2 mM MgSO4 at 37°C to an OD600 of 4.0, and cells were harvested by centrifugation ( ). .. Cells were lysed by freeze-thaw and sonication in buffer containing 50 mM Tris-HCl, pH 7.5, 300 mM NaCl, 2 mM MgCl2 , 10 mM imidazole, and 1mM phenylmethanesulfonyl fluoride (PMSF).

Article Title: Recognition of siRNA asymmetry by TAR RNA binding protein (TRBP)
Article Snippet: Briefly, plasmids were transformed into Rosetta2(DE3) competent cells (Novagen). .. After 2 hrs of expression at 37°C, cells were pelleted (4000 rpm for 10 min), resuspended in Column Buffer (20 mM Tris-HCl, 200 mM NaCl, 1 mM EDTA), lysed via sonication, and then clarified by high speed centrifugation (15,000 rpm for 25 min).

Amplification:

Article Title: The primase domain of PfPrex is a proteolytically matured, essential enzyme of the apicoplast
Article Snippet: Sequences coding for PfPrex’s TOPRIM domain alone (residues 336–465) or complete primase domain (comprised of its Zinc-Binding and TOPRIM domains, residues 115–465; ) were PCR amplified from P. falciparum 3D7 genomic DNA, inserted between the NdeI and XhoI sites of pET28b+ (Novagen) and confirmed by sequencing. .. Expression plasmids were transformed into the Rosetta2(DE3)pLysS strain of E. coli (Novagen).

Article Title: Phosphatidic acid sequesters Sec18p from cis-SNARE complexes to inhibit priming
Article Snippet: The amplified gene was inserted into pET His6 Sumo TEV LIC cloning vector (2S-T) (Addgene plasmid #29711) using the restriction enzyme SspI and the LIC method previously described to create the plasmid pSP1 ( ). .. Three liters of Rosetta2(DE3)pLysS (EMD Millipore) cells transformed with pSP1 were grown in auto-inducing media supplemented with 2 mM MgSO4 at 37°C to an OD600 of 4.0, and cells were harvested by centrifugation ( ).

Article Title: Mechanisms governing the pioneering and redistribution capabilities of the non-classical pioneer PU.1
Article Snippet: The sequence of the full-length hPU.1 was amplified by PCR from pORF9-hSPI1 (InvivoGen) and recombined into a modified pDM8 vector, encoding an N-terminal His-tag, using the Gateway technology (Life Technologies). .. The protein was expressed in Rosetta2(DE)pLysS (Novagen) and purified by Nickel affinity chromatography (Qiagen) as described above.

Filtration:

Article Title: Identification and evolution of fungal mitochondrial tyrosyl-tRNA synthetases with group I intron splicing activity
Article Snippet: Proteins were expressed via autoinduction ( ) in either E. coli BL21(DE3) (CYT-18, An mtTyrRS) or Rosetta2(DE3) (Novagen; Cp mtTyrRS, Hc mtTyrRS, and Sc mtTyrRS). .. The Sc mtTyrRS was purified via a Ni2+ column, TEV cleavage, a second Ni2+ column, and a final Superdex S-200 gel filtration.

Synthesized:

Article Title: Cell-type–restricted anti-cytokine therapy: TNF inhibition from one pathogenic source
Article Snippet: To obtain control antibody, the STI-1 gene encoding the mutated anti-F4/80 scFv part was synthesized de novo (Geneart) and cloned into position of the original anti-F4/80 scFv sequence. .. Expression vectors carrying MYSTI-1 and STI-1 genes were used to transform Rosetta2( DE3 )pLysS cells (Novagen).

Article Title: Mechanisms governing the pioneering and redistribution capabilities of the non-classical pioneer PU.1
Article Snippet: The protein was expressed in Rosetta2(DE)pLysS (Novagen) and purified by Nickel affinity chromatography (Qiagen) as described above. .. Analyzed oligomers were synthesized with Cy3-labeled, with either a methylated or hydroxyl-methylated CpG-site (5mC/5hmC), or as unmodified DNA oligomers (Sigma).

Construct:

Article Title: The human CTF4-orthologue AND-1 interacts with DNA polymerase α/primase via its unique C-terminal HMG box
Article Snippet: Point mutations (I14A, F15A, I46A, A47E) were introduced into the B (1–78; BNT ) construct by site-directed mutagenesis. .. His6 -GST-tagged proteins were expressed in Rosetta2(DE3) cells (Novagen), and purified using Ni-NTA agarose (Qiagen).

Article Title: Phosphatidic acid sequesters Sec18p from cis-SNARE complexes to inhibit priming
Article Snippet: The recombinant His6 -SUMO-Pah1p construct used was created for this study. .. Three liters of Rosetta2(DE3)pLysS (EMD Millipore) cells transformed with pSP1 were grown in auto-inducing media supplemented with 2 mM MgSO4 at 37°C to an OD600 of 4.0, and cells were harvested by centrifugation ( ).

