rneasy qiagen kit  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95

    Structured Review

    Qiagen rneasy qiagen kit
    Rneasy Qiagen Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 95/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rneasy qiagen kit/product/Qiagen
    Average 95 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    rneasy qiagen kit - by Bioz Stars, 2020-02
    95/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: A controlled, parallel, cluster-randomized trial of community-wide screening and treatment of asymptomatic carriers of Plasmodium falciparum in Burkina Faso
    Article Snippet: One hundred and fifty μL of blood/RNAprotect solution were processed for quantification of gametocytes using the RNeasy Plus 96 kit (Qiagen) according to the manufacturer’s protocol with an additional on column step using the RNase-free DNase Set (Qiagen). .. Ct-values were converted into pfs25 templates/μL using standard curves generated with cloned amplicons, and subsequently transcript copy numbers were converted into gametocytes/μL by diluting visually quantified gametocytes from P . falciparum strain 3D7.

    Amplification:

    Article Title: Strategies for Detection of Plasmodium species Gametocytes
    Article Snippet: .. RNA was extracted using the RNeasy plus 96well Kit (Qiagen) with an additional on column DNase digestion step and amplified on pfs25 qRT-PCR and QMAL qPCR. .. A linear regression was applied on the log10 transformed copy numbers of the gametocyte trend line by R version 2.14.0 [ ].

    Quantitative RT-PCR:

    Article Title: Strategies for Detection of Plasmodium species Gametocytes
    Article Snippet: .. RNA was extracted using the RNeasy plus 96well Kit (Qiagen) with an additional on column DNase digestion step and amplified on pfs25 qRT-PCR and QMAL qPCR. .. A linear regression was applied on the log10 transformed copy numbers of the gametocyte trend line by R version 2.14.0 [ ].

    Article Title: Infectivity of symptomatic and asymptomatic Plasmodium vivax infections to a Southeast Asian vector, Anopheles dirus
    Article Snippet: Paragraph title: 2.6. qRT-PCR analyses ... RNA was extracted from 100 μl of whole blood in 500 μl of RNAprotect Cell Reagent and eluted with 50 μl of elution buffer, following the instruction of the RNeasy Plus 96 kit (Qiagen).

    Article Title: Limited Degradation of the Plasmodium falciparum Gametocyte Marker pfs25 mRNA Exposed to Tropical Temperatures: Considerations for Malaria Transmission Field Studies
    Article Snippet: After 1 week of −80°C storage, the RNAprotect-preserved samples were thawed and RNA extraction was performed using a Qiagen RNeasy 96 Plus Kit as described elsewhere with the slight modification to elute the extracted RNA in 60 μL of RNase-Free Water (Qiagen, Hilden, Germany). .. TaqMan one-step RT-qPCR targeting the pfs25 transcript was used to detect and quantify the presence of gametocytes in the experimental samples., The assay and primers have been described previously.

    Article Title: Engineered zinc-finger transcription factors activate OCT4 (POU5F1), SOX2, KLF4, c-MYC (MYC) and miR302/367
    Article Snippet: Paragraph title: Real-time RT-PCR analysis ... Total RNA was isolated from all cells using RNeasy Plus 96 Kit (Qiagen) or RNeasy Plus Mini Kit (Qiagen).

    Electrophoresis:

    Article Title: Host age and Plasmodium falciparum multiclonality are associated with gametocyte prevalence: a 1-year prospective cohort study
    Article Snippet: Total RNA extraction was performed using the RNeasy Plus 96 Kit (Qiagen), with an additional on-column DNase I treatment to eliminate any remaining contaminating genomic DNA (gDNA). .. Prior to the RT-PCR assay for gametocyte detection, all extracted RNA samples were tested for gDNA contamination with a 40-cycle Pfs25-targeted PCR, which was analysed with the LabChip GX and the HT-DNA 5 K LabChip capillary electrophoresis setup in accordance with the manufacturer’s protocol (Caliper Life Sciences).

    Incubation:

    Article Title: Limited Degradation of the Plasmodium falciparum Gametocyte Marker pfs25 mRNA Exposed to Tropical Temperatures: Considerations for Malaria Transmission Field Studies
    Article Snippet: Heparin and EDTA gametocyte preparations were further split for incubation at 4°C or 30°C resulting in four experimental treatments (i.e., heparin or EDTA at 4°C or 30°C). .. After 1 week of −80°C storage, the RNAprotect-preserved samples were thawed and RNA extraction was performed using a Qiagen RNeasy 96 Plus Kit as described elsewhere with the slight modification to elute the extracted RNA in 60 μL of RNase-Free Water (Qiagen, Hilden, Germany).

    Article Title: Novel Genotyping Tools for Investigating Transmission Dynamics of Plasmodium falciparum
    Article Snippet: RNeasy Plus 96 kit (Qiagen) was used as previously described [ ]. .. The gDNA was eluted twice in 50 µL of 40°C prewarmed AE elution buffer (Qiagen) following 30 minutes incubation.

    Expressing:

    Article Title: Host age and Plasmodium falciparum multiclonality are associated with gametocyte prevalence: a 1-year prospective cohort study
    Article Snippet: Using whole blood samples collected in RNAprotect® Cell Reagent, P. falciparum gametocyte prevalence was measured by RT-PCR targeting expression of the female gametocyte specific Pfs25 gene. .. Total RNA extraction was performed using the RNeasy Plus 96 Kit (Qiagen), with an additional on-column DNase I treatment to eliminate any remaining contaminating genomic DNA (gDNA).

    Article Title: Primary cell-based phenotypic assays to pharmacologically and genetically study fibrotic diseases in vitro
    Article Snippet: .. Gene expression analysis For determination of siRNA mediated gene knock down, cells were lysed and RNA was prepared using the RNeasy Plus 96 Kit according to the manufacture’s protocol. .. 2 μg of total RNA was reverse transcribed with the High-Capacity cDNA Reverse Transcription Kit as described in the supplier’s protocol. qPCR with 2μl of cDNA and gene-specific TaqMan Assays (TGFBR1: Hs00610320_m1; ACTA2: Hs00909449_m1, RNA-polymerase II amplification primers: GCAAGCGGATTCCATTTGG and TCTCAGGCCCGTAGTCATCCT, probe: AAGCACCGGACTCTTGCCTCACTTCATC) was performed as suggested in the manual.

    Article Title: A controlled, parallel, cluster-randomized trial of community-wide screening and treatment of asymptomatic carriers of Plasmodium falciparum in Burkina Faso
    Article Snippet: One hundred and fifty μL of blood/RNAprotect solution were processed for quantification of gametocytes using the RNeasy Plus 96 kit (Qiagen) according to the manufacturer’s protocol with an additional on column step using the RNase-free DNase Set (Qiagen). .. A qPCR was performed to demonstrate absence of genomic DNA using the TaqMan gene expression Master Mix (Applied Biosystems).

