rneasy qiagen kit  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    RNeasy Plus Mini Kit
    Description:
    For phenol-free total RNA extraction from cells/tissues with removal of genomic DNA contamination. Kit contents: Qiagen RNeasy Plus Mini Kit, 50 preps, 30mg Sample, 30 to 50L Elution Volume, Tissue, Cells Sample, Total RNA Purification, Silica Technology, Spin Column Format, 25 min. Time/Run, Ideal for PCR, Northern, Dot and Slot Blotting, Array Analysis, Sequencing, For Purification of Up to 100g Total RNA from Cells/tissues Using gDNA Eliminator Columns, Includes RNeasy Mini Spin Columns, gDNA Eliminator Spin Columns, Collection Tubes, RNase-free Water and Buffers. Benefits: Efficient gDNA removal with unique gDNA Eliminator columns (no need for DNase). High-quality total RNA in minutes using fast and simple extraction protocols. Phenol-free RNA isolation. Ideal for sensitive applications such as real-time RT-PCR and RNA-Seq
    Catalog Number:
    74134
    Price:
    None
    Category:
    RNeasy Plus Micro and Mini Kits
    Score:
    85
    Buy from Supplier


    Structured Review

    Qiagen rneasy qiagen kit
    RNeasy Plus Mini Kit
    For phenol-free total RNA extraction from cells/tissues with removal of genomic DNA contamination. Kit contents: Qiagen RNeasy Plus Mini Kit, 50 preps, 30mg Sample, 30 to 50L Elution Volume, Tissue, Cells Sample, Total RNA Purification, Silica Technology, Spin Column Format, 25 min. Time/Run, Ideal for PCR, Northern, Dot and Slot Blotting, Array Analysis, Sequencing, For Purification of Up to 100g Total RNA from Cells/tissues Using gDNA Eliminator Columns, Includes RNeasy Mini Spin Columns, gDNA Eliminator Spin Columns, Collection Tubes, RNase-free Water and Buffers. Benefits: Efficient gDNA removal with unique gDNA Eliminator columns (no need for DNase). High-quality total RNA in minutes using fast and simple extraction protocols. Phenol-free RNA isolation. Ideal for sensitive applications such as real-time RT-PCR and RNA-Seq
    https://www.bioz.com/result/rneasy qiagen kit/product/Qiagen
    Average 99 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    rneasy qiagen kit - by Bioz Stars, 2019-10
    99/100 stars

    Images

    Related Articles

    Amplification:

    Article Title: Octopamine and tyramine respectively regulate attractive and repulsive behavior in locust phase changes
    Article Snippet: Total RNA was extracted from brain tissues following the protocol of RNA easy mini kit (Qiagen). .. Total RNA was extracted from brain tissues following the protocol of RNA easy mini kit (Qiagen).

    Article Title: Melanocortin receptor agonists MCR1‐5 protect photoreceptors from high‐glucose damage and restore antioxidant enzymes in primary retinal cell culture
    Article Snippet: Total RNA was extracted using RNeasy Plus Mini Kit (Qiagen, West Sussex, UK), according to the manufacturer's instructions. .. Total RNA was extracted using RNeasy Plus Mini Kit (Qiagen, West Sussex, UK), according to the manufacturer's instructions.

    Article Title: The Human NADPH Oxidase, Nox4, Regulates Cytoskeletal Organization in Two Cancer Cell Lines, HepG2 and SH-SY5Y
    Article Snippet: Total RNA was isolated using RNeasy Mini kits (Qiagen) and digested with DNaseI (Promega). .. Reverse transcription polymerase chain reaction was performed using the SuperScriptII reverse transcription kit (ThermoScientific) and random hexamer primers (ThermoScientific) followed by IQ SYBR Green (Bio-Rad Laboratories) real-time (RT) PCR analyses on the iQ Multi-Color real time PCR detector (Bio-Rad Laboratories).

    Synthesized:

    Article Title: “Inflamm‐aging” influences immune cell survival factors in human bone marrow
    Article Snippet: RNA was isolated from purified BMMCs using the RNeasy Plus mini kit (Qiagen). .. First‐strand cDNA synthesis was performed using a Reverse Transcription system (Promega). qRT‐PCR experiments were performed using the LightCycler 480 System (Roche Diagnostics), 2X SYBR Green 1 Master (Roche Diagnostics), and β‐actin as housekeeping gene for relative quantification of effector/memory cell survival factors.

    Cytometry:

    Article Title: Neutrophil stunning by metoprolol reduces infarct size
    Article Snippet: Before RNA isolation, neutrophil identity was confirmed by flow cytometry (anti-1A8 Ly6G) and viability evaluated. .. Total RNA from whole hearts, BM and purified neutrophils samples was isolated with the Qiagen RNeasy Plus Mini Kit.

    Quantitative RT-PCR:

    Article Title: Octopamine and tyramine respectively regulate attractive and repulsive behavior in locust phase changes
    Article Snippet: Paragraph title: RNA preparation and qRT-PCR assay ... Total RNA was extracted from brain tissues following the protocol of RNA easy mini kit (Qiagen).

    Article Title: Ribonuclease L mediates the cell-lethal phenotype of double-stranded RNA editing enzyme ADAR1 deficiency in a human cell line
    Article Snippet: Paragraph title: mRNA quantification by quantitative reverse transcriptase-PCR (qRT-PCR) ... Cells were treated with 10 U/ml of IFN-α (PBL) and 24 hr post treatment, cells were lysed in RLT Plus RNA lysis buffer (Qiagen), and RNA was isolated using the RNeasy Plus Mini Kit (Qiagen) as previously described ( ).

    Article Title: “Inflamm‐aging” influences immune cell survival factors in human bone marrow
    Article Snippet: Paragraph title: Isolation of RNA and quantitative RT‐PCR ... RNA was isolated from purified BMMCs using the RNeasy Plus mini kit (Qiagen).

    Article Title: De novo assembly and comparative transcriptome analysis of the foot from Chinese green mussel (Perna viridis) in response to cadmium stimulation
    Article Snippet: Paragraph title: Validation of the RNA-seq analyses by qRT-PCR ... Total RNAs from the foot gland samples were extracted and purified by RNeasy Animal Mini Kit (Qiagen, Valencia, CA).

    Article Title: Nox2 contributes to hyperinsulinemia-induced redox imbalance and impaired vascular function
    Article Snippet: 2.7 Total RNA was extracted using RNeasy mini kits (Qiagen, Germantown, MD). .. 2.7 Total RNA was extracted using RNeasy mini kits (Qiagen, Germantown, MD).

    Article Title: Sensitive detection of viable circulating tumor cells using a novel conditionally telomerase-selective replicating adenovirus in non-small cell lung cancer patients
    Article Snippet: Fixed cells were analyzed using a MACSQuant® Analyzer (Miltenyi Biotec, Bergisch-Gladbach, Germany) to determine the ratio of GFP+ cells. .. Total RNA was extracted from human NSCLC cell lines using the RNeasy Plus Mini Kit (Cat No. 74134, Qiagen, Venlo, The Netherlands). qRT-PCR was performed using the PrimeScript RT reagent kit (TaKaRa, Shiga, Japan) and SYBR Premix EX Taq II (Tli RNaseH Plus, TaKaRa) on a 7500 Fast real-time PCR system (Applied Biosystems, Foster City, CA). .. The following gene-specific primers were used: hTERT F (5′-CGG AAG AGT GTC TGG AGC AA-3′), R (5′-GGA TGA AGC GGA GTC TGG A-3′), GAPDH F (5′-TCG ACA GTC AGC CGC ATC TTC TTT-3′), R (5′-ACC AAA TCC GTT GAC TCC GAC CTT-3′).

    SYBR Green Assay:

    Article Title: Self-cytoplasmic DNA upregulates the mutator enzyme APOBEC3A leading to chromosomal DNA damage
    Article Snippet: Paragraph title: Real-time PCR and SYBR Green quantitative PCR ... Total RNA was extracted from THP-1 cells using RNeasy Plus Mini Kit (Qiagen) according to the manufacturer's instructions.

    Article Title: Nox2 contributes to hyperinsulinemia-induced redox imbalance and impaired vascular function
    Article Snippet: 2.7 Total RNA was extracted using RNeasy mini kits (Qiagen, Germantown, MD). .. 2.7 Total RNA was extracted using RNeasy mini kits (Qiagen, Germantown, MD).

    Microarray:

    Article Title: JunB is essential for IL-23-dependent pathogenicity of Th17 cells
    Article Snippet: Paragraph title: Microarray analysis ... Total RNA was isolated from cells using an RNeasy Plus Mini Kit (74136, Qiagen).

    Expressing:

    Article Title: Self-cytoplasmic DNA upregulates the mutator enzyme APOBEC3A leading to chromosomal DNA damage
    Article Snippet: Total RNA was extracted from THP-1 cells using RNeasy Plus Mini Kit (Qiagen) according to the manufacturer's instructions. .. Primers and PCR condition were described before ( ).

    Article Title: Octopamine and tyramine respectively regulate attractive and repulsive behavior in locust phase changes
    Article Snippet: Total RNA was extracted from brain tissues following the protocol of RNA easy mini kit (Qiagen). .. The details of reverse transcription and PCR amplification were referred to previous study .

    Article Title: Melanocortin receptor agonists MCR1‐5 protect photoreceptors from high‐glucose damage and restore antioxidant enzymes in primary retinal cell culture
    Article Snippet: Total RNA was extracted using RNeasy Plus Mini Kit (Qiagen, West Sussex, UK), according to the manufacturer's instructions. .. Total RNA was extracted using RNeasy Plus Mini Kit (Qiagen, West Sussex, UK), according to the manufacturer's instructions.

    Article Title: Platelet-rich plasma respectively reduces and promotes adipogenic and myofibroblastic differentiation of human adipose-derived stromal cells via the TGFβ signalling pathway
    Article Snippet: Adipogenic-and myofibroblast-gene expression was performed by quantitative PCR. .. RNAs were purified on RNeasy columns (Qiagen, France).

    Article Title: De novo assembly and comparative transcriptome analysis of the foot from Chinese green mussel (Perna viridis) in response to cadmium stimulation
    Article Snippet: Here, tissue-specific expression patterns of 16 representative candidate byssus protein coding genes associated with stress responses were confirmed. .. Total RNAs from the foot gland samples were extracted and purified by RNeasy Animal Mini Kit (Qiagen, Valencia, CA).

    Article Title: Neutrophil stunning by metoprolol reduces infarct size
    Article Snippet: Paragraph title: Neutrophil purification and Adrb1 expression ... Total RNA from whole hearts, BM and purified neutrophils samples was isolated with the Qiagen RNeasy Plus Mini Kit.

    Article Title: Nox2 contributes to hyperinsulinemia-induced redox imbalance and impaired vascular function
    Article Snippet: 2.7 Total RNA was extracted using RNeasy mini kits (Qiagen, Germantown, MD). .. 2.7 Total RNA was extracted using RNeasy mini kits (Qiagen, Germantown, MD).

    Article Title: The Human NADPH Oxidase, Nox4, Regulates Cytoskeletal Organization in Two Cancer Cell Lines, HepG2 and SH-SY5Y
    Article Snippet: Paragraph title: Gene Expression Analyses ... Total RNA was isolated using RNeasy Mini kits (Qiagen) and digested with DNaseI (Promega).