Article Title: A potential structural switch for regulating DNA-binding by TEAD transcription factors
Article Snippet: The ΔL1 TEAD DBD construct was generated using the QuikChange method (Stratagene, La Jolla, CA) starting with hTEAD1 DBD in pET21d. .. [ ] Overexpression and protein purification were carried out as follows: Plasmid was transformed into CodonPlus Escherichia coli cells (Novagen, San Diego, CA) or Rosetta2(DE3)pLysS (EMD Millipore, MA) and grown in 2xYT medium (unlabeled) or M9 medium.

Expressing:

Article Title: Identification of a starter unit acyl-carrier protein transacylase domain in an iterative type I polyketide synthase
Article Snippet: Paragraph title: Expression and Purification of SAT/SAT-C117A. ... SAT and SAT-C117A were expressed for 12 h at 20°C in Rosetta2(DE3) E. coli cells (Novagen) harboring pENTC3 and pENT-C117A, respectively.

Article Title: Structural studies on KijD1, a sugar C‐3′‐methyltransferase
Article Snippet: Paragraph title: Protein expression and purification ... The pET28t‐ kijD1 plasmid was used to transform Rosetta2(DE3) E. coli cells (Novagen).

Article Title: Cell-type–restricted anti-cytokine therapy: TNF inhibition from one pathogenic source
Article Snippet: .. Expression vectors carrying MYSTI-1 and STI-1 genes were used to transform Rosetta2( DE3 )pLysS cells (Novagen). .. Best producers were selected from transformed clones by colony blot procedure using HisProbe-HRP Conjugate (Pierce, 15165).

Article Title: The structure of RbmB from Streptomyces ribosidificus, an aminotransferase involved in the biosynthesis of ribostamycin
Article Snippet: Paragraph title: Protein expression and purification ... The pET28t‐ rbmB or pET28t‐ btrR plasmids were used to transform Rosetta2(DE3) E. coli cells (Novagen).

Article Title: The human CTF4-orthologue AND-1 interacts with DNA polymerase α/primase via its unique C-terminal HMG box
Article Snippet: Paragraph title: Protein cloning, expression and purification ... His6 -GST-tagged proteins were expressed in Rosetta2(DE3) cells (Novagen), and purified using Ni-NTA agarose (Qiagen).

Article Title: Identification and evolution of fungal mitochondrial tyrosyl-tRNA synthetases with group I intron splicing activity
Article Snippet: Paragraph title: Cloning, Expression, and Purification of Fungal mtTyrRSs. ... Proteins were expressed via autoinduction ( ) in either E. coli BL21(DE3) (CYT-18, An mtTyrRS) or Rosetta2(DE3) (Novagen; Cp mtTyrRS, Hc mtTyrRS, and Sc mtTyrRS).

Article Title: The primase domain of PfPrex is a proteolytically matured, essential enzyme of the apicoplast
Article Snippet: .. Expression plasmids were transformed into the Rosetta2(DE3)pLysS strain of E. coli (Novagen). .. Significant quantities of soluble protein expression were only obtained by a multiple step induction process.

Article Title: Recognition of siRNA asymmetry by TAR RNA binding protein (TRBP)
Article Snippet: Paragraph title: Protein expression and purification ... Briefly, plasmids were transformed into Rosetta2(DE3) competent cells (Novagen).

Bradford Assay:

Article Title: Identification of a starter unit acyl-carrier protein transacylase domain in an iterative type I polyketide synthase
Article Snippet: SAT and SAT-C117A were expressed for 12 h at 20°C in Rosetta2(DE3) E. coli cells (Novagen) harboring pENTC3 and pENT-C117A, respectively. .. Protein concentrations were determined in triplicate with the Bradford assay (Bio-Rad, Hercules, CA) with bovine albumin as a standard.

Modification:

Article Title: Mechanisms governing the pioneering and redistribution capabilities of the non-classical pioneer PU.1
Article Snippet: The sequence of the full-length hPU.1 was amplified by PCR from pORF9-hSPI1 (InvivoGen) and recombined into a modified pDM8 vector, encoding an N-terminal His-tag, using the Gateway technology (Life Technologies). .. The protein was expressed in Rosetta2(DE)pLysS (Novagen) and purified by Nickel affinity chromatography (Qiagen) as described above.

Transformation Assay:

Article Title: Cell-type–restricted anti-cytokine therapy: TNF inhibition from one pathogenic source
Article Snippet: Expression vectors carrying MYSTI-1 and STI-1 genes were used to transform Rosetta2( DE3 )pLysS cells (Novagen). .. Best producers were selected from transformed clones by colony blot procedure using HisProbe-HRP Conjugate (Pierce, 15165).