    Article Title: Primary cell-based phenotypic assays to pharmacologically and genetically study fibrotic diseases in vitro
    Article Snippet: Edit-R lentiviral Basticidin-Cas9-Nuclease expressing particles were obtained from Dharmacon. .. RNeasy Plus 96 Kit was from Qiagen.

    Article Title: Toll-Like Receptor 8 Is a Major Sensor of Group B Streptococcus But Not Escherichia coli in Human Primary Monocytes and Macrophages
    Article Snippet: The transfection was repeated after 3 days, and the silenced MDM were infected with bacteria or stimulated with ligands for 4 h. RNA was isolated with an RNeasy 96 Plus kit (Qiagen), cDNA was transcribed with a Maxima cDNA synthesis kit (Thermo Fisher Scientific), and relative quantification by qPCR was done with StepOnePlus using TaqMan probes (Life Technologies) and Perfecta qPCR FastMix from Quanta. .. TBP served as endogenous control, and relative expression was calculated as fold induction by stimulation or infection.

    Article Title: Improvement of culture conditions for long-term in vitro culture of Plasmodium vivax
    Article Snippet: The total RNA was extracted by using the RNeasy® plus 96 (74192, Qiagen) according to manufacturer’s protocol. .. To amplify the P. vivax -specific 18s rRNA, QMAL forward primer (Qmal_Fw) 5′-TTA GAT TGC TTC CTT CAG TRC CTT ATG-3′, Qmal reverse primer (Qmal_Rev) 5′-TGT TGA GTC AAA TTA AGC CGC AA-3′, Qmal probe 5′-FAM-TCA ATT CTT TTA ACT TTC TCG CTT GCG CGA-BHQ1-3′ and TaqMan® Gene Expression Master mix (4369016, Lifetechnologies) were used.

    Article Title: Engineered zinc-finger transcription factors activate OCT4 (POU5F1), SOX2, KLF4, c-MYC (MYC) and miR302/367
    Article Snippet: Total RNA was isolated from all cells using RNeasy Plus 96 Kit (Qiagen) or RNeasy Plus Mini Kit (Qiagen). .. Human OCT4 , SOX2 and KLF4 and c-MYC Taqman gene expression assays (Hs03005111_g1, Hs04234836_s1, Hs00358836_m1 and Hs00153408_m1, respectively) and Human PPIA Endogenous Control Taqman assay (4326316E) were from Life Technologies.

    Modification:

    Article Title: Strategies for Detection of Plasmodium species Gametocytes
    Article Snippet: At day 0, regular medium was added to the gametocytes (modified after [ ]). .. RNA was extracted using the RNeasy plus 96well Kit (Qiagen) with an additional on column DNase digestion step and amplified on pfs25 qRT-PCR and QMAL qPCR.

    Article Title: Limited Degradation of the Plasmodium falciparum Gametocyte Marker pfs25 mRNA Exposed to Tropical Temperatures: Considerations for Malaria Transmission Field Studies
    Article Snippet: .. After 1 week of −80°C storage, the RNAprotect-preserved samples were thawed and RNA extraction was performed using a Qiagen RNeasy 96 Plus Kit as described elsewhere with the slight modification to elute the extracted RNA in 60 μL of RNase-Free Water (Qiagen, Hilden, Germany). .. TaqMan one-step RT-qPCR targeting the pfs25 transcript was used to detect and quantify the presence of gametocytes in the experimental samples., The assay and primers have been described previously.

    Transformation Assay:

    Article Title: Strategies for Detection of Plasmodium species Gametocytes
    Article Snippet: RNA was extracted using the RNeasy plus 96well Kit (Qiagen) with an additional on column DNase digestion step and amplified on pfs25 qRT-PCR and QMAL qPCR. .. A linear regression was applied on the log10 transformed copy numbers of the gametocyte trend line by R version 2.14.0 [ ].

    Electroporation:

    Article Title: Primary cell-based phenotypic assays to pharmacologically and genetically study fibrotic diseases in vitro
    Article Snippet: For Cas9-RNP electroporation, the Nucleofector System and 96-well shuttle device together with the Nucleofector Primary Solution P3 from Lonza was used. .. RNeasy Plus 96 Kit was from Qiagen.

    Transfection:

    Article Title: Toll-Like Receptor 8 Is a Major Sensor of Group B Streptococcus But Not Escherichia coli in Human Primary Monocytes and Macrophages
    Article Snippet: .. The transfection was repeated after 3 days, and the silenced MDM were infected with bacteria or stimulated with ligands for 4 h. RNA was isolated with an RNeasy 96 Plus kit (Qiagen), cDNA was transcribed with a Maxima cDNA synthesis kit (Thermo Fisher Scientific), and relative quantification by qPCR was done with StepOnePlus using TaqMan probes (Life Technologies) and Perfecta qPCR FastMix from Quanta. .. Probes used were: IFNβ, Hs01077958_s1; TNF, Hs00174128_m1; IL-6 Hs00985639_m1; IL-12A Hs1073447_m1; TBP, Hs00427620_m1, IKKβ Hs00233287_m1, cGAS/MB21D1 Hs00403553_m1, MyD88 Hs00182082_m1, STING/TMEM173 Hs00736958_m1, TLR7 Hs00152971_m1, TLR8 Hs00607866_mH, IRF5 Hs00158114_m1, and TBK1 Hs00179410_m1.

    Infection:

    Article Title: Host age and Plasmodium falciparum multiclonality are associated with gametocyte prevalence: a 1-year prospective cohort study
    Article Snippet: Paragraph title: Molecular detection of Plasmodium falciparum infection and gametocyte carriage ... Total RNA extraction was performed using the RNeasy Plus 96 Kit (Qiagen), with an additional on-column DNase I treatment to eliminate any remaining contaminating genomic DNA (gDNA).

    Article Title: Toll-Like Receptor 8 Is a Major Sensor of Group B Streptococcus But Not Escherichia coli in Human Primary Monocytes and Macrophages
    Article Snippet: .. The transfection was repeated after 3 days, and the silenced MDM were infected with bacteria or stimulated with ligands for 4 h. RNA was isolated with an RNeasy 96 Plus kit (Qiagen), cDNA was transcribed with a Maxima cDNA synthesis kit (Thermo Fisher Scientific), and relative quantification by qPCR was done with StepOnePlus using TaqMan probes (Life Technologies) and Perfecta qPCR FastMix from Quanta. .. Probes used were: IFNβ, Hs01077958_s1; TNF, Hs00174128_m1; IL-6 Hs00985639_m1; IL-12A Hs1073447_m1; TBP, Hs00427620_m1, IKKβ Hs00233287_m1, cGAS/MB21D1 Hs00403553_m1, MyD88 Hs00182082_m1, STING/TMEM173 Hs00736958_m1, TLR7 Hs00152971_m1, TLR8 Hs00607866_mH, IRF5 Hs00158114_m1, and TBK1 Hs00179410_m1.