    RNA Sequencing Assay:

    Article Title: The lncRNA VELUCT strongly regulates viability of lung cancer cells despite its extremely low abundance
    Article Snippet: RNA was isolated using TRI reagent (Sigma) according to the manufacturer's protocol. .. Whole cell RNA that was used for RNA-seq experiments was isolated using RNeasy Mini columns (Qiagen). .. DNase treatment of RNA was performed with Turbo DNase (Thermo Scientific) with subsequent RNA purification using Phenol:Chloroform:Isoamyl Alcohol (25:24:1 [v/v/v]) (Roth).

    Article Title: Argininosuccinate synthase 1 is an intrinsic Akt repressor transactivated by p53
    Article Snippet: Paragraph title: Mice and x-ray treatment and RNA-seq ... Bone marrow was resolved in RLT Plus reagent provided by the RNeasy Plus Mini Kit (Qiagen) and homogenized using a QIAshredder column (Qiagen).

    Article Title: De novo assembly and comparative transcriptome analysis of the foot from Chinese green mussel (Perna viridis) in response to cadmium stimulation
    Article Snippet: Paragraph title: Validation of the RNA-seq analyses by qRT-PCR ... Total RNAs from the foot gland samples were extracted and purified by RNeasy Animal Mini Kit (Qiagen, Valencia, CA).

    Article Title: The Transcriptional Landscape of p53 Signalling Pathway
    Article Snippet: Paragraph title: RNA Sequencing ... For RNA extraction from bone marrow, we used the RNeasy Plus Mini Kit (QIAGEN).

    Hybridization:

    Article Title: JunB is essential for IL-23-dependent pathogenicity of Th17 cells
    Article Snippet: Total RNA was isolated from cells using an RNeasy Plus Mini Kit (74136, Qiagen). .. Total RNA was isolated from cells using an RNeasy Plus Mini Kit (74136, Qiagen).

    Flow Cytometry:

    Article Title: Neutrophil stunning by metoprolol reduces infarct size
    Article Snippet: Before RNA isolation, neutrophil identity was confirmed by flow cytometry (anti-1A8 Ly6G) and viability evaluated. .. Total RNA from whole hearts, BM and purified neutrophils samples was isolated with the Qiagen RNeasy Plus Mini Kit.

    Light Microscopy:

    Article Title: Platelet-rich plasma respectively reduces and promotes adipogenic and myofibroblastic differentiation of human adipose-derived stromal cells via the TGFβ signalling pathway
    Article Snippet: RNAs were purified on RNeasy columns (Qiagen, France). .. RNAs were purified on RNeasy columns (Qiagen, France).

    Generated:

    Article Title: De novo assembly and comparative transcriptome analysis of the foot from Chinese green mussel (Perna viridis) in response to cadmium stimulation
    Article Snippet: Quantitative real-time PCR (qRT-PCR) was frequently used to confirm the data generated by high-throughput sequencing [ , ]. .. Total RNAs from the foot gland samples were extracted and purified by RNeasy Animal Mini Kit (Qiagen, Valencia, CA).

    Article Title: Neutrophil stunning by metoprolol reduces infarct size
    Article Snippet: Total RNA from whole hearts, BM and purified neutrophils samples was isolated with the Qiagen RNeasy Plus Mini Kit. .. Total RNA from whole hearts, BM and purified neutrophils samples was isolated with the Qiagen RNeasy Plus Mini Kit.

    Polymerase Chain Reaction:

    Article Title: Self-cytoplasmic DNA upregulates the mutator enzyme APOBEC3A leading to chromosomal DNA damage
    Article Snippet: Total RNA was extracted from THP-1 cells using RNeasy Plus Mini Kit (Qiagen) according to the manufacturer's instructions. .. Total RNA was extracted from THP-1 cells using RNeasy Plus Mini Kit (Qiagen) according to the manufacturer's instructions.

    Article Title: Octopamine and tyramine respectively regulate attractive and repulsive behavior in locust phase changes
    Article Snippet: Total RNA was extracted from brain tissues following the protocol of RNA easy mini kit (Qiagen). .. Total RNA was extracted from brain tissues following the protocol of RNA easy mini kit (Qiagen).

    Article Title: Melanocortin receptor agonists MCR1‐5 protect photoreceptors from high‐glucose damage and restore antioxidant enzymes in primary retinal cell culture
    Article Snippet: Total RNA was extracted using RNeasy Plus Mini Kit (Qiagen, West Sussex, UK), according to the manufacturer's instructions. .. Total RNA was extracted using RNeasy Plus Mini Kit (Qiagen, West Sussex, UK), according to the manufacturer's instructions.

    Article Title: Enhanced generation of human induced pluripotent stem cells by ectopic expression of Connexin 45
    Article Snippet: Total RNA was purified with the RNeasy Plus Mini kit (Qiagen) according to the manufacturer’s instructions. .. Total RNA was purified with the RNeasy Plus Mini kit (Qiagen) according to the manufacturer’s instructions.

    Article Title: Argininosuccinate synthase 1 is an intrinsic Akt repressor transactivated by p53
    Article Snippet: Genotypes were confirmed by PCR analysis. .. Bone marrow was resolved in RLT Plus reagent provided by the RNeasy Plus Mini Kit (Qiagen) and homogenized using a QIAshredder column (Qiagen).

    Article Title: Neutrophil stunning by metoprolol reduces infarct size
    Article Snippet: Total RNA from whole hearts, BM and purified neutrophils samples was isolated with the Qiagen RNeasy Plus Mini Kit. .. Total RNA from whole hearts, BM and purified neutrophils samples was isolated with the Qiagen RNeasy Plus Mini Kit.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Melanocortin receptor agonists MCR1‐5 protect photoreceptors from high‐glucose damage and restore antioxidant enzymes in primary retinal cell culture
    Article Snippet: Paragraph title: RT‐PCR ... Total RNA was extracted using RNeasy Plus Mini Kit (Qiagen, West Sussex, UK), according to the manufacturer's instructions.

    Injection:

    Article Title: Neutrophil stunning by metoprolol reduces infarct size
    Article Snippet: Adrb1 expression in circulating neutrophils was examined in blood drawn from wild-type or Adrb1 KO mice 20 min after injection of heparin (50 μl of 50 U per ml). .. Total RNA from whole hearts, BM and purified neutrophils samples was isolated with the Qiagen RNeasy Plus Mini Kit.

    Gene Knockout:

    Article Title: Neutrophil stunning by metoprolol reduces infarct size
    Article Snippet: Adrb1 expression in circulating neutrophils was examined in blood drawn from wild-type or Adrb1 KO mice 20 min after injection of heparin (50 μl of 50 U per ml). .. Total RNA from whole hearts, BM and purified neutrophils samples was isolated with the Qiagen RNeasy Plus Mini Kit.

    Isolation:

    Article Title: Ribonuclease L mediates the cell-lethal phenotype of double-stranded RNA editing enzyme ADAR1 deficiency in a human cell line
    Article Snippet: U6 primers for normalization are 5’ GCTTCGGCAGCACATATACTA 3’ (forward) and 5’ CGAATTTGCGTGTCATCCTTG 3’ (reverse). .. Cells were treated with 10 U/ml of IFN-α (PBL) and 24 hr post treatment, cells were lysed in RLT Plus RNA lysis buffer (Qiagen), and RNA was isolated using the RNeasy Plus Mini Kit (Qiagen) as previously described ( ). .. Relative IFN-α, IFN-λ, OAS2, IFIT2 mRNA expression levels were quantified as ΔCT values relative to actin mRNA [ΔCT = CT (gene of interest) − CT (β-actin) ] and expressed using the formula 2−ΔCT .

    Article Title: MMP9 integrates multiple immunoregulatory pathways that discriminate high suppressive activity of human mesenchymal stem cells
    Article Snippet: Isolated cells were stored in RNAprotect® Cell Reagent (Qiagen, AMBION,USA) at −80 °C, until RNA extraction. .. Genomic DNA-free total RNA was isolated (RNeasy Plus Mini kit, Qiagen, AMBION, USA), following the manufactures’ protocol. .. RNA concentration and integrity were evaluated by NanoDrop-1000 (Thermo Scientific), UV/Vis ratios and agarose gel.

    Article Title: The lncRNA VELUCT strongly regulates viability of lung cancer cells despite its extremely low abundance
    Article Snippet: RNA was isolated using TRI reagent (Sigma) according to the manufacturer's protocol. .. Whole cell RNA that was used for RNA-seq experiments was isolated using RNeasy Mini columns (Qiagen). .. DNase treatment of RNA was performed with Turbo DNase (Thermo Scientific) with subsequent RNA purification using Phenol:Chloroform:Isoamyl Alcohol (25:24:1 [v/v/v]) (Roth).

    Article Title: WRN conditioned media is sufficient for in vitro propagation of intestinal organoids from large farm and small companion animals
    Article Snippet: To determine enteroid expansion during passage, 200 high passage (P > 10) enteroids were seeded in Matrigel matrix to two wells (P1). .. RNA from enteroids, control tissue, and kidney epithelial cells (CRFK and MDBK) was isolated using the RNeasy Plus mini kit (Qiagen) according to the manufacturer's protocol, with DNase treatment (Qiagen) on the tissue controls samples. .. The High Capacity RNA-to-cDNA kit (Thermo Fisher 4387406) was used to obtain cDNA from 500 ng of RNA. qPCR negative controls omitted the RT enzyme. qPCR was performed with the PowerUp™ SYBR™ Green Master Mix (Thermo Fisher A25742) with a final primer concentration of 0.5 µM ( Table S1 ) and 10 ng of cDNA, and run on an Applied Biosystems (ABI) 7900HT Sequence Detection System.

    Article Title: “Inflamm‐aging” influences immune cell survival factors in human bone marrow
    Article Snippet: BM cells were obtained from mice by flushing the femur and tibia with PBS. .. RNA was isolated from purified BMMCs using the RNeasy Plus mini kit (Qiagen). .. First‐strand cDNA synthesis was performed using a Reverse Transcription system (Promega). qRT‐PCR experiments were performed using the LightCycler 480 System (Roche Diagnostics), 2X SYBR Green 1 Master (Roche Diagnostics), and β‐actin as housekeeping gene for relative quantification of effector/memory cell survival factors.

    Article Title: Genome-wide gene expression array identifies novel genes related to disease severity and excessive daytime sleepiness in patients with obstructive sleep apnea
    Article Snippet: The PBMCs were isolated by Ficoll-Hypaque gradient centrifugation (HISTOPAQUE® -119, Sigma-Aldrich, Inc., St. Louis, MO USA) within 90 min of drawing blood, washed in PBS, and then stored in RNAlater (Ambion Inc., Austin, TX, USA) at -80°C until RNA isolation. .. An RNeasy® Plus Mini Kit (Qiagen, Hilden, Germany) was used for isolation of high quality total RNA, and treated with DNase according to the manufacture protocol. .. RNA samples were run on a RNA 6000 Nano Gel System (Agilent Technologies Inc., Palo Alto, CA, USA) using an Agilent 2100 Bioanalyzer (Agilent) to determine the quality of RNA.