Article Title: The primase domain of PfPrex is a proteolytically matured, essential enzyme of the apicoplast
Article Snippet: .. Expression plasmids were transformed into the Rosetta2(DE3)pLysS strain of E. coli (Novagen). .. Significant quantities of soluble protein expression were only obtained by a multiple step induction process.

Article Title: Phosphatidic acid sequesters Sec18p from cis-SNARE complexes to inhibit priming
Article Snippet: .. Three liters of Rosetta2(DE3)pLysS (EMD Millipore) cells transformed with pSP1 were grown in auto-inducing media supplemented with 2 mM MgSO4 at 37°C to an OD600 of 4.0, and cells were harvested by centrifugation ( ). .. Cells were lysed by freeze-thaw and sonication in buffer containing 50 mM Tris-HCl, pH 7.5, 300 mM NaCl, 2 mM MgCl2 , 10 mM imidazole, and 1mM phenylmethanesulfonyl fluoride (PMSF).

Article Title: A potential structural switch for regulating DNA-binding by TEAD transcription factors
Article Snippet: .. [ ] Overexpression and protein purification were carried out as follows: Plasmid was transformed into CodonPlus Escherichia coli cells (Novagen, San Diego, CA) or Rosetta2(DE3)pLysS (EMD Millipore, MA) and grown in 2xYT medium (unlabeled) or M9 medium. .. Each 2.8L baffled flask containing 650 mL of medium was inoculated with 6.5 mL of overnight culture, grown with shaking at 220 rpm until the optical density measured at 600 nm was near 1.0.

Article Title: Recognition of siRNA asymmetry by TAR RNA binding protein (TRBP)
Article Snippet: .. Briefly, plasmids were transformed into Rosetta2(DE3) competent cells (Novagen). ..

Over Expression:

Article Title: Novel Enzyme Family Found in Filamentous Fungi Catalyzing trans-4-Hydroxylation of l-Pipecolic Acid
Article Snippet: .. Escherichia coli JM109 and Rosetta2(DE3) (Novagen, WI, USA) were used as host strains for the overexpression of the recombinant enzymes and cultured at 28°C in LB medium, comprised of 1% (wt/vol) tryptone, 0.5% (wt/vol) yeast extract, and 1% (wt/vol) NaCl, with the addition of appropriate antibiotics. .. Amino acids were derivatized using an AccQ-Tag derivatization kit (Waters, MA, USA) according to the manufacturer's instructions and analyzed with an Alliance 2695 high-performance liquid chromatography (HPLC) system (Waters).

Article Title: A potential structural switch for regulating DNA-binding by TEAD transcription factors
Article Snippet: .. [ ] Overexpression and protein purification were carried out as follows: Plasmid was transformed into CodonPlus Escherichia coli cells (Novagen, San Diego, CA) or Rosetta2(DE3)pLysS (EMD Millipore, MA) and grown in 2xYT medium (unlabeled) or M9 medium. .. Each 2.8L baffled flask containing 650 mL of medium was inoculated with 6.5 mL of overnight culture, grown with shaking at 220 rpm until the optical density measured at 600 nm was near 1.0.

Cell Culture:

Article Title: Novel Enzyme Family Found in Filamentous Fungi Catalyzing trans-4-Hydroxylation of l-Pipecolic Acid
Article Snippet: .. Escherichia coli JM109 and Rosetta2(DE3) (Novagen, WI, USA) were used as host strains for the overexpression of the recombinant enzymes and cultured at 28°C in LB medium, comprised of 1% (wt/vol) tryptone, 0.5% (wt/vol) yeast extract, and 1% (wt/vol) NaCl, with the addition of appropriate antibiotics. .. Amino acids were derivatized using an AccQ-Tag derivatization kit (Waters, MA, USA) according to the manufacturer's instructions and analyzed with an Alliance 2695 high-performance liquid chromatography (HPLC) system (Waters).

Generated:

Article Title: A potential structural switch for regulating DNA-binding by TEAD transcription factors
Article Snippet: The ΔL1 TEAD DBD construct was generated using the QuikChange method (Stratagene, La Jolla, CA) starting with hTEAD1 DBD in pET21d. .. [ ] Overexpression and protein purification were carried out as follows: Plasmid was transformed into CodonPlus Escherichia coli cells (Novagen, San Diego, CA) or Rosetta2(DE3)pLysS (EMD Millipore, MA) and grown in 2xYT medium (unlabeled) or M9 medium.

Polymerase Chain Reaction:

Article Title: The primase domain of PfPrex is a proteolytically matured, essential enzyme of the apicoplast
Article Snippet: Sequences coding for PfPrex’s TOPRIM domain alone (residues 336–465) or complete primase domain (comprised of its Zinc-Binding and TOPRIM domains, residues 115–465; ) were PCR amplified from P. falciparum 3D7 genomic DNA, inserted between the NdeI and XhoI sites of pET28b+ (Novagen) and confirmed by sequencing. .. Expression plasmids were transformed into the Rosetta2(DE3)pLysS strain of E. coli (Novagen).