    Generated:

    Article Title: A controlled, parallel, cluster-randomized trial of community-wide screening and treatment of asymptomatic carriers of Plasmodium falciparum in Burkina Faso
    Article Snippet: One hundred and fifty μL of blood/RNAprotect solution were processed for quantification of gametocytes using the RNeasy Plus 96 kit (Qiagen) according to the manufacturer’s protocol with an additional on column step using the RNase-free DNase Set (Qiagen). .. Ct-values were converted into pfs25 templates/μL using standard curves generated with cloned amplicons, and subsequently transcript copy numbers were converted into gametocytes/μL by diluting visually quantified gametocytes from P . falciparum strain 3D7.

    Article Title: Cytokine production by activated plasmacytoid dendritic cells and natural killer cells is suppressed by an IRAK4 inhibitor
    Article Snippet: RNA sequencing pDCs from four healthy individuals were stimulated with RNA-IC for 6 h. RNA (RNA integrity number (RIN) ≥ 8) was extracted by the RNeasy 96 plus kit (Qiagen). .. Gene-level quantifications were generated with featureCounts software (v.1.4.4) [ ] and Sailfish (version 0.9.0) [ ].

    Article Title: Ultra-Sensitive Detection of Plasmodium falciparum by Amplification of Multi-Copy Subtelomeric Targets
    Article Snippet: DNA was extracted from the entire volume of these pools using the RNeasy Plus 96 Kit (Qiagen) as described above, and DNA was eluted in 100 μl (five-sample pools) or 200 μl (ten-sample pools). .. In total we generated 20 pools of five samples, five of which contained a P . falciparum –positive sample, and ten pools of ten samples, two of which contained a positive sample.

    Article Title: Improvement of culture conditions for long-term in vitro culture of Plasmodium vivax
    Article Snippet: The total RNA was extracted by using the RNeasy® plus 96 (74192, Qiagen) according to manufacturer’s protocol. .. Standard curve was generated from assay-specific control plasmid at concentration of 102 –106 copies/reaction.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Host age and Plasmodium falciparum multiclonality are associated with gametocyte prevalence: a 1-year prospective cohort study
    Article Snippet: Using whole blood samples collected in RNAprotect® Cell Reagent, P. falciparum gametocyte prevalence was measured by RT-PCR targeting expression of the female gametocyte specific Pfs25 gene. .. Total RNA extraction was performed using the RNeasy Plus 96 Kit (Qiagen), with an additional on-column DNase I treatment to eliminate any remaining contaminating genomic DNA (gDNA).

    Article Title: Comparison of three methods for detection of gametocytes in Melanesian children treated for uncomplicated malaria
    Article Snippet: It should be noted that it takes only approximately 5 min to scan every field on an MF slide for gametocytes using 1,000× magnification, as the preparations contained very few cells. iii) RTPCR: Samples collected in the RNA preservation reagent were transferred to a -80°C freezer as soon as possible (usually on the same day) after collection. .. RNA was extracted from the preserved samples using the Qiagen RNeasy 96 Plus kit (Qiagen, Doncaster, VIC, Australia) following manufacturer’s instructions with slight modifications.

    Software:

    Article Title: Cytokine production by activated plasmacytoid dendritic cells and natural killer cells is suppressed by an IRAK4 inhibitor
    Article Snippet: RNA sequencing pDCs from four healthy individuals were stimulated with RNA-IC for 6 h. RNA (RNA integrity number (RIN) ≥ 8) was extracted by the RNeasy 96 plus kit (Qiagen). .. Gene-level quantifications were generated with featureCounts software (v.1.4.4) [ ] and Sailfish (version 0.9.0) [ ].

    Magnetic Cell Separation:

    Article Title: Comparison of three methods for detection of gametocytes in Melanesian children treated for uncomplicated malaria
    Article Snippet: The samples were then magnetically fractionated as previously described using MACS equipment (Miltenyi Biotec, Bergisch Gladbach, Germany) [ ] After passage of each sample through the columns, the columns were washed twice with 1 mL of MF buffer. .. RNA was extracted from the preserved samples using the Qiagen RNeasy 96 Plus kit (Qiagen, Doncaster, VIC, Australia) following manufacturer’s instructions with slight modifications.

    DNA Extraction:

    Article Title: Ultra-Sensitive Detection of Plasmodium falciparum by Amplification of Multi-Copy Subtelomeric Targets
    Article Snippet: DNA of PNG samples was extracted using the FavorPrep 96-well Genomic DNA Extraction Kit (Favorgen) from blood cell fractions of 50–150 μl, eluted in 200 μl of elution buffer, and stored at −20°C. .. DNA was co-extracted during RNA extraction using the RNeasy Plus 96 Kit (Qiagen).

    RNA Sequencing Assay:

    Article Title: Cytokine production by activated plasmacytoid dendritic cells and natural killer cells is suppressed by an IRAK4 inhibitor
    Article Snippet: .. RNA sequencing pDCs from four healthy individuals were stimulated with RNA-IC for 6 h. RNA (RNA integrity number (RIN) ≥ 8) was extracted by the RNeasy 96 plus kit (Qiagen). .. RNA libraries were prepared with the TruSeq Stranded mRNA kit and sequenced by NextSeq500 (Illumina).

    Isolation:

    Article Title: Toll-Like Receptor 8 Is a Major Sensor of Group B Streptococcus But Not Escherichia coli in Human Primary Monocytes and Macrophages
    Article Snippet: .. The transfection was repeated after 3 days, and the silenced MDM were infected with bacteria or stimulated with ligands for 4 h. RNA was isolated with an RNeasy 96 Plus kit (Qiagen), cDNA was transcribed with a Maxima cDNA synthesis kit (Thermo Fisher Scientific), and relative quantification by qPCR was done with StepOnePlus using TaqMan probes (Life Technologies) and Perfecta qPCR FastMix from Quanta. .. Probes used were: IFNβ, Hs01077958_s1; TNF, Hs00174128_m1; IL-6 Hs00985639_m1; IL-12A Hs1073447_m1; TBP, Hs00427620_m1, IKKβ Hs00233287_m1, cGAS/MB21D1 Hs00403553_m1, MyD88 Hs00182082_m1, STING/TMEM173 Hs00736958_m1, TLR7 Hs00152971_m1, TLR8 Hs00607866_mH, IRF5 Hs00158114_m1, and TBK1 Hs00179410_m1.