    Article Title: JunB is essential for IL-23-dependent pathogenicity of Th17 cells
    Article Snippet: Uncropped original scans of immunoblots were provided in . .. Total RNA was isolated from cells using an RNeasy Plus Mini Kit (74136, Qiagen). .. RNA quality was analysed with an Agilent 2100 Bioanalyzer and an RNA 6000 Nano Kit (5067-1511, Agilent).

    Article Title: Neutrophil stunning by metoprolol reduces infarct size
    Article Snippet: Before RNA isolation, neutrophil identity was confirmed by flow cytometry (anti-1A8 Ly6G) and viability evaluated. .. Total RNA from whole hearts, BM and purified neutrophils samples was isolated with the Qiagen RNeasy Plus Mini Kit. .. RNA (1–2 μg) was reverse transcribed using Ready-to-go RT–PCR Beads (27-9259-01, GE Healthcare).

    Article Title: Genome-wide mapping of DNase I hypersensitive sites reveals chromatin accessibility changes in Arabidopsis euchromatin and heterochromatin regions under extended darkness
    Article Snippet: Total RNA was extracted using TRIZOL reagent (Invitrogen) and purified using RNeasy Mini Kits (Qiagen). .. Total RNA was extracted using TRIZOL reagent (Invitrogen) and purified using RNeasy Mini Kits (Qiagen).

    Article Title: The Human NADPH Oxidase, Nox4, Regulates Cytoskeletal Organization in Two Cancer Cell Lines, HepG2 and SH-SY5Y
    Article Snippet: Media were changed after 6 h, and cells were further incubated in growth medium for a total of 48 h. siRNA transfection efficacy was determined as > 90% of cells, using the BLOCK-iT Fluorescent Oligo (ThermoScientific). .. Total RNA was isolated using RNeasy Mini kits (Qiagen) and digested with DNaseI (Promega). .. Reverse transcription polymerase chain reaction was performed using the SuperScriptII reverse transcription kit (ThermoScientific) and random hexamer primers (ThermoScientific) followed by IQ SYBR Green (Bio-Rad Laboratories) real-time (RT) PCR analyses on the iQ Multi-Color real time PCR detector (Bio-Rad Laboratories).

    Size-exclusion Chromatography:

    Article Title: Melanocortin receptor agonists MCR1‐5 protect photoreceptors from high‐glucose damage and restore antioxidant enzymes in primary retinal cell culture
    Article Snippet: Total RNA was extracted using RNeasy Plus Mini Kit (Qiagen, West Sussex, UK), according to the manufacturer's instructions. .. Total RNA was extracted using RNeasy Plus Mini Kit (Qiagen, West Sussex, UK), according to the manufacturer's instructions.

    Purification:

    Article Title: Enhanced generation of human induced pluripotent stem cells by ectopic expression of Connexin 45
    Article Snippet: The intensity (area × density) of the individual bands on western blotting was measured by a Quantity-One software (Bio-Rad) and the amount of target protein was normalized to β-TUBULIN. .. Total RNA was purified with the RNeasy Plus Mini kit (Qiagen) according to the manufacturer’s instructions. .. The concentration and quality of total RNA samples were checked by a NanoDrop ND-1000 (NanoDrop) and one microgram total RNA was reverse-transcribed using an AMV First-Strand cDNA synthesis kit (Invitrogen).

    Article Title: Argininosuccinate synthase 1 is an intrinsic Akt repressor transactivated by p53
    Article Snippet: Tissues were preserved in RNAlater solution (Qiagen) at 4°C until RNA purification. .. Bone marrow was resolved in RLT Plus reagent provided by the RNeasy Plus Mini Kit (Qiagen) and homogenized using a QIAshredder column (Qiagen).

    Article Title: “Inflamm‐aging” influences immune cell survival factors in human bone marrow
    Article Snippet: BM cells were obtained from mice by flushing the femur and tibia with PBS. .. RNA was isolated from purified BMMCs using the RNeasy Plus mini kit (Qiagen). .. First‐strand cDNA synthesis was performed using a Reverse Transcription system (Promega). qRT‐PCR experiments were performed using the LightCycler 480 System (Roche Diagnostics), 2X SYBR Green 1 Master (Roche Diagnostics), and β‐actin as housekeeping gene for relative quantification of effector/memory cell survival factors.

    Article Title: Platelet-rich plasma respectively reduces and promotes adipogenic and myofibroblastic differentiation of human adipose-derived stromal cells via the TGFβ signalling pathway
    Article Snippet: Adipogenic-and myofibroblast-gene expression was performed by quantitative PCR. .. RNAs were purified on RNeasy columns (Qiagen, France). .. RNA sample concentrations were determined using a Nanodrop spectrophotometer (Thermo Scientific, Waltham, MA, USA).

    Article Title: De novo assembly and comparative transcriptome analysis of the foot from Chinese green mussel (Perna viridis) in response to cadmium stimulation
    Article Snippet: The Chinese green mussel foot gland samples were collected from Cd treated mussels (i.e., Control 48-h, 50 μg/L CdCl2 48-h, 100 μg/L CdCl2 48-h). qRT-PCRs were carried out using gene-specific primers , which were designed using Primer3 version 4.0.0 [ ]. .. Total RNAs from the foot gland samples were extracted and purified by RNeasy Animal Mini Kit (Qiagen, Valencia, CA). .. All samples were examined in triplicate with β-actin as the internal control and the 2-ΔΔCt method [ ] was used to calculate the relative expression.

    Article Title: Neutrophil stunning by metoprolol reduces infarct size
    Article Snippet: Before RNA isolation, neutrophil identity was confirmed by flow cytometry (anti-1A8 Ly6G) and viability evaluated. .. Total RNA from whole hearts, BM and purified neutrophils samples was isolated with the Qiagen RNeasy Plus Mini Kit. .. RNA (1–2 μg) was reverse transcribed using Ready-to-go RT–PCR Beads (27-9259-01, GE Healthcare).

    Article Title: Genome-wide mapping of DNase I hypersensitive sites reveals chromatin accessibility changes in Arabidopsis euchromatin and heterochromatin regions under extended darkness
    Article Snippet: Significance was determined using an algorithm based on Z score and P-value filtering with a cut-off of 0.05 . .. Total RNA was extracted using TRIZOL reagent (Invitrogen) and purified using RNeasy Mini Kits (Qiagen). .. RNA samples were extracted from Arabidopsis whole plants under extended darkness treatment and control condition.

    Sequencing:

    Article Title: “Inflamm‐aging” influences immune cell survival factors in human bone marrow
    Article Snippet: RNA was isolated from purified BMMCs using the RNeasy Plus mini kit (Qiagen). .. First‐strand cDNA synthesis was performed using a Reverse Transcription system (Promega). qRT‐PCR experiments were performed using the LightCycler 480 System (Roche Diagnostics), 2X SYBR Green 1 Master (Roche Diagnostics), and β‐actin as housekeeping gene for relative quantification of effector/memory cell survival factors.

    Article Title: De novo assembly and comparative transcriptome analysis of the foot from Chinese green mussel (Perna viridis) in response to cadmium stimulation
    Article Snippet: Quantitative real-time PCR (qRT-PCR) was frequently used to confirm the data generated by high-throughput sequencing [ , ]. .. Total RNAs from the foot gland samples were extracted and purified by RNeasy Animal Mini Kit (Qiagen, Valencia, CA).

    Article Title: Genome-wide mapping of DNase I hypersensitive sites reveals chromatin accessibility changes in Arabidopsis euchromatin and heterochromatin regions under extended darkness
    Article Snippet: Total RNA was extracted using TRIZOL reagent (Invitrogen) and purified using RNeasy Mini Kits (Qiagen). .. Construction of the sRNA libraries and deep-sequencing were carried out by the Beijing Genomics Institute (BGI, Hong Kong, China): isolated total RNA from each sample was separated on 15% denaturing polyacrylamide gels for size selection.

    Article Title: The Human NADPH Oxidase, Nox4, Regulates Cytoskeletal Organization in Two Cancer Cell Lines, HepG2 and SH-SY5Y
    Article Snippet: Total RNA was isolated using RNeasy Mini kits (Qiagen) and digested with DNaseI (Promega). .. Reverse transcription polymerase chain reaction was performed using the SuperScriptII reverse transcription kit (ThermoScientific) and random hexamer primers (ThermoScientific) followed by IQ SYBR Green (Bio-Rad Laboratories) real-time (RT) PCR analyses on the iQ Multi-Color real time PCR detector (Bio-Rad Laboratories).

    Construct:

    Article Title: The Transcriptional Landscape of p53 Signalling Pathway
    Article Snippet: For RNA extraction from bone marrow, we used the RNeasy Plus Mini Kit (QIAGEN). .. We selected 280 samples for RNA sequencing analysis based on RNA quality and quantity, which were evaluated using a Bioanalyzer (Agilent) and Nanodrop (Thermo Fisher Scientific).

    Staining:

    Article Title: Platelet-rich plasma respectively reduces and promotes adipogenic and myofibroblastic differentiation of human adipose-derived stromal cells via the TGFβ signalling pathway
    Article Snippet: Then, Oil Red O stained cells were quantified by washing in water and lipid-bound Oil Red-O was dissolved in isopropanol for 15 min. .. RNAs were purified on RNeasy columns (Qiagen, France).

    Article Title: JunB is essential for IL-23-dependent pathogenicity of Th17 cells
    Article Snippet: Total RNA was isolated from cells using an RNeasy Plus Mini Kit (74136, Qiagen). .. Total RNA was isolated from cells using an RNeasy Plus Mini Kit (74136, Qiagen).

    Mouse Assay:

    Article Title: Argininosuccinate synthase 1 is an intrinsic Akt repressor transactivated by p53
    Article Snippet: Paragraph title: Mice and x-ray treatment and RNA-seq ... Bone marrow was resolved in RLT Plus reagent provided by the RNeasy Plus Mini Kit (Qiagen) and homogenized using a QIAshredder column (Qiagen).

    Article Title: Neutrophil stunning by metoprolol reduces infarct size
    Article Snippet: Adrb1 expression in circulating neutrophils was examined in blood drawn from wild-type or Adrb1 KO mice 20 min after injection of heparin (50 μl of 50 U per ml). .. Total RNA from whole hearts, BM and purified neutrophils samples was isolated with the Qiagen RNeasy Plus Mini Kit.

    Software:

    Article Title: WRN conditioned media is sufficient for in vitro propagation of intestinal organoids from large farm and small companion animals
    Article Snippet: RNA from enteroids, control tissue, and kidney epithelial cells (CRFK and MDBK) was isolated using the RNeasy Plus mini kit (Qiagen) according to the manufacturer's protocol, with DNase treatment (Qiagen) on the tissue controls samples. .. RNA from enteroids, control tissue, and kidney epithelial cells (CRFK and MDBK) was isolated using the RNeasy Plus mini kit (Qiagen) according to the manufacturer's protocol, with DNase treatment (Qiagen) on the tissue controls samples.

    Article Title: “Inflamm‐aging” influences immune cell survival factors in human bone marrow
    Article Snippet: RNA was isolated from purified BMMCs using the RNeasy Plus mini kit (Qiagen). .. First‐strand cDNA synthesis was performed using a Reverse Transcription system (Promega). qRT‐PCR experiments were performed using the LightCycler 480 System (Roche Diagnostics), 2X SYBR Green 1 Master (Roche Diagnostics), and β‐actin as housekeeping gene for relative quantification of effector/memory cell survival factors.