Article Title: Phosphatidic acid sequesters Sec18p from cis-SNARE complexes to inhibit priming
Article Snippet: The PAH1 gene was cloned from BJ3505 genomic DNA via PCR amplification using the primers: Forward 5’ – TACTTCCAATCCAATGCAATGCAGTACGTAGGAA – 3’ and Reverse 5’ – TTATCCACTTCCAATGTTATTATTAATCTTCGAATTCATCTTCG – 3’. .. Three liters of Rosetta2(DE3)pLysS (EMD Millipore) cells transformed with pSP1 were grown in auto-inducing media supplemented with 2 mM MgSO4 at 37°C to an OD600 of 4.0, and cells were harvested by centrifugation ( ).

Article Title: Mechanisms governing the pioneering and redistribution capabilities of the non-classical pioneer PU.1
Article Snippet: The sequence of the full-length hPU.1 was amplified by PCR from pORF9-hSPI1 (InvivoGen) and recombined into a modified pDM8 vector, encoding an N-terminal His-tag, using the Gateway technology (Life Technologies). .. The protein was expressed in Rosetta2(DE)pLysS (Novagen) and purified by Nickel affinity chromatography (Qiagen) as described above.

Sonication:

Article Title: Structural studies on KijD1, a sugar C‐3′‐methyltransferase
Article Snippet: The pET28t‐ kijD1 plasmid was used to transform Rosetta2(DE3) E. coli cells (Novagen). .. The flasks were cooled in an ice bath, and the cells were induced with 1 mM IPTG and allowed to express protein at 20°C for 24 h. The cells were harvested by centrifugation and disrupted by sonication on ice.

Article Title: The structure of RbmB from Streptomyces ribosidificus, an aminotransferase involved in the biosynthesis of ribostamycin
Article Snippet: The pET28t‐ rbmB or pET28t‐ btrR plasmids were used to transform Rosetta2(DE3) E. coli cells (Novagen). .. The flasks were cooled in an ice bath, and the cells were induced with 1 m M isopropyl β‐ d ‐1‐thiogalactopyranoside and allowed to express protein at 21°C for 24 h. The cells were harvested by centrifugation and disrupted by sonication on ice.

Article Title: Phosphatidic acid sequesters Sec18p from cis-SNARE complexes to inhibit priming
Article Snippet: Three liters of Rosetta2(DE3)pLysS (EMD Millipore) cells transformed with pSP1 were grown in auto-inducing media supplemented with 2 mM MgSO4 at 37°C to an OD600 of 4.0, and cells were harvested by centrifugation ( ). .. Cells were lysed by freeze-thaw and sonication in buffer containing 50 mM Tris-HCl, pH 7.5, 300 mM NaCl, 2 mM MgCl2 , 10 mM imidazole, and 1mM phenylmethanesulfonyl fluoride (PMSF).

Article Title: Recognition of siRNA asymmetry by TAR RNA binding protein (TRBP)
Article Snippet: Briefly, plasmids were transformed into Rosetta2(DE3) competent cells (Novagen). .. After 2 hrs of expression at 37°C, cells were pelleted (4000 rpm for 10 min), resuspended in Column Buffer (20 mM Tris-HCl, 200 mM NaCl, 1 mM EDTA), lysed via sonication, and then clarified by high speed centrifugation (15,000 rpm for 25 min).

Injection:

Article Title: Phosphatidic acid sequesters Sec18p from cis-SNARE complexes to inhibit priming
Article Snippet: Sec18p elutes from the column as three distinct peaks: the hexameric pool with a molecular mass of 640 kDa elutes early (approximately 50 ml post injection), and dimer and monomeric pools each elute later (approximately 90 and 105 ml post-injection, respectively). .. Three liters of Rosetta2(DE3)pLysS (EMD Millipore) cells transformed with pSP1 were grown in auto-inducing media supplemented with 2 mM MgSO4 at 37°C to an OD600 of 4.0, and cells were harvested by centrifugation ( ).

Recombinant:

Article Title: The structure of RbmB from Streptomyces ribosidificus, an aminotransferase involved in the biosynthesis of ribostamycin
Article Snippet: The pET28t‐ rbmB or pET28t‐ btrR plasmids were used to transform Rosetta2(DE3) E. coli cells (Novagen). .. The lysate was cleared by centrifugation, and the recombinant proteins were purified utilizing nickel nitrilotriacetic acid resin (Qiagen) according to the manufacturer's instructions.

Article Title: Novel Enzyme Family Found in Filamentous Fungi Catalyzing trans-4-Hydroxylation of l-Pipecolic Acid
Article Snippet: .. Escherichia coli JM109 and Rosetta2(DE3) (Novagen, WI, USA) were used as host strains for the overexpression of the recombinant enzymes and cultured at 28°C in LB medium, comprised of 1% (wt/vol) tryptone, 0.5% (wt/vol) yeast extract, and 1% (wt/vol) NaCl, with the addition of appropriate antibiotics. .. Amino acids were derivatized using an AccQ-Tag derivatization kit (Waters, MA, USA) according to the manufacturer's instructions and analyzed with an Alliance 2695 high-performance liquid chromatography (HPLC) system (Waters).