    Article Title: Ultra-Sensitive Detection of Plasmodium falciparum by Amplification of Multi-Copy Subtelomeric Targets
    Article Snippet: Negative samples were prepared by mixing 50 μl of blood from a malaria-negative blood donor with 250 μl of RNAprotect Cell Reagent (Qiagen) to permit simultaneous DNA and RNA isolation. .. DNA was extracted from the entire volume of these pools using the RNeasy Plus 96 Kit (Qiagen) as described above, and DNA was eluted in 100 μl (five-sample pools) or 200 μl (ten-sample pools).

    Article Title: Engineered zinc-finger transcription factors activate OCT4 (POU5F1), SOX2, KLF4, c-MYC (MYC) and miR302/367
    Article Snippet: .. Total RNA was isolated from all cells using RNeasy Plus 96 Kit (Qiagen) or RNeasy Plus Mini Kit (Qiagen). .. The levels of target gene mRNA and PPIA (cyclophilin A) endogenous control mRNA were measured by real-time quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) using Quantitative RT-PCR ReadyMix (QR0100), as recommended by the manufacturer.

    Purification:

    Article Title: Strategies for Detection of Plasmodium species Gametocytes
    Article Snippet: At day 12, gametocytes were purified by a percoll gradient [ ] and counted in a Neubauer Cell Count Chamber at 3 different concentrations. .. RNA was extracted using the RNeasy plus 96well Kit (Qiagen) with an additional on column DNase digestion step and amplified on pfs25 qRT-PCR and QMAL qPCR.

    Article Title: Infectivity of symptomatic and asymptomatic Plasmodium vivax infections to a Southeast Asian vector, Anopheles dirus
    Article Snippet: RNA was extracted from 100 μl of whole blood in 500 μl of RNAprotect Cell Reagent and eluted with 50 μl of elution buffer, following the instruction of the RNeasy Plus 96 kit (Qiagen). .. A genus-specific quantitative PCR (qPCR) assay, QMAL , using 4 μl of purified RNA as template, was performed on all RNA samples to ensure there was no contamination of genomic DNA.

    Polymerase Chain Reaction:

    Article Title: Host age and Plasmodium falciparum multiclonality are associated with gametocyte prevalence: a 1-year prospective cohort study
    Article Snippet: Total RNA extraction was performed using the RNeasy Plus 96 Kit (Qiagen), with an additional on-column DNase I treatment to eliminate any remaining contaminating genomic DNA (gDNA). .. Prior to the RT-PCR assay for gametocyte detection, all extracted RNA samples were tested for gDNA contamination with a 40-cycle Pfs25-targeted PCR, which was analysed with the LabChip GX and the HT-DNA 5 K LabChip capillary electrophoresis setup in accordance with the manufacturer’s protocol (Caliper Life Sciences).

    Article Title: Primary cell-based phenotypic assays to pharmacologically and genetically study fibrotic diseases in vitro
    Article Snippet: RNeasy Plus 96 Kit was from Qiagen. .. Direct PCR Lysis Reagent was from Peqlab, proteinase K from Macherey Nagel.

    Article Title: Engineered zinc-finger transcription factors activate OCT4 (POU5F1), SOX2, KLF4, c-MYC (MYC) and miR302/367
    Article Snippet: Total RNA was isolated from all cells using RNeasy Plus 96 Kit (Qiagen) or RNeasy Plus Mini Kit (Qiagen). .. The levels of target gene mRNA and PPIA (cyclophilin A) endogenous control mRNA were measured by real-time quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) using Quantitative RT-PCR ReadyMix (QR0100), as recommended by the manufacturer.

    CRISPR:

    Article Title: Primary cell-based phenotypic assays to pharmacologically and genetically study fibrotic diseases in vitro
    Article Snippet: ; Edit-R Human ACTA2 crRNA: CR-003450-02; Edit-R DNMT3B Control Kit: U-007010-05; Edit-R CRISPR-Cas9 Synthetic tracrRNA: U-002005-05) and synthetic ON-Traget Plus SMART Pool siRNAs (ON-TARGETplus Non-targeting Pool: D-001810-10-05; ON-TARGETplus TGFBR1: L-003929-00-0005; ON-TARGETplus ACTA2: L-003450-00-0005) were purchased. .. RNeasy Plus 96 Kit was from Qiagen.

    Nested PCR:

    Article Title: Host age and Plasmodium falciparum multiclonality are associated with gametocyte prevalence: a 1-year prospective cohort study
    Article Snippet: Molecular detection of Plasmodium falciparum infection and gametocyte carriage DBS samples were screened for P. falciparum infection by species-specific nested-PCR as previously described [ ]. .. Total RNA extraction was performed using the RNeasy Plus 96 Kit (Qiagen), with an additional on-column DNase I treatment to eliminate any remaining contaminating genomic DNA (gDNA).

    Activated Clotting Time Assay:

    Article Title: Improvement of culture conditions for long-term in vitro culture of Plasmodium vivax
    Article Snippet: The total RNA was extracted by using the RNeasy® plus 96 (74192, Qiagen) according to manufacturer’s protocol. .. To amplify the P. vivax -specific 18s rRNA, QMAL forward primer (Qmal_Fw) 5′-TTA GAT TGC TTC CTT CAG TRC CTT ATG-3′, Qmal reverse primer (Qmal_Rev) 5′-TGT TGA GTC AAA TTA AGC CGC AA-3′, Qmal probe 5′-FAM-TCA ATT CTT TTA ACT TTC TCG CTT GCG CGA-BHQ1-3′ and TaqMan® Gene Expression Master mix (4369016, Lifetechnologies) were used.

    Plasmid Preparation:

    Article Title: Limited Degradation of the Plasmodium falciparum Gametocyte Marker pfs25 mRNA Exposed to Tropical Temperatures: Considerations for Malaria Transmission Field Studies
    Article Snippet: After 1 week of −80°C storage, the RNAprotect-preserved samples were thawed and RNA extraction was performed using a Qiagen RNeasy 96 Plus Kit as described elsewhere with the slight modification to elute the extracted RNA in 60 μL of RNase-Free Water (Qiagen, Hilden, Germany). .. Each detection experiment included duplicate plasmid controls containing the pfs25 target product (at 104 , 103 , 102 , 10, 5, and 1 copies/μL) to estimate gametocyte densities as pfs25 transcript copies/μL.

    Article Title: Improvement of culture conditions for long-term in vitro culture of Plasmodium vivax
    Article Snippet: The total RNA was extracted by using the RNeasy® plus 96 (74192, Qiagen) according to manufacturer’s protocol. .. Standard curve was generated from assay-specific control plasmid at concentration of 102 –106 copies/reaction.

    TaqMan Assay:

    Article Title: Engineered zinc-finger transcription factors activate OCT4 (POU5F1), SOX2, KLF4, c-MYC (MYC) and miR302/367
    Article Snippet: Total RNA was isolated from all cells using RNeasy Plus 96 Kit (Qiagen) or RNeasy Plus Mini Kit (Qiagen). .. Human OCT4 , SOX2 and KLF4 and c-MYC Taqman gene expression assays (Hs03005111_g1, Hs04234836_s1, Hs00358836_m1 and Hs00153408_m1, respectively) and Human PPIA Endogenous Control Taqman assay (4326316E) were from Life Technologies.

    Real-time Polymerase Chain Reaction:

    Article Title: Ultra-Sensitive Detection of Plasmodium falciparum by Amplification of Multi-Copy Subtelomeric Targets
    Article Snippet: DNA was co-extracted during RNA extraction using the RNeasy Plus 96 Kit (Qiagen). .. TARE-2, var ATS, and 18S rRNA qPCR were performed once on each TZ DNA sample.

    Article Title: A controlled, parallel, cluster-randomized trial of community-wide screening and treatment of asymptomatic carriers of Plasmodium falciparum in Burkina Faso
    Article Snippet: One hundred and fifty μL of blood/RNAprotect solution were processed for quantification of gametocytes using the RNeasy Plus 96 kit (Qiagen) according to the manufacturer’s protocol with an additional on column step using the RNase-free DNase Set (Qiagen). .. A qPCR was performed to demonstrate absence of genomic DNA using the TaqMan gene expression Master Mix (Applied Biosystems).

    Article Title: Strategies for Detection of Plasmodium species Gametocytes
    Article Snippet: .. RNA was extracted using the RNeasy plus 96well Kit (Qiagen) with an additional on column DNase digestion step and amplified on pfs25 qRT-PCR and QMAL qPCR. .. A linear regression was applied on the log10 transformed copy numbers of the gametocyte trend line by R version 2.14.0 [ ].

    Article Title: Infectivity of symptomatic and asymptomatic Plasmodium vivax infections to a Southeast Asian vector, Anopheles dirus
    Article Snippet: RNA was extracted from 100 μl of whole blood in 500 μl of RNAprotect Cell Reagent and eluted with 50 μl of elution buffer, following the instruction of the RNeasy Plus 96 kit (Qiagen). .. A genus-specific quantitative PCR (qPCR) assay, QMAL , using 4 μl of purified RNA as template, was performed on all RNA samples to ensure there was no contamination of genomic DNA.

    Article Title: Toll-Like Receptor 8 Is a Major Sensor of Group B Streptococcus But Not Escherichia coli in Human Primary Monocytes and Macrophages
    Article Snippet: .. The transfection was repeated after 3 days, and the silenced MDM were infected with bacteria or stimulated with ligands for 4 h. RNA was isolated with an RNeasy 96 Plus kit (Qiagen), cDNA was transcribed with a Maxima cDNA synthesis kit (Thermo Fisher Scientific), and relative quantification by qPCR was done with StepOnePlus using TaqMan probes (Life Technologies) and Perfecta qPCR FastMix from Quanta. .. Probes used were: IFNβ, Hs01077958_s1; TNF, Hs00174128_m1; IL-6 Hs00985639_m1; IL-12A Hs1073447_m1; TBP, Hs00427620_m1, IKKβ Hs00233287_m1, cGAS/MB21D1 Hs00403553_m1, MyD88 Hs00182082_m1, STING/TMEM173 Hs00736958_m1, TLR7 Hs00152971_m1, TLR8 Hs00607866_mH, IRF5 Hs00158114_m1, and TBK1 Hs00179410_m1.

    Article Title: Ultra-Sensitive Detection of Plasmodium falciparum by Amplification of Multi-Copy Subtelomeric Targets
    Article Snippet: Generation of Pooled Samples Low-density P . falciparum –positive samples ( < 2 parasites/μl by TARE-2 qPCR, LM negative) were selected from the TZ collection and mixed with four or nine P . falciparum –negative blood samples to create pools of five or ten samples. .. DNA was extracted from the entire volume of these pools using the RNeasy Plus 96 Kit (Qiagen) as described above, and DNA was eluted in 100 μl (five-sample pools) or 200 μl (ten-sample pools).

    RNA Extraction:

    Article Title: Ultra-Sensitive Detection of Plasmodium falciparum by Amplification of Multi-Copy Subtelomeric Targets
    Article Snippet: .. DNA was co-extracted during RNA extraction using the RNeasy Plus 96 Kit (Qiagen). ..

    Article Title: Host age and Plasmodium falciparum multiclonality are associated with gametocyte prevalence: a 1-year prospective cohort study
    Article Snippet: .. Total RNA extraction was performed using the RNeasy Plus 96 Kit (Qiagen), with an additional on-column DNase I treatment to eliminate any remaining contaminating genomic DNA (gDNA). ..

    Article Title: Limited Degradation of the Plasmodium falciparum Gametocyte Marker pfs25 mRNA Exposed to Tropical Temperatures: Considerations for Malaria Transmission Field Studies
    Article Snippet: .. After 1 week of −80°C storage, the RNAprotect-preserved samples were thawed and RNA extraction was performed using a Qiagen RNeasy 96 Plus Kit as described elsewhere with the slight modification to elute the extracted RNA in 60 μL of RNase-Free Water (Qiagen, Hilden, Germany). .. TaqMan one-step RT-qPCR targeting the pfs25 transcript was used to detect and quantify the presence of gametocytes in the experimental samples., The assay and primers have been described previously.

    Preserving:

    Article Title: Comparison of three methods for detection of gametocytes in Melanesian children treated for uncomplicated malaria
    Article Snippet: It should be noted that it takes only approximately 5 min to scan every field on an MF slide for gametocytes using 1,000× magnification, as the preparations contained very few cells. iii) RTPCR: Samples collected in the RNA preservation reagent were transferred to a -80°C freezer as soon as possible (usually on the same day) after collection. .. RNA was extracted from the preserved samples using the Qiagen RNeasy 96 Plus kit (Qiagen, Doncaster, VIC, Australia) following manufacturer’s instructions with slight modifications.