    Article Title: Genome-wide mapping of DNase I hypersensitive sites reveals chromatin accessibility changes in Arabidopsis euchromatin and heterochromatin regions under extended darkness
    Article Snippet: Total RNA was extracted using TRIZOL reagent (Invitrogen) and purified using RNeasy Mini Kits (Qiagen). .. Total RNA was extracted using TRIZOL reagent (Invitrogen) and purified using RNeasy Mini Kits (Qiagen).

    Real-time Polymerase Chain Reaction:

    Article Title: Self-cytoplasmic DNA upregulates the mutator enzyme APOBEC3A leading to chromosomal DNA damage
    Article Snippet: Paragraph title: Real-time PCR and SYBR Green quantitative PCR ... Total RNA was extracted from THP-1 cells using RNeasy Plus Mini Kit (Qiagen) according to the manufacturer's instructions.

    Article Title: Melanocortin receptor agonists MCR1‐5 protect photoreceptors from high‐glucose damage and restore antioxidant enzymes in primary retinal cell culture
    Article Snippet: Total RNA was extracted using RNeasy Plus Mini Kit (Qiagen, West Sussex, UK), according to the manufacturer's instructions. .. Total RNA was extracted using RNeasy Plus Mini Kit (Qiagen, West Sussex, UK), according to the manufacturer's instructions.

    Article Title: Enhanced generation of human induced pluripotent stem cells by ectopic expression of Connexin 45
    Article Snippet: Paragraph title: Real-time PCR ... Total RNA was purified with the RNeasy Plus Mini kit (Qiagen) according to the manufacturer’s instructions.

    Article Title: WRN conditioned media is sufficient for in vitro propagation of intestinal organoids from large farm and small companion animals
    Article Snippet: Paragraph title: RNA isolation and qPCR ... RNA from enteroids, control tissue, and kidney epithelial cells (CRFK and MDBK) was isolated using the RNeasy Plus mini kit (Qiagen) according to the manufacturer's protocol, with DNase treatment (Qiagen) on the tissue controls samples.

    Article Title: Platelet-rich plasma respectively reduces and promotes adipogenic and myofibroblastic differentiation of human adipose-derived stromal cells via the TGFβ signalling pathway
    Article Snippet: Adipogenic-and myofibroblast-gene expression was performed by quantitative PCR. .. RNAs were purified on RNeasy columns (Qiagen, France).

    Article Title: De novo assembly and comparative transcriptome analysis of the foot from Chinese green mussel (Perna viridis) in response to cadmium stimulation
    Article Snippet: Quantitative real-time PCR (qRT-PCR) was frequently used to confirm the data generated by high-throughput sequencing [ , ]. .. Total RNAs from the foot gland samples were extracted and purified by RNeasy Animal Mini Kit (Qiagen, Valencia, CA).

    Article Title: Neutrophil stunning by metoprolol reduces infarct size
    Article Snippet: Total RNA from whole hearts, BM and purified neutrophils samples was isolated with the Qiagen RNeasy Plus Mini Kit. .. Total RNA from whole hearts, BM and purified neutrophils samples was isolated with the Qiagen RNeasy Plus Mini Kit.

    Article Title: Nox2 contributes to hyperinsulinemia-induced redox imbalance and impaired vascular function
    Article Snippet: Paragraph title: Real-time PCR ... 2.7 Total RNA was extracted using RNeasy mini kits (Qiagen, Germantown, MD).

    Article Title: Sensitive detection of viable circulating tumor cells using a novel conditionally telomerase-selective replicating adenovirus in non-small cell lung cancer patients
    Article Snippet: Fixed cells were analyzed using a MACSQuant® Analyzer (Miltenyi Biotec, Bergisch-Gladbach, Germany) to determine the ratio of GFP+ cells. .. Total RNA was extracted from human NSCLC cell lines using the RNeasy Plus Mini Kit (Cat No. 74134, Qiagen, Venlo, The Netherlands). qRT-PCR was performed using the PrimeScript RT reagent kit (TaKaRa, Shiga, Japan) and SYBR Premix EX Taq II (Tli RNaseH Plus, TaKaRa) on a 7500 Fast real-time PCR system (Applied Biosystems, Foster City, CA). .. The following gene-specific primers were used: hTERT F (5′-CGG AAG AGT GTC TGG AGC AA-3′), R (5′-GGA TGA AGC GGA GTC TGG A-3′), GAPDH F (5′-TCG ACA GTC AGC CGC ATC TTC TTT-3′), R (5′-ACC AAA TCC GTT GAC TCC GAC CTT-3′).

    RNA Extraction:

    Article Title: Argininosuccinate synthase 1 is an intrinsic Akt repressor transactivated by p53
    Article Snippet: Bone marrow was resolved in RLT Plus reagent provided by the RNeasy Plus Mini Kit (Qiagen) and homogenized using a QIAshredder column (Qiagen). .. Bone marrow was resolved in RLT Plus reagent provided by the RNeasy Plus Mini Kit (Qiagen) and homogenized using a QIAshredder column (Qiagen).

    Article Title: The Transcriptional Landscape of p53 Signalling Pathway
    Article Snippet: Total RNA was recovered using the RNeasy Plus Universal Mini Kit (QIAGEN). .. For RNA extraction from bone marrow, we used the RNeasy Plus Mini Kit (QIAGEN). .. We selected 280 samples for RNA sequencing analysis based on RNA quality and quantity, which were evaluated using a Bioanalyzer (Agilent) and Nanodrop (Thermo Fisher Scientific).

    Selection:

    Article Title: Genome-wide mapping of DNase I hypersensitive sites reveals chromatin accessibility changes in Arabidopsis euchromatin and heterochromatin regions under extended darkness
    Article Snippet: Total RNA was extracted using TRIZOL reagent (Invitrogen) and purified using RNeasy Mini Kits (Qiagen). .. Total RNA was extracted using TRIZOL reagent (Invitrogen) and purified using RNeasy Mini Kits (Qiagen).

    Article Title: The Transcriptional Landscape of p53 Signalling Pathway
    Article Snippet: For RNA extraction from bone marrow, we used the RNeasy Plus Mini Kit (QIAGEN). .. We selected 280 samples for RNA sequencing analysis based on RNA quality and quantity, which were evaluated using a Bioanalyzer (Agilent) and Nanodrop (Thermo Fisher Scientific).

    Agarose Gel Electrophoresis:

    Article Title: Neutrophil stunning by metoprolol reduces infarct size
    Article Snippet: Total RNA from whole hearts, BM and purified neutrophils samples was isolated with the Qiagen RNeasy Plus Mini Kit. .. Total RNA from whole hearts, BM and purified neutrophils samples was isolated with the Qiagen RNeasy Plus Mini Kit.

    Concentration Assay:

    Article Title: Melanocortin receptor agonists MCR1‐5 protect photoreceptors from high‐glucose damage and restore antioxidant enzymes in primary retinal cell culture
    Article Snippet: Total RNA was extracted using RNeasy Plus Mini Kit (Qiagen, West Sussex, UK), according to the manufacturer's instructions. .. Total RNA was extracted using RNeasy Plus Mini Kit (Qiagen, West Sussex, UK), according to the manufacturer's instructions.

    Fractionation:

    Article Title: The lncRNA VELUCT strongly regulates viability of lung cancer cells despite its extremely low abundance
    Article Snippet: Paragraph title: Subcellular fractionation, RNA isolation and DNase treatment ... Whole cell RNA that was used for RNA-seq experiments was isolated using RNeasy Mini columns (Qiagen).

    High Throughput Screening Assay:

    Article Title: De novo assembly and comparative transcriptome analysis of the foot from Chinese green mussel (Perna viridis) in response to cadmium stimulation
    Article Snippet: Quantitative real-time PCR (qRT-PCR) was frequently used to confirm the data generated by high-throughput sequencing [ , ]. .. Total RNAs from the foot gland samples were extracted and purified by RNeasy Animal Mini Kit (Qiagen, Valencia, CA).

    Lysis:

    Article Title: Ribonuclease L mediates the cell-lethal phenotype of double-stranded RNA editing enzyme ADAR1 deficiency in a human cell line
    Article Snippet: U6 primers for normalization are 5’ GCTTCGGCAGCACATATACTA 3’ (forward) and 5’ CGAATTTGCGTGTCATCCTTG 3’ (reverse). .. Cells were treated with 10 U/ml of IFN-α (PBL) and 24 hr post treatment, cells were lysed in RLT Plus RNA lysis buffer (Qiagen), and RNA was isolated using the RNeasy Plus Mini Kit (Qiagen) as previously described ( ). .. Relative IFN-α, IFN-λ, OAS2, IFIT2 mRNA expression levels were quantified as ΔCT values relative to actin mRNA [ΔCT = CT (gene of interest) − CT (β-actin) ] and expressed using the formula 2−ΔCT .

    Article Title: Argininosuccinate synthase 1 is an intrinsic Akt repressor transactivated by p53
    Article Snippet: Bone marrow was resolved in RLT Plus reagent provided by the RNeasy Plus Mini Kit (Qiagen) and homogenized using a QIAshredder column (Qiagen). .. The lysates were stored at −80°C until RNA purification.

    Article Title: The Transcriptional Landscape of p53 Signalling Pathway
    Article Snippet: 2.2 Tissues were homogenized in QIAzol lysis reagent (QIAGEN) using Precellys 24 (Bertin Corporation). .. For RNA extraction from bone marrow, we used the RNeasy Plus Mini Kit (QIAGEN).

    Gradient Centrifugation:

    Article Title: Genome-wide gene expression array identifies novel genes related to disease severity and excessive daytime sleepiness in patients with obstructive sleep apnea
    Article Snippet: The PBMCs were isolated by Ficoll-Hypaque gradient centrifugation (HISTOPAQUE® -119, Sigma-Aldrich, Inc., St. Louis, MO USA) within 90 min of drawing blood, washed in PBS, and then stored in RNAlater (Ambion Inc., Austin, TX, USA) at -80°C until RNA isolation. .. An RNeasy® Plus Mini Kit (Qiagen, Hilden, Germany) was used for isolation of high quality total RNA, and treated with DNase according to the manufacture protocol.