Article Title: Phosphatidic acid sequesters Sec18p from cis-SNARE complexes to inhibit priming
Article Snippet: Paragraph title: Recombinant proteins ... Three liters of Rosetta2(DE3)pLysS (EMD Millipore) cells transformed with pSP1 were grown in auto-inducing media supplemented with 2 mM MgSO4 at 37°C to an OD600 of 4.0, and cells were harvested by centrifugation ( ).

Article Title: Mechanisms governing the pioneering and redistribution capabilities of the non-classical pioneer PU.1
Article Snippet: In brief, binding assays were performed using annealed oligonucleotides (Cy3-labeled on one strand, listed in Supplementary Table ) and recombinant full-length PU.1 on the Nanotemper Monolith NT.115 device. .. The protein was expressed in Rosetta2(DE)pLysS (Novagen) and purified by Nickel affinity chromatography (Qiagen) as described above.

Molecular Weight:

Article Title: A potential structural switch for regulating DNA-binding by TEAD transcription factors
Article Snippet: [ ] The resulting protein consists of a truncated L1 loop and is lacks amino acids Pro26 to Arg37 relative to the original TEAD DBD (calculated molecular weight of 9,371.6 with molar extinction coefficient of 9,970 M−1 cm−1 ). .. [ ] Overexpression and protein purification were carried out as follows: Plasmid was transformed into CodonPlus Escherichia coli cells (Novagen, San Diego, CA) or Rosetta2(DE3)pLysS (EMD Millipore, MA) and grown in 2xYT medium (unlabeled) or M9 medium.

Methylation:

Article Title: Mechanisms governing the pioneering and redistribution capabilities of the non-classical pioneer PU.1
Article Snippet: The protein was expressed in Rosetta2(DE)pLysS (Novagen) and purified by Nickel affinity chromatography (Qiagen) as described above. .. Analyzed oligomers were synthesized with Cy3-labeled, with either a methylated or hydroxyl-methylated CpG-site (5mC/5hmC), or as unmodified DNA oligomers (Sigma).

Mutagenesis:

Article Title: The human CTF4-orthologue AND-1 interacts with DNA polymerase α/primase via its unique C-terminal HMG box
Article Snippet: Point mutations (I14A, F15A, I46A, A47E) were introduced into the B (1–78; BNT ) construct by site-directed mutagenesis. .. His6 -GST-tagged proteins were expressed in Rosetta2(DE3) cells (Novagen), and purified using Ni-NTA agarose (Qiagen).

Isolation:

Article Title: Novel Enzyme Family Found in Filamentous Fungi Catalyzing trans-4-Hydroxylation of l-Pipecolic Acid
Article Snippet: Microorganisms isolated from soil and plant samples were cultured in GP medium comprised of 0.15% (wt/vol) KH2 PO4 , 0.05% (wt/vol) K2 HPO4 , 0.1% (wt/vol) NH4 Cl, 0.03% (wt/vol) MgSO4 ·7H2 O, 0.01% (wt/vol) yeast extract, 0.025% (wt/vol) glucose, and 0.1% (wt/vol) l -Pip (pH 7.0) and grown at 28°C with shaking. .. Escherichia coli JM109 and Rosetta2(DE3) (Novagen, WI, USA) were used as host strains for the overexpression of the recombinant enzymes and cultured at 28°C in LB medium, comprised of 1% (wt/vol) tryptone, 0.5% (wt/vol) yeast extract, and 1% (wt/vol) NaCl, with the addition of appropriate antibiotics.

Size-exclusion Chromatography:

Article Title: The human CTF4-orthologue AND-1 interacts with DNA polymerase α/primase via its unique C-terminal HMG box
Article Snippet: The point mutants were confirmed folded by cleaving the His6 -MBP tag overnight with TEV protease, followed by Ni-NTA agarose recapture of the His6 -MBP tag and subsequent size-exclusion chromatography of the AND-1 HMG constructs using a Superdex 75 10/300 GL column (GE Healthcare) in PBS buffer. .. His6 -GST-tagged proteins were expressed in Rosetta2(DE3) cells (Novagen), and purified using Ni-NTA agarose (Qiagen).

Purification:

Article Title: Identification of a starter unit acyl-carrier protein transacylase domain in an iterative type I polyketide synthase
Article Snippet: Paragraph title: Expression and Purification of SAT/SAT-C117A. ... SAT and SAT-C117A were expressed for 12 h at 20°C in Rosetta2(DE3) E. coli cells (Novagen) harboring pENTC3 and pENT-C117A, respectively.