    Concentration Assay:

    Article Title: Comparison of three methods for detection of gametocytes in Melanesian children treated for uncomplicated malaria
    Article Snippet: Magnetic particles (Spherotech, Lake Forest, IL, USA) were added to achieve a total known particle concentration of 100 particles per μL of blood. .. RNA was extracted from the preserved samples using the Qiagen RNeasy 96 Plus kit (Qiagen, Doncaster, VIC, Australia) following manufacturer’s instructions with slight modifications.

    Article Title: Toll-Like Receptor 8 Is a Major Sensor of Group B Streptococcus But Not Escherichia coli in Human Primary Monocytes and Macrophages
    Article Snippet: Silencing and Quantitative Real-time PCR (qPCR) A pool of four individual ON-TARGETplus siRNAs (Dharmacon) was transiently transfected using siLentFect (Bio-Rad), yielding a final concentration of 5 nM siRNA. .. The transfection was repeated after 3 days, and the silenced MDM were infected with bacteria or stimulated with ligands for 4 h. RNA was isolated with an RNeasy 96 Plus kit (Qiagen), cDNA was transcribed with a Maxima cDNA synthesis kit (Thermo Fisher Scientific), and relative quantification by qPCR was done with StepOnePlus using TaqMan probes (Life Technologies) and Perfecta qPCR FastMix from Quanta.

    Article Title: Improvement of culture conditions for long-term in vitro culture of Plasmodium vivax
    Article Snippet: The total RNA was extracted by using the RNeasy® plus 96 (74192, Qiagen) according to manufacturer’s protocol. .. Standard curve was generated from assay-specific control plasmid at concentration of 102 –106 copies/reaction.

    Cell Counting:

    Article Title: Strategies for Detection of Plasmodium species Gametocytes
    Article Snippet: At day 12, gametocytes were purified by a percoll gradient [ ] and counted in a Neubauer Cell Count Chamber at 3 different concentrations. .. RNA was extracted using the RNeasy plus 96well Kit (Qiagen) with an additional on column DNase digestion step and amplified on pfs25 qRT-PCR and QMAL qPCR.

    Lysis:

    Article Title: Primary cell-based phenotypic assays to pharmacologically and genetically study fibrotic diseases in vitro
    Article Snippet: RNeasy Plus 96 Kit was from Qiagen. .. Direct PCR Lysis Reagent was from Peqlab, proteinase K from Macherey Nagel.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • N/A
    For purification of up to 45 µg total RNA from small or low biomass samples Kit contents The RNeasy UCP Micro Kit Tissues cells low biomass samples Elution volume 10
      Buy from Supplier

    dls  (Qiagen)
    89
    Qiagen dls
    FCM detection of lipid bodies (LBs) in control C57BL/6 <t>DLs</t> and C57BL/6 DLs hosting Ds Red2 L. am amastigotes. Panel A. Representative analysis of the fluorescence of BODIPY 493/503 in <t>MHC</t> II + DLs. A1, A2. Control C57BL/6 DL cultures –i.e. not exposed to L. am amastigotes- were incubated or not at 34°C with 200 µM oleate for 21 hours. A3, A4. Ds Red2- L. am were added to DL cultures at a ratio of 5 Ds Red2- L. am per DL (+ L. am ). Oleic acid (200 µM) was added 3 hours post inoculation, (A4: +Oleate) or not (A3: −Oleate) for a further 21 hours at 34°C. Control and L. am -loaded DLs were then detached. LBs were stained with BODIPY 493/503 2 µg/ml in PBS for 30 minutes at 34°C. The cells were then incubated with anti MHC II- PE-Cy5 mAb to analyze only the MHC class II-positive DLs. FCM histograms show BODIPY 493/503 fluorescence for Ctrl (A1, A2: white histograms) and Ds Red2 L. am -hosting DLs (A3, A4) ( Ds Red2 + , black histograms) and amastigotes-free DLs ( Ds Red2 − , grey histograms). Mean fluorescence intensity was indicated for each histogram. Panel B: Statistical analysis of the BODIPY 493/503 MFI values. Mean BODIPY 493/503 fluorescence by MHC II + DLs was determined for n = 7 independent experiments. MFI in L. am -loaded cultures is shown for Ds Red2 + and Ds Red2 − DLs as black and grey bars, respectively. Statistical analyses were performed by the Mann Whitney test.
    Dls, supplied by Qiagen, used in various techniques. Bioz Stars score: 89/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dls/product/Qiagen
    Average 89 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    dls - by Bioz Stars, 2020-02
    89/100 stars
      Buy from Supplier

    79
    Qiagen p aeruginosa mus
    Schematic representations of the genetic environment of the bla OXA-18 gene (A) and the bla OXA-20 ) in P. <t>aeruginosa</t> <t>MUS.</t> The coding regions are shown as boxes, with an arrow indicating the orientation of transcription. Black circles indicate
    P Aeruginosa Mus, supplied by Qiagen, used in various techniques. Bioz Stars score: 79/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/p aeruginosa mus/product/Qiagen
    Average 79 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    p aeruginosa mus - by Bioz Stars, 2020-02
    79/100 stars
      Buy from Supplier

    99
    Qiagen rneasy mini kit
    Reverse transcription polymerase chain reaction amplification of RNA extracted from VSV‐IND and VSV‐NJ spiked bovine lymph nodes by <t>Qiagen</t> <t>RNeasy</t> mini kit. Lane 1: 100 bp marker; lanes 2–6: IND and NJ RNA with NJ Primer set; lanes 7–11: IND and NJ RNA with IND Primer set; lane 12–16: IND and NJ RNA with both IND and NJ primer sets; lane 17: Negative extraction control; lane 18: Negative PCR control; lane 19: 100 bp marker.
    Rneasy Mini Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 8428 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rneasy mini kit/product/Qiagen
    Average 99 stars, based on 8428 article reviews
    Price from $9.99 to $1999.99
    rneasy mini kit - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    Image Search Results


    FCM detection of lipid bodies (LBs) in control C57BL/6 DLs and C57BL/6 DLs hosting Ds Red2 L. am amastigotes. Panel A. Representative analysis of the fluorescence of BODIPY 493/503 in MHC II + DLs. A1, A2. Control C57BL/6 DL cultures –i.e. not exposed to L. am amastigotes- were incubated or not at 34°C with 200 µM oleate for 21 hours. A3, A4. Ds Red2- L. am were added to DL cultures at a ratio of 5 Ds Red2- L. am per DL (+ L. am ). Oleic acid (200 µM) was added 3 hours post inoculation, (A4: +Oleate) or not (A3: −Oleate) for a further 21 hours at 34°C. Control and L. am -loaded DLs were then detached. LBs were stained with BODIPY 493/503 2 µg/ml in PBS for 30 minutes at 34°C. The cells were then incubated with anti MHC II- PE-Cy5 mAb to analyze only the MHC class II-positive DLs. FCM histograms show BODIPY 493/503 fluorescence for Ctrl (A1, A2: white histograms) and Ds Red2 L. am -hosting DLs (A3, A4) ( Ds Red2 + , black histograms) and amastigotes-free DLs ( Ds Red2 − , grey histograms). Mean fluorescence intensity was indicated for each histogram. Panel B: Statistical analysis of the BODIPY 493/503 MFI values. Mean BODIPY 493/503 fluorescence by MHC II + DLs was determined for n = 7 independent experiments. MFI in L. am -loaded cultures is shown for Ds Red2 + and Ds Red2 − DLs as black and grey bars, respectively. Statistical analyses were performed by the Mann Whitney test.