    Article Title: Neutrophil stunning by metoprolol reduces infarct size
    Article Snippet: Whole blood was filtered and pooled, and polymorphonuclear leukocytes were purified by gradient-centrifugation (800g , 20 min, 4 °C) in 65% Percoll Plus in Hanks balanced salt solution (HBSS). .. Total RNA from whole hearts, BM and purified neutrophils samples was isolated with the Qiagen RNeasy Plus Mini Kit.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Qiagen rneasy mini kit
    Chemerin and IL-1β co-incubation; synergistic increase in cell adhesion molecule expression Serum starved <t>HMEC-1</t> cells were treated with chemerin (3nM) with or without IL-1β (10ng/ml) for 12 hours. ( A ) Representative western blots of E-selectin, VCAM-1 and ICAM-1 and their respective β-actin. ( B-D ) Densitometric analysis of western blots (cell protein lysates) of E-selectin, VCAM-1 and ICAM-1 immune complexes having normalized to β-actin, respectively, showed that protein expression of cell adhesion molecules, i.e. E-selectin, VCAM-1 and ICAM-1, were synergistically increased when compared to chemerin or IL-1β, alone (Figures 5A-5D: *** P
    Rneasy Mini Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rneasy mini kit/product/Qiagen
    Average 99 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    rneasy mini kit - by Bioz Stars, 2019-10
    99/100 stars
      Buy from Supplier

    78
    Qiagen flsirna
    Effect of iron, iron chelation, FHsiRNA, and <t>FLsiRNA</t> on VEGF accumulation in LEC conditioned medium. LECs were transfected, and 4 days after transfection, VEGF was measured in the CCM. In a parallel set of experiments, nontransfected cells (LECs) were
    Flsirna, supplied by Qiagen, used in various techniques. Bioz Stars score: 78/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/flsirna/product/Qiagen
    Average 78 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    flsirna - by Bioz Stars, 2019-10
    78/100 stars
      Buy from Supplier

    79
    Qiagen vehicle injected eiu rat eyes
    Ionized calcium-binding adaptor molecule 1 immunostaining on flatmounted retinas. A – B : Example of flatmounted retinas from rat eyes with endotoxin-induced uveitis <t>(EIU)</t> injected with vehicle ( A ) or with antivascular endothelial growth factor <t>(VEGF)</t> antibodies ( B ); Bar = 50 µm. Arrowhead show round reactive ionized calcium-binding adaptor molecule 1 (IBA1)-positive cells. C – D : Extraction of cell contours used for automatic labeling of IBA1 staining. E - F : Quantification of round and total IBA-1 positive cells on flat-mounted retina from EIU control and anti-VEGF treated eyes. Bar = 50 µm.
    Vehicle Injected Eiu Rat Eyes, supplied by Qiagen, used in various techniques. Bioz Stars score: 79/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/vehicle injected eiu rat eyes/product/Qiagen
    Average 79 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    vehicle injected eiu rat eyes - by Bioz Stars, 2019-10
    79/100 stars
      Buy from Supplier

    Image Search Results


    Chemerin and IL-1β co-incubation; synergistic increase in cell adhesion molecule expression Serum starved HMEC-1 cells were treated with chemerin (3nM) with or without IL-1β (10ng/ml) for 12 hours. ( A ) Representative western blots of E-selectin, VCAM-1 and ICAM-1 and their respective β-actin. ( B-D ) Densitometric analysis of western blots (cell protein lysates) of E-selectin, VCAM-1 and ICAM-1 immune complexes having normalized to β-actin, respectively, showed that protein expression of cell adhesion molecules, i.e. E-selectin, VCAM-1 and ICAM-1, were synergistically increased when compared to chemerin or IL-1β, alone (Figures 5A-5D: *** P

    Journal: Oncotarget

    Article Title: Chemerin induces endothelial cell inflammation: activation of nuclear factor-kappa beta and monocyte-endothelial adhesion

    doi: 10.18632/oncotarget.24659

    Figure Lengend Snippet: Chemerin and IL-1β co-incubation; synergistic increase in cell adhesion molecule expression Serum starved HMEC-1 cells were treated with chemerin (3nM) with or without IL-1β (10ng/ml) for 12 hours. ( A ) Representative western blots of E-selectin, VCAM-1 and ICAM-1 and their respective β-actin. ( B-D ) Densitometric analysis of western blots (cell protein lysates) of E-selectin, VCAM-1 and ICAM-1 immune complexes having normalized to β-actin, respectively, showed that protein expression of cell adhesion molecules, i.e. E-selectin, VCAM-1 and ICAM-1, were synergistically increased when compared to chemerin or IL-1β, alone (Figures 5A-5D: *** P

    Article Snippet: Total RNA was extracted from HMEC-1 cells Qiagen RNeasy Mini Kit according to the manufacturer's guidelines (Qiagen, Crawley, UK).

    Techniques: Incubation, Expressing, Western Blot

    Chemerin increases endothelial cell adhesion molecules mRNA expression in HMEC-1 cells Serum starved HMEC-1 cells were treated with chemerin (0-10nM) for 4 hours. Real-time quantitative RT-PCR analyses showed that mRNA expression of cell adhesion molecules, i.e. E-selectin, VCAM-1 and ICAM-1, were significantly up-regulated by chemerin in a concentration dependent manner at 4 hours (Figures 2A-2C : *** P

    Journal: Oncotarget

    Article Title: Chemerin induces endothelial cell inflammation: activation of nuclear factor-kappa beta and monocyte-endothelial adhesion

    doi: 10.18632/oncotarget.24659

    Figure Lengend Snippet: Chemerin increases endothelial cell adhesion molecules mRNA expression in HMEC-1 cells Serum starved HMEC-1 cells were treated with chemerin (0-10nM) for 4 hours. Real-time quantitative RT-PCR analyses showed that mRNA expression of cell adhesion molecules, i.e. E-selectin, VCAM-1 and ICAM-1, were significantly up-regulated by chemerin in a concentration dependent manner at 4 hours (Figures 2A-2C : *** P

    Article Snippet: Total RNA was extracted from HMEC-1 cells Qiagen RNeasy Mini Kit according to the manufacturer's guidelines (Qiagen, Crawley, UK).

    Techniques: Expressing, Quantitative RT-PCR, Concentration Assay

    Chemerin increases endothelial cell adhesion molecules protein expression in HMEC-1 cells Serum starved HMEC-1 cells were treated with chemerin (0-10nM) for 12 and 24 hours. Densitometric analysis of western blots (cell protein lysates) of E-selectin, VCAM-1 and ICAM-1 immune complexes having normalized to β-actin, respectively, showed that protein expression of cell adhesion molecules, i.e. E-selectin, VCAM-1 and ICAM-1, were significantly increased by chemerin in a concentration dependent manner at 12 hours (Figures 3A-3C : * P

    Journal: Oncotarget

    Article Title: Chemerin induces endothelial cell inflammation: activation of nuclear factor-kappa beta and monocyte-endothelial adhesion

    doi: 10.18632/oncotarget.24659

    Figure Lengend Snippet: Chemerin increases endothelial cell adhesion molecules protein expression in HMEC-1 cells Serum starved HMEC-1 cells were treated with chemerin (0-10nM) for 12 and 24 hours. Densitometric analysis of western blots (cell protein lysates) of E-selectin, VCAM-1 and ICAM-1 immune complexes having normalized to β-actin, respectively, showed that protein expression of cell adhesion molecules, i.e. E-selectin, VCAM-1 and ICAM-1, were significantly increased by chemerin in a concentration dependent manner at 12 hours (Figures 3A-3C : * P

    Article Snippet: Total RNA was extracted from HMEC-1 cells Qiagen RNeasy Mini Kit according to the manufacturer's guidelines (Qiagen, Crawley, UK).

    Techniques: Expressing, Western Blot, Concentration Assay

    Chemerin increases endothelial cell adhesion molecules protein secretion in HMEC-1 cells Serum starved HMEC-1 cells were treated with chemerin (0-10nM) for 12 hours. Densitometric analysis of western blots (conditioned media) of E-selectin, VCAM-1 and ICAM-1 immune complexes having normalized to β-actin, respectively, showed that secretion of cell adhesion molecules, i.e. E-selectin, VCAM-1 and ICAM-1, were significantly elevated by chemerin in a concentration dependent manner at 12 hours (Figures 4A-4C : * P

    Journal: Oncotarget

    Article Title: Chemerin induces endothelial cell inflammation: activation of nuclear factor-kappa beta and monocyte-endothelial adhesion

    doi: 10.18632/oncotarget.24659

    Figure Lengend Snippet: Chemerin increases endothelial cell adhesion molecules protein secretion in HMEC-1 cells Serum starved HMEC-1 cells were treated with chemerin (0-10nM) for 12 hours. Densitometric analysis of western blots (conditioned media) of E-selectin, VCAM-1 and ICAM-1 immune complexes having normalized to β-actin, respectively, showed that secretion of cell adhesion molecules, i.e. E-selectin, VCAM-1 and ICAM-1, were significantly elevated by chemerin in a concentration dependent manner at 12 hours (Figures 4A-4C : * P

    Article Snippet: Total RNA was extracted from HMEC-1 cells Qiagen RNeasy Mini Kit according to the manufacturer's guidelines (Qiagen, Crawley, UK).

    Techniques: Western Blot, Concentration Assay

    Chemerin stimulates monocyte-endothelial cell adhesion via NF-ĸB, MAPK and PI3K/Akt pathways Serum starved chemerin (0-10nM) treated HMEC-1 cells were co-cultured with THP-1 cells for 2 hours. Chemerin enhanced monocyte-endothelial adhesion in a concentration dependent fashion (Figure 6A : * P

    Journal: Oncotarget

    Article Title: Chemerin induces endothelial cell inflammation: activation of nuclear factor-kappa beta and monocyte-endothelial adhesion

    doi: 10.18632/oncotarget.24659

    Figure Lengend Snippet: Chemerin stimulates monocyte-endothelial cell adhesion via NF-ĸB, MAPK and PI3K/Akt pathways Serum starved chemerin (0-10nM) treated HMEC-1 cells were co-cultured with THP-1 cells for 2 hours. Chemerin enhanced monocyte-endothelial adhesion in a concentration dependent fashion (Figure 6A : * P

    Article Snippet: Total RNA was extracted from HMEC-1 cells Qiagen RNeasy Mini Kit according to the manufacturer's guidelines (Qiagen, Crawley, UK).

    Techniques: Cell Culture, Concentration Assay

    Chemerin activates NF-кB in HMEC-1 cells via MAPK and PI3K/Akt pathways; synergistic activation with IL-1β pathways Serum starved HMEC-1 cells stably transfected with pNFкB-Luciferase were treated with or without chemerin (0-10nM) for 2 hours. Cells were lysed and luciferase activities were measured. Chemerin induced a concentration dependent increase in luciferase activity after 2 hours of incubation ( ** P

    Journal: Oncotarget

    Article Title: Chemerin induces endothelial cell inflammation: activation of nuclear factor-kappa beta and monocyte-endothelial adhesion

    doi: 10.18632/oncotarget.24659

    Figure Lengend Snippet: Chemerin activates NF-кB in HMEC-1 cells via MAPK and PI3K/Akt pathways; synergistic activation with IL-1β pathways Serum starved HMEC-1 cells stably transfected with pNFкB-Luciferase were treated with or without chemerin (0-10nM) for 2 hours. Cells were lysed and luciferase activities were measured. Chemerin induced a concentration dependent increase in luciferase activity after 2 hours of incubation ( ** P

    Article Snippet: Total RNA was extracted from HMEC-1 cells Qiagen RNeasy Mini Kit according to the manufacturer's guidelines (Qiagen, Crawley, UK).