Article Title: Structural studies on KijD1, a sugar C‐3′‐methyltransferase
Article Snippet: Paragraph title: Protein expression and purification ... The pET28t‐ kijD1 plasmid was used to transform Rosetta2(DE3) E. coli cells (Novagen).

Article Title: The structure of RbmB from Streptomyces ribosidificus, an aminotransferase involved in the biosynthesis of ribostamycin
Article Snippet: Paragraph title: Protein expression and purification ... The pET28t‐ rbmB or pET28t‐ btrR plasmids were used to transform Rosetta2(DE3) E. coli cells (Novagen).

Article Title: The human CTF4-orthologue AND-1 interacts with DNA polymerase α/primase via its unique C-terminal HMG box
Article Snippet: .. His6 -GST-tagged proteins were expressed in Rosetta2(DE3) cells (Novagen), and purified using Ni-NTA agarose (Qiagen). .. These mutants were confirmed folded by cleaving the His6 -GST tag overnight with thrombin protease (50 units, Sigma Aldrich), followed by Ni-NTA recapture of the His6 -GST tag and subsequent size-exclusion chromatography of the BNTD on a Superdex 75 10/300 GL column (GE Healthcare) in PBS buffer.

Article Title: Identification and evolution of fungal mitochondrial tyrosyl-tRNA synthetases with group I intron splicing activity
Article Snippet: Paragraph title: Cloning, Expression, and Purification of Fungal mtTyrRSs. ... Proteins were expressed via autoinduction ( ) in either E. coli BL21(DE3) (CYT-18, An mtTyrRS) or Rosetta2(DE3) (Novagen; Cp mtTyrRS, Hc mtTyrRS, and Sc mtTyrRS).

Article Title: The primase domain of PfPrex is a proteolytically matured, essential enzyme of the apicoplast
Article Snippet: Paragraph title: 2.1 Bacterial expression and purification of PfPrex primase derivatives ... Expression plasmids were transformed into the Rosetta2(DE3)pLysS strain of E. coli (Novagen).

Article Title: Mechanisms governing the pioneering and redistribution capabilities of the non-classical pioneer PU.1
Article Snippet: .. The protein was expressed in Rosetta2(DE)pLysS (Novagen) and purified by Nickel affinity chromatography (Qiagen) as described above. .. Analyzed oligomers were synthesized with Cy3-labeled, with either a methylated or hydroxyl-methylated CpG-site (5mC/5hmC), or as unmodified DNA oligomers (Sigma).

Article Title: Recognition of siRNA asymmetry by TAR RNA binding protein (TRBP)
Article Snippet: Paragraph title: Protein expression and purification ... Briefly, plasmids were transformed into Rosetta2(DE3) competent cells (Novagen).

Protein Purification:

Article Title: A potential structural switch for regulating DNA-binding by TEAD transcription factors
Article Snippet: .. [ ] Overexpression and protein purification were carried out as follows: Plasmid was transformed into CodonPlus Escherichia coli cells (Novagen, San Diego, CA) or Rosetta2(DE3)pLysS (EMD Millipore, MA) and grown in 2xYT medium (unlabeled) or M9 medium. .. Each 2.8L baffled flask containing 650 mL of medium was inoculated with 6.5 mL of overnight culture, grown with shaking at 220 rpm until the optical density measured at 600 nm was near 1.0.

Sequencing:

Article Title: Cell-type–restricted anti-cytokine therapy: TNF inhibition from one pathogenic source
Article Snippet: As a result, STI-1 had the same nucleotide and amino acid sequence as MYSTI-1, except that all six of its CDRs in the anti-F4/80 scFv portion were substituted by (Gly4 Ser)n insertions of the same length as the original CDR nucleotide sequence. .. Expression vectors carrying MYSTI-1 and STI-1 genes were used to transform Rosetta2( DE3 )pLysS cells (Novagen).

Article Title: The primase domain of PfPrex is a proteolytically matured, essential enzyme of the apicoplast
Article Snippet: Sequences coding for PfPrex’s TOPRIM domain alone (residues 336–465) or complete primase domain (comprised of its Zinc-Binding and TOPRIM domains, residues 115–465; ) were PCR amplified from P. falciparum 3D7 genomic DNA, inserted between the NdeI and XhoI sites of pET28b+ (Novagen) and confirmed by sequencing. .. Expression plasmids were transformed into the Rosetta2(DE3)pLysS strain of E. coli (Novagen).

Article Title: Mechanisms governing the pioneering and redistribution capabilities of the non-classical pioneer PU.1
Article Snippet: The sequence of the full-length hPU.1 was amplified by PCR from pORF9-hSPI1 (InvivoGen) and recombined into a modified pDM8 vector, encoding an N-terminal His-tag, using the Gateway technology (Life Technologies). .. The protein was expressed in Rosetta2(DE)pLysS (Novagen) and purified by Nickel affinity chromatography (Qiagen) as described above.