    Journal: PLoS Neglected Tropical Diseases

    Article Title: Reprogramming Neutral Lipid Metabolism in Mouse Dendritic Leucocytes Hosting Live Leishmania amazonensis Amastigotes

    doi: 10.1371/journal.pntd.0002276

    Figure Lengend Snippet: FCM detection of lipid bodies (LBs) in control C57BL/6 DLs and C57BL/6 DLs hosting Ds Red2 L. am amastigotes. Panel A. Representative analysis of the fluorescence of BODIPY 493/503 in MHC II + DLs. A1, A2. Control C57BL/6 DL cultures –i.e. not exposed to L. am amastigotes- were incubated or not at 34°C with 200 µM oleate for 21 hours. A3, A4. Ds Red2- L. am were added to DL cultures at a ratio of 5 Ds Red2- L. am per DL (+ L. am ). Oleic acid (200 µM) was added 3 hours post inoculation, (A4: +Oleate) or not (A3: −Oleate) for a further 21 hours at 34°C. Control and L. am -loaded DLs were then detached. LBs were stained with BODIPY 493/503 2 µg/ml in PBS for 30 minutes at 34°C. The cells were then incubated with anti MHC II- PE-Cy5 mAb to analyze only the MHC class II-positive DLs. FCM histograms show BODIPY 493/503 fluorescence for Ctrl (A1, A2: white histograms) and Ds Red2 L. am -hosting DLs (A3, A4) ( Ds Red2 + , black histograms) and amastigotes-free DLs ( Ds Red2 − , grey histograms). Mean fluorescence intensity was indicated for each histogram. Panel B: Statistical analysis of the BODIPY 493/503 MFI values. Mean BODIPY 493/503 fluorescence by MHC II + DLs was determined for n = 7 independent experiments. MFI in L. am -loaded cultures is shown for Ds Red2 + and Ds Red2 − DLs as black and grey bars, respectively. Statistical analyses were performed by the Mann Whitney test.

    Article Snippet: DL extracted RNA integrity control Total RNA was extracted from MHC II+ DLs (RNeasy+ Mini-Kit, Qiagen) and its quality and concentration was determined using a NanoDrop ND-1000 micro-spectrophotometer (Kisker, http://www.kisker-biotech.com ) and an Agilent-2100 Bioanalyzer (Agilent, http://www.chem.agilent.com ).

    Techniques: Fluorescence, Incubation, Staining, MANN-WHITNEY

    Flow cytometric analysis of CD36 expression in C57BL/6 DLs hosting live L. am amastigotes. L. am amastigotes were added to DL cultures at a ratio of 5 amastigotes per DL. Twenty-four hours later, DLs were detached and stained successively with anti- MHC II- PE-Cy5 and CD36-PE conjugated mAbs. As the fluorescence of transgenic Ds Red2 amastigotes was quashed by the fixation step, we used 2A3-26 mAb generated in our laboratory to image intact amastigotes inside their parasitophorous vacuoles. Thus, after fixation, the DLs were first permeabilized then labelled with alexafluor480-conjugated 2A3-26 mAbs before being analysed by FCM. This analysis was performed on gated MHC II + DLs. The central dot plot shows CD36 expression and the presence of intracellular parasites. The profiles of CD36 expression and mean CD36 fluorescence value are shown for 2A3-26 + DLs (red gate) and 2A3-26 − DLs (black gate).

    Journal: PLoS Neglected Tropical Diseases

    Article Title: Reprogramming Neutral Lipid Metabolism in Mouse Dendritic Leucocytes Hosting Live Leishmania amazonensis Amastigotes

    doi: 10.1371/journal.pntd.0002276

    Figure Lengend Snippet: Flow cytometric analysis of CD36 expression in C57BL/6 DLs hosting live L. am amastigotes. L. am amastigotes were added to DL cultures at a ratio of 5 amastigotes per DL. Twenty-four hours later, DLs were detached and stained successively with anti- MHC II- PE-Cy5 and CD36-PE conjugated mAbs. As the fluorescence of transgenic Ds Red2 amastigotes was quashed by the fixation step, we used 2A3-26 mAb generated in our laboratory to image intact amastigotes inside their parasitophorous vacuoles. Thus, after fixation, the DLs were first permeabilized then labelled with alexafluor480-conjugated 2A3-26 mAbs before being analysed by FCM. This analysis was performed on gated MHC II + DLs. The central dot plot shows CD36 expression and the presence of intracellular parasites. The profiles of CD36 expression and mean CD36 fluorescence value are shown for 2A3-26 + DLs (red gate) and 2A3-26 − DLs (black gate).

    Article Snippet: DL extracted RNA integrity control Total RNA was extracted from MHC II+ DLs (RNeasy+ Mini-Kit, Qiagen) and its quality and concentration was determined using a NanoDrop ND-1000 micro-spectrophotometer (Kisker, http://www.kisker-biotech.com ) and an Agilent-2100 Bioanalyzer (Agilent, http://www.chem.agilent.com ).

    Techniques: Flow Cytometry, Expressing, Staining, Fluorescence, Transgenic Assay, Generated

    Schematic representations of the genetic environment of the bla OXA-18 gene (A) and the bla OXA-20 ) in P. aeruginosa MUS. The coding regions are shown as boxes, with an arrow indicating the orientation of transcription. Black circles indicate

    Journal:

    Article Title: Genetic Structure Associated with blaOXA-18, Encoding a Clavulanic Acid-Inhibited Extended-Spectrum Oxacillinase ▿

    doi: 10.1128/AAC.00403-08

    Figure Lengend Snippet: Schematic representations of the genetic environment of the bla OXA-18 gene (A) and the bla OXA-20 ) in P. aeruginosa MUS. The coding regions are shown as boxes, with an arrow indicating the orientation of transcription. Black circles indicate

    Article Snippet: Then, 5 μg of total RNAs extracted from P. aeruginosa MUS (Qiagen RNeasy Maxi kit) was used to determine the bla OXA-18 initiation site of transcription.

    Techniques:

    Molecular comparison of bla OXA-18 -producing P. aeruginosa isolates. (A and B) PFGE with SpeI-restricted DNA (A) and bla OXA-18 hybridization of the SpeI PFGE gel (B). Lane 1, P. aeruginosa MUS; lane 2, P. aeruginosa 1-63; lane 3, P. aeruginosa 1-22; lane

    Journal:

    Article Title: Genetic Structure Associated with blaOXA-18, Encoding a Clavulanic Acid-Inhibited Extended-Spectrum Oxacillinase ▿

    doi: 10.1128/AAC.00403-08

    Figure Lengend Snippet: Molecular comparison of bla OXA-18 -producing P. aeruginosa isolates. (A and B) PFGE with SpeI-restricted DNA (A) and bla OXA-18 hybridization of the SpeI PFGE gel (B). Lane 1, P. aeruginosa MUS; lane 2, P. aeruginosa 1-63; lane 3, P. aeruginosa 1-22; lane

    Article Snippet: Then, 5 μg of total RNAs extracted from P. aeruginosa MUS (Qiagen RNeasy Maxi kit) was used to determine the bla OXA-18 initiation site of transcription.

    Techniques: Hybridization

    Reverse transcription polymerase chain reaction amplification of RNA extracted from VSV‐IND and VSV‐NJ spiked bovine lymph nodes by Qiagen RNeasy mini kit. Lane 1: 100 bp marker; lanes 2–6: IND and NJ RNA with NJ Primer set; lanes 7–11: IND and NJ RNA with IND Primer set; lane 12–16: IND and NJ RNA with both IND and NJ primer sets; lane 17: Negative extraction control; lane 18: Negative PCR control; lane 19: 100 bp marker.

    Journal: Journal of Clinical Laboratory Analysis

    Article Title: Comparison of RNA extraction methods to augment the sensitivity for the differentiation of vesicular stomatitis virus Indiana1 and New Jersey

    doi: 10.1002/jcla.20439

    Figure Lengend Snippet: Reverse transcription polymerase chain reaction amplification of RNA extracted from VSV‐IND and VSV‐NJ spiked bovine lymph nodes by Qiagen RNeasy mini kit. Lane 1: 100 bp marker; lanes 2–6: IND and NJ RNA with NJ Primer set; lanes 7–11: IND and NJ RNA with IND Primer set; lane 12–16: IND and NJ RNA with both IND and NJ primer sets; lane 17: Negative extraction control; lane 18: Negative PCR control; lane 19: 100 bp marker.

    Article Snippet: RNA from various dilutions of each VSV type was extracted by using Qiagen RNeasy mini kit as per manufacturer's instructions (Qiagen, Valencia, CA).

    Techniques: Reverse Transcription Polymerase Chain Reaction, Amplification, Marker, Polymerase Chain Reaction

    Multiplex RT‐PCR sensitivity and specificity assay for VSV‐IND and VSV‐NJ detection. RNA extracted from serial dilutions of both types of VSV with titers of 10 3.625 TCID 50 /25 µl and 10 4.375 TCID 50 /25 µl, for IND and NJ, respectively, using Qiagen RNeasy mini kit. Lanes 2–5: typical positive VSV‐IND reactions; lane 6: negative VSV‐IND reaction; lane 7–10: positive VSV‐NJ reactions; lane 11: negative VSV‐NJ reaction; lanes 12–15: VSV‐IND and VSV‐NJ positive reactions utilizing both primer sets; lane 16: negative for VSV‐IND NJ reaction; CE: negative extraction control; CP: negative PCR control; M: DNA marker.

    Journal: Journal of Clinical Laboratory Analysis

    Article Title: Comparison of RNA extraction methods to augment the sensitivity for the differentiation of vesicular stomatitis virus Indiana1 and New Jersey

    doi: 10.1002/jcla.20439

    Figure Lengend Snippet: Multiplex RT‐PCR sensitivity and specificity assay for VSV‐IND and VSV‐NJ detection. RNA extracted from serial dilutions of both types of VSV with titers of 10 3.625 TCID 50 /25 µl and 10 4.375 TCID 50 /25 µl, for IND and NJ, respectively, using Qiagen RNeasy mini kit. Lanes 2–5: typical positive VSV‐IND reactions; lane 6: negative VSV‐IND reaction; lane 7–10: positive VSV‐NJ reactions; lane 11: negative VSV‐NJ reaction; lanes 12–15: VSV‐IND and VSV‐NJ positive reactions utilizing both primer sets; lane 16: negative for VSV‐IND NJ reaction; CE: negative extraction control; CP: negative PCR control; M: DNA marker.

    Article Snippet: RNA from various dilutions of each VSV type was extracted by using Qiagen RNeasy mini kit as per manufacturer's instructions (Qiagen, Valencia, CA).

    Techniques: Multiplex Assay, Polymerase Chain Reaction, Marker

    Reverse transcription polymerase chain reaction amplification of RNA extracted from spiked BHK‐21 cell suspensions by using Qiagen RNeasy mini kit. Lane 1: 100 bp marker; lane 2–6: IND and NJ RNA with IND Primer set; lane 7–11: IND and NJ RNA with NJ Primer set; lane 12: Negative extraction control (IND primer set); lane 13–17: IND and NJ RNA with both IND and NJ primer sets; lane 18: Negative extraction control (NJ primer set); lane 19: Negative extraction control (IND and NJ primer sets); lane 20: Negative PCR control.

    Journal: Journal of Clinical Laboratory Analysis

    Article Title: Comparison of RNA extraction methods to augment the sensitivity for the differentiation of vesicular stomatitis virus Indiana1 and New Jersey

    doi: 10.1002/jcla.20439

    Figure Lengend Snippet: Reverse transcription polymerase chain reaction amplification of RNA extracted from spiked BHK‐21 cell suspensions by using Qiagen RNeasy mini kit. Lane 1: 100 bp marker; lane 2–6: IND and NJ RNA with IND Primer set; lane 7–11: IND and NJ RNA with NJ Primer set; lane 12: Negative extraction control (IND primer set); lane 13–17: IND and NJ RNA with both IND and NJ primer sets; lane 18: Negative extraction control (NJ primer set); lane 19: Negative extraction control (IND and NJ primer sets); lane 20: Negative PCR control.

    Article Snippet: RNA from various dilutions of each VSV type was extracted by using Qiagen RNeasy mini kit as per manufacturer's instructions (Qiagen, Valencia, CA).

    Techniques: Reverse Transcription Polymerase Chain Reaction, Amplification, Marker, Polymerase Chain Reaction