    Techniques: Activation Assay, Stable Transfection, Transfection, Luciferase, Concentration Assay, Activity Assay, Incubation

    Stimulation of an IFN-mediated antiviral response in human transformed or tumor cells upon Poly(I:C) transfection. ( A ) HEK293, HEK293T, NB324K and Hela cultures were transfected with 2 µg/ml of synthetic dsRNA Poly(I:C) (pI:C) or a 150 mM NaCl solution as control, using lipofectamine 2000 for the period indicated in the figure. The respective culture media were then collected, centrifuged to discard cellular debris, and analyzed by Enzyme-linked Immuno-Sorbent Assay (ELISA) for their content in human IFN-β. Each result is represented as mean+standard deviation of three independent experiments. ( B ) Expression of IFN-α and IFN-β transcripts in mock-treated or pI:C-transfected human cell lines was assessed by RT-PCRs. At the indicated time points, total RNAs were extracted from the respective cultures using the RNeasy kit. One µg of RNA was then treated by DNase I in order to remove potential contaminating DNA and reverse transcribed into cDNA. A fraction of the obtained cDNA (1/10) was then analyzed by PCR for its content in type-I IFN transcripts using specific primer pairs. Transcripts encoding the Human 18S ribosomal protein were used as internal loading controls. Data shown are representative of 3 experiments which gave similar results. ( C ) Assessment of the IFN-signaling (Jak/STAT) pathway activation in HEK293, HEK293T, NB324K and Hela cells upon pI:C transfection. At the time indicated mock-treated or pI:C-transfected (2 µg/ml) cultures were harvested by scraping in PBS and centrifuged. Cell pellets were then re-suspended in complete Ripa buffer supplemented with phosphatase and protease inhibitors. Total proteins were extracted from each sample as described in Materials and Methods . Fifty µg total proteins per sample were then subjected to bipartite 8/10% SDS-PAGE, transferred onto membranes, and probed with antibodies specific for phosphorylated and total isoforms of STAT 1 and STAT 2 as well as with an antibody specific to PKR. Actin was used as an internal loading control. Each presented blot is representative of 3 additional which gave similar results.

    Journal: PLoS ONE

    Article Title: TLR-9 Contributes to the Antiviral Innate Immune Sensing of Rodent Parvoviruses MVMp and H-1PV by Normal Human Immune Cells

    doi: 10.1371/journal.pone.0055086

    Figure Lengend Snippet: Stimulation of an IFN-mediated antiviral response in human transformed or tumor cells upon Poly(I:C) transfection. ( A ) HEK293, HEK293T, NB324K and Hela cultures were transfected with 2 µg/ml of synthetic dsRNA Poly(I:C) (pI:C) or a 150 mM NaCl solution as control, using lipofectamine 2000 for the period indicated in the figure. The respective culture media were then collected, centrifuged to discard cellular debris, and analyzed by Enzyme-linked Immuno-Sorbent Assay (ELISA) for their content in human IFN-β. Each result is represented as mean+standard deviation of three independent experiments. ( B ) Expression of IFN-α and IFN-β transcripts in mock-treated or pI:C-transfected human cell lines was assessed by RT-PCRs. At the indicated time points, total RNAs were extracted from the respective cultures using the RNeasy kit. One µg of RNA was then treated by DNase I in order to remove potential contaminating DNA and reverse transcribed into cDNA. A fraction of the obtained cDNA (1/10) was then analyzed by PCR for its content in type-I IFN transcripts using specific primer pairs. Transcripts encoding the Human 18S ribosomal protein were used as internal loading controls. Data shown are representative of 3 experiments which gave similar results. ( C ) Assessment of the IFN-signaling (Jak/STAT) pathway activation in HEK293, HEK293T, NB324K and Hela cells upon pI:C transfection. At the time indicated mock-treated or pI:C-transfected (2 µg/ml) cultures were harvested by scraping in PBS and centrifuged. Cell pellets were then re-suspended in complete Ripa buffer supplemented with phosphatase and protease inhibitors. Total proteins were extracted from each sample as described in Materials and Methods . Fifty µg total proteins per sample were then subjected to bipartite 8/10% SDS-PAGE, transferred onto membranes, and probed with antibodies specific for phosphorylated and total isoforms of STAT 1 and STAT 2 as well as with an antibody specific to PKR. Actin was used as an internal loading control. Each presented blot is representative of 3 additional which gave similar results.

    Article Snippet: Briefly, Total RNAs of mock-treated, parvovirus- or NDV-infected, and/or PolyI:C transfected cells were isolated using an RNeasy mini kit (QIAGEN, Hilden, Germany) according to the manufacturer's instructions.

    Techniques: Transformation Assay, Transfection, Enzyme-linked Immunosorbent Assay, Standard Deviation, Expressing, Polymerase Chain Reaction, Activation Assay, SDS Page

    Time-dependent transcriptional up-regulation of type-I IFN encoding mRNAs in MVMp- or H-1PV-infected human cell lines. ( A ) HEK293 and HEK293T, ( B ) NB324K and ( C ) Hela cells were mock-treated for 24 hrs, infected with parvoviruses (5 PFUs/cell) for the indicated times, or infected with NDV (6 HU/10 6 cells) or transfected with pI:C (2 µg/ml) for 15 hrs. At the indicated times, cells were harvested and total RNAs were extracted using the RNeasy kit. One µg was then reverse transcribed into cDNA and 10% of this product was subjected to PCR reactions using sets of primers specific to each indicated cytokine mRNA or viral transcripts. PCR product of 18S ribosomal RNA was used as housekeeping gene to normalize loading. No signal was detected in the samples when omitting the reverse transcriptase. Presented data are representative of 3 experiments which all gave similar results.

    Journal: PLoS ONE

    Article Title: TLR-9 Contributes to the Antiviral Innate Immune Sensing of Rodent Parvoviruses MVMp and H-1PV by Normal Human Immune Cells

    doi: 10.1371/journal.pone.0055086

    Figure Lengend Snippet: Time-dependent transcriptional up-regulation of type-I IFN encoding mRNAs in MVMp- or H-1PV-infected human cell lines. ( A ) HEK293 and HEK293T, ( B ) NB324K and ( C ) Hela cells were mock-treated for 24 hrs, infected with parvoviruses (5 PFUs/cell) for the indicated times, or infected with NDV (6 HU/10 6 cells) or transfected with pI:C (2 µg/ml) for 15 hrs. At the indicated times, cells were harvested and total RNAs were extracted using the RNeasy kit. One µg was then reverse transcribed into cDNA and 10% of this product was subjected to PCR reactions using sets of primers specific to each indicated cytokine mRNA or viral transcripts. PCR product of 18S ribosomal RNA was used as housekeeping gene to normalize loading. No signal was detected in the samples when omitting the reverse transcriptase. Presented data are representative of 3 experiments which all gave similar results.

    Article Snippet: Briefly, Total RNAs of mock-treated, parvovirus- or NDV-infected, and/or PolyI:C transfected cells were isolated using an RNeasy mini kit (QIAGEN, Hilden, Germany) according to the manufacturer's instructions.

    Techniques: Infection, Transfection, Polymerase Chain Reaction

    Activation of both IFN-producing and IFN-signaling pathways in hPBMCs upon parvovirus infection and comparison of their intensity to that triggered by NDV. ( A , B and D ) hPBMCs collected from the blood of healthy donors were distributed into 6-well plates at 1×10 7 cells/5 ml culture medium/well. They were then mock-treated or infected with MVMp or H-1PV at 20 PFUs/cell or with NDV (6 HU/10 6 cells). Cultures were harvested in PBS and centrifuged at the time p.i. indicated in each figure. ( A , D ) One half of each pellet was resuspended in Ripa buffer supplemented with phosphatase and protease inhibitors in order to perform Western blot experiments whereas ( B ) total RNAs were extracted from the rest of each cell pellet using the RNeasy kit. ( A , D ) Total proteins were extracted from each sample as described in Materials and Methods . Seventy µg total proteins per sample were then subjected to 10% SDS-PAGE, transferred onto membranes, and probed with antibodies specific for total and phosphorylated STAT 2 and STAT 1 polypeptides as well as for PKR. Actin was used as an internal loading control. Each presented blot is representative of 4 additional which gave similar results. ( B ). One µg of isolated total RNA was then reverse transcribed into cDNA and 10% of this product was subjected to PCR reactions using sets of primers specific to each indicated mRNA. PCR product of 18S ribosomal RNA was used as housekeeping gene to normalize loading. No signal was detected in the samples when omitting the reverse transcriptase. Presented data are representative of 4 experiments which all gave similar results. ( C ) hPBMCs collected from the blood of healthy donors were distributed into 24-well plates at 1×10 6 cells/500 µl culture medium/well. They were then mock-treated or infected with MVMp, H-1PV (20 PFUs/cell) or NDV (6 HU/10 6 cells). After a period of incubation of 24 hrs media were collected, centrifuged in order to discard cellular debris and analyzed by Enzyme-linked Immuno-Sorbent Assay (ELISA) for their content in IFN-α and IFN-β. Results are expressed as means+standard deviations of seven independent experiments.

    Journal: PLoS ONE

    Article Title: TLR-9 Contributes to the Antiviral Innate Immune Sensing of Rodent Parvoviruses MVMp and H-1PV by Normal Human Immune Cells

    doi: 10.1371/journal.pone.0055086

    Figure Lengend Snippet: Activation of both IFN-producing and IFN-signaling pathways in hPBMCs upon parvovirus infection and comparison of their intensity to that triggered by NDV. ( A , B and D ) hPBMCs collected from the blood of healthy donors were distributed into 6-well plates at 1×10 7 cells/5 ml culture medium/well. They were then mock-treated or infected with MVMp or H-1PV at 20 PFUs/cell or with NDV (6 HU/10 6 cells). Cultures were harvested in PBS and centrifuged at the time p.i. indicated in each figure. ( A , D ) One half of each pellet was resuspended in Ripa buffer supplemented with phosphatase and protease inhibitors in order to perform Western blot experiments whereas ( B ) total RNAs were extracted from the rest of each cell pellet using the RNeasy kit. ( A , D ) Total proteins were extracted from each sample as described in Materials and Methods . Seventy µg total proteins per sample were then subjected to 10% SDS-PAGE, transferred onto membranes, and probed with antibodies specific for total and phosphorylated STAT 2 and STAT 1 polypeptides as well as for PKR. Actin was used as an internal loading control. Each presented blot is representative of 4 additional which gave similar results. ( B ). One µg of isolated total RNA was then reverse transcribed into cDNA and 10% of this product was subjected to PCR reactions using sets of primers specific to each indicated mRNA. PCR product of 18S ribosomal RNA was used as housekeeping gene to normalize loading. No signal was detected in the samples when omitting the reverse transcriptase. Presented data are representative of 4 experiments which all gave similar results. ( C ) hPBMCs collected from the blood of healthy donors were distributed into 24-well plates at 1×10 6 cells/500 µl culture medium/well. They were then mock-treated or infected with MVMp, H-1PV (20 PFUs/cell) or NDV (6 HU/10 6 cells). After a period of incubation of 24 hrs media were collected, centrifuged in order to discard cellular debris and analyzed by Enzyme-linked Immuno-Sorbent Assay (ELISA) for their content in IFN-α and IFN-β. Results are expressed as means+standard deviations of seven independent experiments.

    Article Snippet: Briefly, Total RNAs of mock-treated, parvovirus- or NDV-infected, and/or PolyI:C transfected cells were isolated using an RNeasy mini kit (QIAGEN, Hilden, Germany) according to the manufacturer's instructions.