Affinity Chromatography:

Article Title: Mechanisms governing the pioneering and redistribution capabilities of the non-classical pioneer PU.1
Article Snippet: .. The protein was expressed in Rosetta2(DE)pLysS (Novagen) and purified by Nickel affinity chromatography (Qiagen) as described above. .. Analyzed oligomers were synthesized with Cy3-labeled, with either a methylated or hydroxyl-methylated CpG-site (5mC/5hmC), or as unmodified DNA oligomers (Sigma).

Fast Protein Liquid Chromatography:

Article Title: Recognition of siRNA asymmetry by TAR RNA binding protein (TRBP)
Article Snippet: Briefly, plasmids were transformed into Rosetta2(DE3) competent cells (Novagen). .. The supernatant was purified with an AKTA FPLC (GE Healthcare).

Plasmid Preparation:

Article Title: Structural studies on KijD1, a sugar C‐3′‐methyltransferase
Article Snippet: .. The pET28t‐ kijD1 plasmid was used to transform Rosetta2(DE3) E. coli cells (Novagen). ..

Article Title: Cell-type–restricted anti-cytokine therapy: TNF inhibition from one pathogenic source
Article Snippet: NcoI and XhoI restriction sites were included in forward and reverse primer sequences, respectively, so that, when cloned to expression vector pET-28b (Novagen), the C-terminal 6XHis tag sequence was in the same reading frame as the rest of the cDNA. .. Expression vectors carrying MYSTI-1 and STI-1 genes were used to transform Rosetta2( DE3 )pLysS cells (Novagen).

Article Title: The human CTF4-orthologue AND-1 interacts with DNA polymerase α/primase via its unique C-terminal HMG box
Article Snippet: B subunit N-terminal constructs (1–78, 1–104 and 1–156) were cloned into the pGAT2 vector [ ]. .. His6 -GST-tagged proteins were expressed in Rosetta2(DE3) cells (Novagen), and purified using Ni-NTA agarose (Qiagen).

Article Title: Identification and evolution of fungal mitochondrial tyrosyl-tRNA synthetases with group I intron splicing activity
Article Snippet: The An and Sc mtTyrRSs, the latter with an N-terminal hexahistidine tag that could be cleaved by tobacco etch virus (TEV) protease, were cloned into expression vector pET11d (Novagen). .. Proteins were expressed via autoinduction ( ) in either E. coli BL21(DE3) (CYT-18, An mtTyrRS) or Rosetta2(DE3) (Novagen; Cp mtTyrRS, Hc mtTyrRS, and Sc mtTyrRS).

Article Title: Phosphatidic acid sequesters Sec18p from cis-SNARE complexes to inhibit priming
Article Snippet: The amplified gene was inserted into pET His6 Sumo TEV LIC cloning vector (2S-T) (Addgene plasmid #29711) using the restriction enzyme SspI and the LIC method previously described to create the plasmid pSP1 ( ). .. Three liters of Rosetta2(DE3)pLysS (EMD Millipore) cells transformed with pSP1 were grown in auto-inducing media supplemented with 2 mM MgSO4 at 37°C to an OD600 of 4.0, and cells were harvested by centrifugation ( ).

Article Title: A potential structural switch for regulating DNA-binding by TEAD transcription factors
Article Snippet: .. [ ] Overexpression and protein purification were carried out as follows: Plasmid was transformed into CodonPlus Escherichia coli cells (Novagen, San Diego, CA) or Rosetta2(DE3)pLysS (EMD Millipore, MA) and grown in 2xYT medium (unlabeled) or M9 medium. .. Each 2.8L baffled flask containing 650 mL of medium was inoculated with 6.5 mL of overnight culture, grown with shaking at 220 rpm until the optical density measured at 600 nm was near 1.0.

Article Title: Mechanisms governing the pioneering and redistribution capabilities of the non-classical pioneer PU.1
Article Snippet: The sequence of the full-length hPU.1 was amplified by PCR from pORF9-hSPI1 (InvivoGen) and recombined into a modified pDM8 vector, encoding an N-terminal His-tag, using the Gateway technology (Life Technologies). .. The protein was expressed in Rosetta2(DE)pLysS (Novagen) and purified by Nickel affinity chromatography (Qiagen) as described above.

Software:

Article Title: Mechanisms governing the pioneering and redistribution capabilities of the non-classical pioneer PU.1
Article Snippet: The protein was expressed in Rosetta2(DE)pLysS (Novagen) and purified by Nickel affinity chromatography (Qiagen) as described above. .. Data analysis was done using the NT-analysis acquisition software (1.2.229).

Binding Assay:

Article Title: Mechanisms governing the pioneering and redistribution capabilities of the non-classical pioneer PU.1
Article Snippet: In brief, binding assays were performed using annealed oligonucleotides (Cy3-labeled on one strand, listed in Supplementary Table ) and recombinant full-length PU.1 on the Nanotemper Monolith NT.115 device. .. The protein was expressed in Rosetta2(DE)pLysS (Novagen) and purified by Nickel affinity chromatography (Qiagen) as described above.

Article Title: Recognition of siRNA asymmetry by TAR RNA binding protein (TRBP)
Article Snippet: Plasmids encoding TRBP as a fusion product with maltose binding protein (MBP-TRBP) and MBP alone were kindly provided by Professor Anne Gatignol and expressed essentially as described ( ). .. Briefly, plasmids were transformed into Rosetta2(DE3) competent cells (Novagen).

Sample Prep:

Article Title: A potential structural switch for regulating DNA-binding by TEAD transcription factors
Article Snippet: Paragraph title: Sample Preparation ... [ ] Overexpression and protein purification were carried out as follows: Plasmid was transformed into CodonPlus Escherichia coli cells (Novagen, San Diego, CA) or Rosetta2(DE3)pLysS (EMD Millipore, MA) and grown in 2xYT medium (unlabeled) or M9 medium.

Microscale Thermophoresis:

Article Title: Mechanisms governing the pioneering and redistribution capabilities of the non-classical pioneer PU.1
Article Snippet: Paragraph title: Microscale thermophoresis measurements ... The protein was expressed in Rosetta2(DE)pLysS (Novagen) and purified by Nickel affinity chromatography (Qiagen) as described above.

Concentration Assay:

Article Title: Mechanisms governing the pioneering and redistribution capabilities of the non-classical pioneer PU.1
Article Snippet: The protein was expressed in Rosetta2(DE)pLysS (Novagen) and purified by Nickel affinity chromatography (Qiagen) as described above. .. For each motif, two independent sets of 16 affinity measurement reactions were prepared using a dilution series of PU.1 protein where the concentration of the double-stranded oligonucleotide was kept constant (50 nM).

Lysis:

Article Title: Cell-type–restricted anti-cytokine therapy: TNF inhibition from one pathogenic source
Article Snippet: Expression vectors carrying MYSTI-1 and STI-1 genes were used to transform Rosetta2( DE3 )pLysS cells (Novagen). .. After 4 h of induction, cultures were centrifuged at 3,200 × g for 30 min. Pellets were frozen and later resuspended in lysis buffer [50 mM Tris⋅HCl, 300 mM NaCl, 5% (vol/vol) glycerol, 0.5% Triton X-100, 10,000 U/mL lysozyme, 10 mM β-mercaptoethanol] and disrupted by ultrasound.

Article Title: Phosphatidic acid sequesters Sec18p from cis-SNARE complexes to inhibit priming
Article Snippet: Three liters of Rosetta2(DE3)pLysS (EMD Millipore) cells transformed with pSP1 were grown in auto-inducing media supplemented with 2 mM MgSO4 at 37°C to an OD600 of 4.0, and cells were harvested by centrifugation ( ). .. The resin was washed with lysis buffer supplemented with 25 mM imidazole and 0.5 mM ATP, and bound proteins were eluted with lysis buffer supplemented with 300 mM imidazole.

Positron Emission Tomography:

Article Title: Cell-type–restricted anti-cytokine therapy: TNF inhibition from one pathogenic source
Article Snippet: NcoI and XhoI restriction sites were included in forward and reverse primer sequences, respectively, so that, when cloned to expression vector pET-28b (Novagen), the C-terminal 6XHis tag sequence was in the same reading frame as the rest of the cDNA. .. Expression vectors carrying MYSTI-1 and STI-1 genes were used to transform Rosetta2( DE3 )pLysS cells (Novagen).

Article Title: Phosphatidic acid sequesters Sec18p from cis-SNARE complexes to inhibit priming
Article Snippet: The amplified gene was inserted into pET His6 Sumo TEV LIC cloning vector (2S-T) (Addgene plasmid #29711) using the restriction enzyme SspI and the LIC method previously described to create the plasmid pSP1 ( ). .. Three liters of Rosetta2(DE3)pLysS (EMD Millipore) cells transformed with pSP1 were grown in auto-inducing media supplemented with 2 mM MgSO4 at 37°C to an OD600 of 4.0, and cells were harvested by centrifugation ( ).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Millipore rosetta2
    Rosetta2, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 111 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rosetta2/product/Millipore
    Average 99 stars, based on 111 article reviews
    Price from $9.99 to $1999.99
    rosetta2 - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    94
    Millipore e coli rosetta2 de3 cells
    E Coli Rosetta2 De3 Cells, supplied by Millipore, used in various techniques. Bioz Stars score: 94/100, based on 19 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e coli rosetta2 de3 cells/product/Millipore
    Average 94 stars, based on 19 article reviews
    Price from $9.99 to $1999.99
    e coli rosetta2 de3 cells - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    Image Search Results