    Techniques: Activation Assay, Infection, Western Blot, SDS Page, Isolation, Polymerase Chain Reaction, Incubation, Enzyme-linked Immunosorbent Assay

    Activation of a TLR-9 dependent production of type-I IFNs in parvovirus-infected human Namalwa cells. The cells (1.10 6 cells/well of a 24-well plate) were either infected with MVMp or H-1PV (∼80 PFUs/cell equivalent to 1×10 4 virus genomes/cell), stimulated with the TLR-9 agonist ODN 2395 at 1 µM, or mock-treated. ( A ) At the indicated time points culture supernatants were collected from the respective wells and used to determine the quantity of type-I IFNs released in the culture medium by ELISA experiments. Results are expressed as means+standard deviations of three independent experiments. ( B ) Mock-treated, parvovirus-infected or ODN stimulated Namalwa cells were harvested at the indicated time points and total RNAs were extracted using the RNeasy kit as described previously in Figure 1 . Total RNAs extracted from parvovirus-infected (24 hrs p.i. at 80 PFUs/cell) or pI:C-transfected (15 hrs post-transfection with 2 µg dsRNA/ml) NB324K cells were used as positive or negative controls. Presented data are representative of 3 experiments which all gave similar results. ( C ) Total DNA was harvested at the indicated time points from parvovirus-infected (MOI of 80 PFUs/cell) or mock-treated Namalwa or HEK293T cultures to assess by Southern blot experiments as described in Figure 2 the replication of both parvoviruses (dRF, dimmer replicative form; mRF, monomeric replicative form; ssDNA, single-stranded DNA genome). The blot shown is representative of 3 experiments which gave similar results. ( D ) Cell pellets from mock-treated or parvovirus-infected Namalwa cultures were re-suspended in complete Ripa buffer and Western blotting was performed as described in Figure 6 . Actin was used as an internal loading control. Each presented blot is representative of 3 experiments which gave similar results.

    Journal: PLoS ONE

    Article Title: TLR-9 Contributes to the Antiviral Innate Immune Sensing of Rodent Parvoviruses MVMp and H-1PV by Normal Human Immune Cells

    doi: 10.1371/journal.pone.0055086

    Figure Lengend Snippet: Activation of a TLR-9 dependent production of type-I IFNs in parvovirus-infected human Namalwa cells. The cells (1.10 6 cells/well of a 24-well plate) were either infected with MVMp or H-1PV (∼80 PFUs/cell equivalent to 1×10 4 virus genomes/cell), stimulated with the TLR-9 agonist ODN 2395 at 1 µM, or mock-treated. ( A ) At the indicated time points culture supernatants were collected from the respective wells and used to determine the quantity of type-I IFNs released in the culture medium by ELISA experiments. Results are expressed as means+standard deviations of three independent experiments. ( B ) Mock-treated, parvovirus-infected or ODN stimulated Namalwa cells were harvested at the indicated time points and total RNAs were extracted using the RNeasy kit as described previously in Figure 1 . Total RNAs extracted from parvovirus-infected (24 hrs p.i. at 80 PFUs/cell) or pI:C-transfected (15 hrs post-transfection with 2 µg dsRNA/ml) NB324K cells were used as positive or negative controls. Presented data are representative of 3 experiments which all gave similar results. ( C ) Total DNA was harvested at the indicated time points from parvovirus-infected (MOI of 80 PFUs/cell) or mock-treated Namalwa or HEK293T cultures to assess by Southern blot experiments as described in Figure 2 the replication of both parvoviruses (dRF, dimmer replicative form; mRF, monomeric replicative form; ssDNA, single-stranded DNA genome). The blot shown is representative of 3 experiments which gave similar results. ( D ) Cell pellets from mock-treated or parvovirus-infected Namalwa cultures were re-suspended in complete Ripa buffer and Western blotting was performed as described in Figure 6 . Actin was used as an internal loading control. Each presented blot is representative of 3 experiments which gave similar results.

    Article Snippet: Briefly, Total RNAs of mock-treated, parvovirus- or NDV-infected, and/or PolyI:C transfected cells were isolated using an RNeasy mini kit (QIAGEN, Hilden, Germany) according to the manufacturer's instructions.

    Techniques: Activation Assay, Infection, Enzyme-linked Immunosorbent Assay, Transfection, Southern Blot, Western Blot

    Effect of iron, iron chelation, FHsiRNA, and FLsiRNA on VEGF accumulation in LEC conditioned medium. LECs were transfected, and 4 days after transfection, VEGF was measured in the CCM. In a parallel set of experiments, nontransfected cells (LECs) were

    Journal:

    Article Title: Altered Ferritin Subunit Composition: Change in Iron Metabolism in Lens Epithelial Cells and Downstream Effects on Glutathione Levels and VEGF Secretion

    doi: 10.1167/iovs.09-3861

    Figure Lengend Snippet: Effect of iron, iron chelation, FHsiRNA, and FLsiRNA on VEGF accumulation in LEC conditioned medium. LECs were transfected, and 4 days after transfection, VEGF was measured in the CCM. In a parallel set of experiments, nontransfected cells (LECs) were

    Article Snippet: Total RNA was extracted from cultured LECs, 24 hours after transfection with CTL, FH, or FLsiRNA (RNeasy kit and Qiashredders; Qiagen, Valencia CA) according to the manufacturer's protocol.

    Techniques: Transfection

    Ferritin chain degradation after siRNA knockdown. Twenty-four hours after transfection with a control nontargeting siRNA, FHsiRNA, or FLsiRNA, LECs were incubated for 18 hours with 60 μCi translabel 35 S-methionine. After the labeling period, the

    Journal:

    Article Title: Altered Ferritin Subunit Composition: Change in Iron Metabolism in Lens Epithelial Cells and Downstream Effects on Glutathione Levels and VEGF Secretion

    doi: 10.1167/iovs.09-3861

    Figure Lengend Snippet: Ferritin chain degradation after siRNA knockdown. Twenty-four hours after transfection with a control nontargeting siRNA, FHsiRNA, or FLsiRNA, LECs were incubated for 18 hours with 60 μCi translabel 35 S-methionine. After the labeling period, the

    Article Snippet: Total RNA was extracted from cultured LECs, 24 hours after transfection with CTL, FH, or FLsiRNA (RNeasy kit and Qiashredders; Qiagen, Valencia CA) according to the manufacturer's protocol.

    Techniques: Transfection, Incubation, Labeling

    Transfection with FH- or FLsiRNA altered the levels of ferritin chains as determined by immunolocalization. The cells were transfected with control nontargeting siRNA ( A , D , G , J ), FHsiRNA ( B , E , H , K , M – O ), or FLsiRNA ( C , F , I , L ) and immunolabeled

    Journal:

    Article Title: Altered Ferritin Subunit Composition: Change in Iron Metabolism in Lens Epithelial Cells and Downstream Effects on Glutathione Levels and VEGF Secretion

    doi: 10.1167/iovs.09-3861

    Figure Lengend Snippet: Transfection with FH- or FLsiRNA altered the levels of ferritin chains as determined by immunolocalization. The cells were transfected with control nontargeting siRNA ( A , D , G , J ), FHsiRNA ( B , E , H , K , M – O ), or FLsiRNA ( C , F , I , L ) and immunolabeled

    Article Snippet: Total RNA was extracted from cultured LECs, 24 hours after transfection with CTL, FH, or FLsiRNA (RNeasy kit and Qiashredders; Qiagen, Valencia CA) according to the manufacturer's protocol.

    Techniques: Transfection, Immunolabeling

    Effect of H- and L-chain siRNA on de novo ferritin subunit synthesis in LECs. ( A , B ) LECs were seeded in six-well plates, then transfected with nontargeting control or FH- or FLsiRNA. Two and 4 days later, the cells were incubated with 35 S-methionine

    Journal:

    Article Title: Altered Ferritin Subunit Composition: Change in Iron Metabolism in Lens Epithelial Cells and Downstream Effects on Glutathione Levels and VEGF Secretion

    doi: 10.1167/iovs.09-3861

    Figure Lengend Snippet: Effect of H- and L-chain siRNA on de novo ferritin subunit synthesis in LECs. ( A , B ) LECs were seeded in six-well plates, then transfected with nontargeting control or FH- or FLsiRNA. Two and 4 days later, the cells were incubated with 35 S-methionine

    Article Snippet: Total RNA was extracted from cultured LECs, 24 hours after transfection with CTL, FH, or FLsiRNA (RNeasy kit and Qiashredders; Qiagen, Valencia CA) according to the manufacturer's protocol.

    Techniques: Transfection, Incubation

    The effect of FH and FLsiRNA on FH and FL mRNA in cultured LECs. Total RNA was extracted from cultured LECs differentially transfected with siRNAs designed to suppress FH- or FLsiRNA expression or with nontargeting Ctl siRNA. Changes in the expression

    Journal:

    Article Title: Altered Ferritin Subunit Composition: Change in Iron Metabolism in Lens Epithelial Cells and Downstream Effects on Glutathione Levels and VEGF Secretion

    doi: 10.1167/iovs.09-3861

    Figure Lengend Snippet: The effect of FH and FLsiRNA on FH and FL mRNA in cultured LECs. Total RNA was extracted from cultured LECs differentially transfected with siRNAs designed to suppress FH- or FLsiRNA expression or with nontargeting Ctl siRNA. Changes in the expression

    Article Snippet: Total RNA was extracted from cultured LECs, 24 hours after transfection with CTL, FH, or FLsiRNA (RNeasy kit and Qiashredders; Qiagen, Valencia CA) according to the manufacturer's protocol.

    Techniques: Cell Culture, Transfection, Expressing, CTL Assay

    Effect of siRNA knockdown of ferritin H- and L-chain on transferrin receptor and iron uptake in LECs. ( A ) TfR Western blot. Twenty-four hours after transfection with a nontargeting control, FHsiRNA, or FLsiRNA, the cells were rinsed and incubated in serum-free

    Journal:

    Article Title: Altered Ferritin Subunit Composition: Change in Iron Metabolism in Lens Epithelial Cells and Downstream Effects on Glutathione Levels and VEGF Secretion

    doi: 10.1167/iovs.09-3861

    Figure Lengend Snippet: Effect of siRNA knockdown of ferritin H- and L-chain on transferrin receptor and iron uptake in LECs. ( A ) TfR Western blot. Twenty-four hours after transfection with a nontargeting control, FHsiRNA, or FLsiRNA, the cells were rinsed and incubated in serum-free

    Article Snippet: Total RNA was extracted from cultured LECs, 24 hours after transfection with CTL, FH, or FLsiRNA (RNeasy kit and Qiashredders; Qiagen, Valencia CA) according to the manufacturer's protocol.

    Techniques: Western Blot, Transfection, Incubation

    Effect of ferritin H- and L-chain siRNA on cystine uptake and GSH concentration 4 days after transfection. LECs were transfected with either nontargeting control, FHsiRNA, or FLsiRNA, lysed, and intracellular GSH measured in the lysates. In a parallel

    Journal:

    Article Title: Altered Ferritin Subunit Composition: Change in Iron Metabolism in Lens Epithelial Cells and Downstream Effects on Glutathione Levels and VEGF Secretion

    doi: 10.1167/iovs.09-3861

    Figure Lengend Snippet: Effect of ferritin H- and L-chain siRNA on cystine uptake and GSH concentration 4 days after transfection. LECs were transfected with either nontargeting control, FHsiRNA, or FLsiRNA, lysed, and intracellular GSH measured in the lysates. In a parallel

    Article Snippet: Total RNA was extracted from cultured LECs, 24 hours after transfection with CTL, FH, or FLsiRNA (RNeasy kit and Qiashredders; Qiagen, Valencia CA) according to the manufacturer's protocol.

    Techniques: Concentration Assay, Transfection

    Effect of H- and L-chain siRNA on iron incorporation into ferritin. ( A ) Two and 4 days after transfection with either nontargeting control, FHsiRNA, or FLsiRNA, LECs were incubated for 20 hours with 59 Fe-transferrin. After cell lysis, proteins were precipitated

    Journal:

    Article Title: Altered Ferritin Subunit Composition: Change in Iron Metabolism in Lens Epithelial Cells and Downstream Effects on Glutathione Levels and VEGF Secretion

    doi: 10.1167/iovs.09-3861

    Figure Lengend Snippet: Effect of H- and L-chain siRNA on iron incorporation into ferritin. ( A ) Two and 4 days after transfection with either nontargeting control, FHsiRNA, or FLsiRNA, LECs were incubated for 20 hours with 59 Fe-transferrin. After cell lysis, proteins were precipitated

    Article Snippet: Total RNA was extracted from cultured LECs, 24 hours after transfection with CTL, FH, or FLsiRNA (RNeasy kit and Qiashredders; Qiagen, Valencia CA) according to the manufacturer's protocol.

    Techniques: Transfection, Incubation, Lysis

    Ionized calcium-binding adaptor molecule 1 immunostaining on flatmounted retinas. A – B : Example of flatmounted retinas from rat eyes with endotoxin-induced uveitis (EIU) injected with vehicle ( A ) or with antivascular endothelial growth factor (VEGF) antibodies ( B ); Bar = 50 µm. Arrowhead show round reactive ionized calcium-binding adaptor molecule 1 (IBA1)-positive cells. C – D : Extraction of cell contours used for automatic labeling of IBA1 staining. E - F : Quantification of round and total IBA-1 positive cells on flat-mounted retina from EIU control and anti-VEGF treated eyes. Bar = 50 µm.

    Journal: Molecular Vision

    Article Title: Anti-vascular endothelial growth factor acts on retinal microglia/macrophage activation in a rat model of ocular inflammation

    doi:

    Figure Lengend Snippet: Ionized calcium-binding adaptor molecule 1 immunostaining on flatmounted retinas. A – B : Example of flatmounted retinas from rat eyes with endotoxin-induced uveitis (EIU) injected with vehicle ( A ) or with antivascular endothelial growth factor (VEGF) antibodies ( B ); Bar = 50 µm. Arrowhead show round reactive ionized calcium-binding adaptor molecule 1 (IBA1)-positive cells. C – D : Extraction of cell contours used for automatic labeling of IBA1 staining. E - F : Quantification of round and total IBA-1 positive cells on flat-mounted retina from EIU control and anti-VEGF treated eyes. Bar = 50 µm.

    Article Snippet: Total RNA was isolated from neuroretinas from anti-VEGF and vehicle-injected EIU rat eyes (n = 5 eyes of five rats per group; RNeasy Plus Mini Kit; Qiagen, Courtaboeuf, France).

    Techniques: Binding Assay, Immunostaining, Injection, Labeling, Staining

    Ionized calcium-binding adaptor molecule 1 immunostaining of microglia and macrophages in endotoxin-induced uveitis at 24 h after lipopolysaccharide injection A : Retina section after vehicle intravitreal injection; in green ionized calcium-binding adaptor molecule 1 (IBA1) staining and in blue nuclei are stained with 4’,6-diamidino-2-phenyl-indole (DAPI). Arrowheads indicates round IBA1-positive cells, magnified in the inset. Bar = 50 µm, GCL = ganglion cell layer, INL = inner nuclear layer, ONL = outer nuclear layer. B : Retina section after anti-vascular endothelial growth factor (VEGF) intravitreal injection. IBA1-positive cells (in green) are ramified and elongated in the inner retina as magnified in the inset. Nuclei are stained in blue with DAPI. Bar = 50 µm, GCL = ganglion cell layer, INL = inner nuclear layer, ONL = outer nuclear layer. D – F : Choroid section after vehicle intravitreal injection stained with IBA1 ( D ) and DAPI ( F ), showing round amoeboid cells (magnified in the inset). Bar = 50 µm, RPE = retinal pigment epithelial cells. E – G : Choroid section after anti-VEGF intravitreal injection stained with IBA1 ( E ) and DAPI ( G ), showing round elongated ramified cells (magnified in the inset). Bar = 50 µm, RPE = retinal pigment epithelial cells. C and H : Quantification of round IBA1-positive cells in the inner and outer retina and in the choroid of rat eyes with EIU at 24 h, injected either with vehicle or with anti-VEGF antibody ( C ) or with control rat isotype immunoglobulin G (IgG) antibodies ( H ) *p

    Journal: Molecular Vision

    Article Title: Anti-vascular endothelial growth factor acts on retinal microglia/macrophage activation in a rat model of ocular inflammation

    doi:

    Figure Lengend Snippet: Ionized calcium-binding adaptor molecule 1 immunostaining of microglia and macrophages in endotoxin-induced uveitis at 24 h after lipopolysaccharide injection A : Retina section after vehicle intravitreal injection; in green ionized calcium-binding adaptor molecule 1 (IBA1) staining and in blue nuclei are stained with 4’,6-diamidino-2-phenyl-indole (DAPI). Arrowheads indicates round IBA1-positive cells, magnified in the inset. Bar = 50 µm, GCL = ganglion cell layer, INL = inner nuclear layer, ONL = outer nuclear layer. B : Retina section after anti-vascular endothelial growth factor (VEGF) intravitreal injection. IBA1-positive cells (in green) are ramified and elongated in the inner retina as magnified in the inset. Nuclei are stained in blue with DAPI. Bar = 50 µm, GCL = ganglion cell layer, INL = inner nuclear layer, ONL = outer nuclear layer. D – F : Choroid section after vehicle intravitreal injection stained with IBA1 ( D ) and DAPI ( F ), showing round amoeboid cells (magnified in the inset). Bar = 50 µm, RPE = retinal pigment epithelial cells. E – G : Choroid section after anti-VEGF intravitreal injection stained with IBA1 ( E ) and DAPI ( G ), showing round elongated ramified cells (magnified in the inset). Bar = 50 µm, RPE = retinal pigment epithelial cells. C and H : Quantification of round IBA1-positive cells in the inner and outer retina and in the choroid of rat eyes with EIU at 24 h, injected either with vehicle or with anti-VEGF antibody ( C ) or with control rat isotype immunoglobulin G (IgG) antibodies ( H ) *p

    Article Snippet: Total RNA was isolated from neuroretinas from anti-VEGF and vehicle-injected EIU rat eyes (n = 5 eyes of five rats per group; RNeasy Plus Mini Kit; Qiagen, Courtaboeuf, France).

    Techniques: Binding Assay, Immunostaining, Injection, Staining

    VEGF-R1 and IBA1 co-immunostaining on retinal sections retinal sections of EIU rats injected with vehicle ( A – C ) or anti-VEGF ( D – F ). GCL = ganglion cell layer, INL = inner nuclear layer, ONL = outer nuclear layer, RPE = retinal pigment epithelial cells, Chor = choroid. Insets are increased magnification (5X) of regions delimited by squares. Bar = 50 µm.

    Journal: Molecular Vision

    Article Title: Anti-vascular endothelial growth factor acts on retinal microglia/macrophage activation in a rat model of ocular inflammation

    doi:

    Figure Lengend Snippet: VEGF-R1 and IBA1 co-immunostaining on retinal sections retinal sections of EIU rats injected with vehicle ( A – C ) or anti-VEGF ( D – F ). GCL = ganglion cell layer, INL = inner nuclear layer, ONL = outer nuclear layer, RPE = retinal pigment epithelial cells, Chor = choroid. Insets are increased magnification (5X) of regions delimited by squares. Bar = 50 µm.

    Article Snippet: Total RNA was isolated from neuroretinas from anti-VEGF and vehicle-injected EIU rat eyes (n = 5 eyes of five rats per group; RNeasy Plus Mini Kit; Qiagen, Courtaboeuf, France).

    Techniques: Immunostaining, Injection

    VEGF-R2 and IBA1 coimmunostaining on retinal sections retinal sections of EIU rats injected with vehicle ( A – C ) or anti-VEGF ( D – F ). GCL = ganglion cell layer, INL = inner nuclear layer, ONL = outer nuclear layer, RPE = retinal pigment epithelial cells, Chor = choroid. Insets are increased magnification (5X) of regions delimited by squares. Bar = 50 µm.

    Journal: Molecular Vision

    Article Title: Anti-vascular endothelial growth factor acts on retinal microglia/macrophage activation in a rat model of ocular inflammation

    doi:

    Figure Lengend Snippet: VEGF-R2 and IBA1 coimmunostaining on retinal sections retinal sections of EIU rats injected with vehicle ( A – C ) or anti-VEGF ( D – F ). GCL = ganglion cell layer, INL = inner nuclear layer, ONL = outer nuclear layer, RPE = retinal pigment epithelial cells, Chor = choroid. Insets are increased magnification (5X) of regions delimited by squares. Bar = 50 µm.

    Article Snippet: Total RNA was isolated from neuroretinas from anti-VEGF and vehicle-injected EIU rat eyes (n = 5 eyes of five rats per group; RNeasy Plus Mini Kit; Qiagen, Courtaboeuf, France).

    Techniques: Injection

    Clinical and biological effects of anti-VEGF on EIU in rats. A : Clinical scoring of endotoxin-induced uveitis (EIU; n = 5 rats per group, p > 0.05). B : vascular endothelial growth factor (VEGF) ocular levels (pg/ml) at 24 h (n = 5 rats per group, p = 0.0436). C : Polymorphonuclear cell infiltration in the anterior segment (AS) and in the posterior segment (PS) of rats (five sections/ eye, five eyes per group). D : Ocular levels of interleukin (IL)1-β (πγ/μλ; n = 5, p = 0.55), E : IL-6 (pg/ml; n = 5, p = 0.068). F : Monocyte chemoattractant protein-1 (MCP-1; pg/ml; n = 5, p = 0.3132). G : Tumor necrosis factor (TNF)-α (πγ/μλ; n = 5, p = 0.7273).

    Journal: Molecular Vision

    Article Title: Anti-vascular endothelial growth factor acts on retinal microglia/macrophage activation in a rat model of ocular inflammation

    doi:

    Figure Lengend Snippet: Clinical and biological effects of anti-VEGF on EIU in rats. A : Clinical scoring of endotoxin-induced uveitis (EIU; n = 5 rats per group, p > 0.05). B : vascular endothelial growth factor (VEGF) ocular levels (pg/ml) at 24 h (n = 5 rats per group, p = 0.0436). C : Polymorphonuclear cell infiltration in the anterior segment (AS) and in the posterior segment (PS) of rats (five sections/ eye, five eyes per group). D : Ocular levels of interleukin (IL)1-β (πγ/μλ; n = 5, p = 0.55), E : IL-6 (pg/ml; n = 5, p = 0.068). F : Monocyte chemoattractant protein-1 (MCP-1; pg/ml; n = 5, p = 0.3132). G : Tumor necrosis factor (TNF)-α (πγ/μλ; n = 5, p = 0.7273).

    Article Snippet: Total RNA was isolated from neuroretinas from anti-VEGF and vehicle-injected EIU rat eyes (n = 5 eyes of five rats per group; RNeasy Plus Mini Kit; Qiagen, Courtaboeuf, France).

    Techniques: