rneasy plus mini kit  (Qiagen)

Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    RNeasy Plus Mini Kit
    For phenol-free total RNA extraction from cells/tissues with removal of genomic DNA contamination. Kit contents: Qiagen RNeasy Plus Mini Kit, 50 preps, 30mg Sample, 30 to 50L Elution Volume, Tissue, Cells Sample, Total RNA Purification, Silica Technology, Spin Column Format, 25 min. Time/Run, Ideal for PCR, Northern, Dot and Slot Blotting, Array Analysis, Sequencing, For Purification of Up to 100g Total RNA from Cells/tissues Using gDNA Eliminator Columns, Includes RNeasy Mini Spin Columns, gDNA Eliminator Spin Columns, Collection Tubes, RNase-free Water and Buffers. Benefits: Efficient gDNA removal with unique gDNA Eliminator columns (no need for DNase). High-quality total RNA in minutes using fast and simple extraction protocols. Phenol-free RNA isolation. Ideal for sensitive applications such as real-time RT-PCR and RNA-Seq
    Catalog Number:
    RNeasy Plus Micro and Mini Kits
    Buy from Supplier

    Structured Review

    Qiagen rneasy plus mini kit
    RNeasy Plus Mini Kit
    For phenol-free total RNA extraction from cells/tissues with removal of genomic DNA contamination. Kit contents: Qiagen RNeasy Plus Mini Kit, 50 preps, 30mg Sample, 30 to 50L Elution Volume, Tissue, Cells Sample, Total RNA Purification, Silica Technology, Spin Column Format, 25 min. Time/Run, Ideal for PCR, Northern, Dot and Slot Blotting, Array Analysis, Sequencing, For Purification of Up to 100g Total RNA from Cells/tissues Using gDNA Eliminator Columns, Includes RNeasy Mini Spin Columns, gDNA Eliminator Spin Columns, Collection Tubes, RNase-free Water and Buffers. Benefits: Efficient gDNA removal with unique gDNA Eliminator columns (no need for DNase). High-quality total RNA in minutes using fast and simple extraction protocols. Phenol-free RNA isolation. Ideal for sensitive applications such as real-time RT-PCR and RNA-Seq
    https://www.bioz.com/result/rneasy plus mini kit/product/Qiagen
    Average 99 stars, based on 617 article reviews
    Price from $9.99 to $1999.99
    rneasy plus mini kit - by Bioz Stars, 2019-12
    99/100 stars


    1) Product Images from "Activation of Melanocortin Receptors MC1 and MC5 Attenuates Retinal Damage in Experimental Diabetic Retinopathy"

    Article Title: Activation of Melanocortin Receptors MC1 and MC5 Attenuates Retinal Damage in Experimental Diabetic Retinopathy

    Journal: Mediators of Inflammation

    doi: 10.1155/2016/7368389

    Real Time PCR for the expression of melanocortin receptor subtypes within the retina. (a) Representative traces of the RT-PCR and (b) relative 2 −ΔΔCt gene expressions for MC 1 , MC 3 , and MC 5 receptors assayed after 16-week follow-up in nondiabetic mice, and diabetic mice with retinopathy. Total RNA was extracted using RNeasy Plus Mini Kit and commercially available primer for amplification of mouse MC 1 , MC 3 , and MC 5 receptors. Negative controls were either RT without enzyme or PCR without cDNA template.
    Figure Legend Snippet: Real Time PCR for the expression of melanocortin receptor subtypes within the retina. (a) Representative traces of the RT-PCR and (b) relative 2 −ΔΔCt gene expressions for MC 1 , MC 3 , and MC 5 receptors assayed after 16-week follow-up in nondiabetic mice, and diabetic mice with retinopathy. Total RNA was extracted using RNeasy Plus Mini Kit and commercially available primer for amplification of mouse MC 1 , MC 3 , and MC 5 receptors. Negative controls were either RT without enzyme or PCR without cDNA template.

    Techniques Used: Real-time Polymerase Chain Reaction, Expressing, Reverse Transcription Polymerase Chain Reaction, Mouse Assay, Amplification, Polymerase Chain Reaction

    2) Product Images from "Elimination of bacterial DNA during RNA isolation from sputum: Bashing bead vortexing is preferable over prolonged DNase treatment"

    Article Title: Elimination of bacterial DNA during RNA isolation from sputum: Bashing bead vortexing is preferable over prolonged DNase treatment

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0214609

    Representative gel electrophoresis of PCR reactions using universal bacterial primers and sputum RNA isolated with the RNeasy Plus Mini kit. Sputum cells were either subjected or not to bead vortexing (bashing or glass beads) prior to RNA isolation. Bands representing contaminating bacterial DNA are indicated. M: molecular weight marker.
    Figure Legend Snippet: Representative gel electrophoresis of PCR reactions using universal bacterial primers and sputum RNA isolated with the RNeasy Plus Mini kit. Sputum cells were either subjected or not to bead vortexing (bashing or glass beads) prior to RNA isolation. Bands representing contaminating bacterial DNA are indicated. M: molecular weight marker.

    Techniques Used: Nucleic Acid Electrophoresis, Polymerase Chain Reaction, Isolation, Molecular Weight, Marker

    Cycle threshold (Ct) values for real-time PCR assays with different base pair (bp) long amplicons of glyceraldehyde 3-phophate dehydrogenase on RNA isolated from sputum samples. Samples were subjected either to repeated digestion process (up to 6 times) with the Turbo DNA-free kit or bead vortexing prior to RNA isolation using the RNeasy Plus Mini kit equipped with the gDNA eliminator spin column (n = 6 for each group). Error bars indicate SEM. # p
    Figure Legend Snippet: Cycle threshold (Ct) values for real-time PCR assays with different base pair (bp) long amplicons of glyceraldehyde 3-phophate dehydrogenase on RNA isolated from sputum samples. Samples were subjected either to repeated digestion process (up to 6 times) with the Turbo DNA-free kit or bead vortexing prior to RNA isolation using the RNeasy Plus Mini kit equipped with the gDNA eliminator spin column (n = 6 for each group). Error bars indicate SEM. # p

    Techniques Used: Real-time Polymerase Chain Reaction, Isolation

    3) Product Images from "Ectromelia virus accumulates less double-stranded RNA compared to vaccinia virus in BS-C-1 cells"

    Article Title: Ectromelia virus accumulates less double-stranded RNA compared to vaccinia virus in BS-C-1 cells


    doi: 10.1016/j.virol.2017.06.010

    The accumulation of dsRNA greatly varies after infection with different orthopoxviruses (A) BS-C-1 cells were infected (MOI=10) with ECTV, VACV, or CPXV for 24 hrs. prior to staining for dsRNA (red) and cell nuclei/virus factories (DAPI; blue). Images were merged using ImageJ software, are at 400× total magnification, and representative of three independent trials. AraC was added at the time of infection where indicated. (B) BS-C-1 cells were infected (MOI=10) with either ECTV or VACV for 24 hrs. prior to staining intracellularly for dsRNA and analyzed using flow cytometry. Positive gates were drawn based upon the mock condition. The depicted data are representative of four independent trials. (C) Flow cytometry was used to measure dsRNA levels within infected cells as above. The data are shown in histogram format and representative of four independent trials. (D) BS-C-1 cells were infected (MOI=10) with ECTV or VACV. RNA was isolated at 24 hrs. post-infection using the RNeasy Plus Mini Kit (Qiagen) and 5 µg RNA was spotted onto a membrane. dsRNA was detected using the J2 antibody and beta-actin mRNA was detected using a biotin-labeled antisense RNA as described in the methods.
    Figure Legend Snippet: The accumulation of dsRNA greatly varies after infection with different orthopoxviruses (A) BS-C-1 cells were infected (MOI=10) with ECTV, VACV, or CPXV for 24 hrs. prior to staining for dsRNA (red) and cell nuclei/virus factories (DAPI; blue). Images were merged using ImageJ software, are at 400× total magnification, and representative of three independent trials. AraC was added at the time of infection where indicated. (B) BS-C-1 cells were infected (MOI=10) with either ECTV or VACV for 24 hrs. prior to staining intracellularly for dsRNA and analyzed using flow cytometry. Positive gates were drawn based upon the mock condition. The depicted data are representative of four independent trials. (C) Flow cytometry was used to measure dsRNA levels within infected cells as above. The data are shown in histogram format and representative of four independent trials. (D) BS-C-1 cells were infected (MOI=10) with ECTV or VACV. RNA was isolated at 24 hrs. post-infection using the RNeasy Plus Mini Kit (Qiagen) and 5 µg RNA was spotted onto a membrane. dsRNA was detected using the J2 antibody and beta-actin mRNA was detected using a biotin-labeled antisense RNA as described in the methods.

    Techniques Used: Infection, Staining, Software, Flow Cytometry, Cytometry, Isolation, Labeling

    4) Product Images from "Elimination of bacterial DNA during RNA isolation from sputum: Bashing bead vortexing is preferable over prolonged DNase treatment"

    Article Title: Elimination of bacterial DNA during RNA isolation from sputum: Bashing bead vortexing is preferable over prolonged DNase treatment

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0214609

    Cycle threshold (Ct) values for real-time PCR assays with different base pair (bp) long amplicons of glyceraldehyde 3-phophate dehydrogenase on RNA isolated from sputum samples. Samples were subjected either to repeated digestion process (up to 6 times) with the Turbo DNA-free kit or bead vortexing prior to RNA isolation using the RNeasy Plus Mini kit equipped with the gDNA eliminator spin column (n = 6 for each group). Error bars indicate SEM. # p
    Figure Legend Snippet: Cycle threshold (Ct) values for real-time PCR assays with different base pair (bp) long amplicons of glyceraldehyde 3-phophate dehydrogenase on RNA isolated from sputum samples. Samples were subjected either to repeated digestion process (up to 6 times) with the Turbo DNA-free kit or bead vortexing prior to RNA isolation using the RNeasy Plus Mini kit equipped with the gDNA eliminator spin column (n = 6 for each group). Error bars indicate SEM. # p

    Techniques Used: Real-time Polymerase Chain Reaction, Isolation

    5) Product Images from "Mutated NPM1 in combination with overexpression of Meis1 or Hoxa9 is not sufficient to induce acute myeloid leukemia"

    Article Title: Mutated NPM1 in combination with overexpression of Meis1 or Hoxa9 is not sufficient to induce acute myeloid leukemia

    Journal: Experimental Hematology & Oncology

    doi: 10.1186/s40164-016-0053-2

    Transduction of murine bone marrow cells with NPMc + , Meis1 and Hoxa9. a The table shows the combination of genes murine bone marrow cells were transduced with. b – d RNA was extracted from transduced cells using the RNeasy Plus Mini kit and analyzed by qPCR for expression of human NPM1 ( b ), human MEIS1 ( c ) and murine Hoxa9 ( d ). For all qPCR analysis n = 3. The bars indicate mean ± SD. Statistical calculations were performed using Student´s unpaired t test. *p
    Figure Legend Snippet: Transduction of murine bone marrow cells with NPMc + , Meis1 and Hoxa9. a The table shows the combination of genes murine bone marrow cells were transduced with. b – d RNA was extracted from transduced cells using the RNeasy Plus Mini kit and analyzed by qPCR for expression of human NPM1 ( b ), human MEIS1 ( c ) and murine Hoxa9 ( d ). For all qPCR analysis n = 3. The bars indicate mean ± SD. Statistical calculations were performed using Student´s unpaired t test. *p

    Techniques Used: Transduction, Real-time Polymerase Chain Reaction, Expressing

    6) Product Images from "Ectromelia virus accumulates less double-stranded RNA compared to vaccinia virus in BS-C-1 cells"

    Article Title: Ectromelia virus accumulates less double-stranded RNA compared to vaccinia virus in BS-C-1 cells


    doi: 10.1016/j.virol.2017.06.010

    The accumulation of dsRNA greatly varies after infection with different orthopoxviruses (A) BS-C-1 cells were infected (MOI=10) with ECTV, VACV, or CPXV for 24 hrs. prior to staining for dsRNA (red) and cell nuclei/virus factories (DAPI; blue). Images were merged using ImageJ software, are at 400× total magnification, and representative of three independent trials. AraC was added at the time of infection where indicated. (B) BS-C-1 cells were infected (MOI=10) with either ECTV or VACV for 24 hrs. prior to staining intracellularly for dsRNA and analyzed using flow cytometry. Positive gates were drawn based upon the mock condition. The depicted data are representative of four independent trials. (C) Flow cytometry was used to measure dsRNA levels within infected cells as above. The data are shown in histogram format and representative of four independent trials. (D) BS-C-1 cells were infected (MOI=10) with ECTV or VACV. RNA was isolated at 24 hrs. post-infection using the RNeasy Plus Mini Kit (Qiagen) and 5 µg RNA was spotted onto a membrane. dsRNA was detected using the J2 antibody and beta-actin mRNA was detected using a biotin-labeled antisense RNA as described in the methods.
    Figure Legend Snippet: The accumulation of dsRNA greatly varies after infection with different orthopoxviruses (A) BS-C-1 cells were infected (MOI=10) with ECTV, VACV, or CPXV for 24 hrs. prior to staining for dsRNA (red) and cell nuclei/virus factories (DAPI; blue). Images were merged using ImageJ software, are at 400× total magnification, and representative of three independent trials. AraC was added at the time of infection where indicated. (B) BS-C-1 cells were infected (MOI=10) with either ECTV or VACV for 24 hrs. prior to staining intracellularly for dsRNA and analyzed using flow cytometry. Positive gates were drawn based upon the mock condition. The depicted data are representative of four independent trials. (C) Flow cytometry was used to measure dsRNA levels within infected cells as above. The data are shown in histogram format and representative of four independent trials. (D) BS-C-1 cells were infected (MOI=10) with ECTV or VACV. RNA was isolated at 24 hrs. post-infection using the RNeasy Plus Mini Kit (Qiagen) and 5 µg RNA was spotted onto a membrane. dsRNA was detected using the J2 antibody and beta-actin mRNA was detected using a biotin-labeled antisense RNA as described in the methods.

    Techniques Used: Infection, Staining, Software, Flow Cytometry, Cytometry, Isolation, Labeling

    7) Product Images from "Elimination of bacterial DNA during RNA isolation from sputum: Bashing bead vortexing is preferable over prolonged DNase treatment"

    Article Title: Elimination of bacterial DNA during RNA isolation from sputum: Bashing bead vortexing is preferable over prolonged DNase treatment

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0214609

    Cycle threshold (Ct) values for real-time PCR assays with different base pair (bp) long amplicons of glyceraldehyde 3-phophate dehydrogenase on RNA isolated from sputum samples. Samples were subjected either to repeated digestion process (up to 6 times) with the Turbo DNA-free kit or bead vortexing prior to RNA isolation using the RNeasy Plus Mini kit equipped with the gDNA eliminator spin column (n = 6 for each group). Error bars indicate SEM. # p
    Figure Legend Snippet: Cycle threshold (Ct) values for real-time PCR assays with different base pair (bp) long amplicons of glyceraldehyde 3-phophate dehydrogenase on RNA isolated from sputum samples. Samples were subjected either to repeated digestion process (up to 6 times) with the Turbo DNA-free kit or bead vortexing prior to RNA isolation using the RNeasy Plus Mini kit equipped with the gDNA eliminator spin column (n = 6 for each group). Error bars indicate SEM. # p

    Techniques Used: Real-time Polymerase Chain Reaction, Isolation

    8) Product Images from "Elimination of bacterial DNA during RNA isolation from sputum: Bashing bead vortexing is preferable over prolonged DNase treatment"

    Article Title: Elimination of bacterial DNA during RNA isolation from sputum: Bashing bead vortexing is preferable over prolonged DNase treatment

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0214609

    Representative gel electrophoresis of PCR reactions using universal bacterial primers and sputum RNA isolated with the RNeasy Plus Mini kit. Sputum cells were either subjected or not to bead vortexing (bashing or glass beads) prior to RNA isolation. Bands representing contaminating bacterial DNA are indicated. M: molecular weight marker.
    Figure Legend Snippet: Representative gel electrophoresis of PCR reactions using universal bacterial primers and sputum RNA isolated with the RNeasy Plus Mini kit. Sputum cells were either subjected or not to bead vortexing (bashing or glass beads) prior to RNA isolation. Bands representing contaminating bacterial DNA are indicated. M: molecular weight marker.

    Techniques Used: Nucleic Acid Electrophoresis, Polymerase Chain Reaction, Isolation, Molecular Weight, Marker

    Cycle threshold (Ct) values for real-time PCR assays with different base pair (bp) long amplicons of glyceraldehyde 3-phophate dehydrogenase on RNA isolated from sputum samples. Samples were subjected either to repeated digestion process (up to 6 times) with the Turbo DNA-free kit or bead vortexing prior to RNA isolation using the RNeasy Plus Mini kit equipped with the gDNA eliminator spin column (n = 6 for each group). Error bars indicate SEM. # p
    Figure Legend Snippet: Cycle threshold (Ct) values for real-time PCR assays with different base pair (bp) long amplicons of glyceraldehyde 3-phophate dehydrogenase on RNA isolated from sputum samples. Samples were subjected either to repeated digestion process (up to 6 times) with the Turbo DNA-free kit or bead vortexing prior to RNA isolation using the RNeasy Plus Mini kit equipped with the gDNA eliminator spin column (n = 6 for each group). Error bars indicate SEM. # p

    Techniques Used: Real-time Polymerase Chain Reaction, Isolation

    Related Articles


    Article Title: Melanocortin receptor agonists MCR1‐5 protect photoreceptors from high‐glucose damage and restore antioxidant enzymes in primary retinal cell culture
    Article Snippet: Total RNA was extracted using RNeasy Plus Mini Kit (Qiagen, West Sussex, UK), according to the manufacturer's instructions. .. Total RNA was extracted using RNeasy Plus Mini Kit (Qiagen, West Sussex, UK), according to the manufacturer's instructions.

    Article Title: Octopamine and tyramine respectively regulate attractive and repulsive behavior in locust phase changes
    Article Snippet: Total RNA was extracted from brain tissues following the protocol of RNA easy mini kit (Qiagen). .. Total RNA was extracted from brain tissues following the protocol of RNA easy mini kit (Qiagen).

    Article Title: The Human NADPH Oxidase, Nox4, Regulates Cytoskeletal Organization in Two Cancer Cell Lines, HepG2 and SH-SY5Y
    Article Snippet: Total RNA was isolated using RNeasy Mini kits (Qiagen) and digested with DNaseI (Promega). .. Reverse transcription polymerase chain reaction was performed using the SuperScriptII reverse transcription kit (ThermoScientific) and random hexamer primers (ThermoScientific) followed by IQ SYBR Green (Bio-Rad Laboratories) real-time (RT) PCR analyses on the iQ Multi-Color real time PCR detector (Bio-Rad Laboratories).


    Article Title: “Inflamm‐aging” influences immune cell survival factors in human bone marrow
    Article Snippet: RNA was isolated from purified BMMCs using the RNeasy Plus mini kit (Qiagen). .. First‐strand cDNA synthesis was performed using a Reverse Transcription system (Promega). qRT‐PCR experiments were performed using the LightCycler 480 System (Roche Diagnostics), 2X SYBR Green 1 Master (Roche Diagnostics), and β‐actin as housekeeping gene for relative quantification of effector/memory cell survival factors.


    Article Title: Neutrophil stunning by metoprolol reduces infarct size
    Article Snippet: Before RNA isolation, neutrophil identity was confirmed by flow cytometry (anti-1A8 Ly6G) and viability evaluated. .. Total RNA from whole hearts, BM and purified neutrophils samples was isolated with the Qiagen RNeasy Plus Mini Kit.

    Quantitative RT-PCR:

    Article Title: Ribonuclease L mediates the cell-lethal phenotype of double-stranded RNA editing enzyme ADAR1 deficiency in a human cell line
    Article Snippet: Paragraph title: mRNA quantification by quantitative reverse transcriptase-PCR (qRT-PCR) ... Cells were treated with 10 U/ml of IFN-α (PBL) and 24 hr post treatment, cells were lysed in RLT Plus RNA lysis buffer (Qiagen), and RNA was isolated using the RNeasy Plus Mini Kit (Qiagen) as previously described ( ).

    Article Title: “Inflamm‐aging” influences immune cell survival factors in human bone marrow
    Article Snippet: Paragraph title: Isolation of RNA and quantitative RT‐PCR ... RNA was isolated from purified BMMCs using the RNeasy Plus mini kit (Qiagen).

    Article Title: Sensitive detection of viable circulating tumor cells using a novel conditionally telomerase-selective replicating adenovirus in non-small cell lung cancer patients
    Article Snippet: Fixed cells were analyzed using a MACSQuant® Analyzer (Miltenyi Biotec, Bergisch-Gladbach, Germany) to determine the ratio of GFP+ cells. .. Total RNA was extracted from human NSCLC cell lines using the RNeasy Plus Mini Kit (Cat No. 74134, Qiagen, Venlo, The Netherlands). qRT-PCR was performed using the PrimeScript RT reagent kit (TaKaRa, Shiga, Japan) and SYBR Premix EX Taq II (Tli RNaseH Plus, TaKaRa) on a 7500 Fast real-time PCR system (Applied Biosystems, Foster City, CA). .. The following gene-specific primers were used: hTERT F (5′-CGG AAG AGT GTC TGG AGC AA-3′), R (5′-GGA TGA AGC GGA GTC TGG A-3′), GAPDH F (5′-TCG ACA GTC AGC CGC ATC TTC TTT-3′), R (5′-ACC AAA TCC GTT GAC TCC GAC CTT-3′).

    Article Title: Octopamine and tyramine respectively regulate attractive and repulsive behavior in locust phase changes
    Article Snippet: Paragraph title: RNA preparation and qRT-PCR assay ... Total RNA was extracted from brain tissues following the protocol of RNA easy mini kit (Qiagen).

    Article Title: Nox2 contributes to hyperinsulinemia-induced redox imbalance and impaired vascular function
    Article Snippet: 2.7 Total RNA was extracted using RNeasy mini kits (Qiagen, Germantown, MD). .. 2.7 Total RNA was extracted using RNeasy mini kits (Qiagen, Germantown, MD).

    Article Title: De novo assembly and comparative transcriptome analysis of the foot from Chinese green mussel (Perna viridis) in response to cadmium stimulation
    Article Snippet: Paragraph title: Validation of the RNA-seq analyses by qRT-PCR ... Total RNAs from the foot gland samples were extracted and purified by RNeasy Animal Mini Kit (Qiagen, Valencia, CA).

    SYBR Green Assay:

    Article Title: Self-cytoplasmic DNA upregulates the mutator enzyme APOBEC3A leading to chromosomal DNA damage
    Article Snippet: Paragraph title: Real-time PCR and SYBR Green quantitative PCR ... Total RNA was extracted from THP-1 cells using RNeasy Plus Mini Kit (Qiagen) according to the manufacturer's instructions.

    Article Title: Nox2 contributes to hyperinsulinemia-induced redox imbalance and impaired vascular function
    Article Snippet: 2.7 Total RNA was extracted using RNeasy mini kits (Qiagen, Germantown, MD). .. 2.7 Total RNA was extracted using RNeasy mini kits (Qiagen, Germantown, MD).


    Article Title: JunB is essential for IL-23-dependent pathogenicity of Th17 cells
    Article Snippet: Paragraph title: Microarray analysis ... Total RNA was isolated from cells using an RNeasy Plus Mini Kit (74136, Qiagen).


    Article Title: Self-cytoplasmic DNA upregulates the mutator enzyme APOBEC3A leading to chromosomal DNA damage
    Article Snippet: Total RNA was extracted from THP-1 cells using RNeasy Plus Mini Kit (Qiagen) according to the manufacturer's instructions. .. Primers and PCR condition were described before ( ).

    Article Title: Melanocortin receptor agonists MCR1‐5 protect photoreceptors from high‐glucose damage and restore antioxidant enzymes in primary retinal cell culture
    Article Snippet: Total RNA was extracted using RNeasy Plus Mini Kit (Qiagen, West Sussex, UK), according to the manufacturer's instructions. .. Total RNA was extracted using RNeasy Plus Mini Kit (Qiagen, West Sussex, UK), according to the manufacturer's instructions.

    Article Title: Neutrophil stunning by metoprolol reduces infarct size
    Article Snippet: Paragraph title: Neutrophil purification and Adrb1 expression ... Total RNA from whole hearts, BM and purified neutrophils samples was isolated with the Qiagen RNeasy Plus Mini Kit.

    Article Title: Octopamine and tyramine respectively regulate attractive and repulsive behavior in locust phase changes
    Article Snippet: Total RNA was extracted from brain tissues following the protocol of RNA easy mini kit (Qiagen). .. The details of reverse transcription and PCR amplification were referred to previous study .

    Article Title: Nox2 contributes to hyperinsulinemia-induced redox imbalance and impaired vascular function
    Article Snippet: 2.7 Total RNA was extracted using RNeasy mini kits (Qiagen, Germantown, MD). .. 2.7 Total RNA was extracted using RNeasy mini kits (Qiagen, Germantown, MD).

    Article Title: The Human NADPH Oxidase, Nox4, Regulates Cytoskeletal Organization in Two Cancer Cell Lines, HepG2 and SH-SY5Y
    Article Snippet: Paragraph title: Gene Expression Analyses ... Total RNA was isolated using RNeasy Mini kits (Qiagen) and digested with DNaseI (Promega).

    Article Title: De novo assembly and comparative transcriptome analysis of the foot from Chinese green mussel (Perna viridis) in response to cadmium stimulation
    Article Snippet: Here, tissue-specific expression patterns of 16 representative candidate byssus protein coding genes associated with stress responses were confirmed. .. Total RNAs from the foot gland samples were extracted and purified by RNeasy Animal Mini Kit (Qiagen, Valencia, CA).

    Article Title: Platelet-rich plasma respectively reduces and promotes adipogenic and myofibroblastic differentiation of human adipose-derived stromal cells via the TGFβ signalling pathway
    Article Snippet: Adipogenic-and myofibroblast-gene expression was performed by quantitative PCR. .. RNAs were purified on RNeasy columns (Qiagen, France).

    RNA Sequencing Assay:

    Article Title: Argininosuccinate synthase 1 is an intrinsic Akt repressor transactivated by p53
    Article Snippet: Paragraph title: Mice and x-ray treatment and RNA-seq ... Bone marrow was resolved in RLT Plus reagent provided by the RNeasy Plus Mini Kit (Qiagen) and homogenized using a QIAshredder column (Qiagen).

    Article Title: The Transcriptional Landscape of p53 Signalling Pathway
    Article Snippet: Paragraph title: RNA Sequencing ... For RNA extraction from bone marrow, we used the RNeasy Plus Mini Kit (QIAGEN).

    Article Title: De novo assembly and comparative transcriptome analysis of the foot from Chinese green mussel (Perna viridis) in response to cadmium stimulation
    Article Snippet: Paragraph title: Validation of the RNA-seq analyses by qRT-PCR ... Total RNAs from the foot gland samples were extracted and purified by RNeasy Animal Mini Kit (Qiagen, Valencia, CA).

    Article Title: The lncRNA VELUCT strongly regulates viability of lung cancer cells despite its extremely low abundance
    Article Snippet: RNA was isolated using TRI reagent (Sigma) according to the manufacturer's protocol. .. Whole cell RNA that was used for RNA-seq experiments was isolated using RNeasy Mini columns (Qiagen). .. DNase treatment of RNA was performed with Turbo DNase (Thermo Scientific) with subsequent RNA purification using Phenol:Chloroform:Isoamyl Alcohol (25:24:1 [v/v/v]) (Roth).


    Article Title: JunB is essential for IL-23-dependent pathogenicity of Th17 cells
    Article Snippet: Total RNA was isolated from cells using an RNeasy Plus Mini Kit (74136, Qiagen). .. Total RNA was isolated from cells using an RNeasy Plus Mini Kit (74136, Qiagen).

    Flow Cytometry:

    Article Title: Neutrophil stunning by metoprolol reduces infarct size
    Article Snippet: Before RNA isolation, neutrophil identity was confirmed by flow cytometry (anti-1A8 Ly6G) and viability evaluated. .. Total RNA from whole hearts, BM and purified neutrophils samples was isolated with the Qiagen RNeasy Plus Mini Kit.

    Light Microscopy:

    Article Title: Platelet-rich plasma respectively reduces and promotes adipogenic and myofibroblastic differentiation of human adipose-derived stromal cells via the TGFβ signalling pathway
    Article Snippet: RNAs were purified on RNeasy columns (Qiagen, France). .. RNAs were purified on RNeasy columns (Qiagen, France).


    Article Title: Neutrophil stunning by metoprolol reduces infarct size
    Article Snippet: Total RNA from whole hearts, BM and purified neutrophils samples was isolated with the Qiagen RNeasy Plus Mini Kit. .. Total RNA from whole hearts, BM and purified neutrophils samples was isolated with the Qiagen RNeasy Plus Mini Kit.

    Article Title: De novo assembly and comparative transcriptome analysis of the foot from Chinese green mussel (Perna viridis) in response to cadmium stimulation
    Article Snippet: Quantitative real-time PCR (qRT-PCR) was frequently used to confirm the data generated by high-throughput sequencing [ , ]. .. Total RNAs from the foot gland samples were extracted and purified by RNeasy Animal Mini Kit (Qiagen, Valencia, CA).

    Polymerase Chain Reaction:

    Article Title: Self-cytoplasmic DNA upregulates the mutator enzyme APOBEC3A leading to chromosomal DNA damage
    Article Snippet: Total RNA was extracted from THP-1 cells using RNeasy Plus Mini Kit (Qiagen) according to the manufacturer's instructions. .. Total RNA was extracted from THP-1 cells using RNeasy Plus Mini Kit (Qiagen) according to the manufacturer's instructions.

    Article Title: Melanocortin receptor agonists MCR1‐5 protect photoreceptors from high‐glucose damage and restore antioxidant enzymes in primary retinal cell culture
    Article Snippet: Total RNA was extracted using RNeasy Plus Mini Kit (Qiagen, West Sussex, UK), according to the manufacturer's instructions. .. Total RNA was extracted using RNeasy Plus Mini Kit (Qiagen, West Sussex, UK), according to the manufacturer's instructions.

    Article Title: Enhanced generation of human induced pluripotent stem cells by ectopic expression of Connexin 45
    Article Snippet: Total RNA was purified with the RNeasy Plus Mini kit (Qiagen) according to the manufacturer’s instructions. .. Total RNA was purified with the RNeasy Plus Mini kit (Qiagen) according to the manufacturer’s instructions.

    Article Title: Argininosuccinate synthase 1 is an intrinsic Akt repressor transactivated by p53
    Article Snippet: Genotypes were confirmed by PCR analysis. .. Bone marrow was resolved in RLT Plus reagent provided by the RNeasy Plus Mini Kit (Qiagen) and homogenized using a QIAshredder column (Qiagen).

    Article Title: Neutrophil stunning by metoprolol reduces infarct size
    Article Snippet: Total RNA from whole hearts, BM and purified neutrophils samples was isolated with the Qiagen RNeasy Plus Mini Kit. .. Total RNA from whole hearts, BM and purified neutrophils samples was isolated with the Qiagen RNeasy Plus Mini Kit.

    Article Title: Octopamine and tyramine respectively regulate attractive and repulsive behavior in locust phase changes
    Article Snippet: Total RNA was extracted from brain tissues following the protocol of RNA easy mini kit (Qiagen). .. Total RNA was extracted from brain tissues following the protocol of RNA easy mini kit (Qiagen).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Melanocortin receptor agonists MCR1‐5 protect photoreceptors from high‐glucose damage and restore antioxidant enzymes in primary retinal cell culture
    Article Snippet: Paragraph title: RT‐PCR ... Total RNA was extracted using RNeasy Plus Mini Kit (Qiagen, West Sussex, UK), according to the manufacturer's instructions.


    Article Title: Neutrophil stunning by metoprolol reduces infarct size
    Article Snippet: Adrb1 expression in circulating neutrophils was examined in blood drawn from wild-type or Adrb1 KO mice 20 min after injection of heparin (50 μl of 50 U per ml). .. Total RNA from whole hearts, BM and purified neutrophils samples was isolated with the Qiagen RNeasy Plus Mini Kit.

    Gene Knockout:

    Article Title: Neutrophil stunning by metoprolol reduces infarct size
    Article Snippet: Adrb1 expression in circulating neutrophils was examined in blood drawn from wild-type or Adrb1 KO mice 20 min after injection of heparin (50 μl of 50 U per ml). .. Total RNA from whole hearts, BM and purified neutrophils samples was isolated with the Qiagen RNeasy Plus Mini Kit.


    Article Title: Ribonuclease L mediates the cell-lethal phenotype of double-stranded RNA editing enzyme ADAR1 deficiency in a human cell line
    Article Snippet: U6 primers for normalization are 5’ GCTTCGGCAGCACATATACTA 3’ (forward) and 5’ CGAATTTGCGTGTCATCCTTG 3’ (reverse). .. Cells were treated with 10 U/ml of IFN-α (PBL) and 24 hr post treatment, cells were lysed in RLT Plus RNA lysis buffer (Qiagen), and RNA was isolated using the RNeasy Plus Mini Kit (Qiagen) as previously described ( ). .. Relative IFN-α, IFN-λ, OAS2, IFIT2 mRNA expression levels were quantified as ΔCT values relative to actin mRNA [ΔCT = CT (gene of interest) − CT (β-actin) ] and expressed using the formula 2−ΔCT .

    Article Title: MMP9 integrates multiple immunoregulatory pathways that discriminate high suppressive activity of human mesenchymal stem cells
    Article Snippet: Isolated cells were stored in RNAprotect® Cell Reagent (Qiagen, AMBION,USA) at −80 °C, until RNA extraction. .. Genomic DNA-free total RNA was isolated (RNeasy Plus Mini kit, Qiagen, AMBION, USA), following the manufactures’ protocol. .. RNA concentration and integrity were evaluated by NanoDrop-1000 (Thermo Scientific), UV/Vis ratios and agarose gel.

    Article Title: WRN conditioned media is sufficient for in vitro propagation of intestinal organoids from large farm and small companion animals
    Article Snippet: To determine enteroid expansion during passage, 200 high passage (P > 10) enteroids were seeded in Matrigel matrix to two wells (P1). .. RNA from enteroids, control tissue, and kidney epithelial cells (CRFK and MDBK) was isolated using the RNeasy Plus mini kit (Qiagen) according to the manufacturer's protocol, with DNase treatment (Qiagen) on the tissue controls samples. .. The High Capacity RNA-to-cDNA kit (Thermo Fisher 4387406) was used to obtain cDNA from 500 ng of RNA. qPCR negative controls omitted the RT enzyme. qPCR was performed with the PowerUp™ SYBR™ Green Master Mix (Thermo Fisher A25742) with a final primer concentration of 0.5 µM ( Table S1 ) and 10 ng of cDNA, and run on an Applied Biosystems (ABI) 7900HT Sequence Detection System.

    Article Title: “Inflamm‐aging” influences immune cell survival factors in human bone marrow
    Article Snippet: BM cells were obtained from mice by flushing the femur and tibia with PBS. .. RNA was isolated from purified BMMCs using the RNeasy Plus mini kit (Qiagen). .. First‐strand cDNA synthesis was performed using a Reverse Transcription system (Promega). qRT‐PCR experiments were performed using the LightCycler 480 System (Roche Diagnostics), 2X SYBR Green 1 Master (Roche Diagnostics), and β‐actin as housekeeping gene for relative quantification of effector/memory cell survival factors.

    Article Title: Genome-wide gene expression array identifies novel genes related to disease severity and excessive daytime sleepiness in patients with obstructive sleep apnea
    Article Snippet: The PBMCs were isolated by Ficoll-Hypaque gradient centrifugation (HISTOPAQUE® -119, Sigma-Aldrich, Inc., St. Louis, MO USA) within 90 min of drawing blood, washed in PBS, and then stored in RNAlater (Ambion Inc., Austin, TX, USA) at -80°C until RNA isolation. .. An RNeasy® Plus Mini Kit (Qiagen, Hilden, Germany) was used for isolation of high quality total RNA, and treated with DNase according to the manufacture protocol. .. RNA samples were run on a RNA 6000 Nano Gel System (Agilent Technologies Inc., Palo Alto, CA, USA) using an Agilent 2100 Bioanalyzer (Agilent) to determine the quality of RNA.

    Article Title: Neutrophil stunning by metoprolol reduces infarct size
    Article Snippet: Before RNA isolation, neutrophil identity was confirmed by flow cytometry (anti-1A8 Ly6G) and viability evaluated. .. Total RNA from whole hearts, BM and purified neutrophils samples was isolated with the Qiagen RNeasy Plus Mini Kit. .. RNA (1–2 μg) was reverse transcribed using Ready-to-go RT–PCR Beads (27-9259-01, GE Healthcare).

    Article Title: JunB is essential for IL-23-dependent pathogenicity of Th17 cells
    Article Snippet: Uncropped original scans of immunoblots were provided in . .. Total RNA was isolated from cells using an RNeasy Plus Mini Kit (74136, Qiagen). .. RNA quality was analysed with an Agilent 2100 Bioanalyzer and an RNA 6000 Nano Kit (5067-1511, Agilent).

    Article Title: Genome-wide mapping of DNase I hypersensitive sites reveals chromatin accessibility changes in Arabidopsis euchromatin and heterochromatin regions under extended darkness
    Article Snippet: Total RNA was extracted using TRIZOL reagent (Invitrogen) and purified using RNeasy Mini Kits (Qiagen). .. Total RNA was extracted using TRIZOL reagent (Invitrogen) and purified using RNeasy Mini Kits (Qiagen).

    Article Title: The Human NADPH Oxidase, Nox4, Regulates Cytoskeletal Organization in Two Cancer Cell Lines, HepG2 and SH-SY5Y
    Article Snippet: Media were changed after 6 h, and cells were further incubated in growth medium for a total of 48 h. siRNA transfection efficacy was determined as > 90% of cells, using the BLOCK-iT Fluorescent Oligo (ThermoScientific). .. Total RNA was isolated using RNeasy Mini kits (Qiagen) and digested with DNaseI (Promega). .. Reverse transcription polymerase chain reaction was performed using the SuperScriptII reverse transcription kit (ThermoScientific) and random hexamer primers (ThermoScientific) followed by IQ SYBR Green (Bio-Rad Laboratories) real-time (RT) PCR analyses on the iQ Multi-Color real time PCR detector (Bio-Rad Laboratories).

    Article Title: The lncRNA VELUCT strongly regulates viability of lung cancer cells despite its extremely low abundance
    Article Snippet: RNA was isolated using TRI reagent (Sigma) according to the manufacturer's protocol. .. Whole cell RNA that was used for RNA-seq experiments was isolated using RNeasy Mini columns (Qiagen). .. DNase treatment of RNA was performed with Turbo DNase (Thermo Scientific) with subsequent RNA purification using Phenol:Chloroform:Isoamyl Alcohol (25:24:1 [v/v/v]) (Roth).

    Size-exclusion Chromatography:

    Article Title: Melanocortin receptor agonists MCR1‐5 protect photoreceptors from high‐glucose damage and restore antioxidant enzymes in primary retinal cell culture
    Article Snippet: Total RNA was extracted using RNeasy Plus Mini Kit (Qiagen, West Sussex, UK), according to the manufacturer's instructions. .. Total RNA was extracted using RNeasy Plus Mini Kit (Qiagen, West Sussex, UK), according to the manufacturer's instructions.


    Article Title: Enhanced generation of human induced pluripotent stem cells by ectopic expression of Connexin 45
    Article Snippet: The intensity (area × density) of the individual bands on western blotting was measured by a Quantity-One software (Bio-Rad) and the amount of target protein was normalized to β-TUBULIN. .. Total RNA was purified with the RNeasy Plus Mini kit (Qiagen) according to the manufacturer’s instructions. .. The concentration and quality of total RNA samples were checked by a NanoDrop ND-1000 (NanoDrop) and one microgram total RNA was reverse-transcribed using an AMV First-Strand cDNA synthesis kit (Invitrogen).

    Article Title: Argininosuccinate synthase 1 is an intrinsic Akt repressor transactivated by p53
    Article Snippet: Tissues were preserved in RNAlater solution (Qiagen) at 4°C until RNA purification. .. Bone marrow was resolved in RLT Plus reagent provided by the RNeasy Plus Mini Kit (Qiagen) and homogenized using a QIAshredder column (Qiagen).

    Article Title: “Inflamm‐aging” influences immune cell survival factors in human bone marrow
    Article Snippet: BM cells were obtained from mice by flushing the femur and tibia with PBS. .. RNA was isolated from purified BMMCs using the RNeasy Plus mini kit (Qiagen). .. First‐strand cDNA synthesis was performed using a Reverse Transcription system (Promega). qRT‐PCR experiments were performed using the LightCycler 480 System (Roche Diagnostics), 2X SYBR Green 1 Master (Roche Diagnostics), and β‐actin as housekeeping gene for relative quantification of effector/memory cell survival factors.

    Article Title: Neutrophil stunning by metoprolol reduces infarct size
    Article Snippet: Before RNA isolation, neutrophil identity was confirmed by flow cytometry (anti-1A8 Ly6G) and viability evaluated. .. Total RNA from whole hearts, BM and purified neutrophils samples was isolated with the Qiagen RNeasy Plus Mini Kit. .. RNA (1–2 μg) was reverse transcribed using Ready-to-go RT–PCR Beads (27-9259-01, GE Healthcare).

    Article Title: Genome-wide mapping of DNase I hypersensitive sites reveals chromatin accessibility changes in Arabidopsis euchromatin and heterochromatin regions under extended darkness
    Article Snippet: Significance was determined using an algorithm based on Z score and P-value filtering with a cut-off of 0.05 . .. Total RNA was extracted using TRIZOL reagent (Invitrogen) and purified using RNeasy Mini Kits (Qiagen). .. RNA samples were extracted from Arabidopsis whole plants under extended darkness treatment and control condition.

    Article Title: De novo assembly and comparative transcriptome analysis of the foot from Chinese green mussel (Perna viridis) in response to cadmium stimulation
    Article Snippet: The Chinese green mussel foot gland samples were collected from Cd treated mussels (i.e., Control 48-h, 50 μg/L CdCl2 48-h, 100 μg/L CdCl2 48-h). qRT-PCRs were carried out using gene-specific primers , which were designed using Primer3 version 4.0.0 [ ]. .. Total RNAs from the foot gland samples were extracted and purified by RNeasy Animal Mini Kit (Qiagen, Valencia, CA). .. All samples were examined in triplicate with β-actin as the internal control and the 2-ΔΔCt method [ ] was used to calculate the relative expression.

    Article Title: Platelet-rich plasma respectively reduces and promotes adipogenic and myofibroblastic differentiation of human adipose-derived stromal cells via the TGFβ signalling pathway
    Article Snippet: Adipogenic-and myofibroblast-gene expression was performed by quantitative PCR. .. RNAs were purified on RNeasy columns (Qiagen, France). .. RNA sample concentrations were determined using a Nanodrop spectrophotometer (Thermo Scientific, Waltham, MA, USA).


    Article Title: “Inflamm‐aging” influences immune cell survival factors in human bone marrow
    Article Snippet: RNA was isolated from purified BMMCs using the RNeasy Plus mini kit (Qiagen). .. First‐strand cDNA synthesis was performed using a Reverse Transcription system (Promega). qRT‐PCR experiments were performed using the LightCycler 480 System (Roche Diagnostics), 2X SYBR Green 1 Master (Roche Diagnostics), and β‐actin as housekeeping gene for relative quantification of effector/memory cell survival factors.

    Article Title: Genome-wide mapping of DNase I hypersensitive sites reveals chromatin accessibility changes in Arabidopsis euchromatin and heterochromatin regions under extended darkness
    Article Snippet: Total RNA was extracted using TRIZOL reagent (Invitrogen) and purified using RNeasy Mini Kits (Qiagen). .. Construction of the sRNA libraries and deep-sequencing were carried out by the Beijing Genomics Institute (BGI, Hong Kong, China): isolated total RNA from each sample was separated on 15% denaturing polyacrylamide gels for size selection.

    Article Title: The Human NADPH Oxidase, Nox4, Regulates Cytoskeletal Organization in Two Cancer Cell Lines, HepG2 and SH-SY5Y
    Article Snippet: Total RNA was isolated using RNeasy Mini kits (Qiagen) and digested with DNaseI (Promega). .. Reverse transcription polymerase chain reaction was performed using the SuperScriptII reverse transcription kit (ThermoScientific) and random hexamer primers (ThermoScientific) followed by IQ SYBR Green (Bio-Rad Laboratories) real-time (RT) PCR analyses on the iQ Multi-Color real time PCR detector (Bio-Rad Laboratories).

    Article Title: De novo assembly and comparative transcriptome analysis of the foot from Chinese green mussel (Perna viridis) in response to cadmium stimulation
    Article Snippet: Quantitative real-time PCR (qRT-PCR) was frequently used to confirm the data generated by high-throughput sequencing [ , ]. .. Total RNAs from the foot gland samples were extracted and purified by RNeasy Animal Mini Kit (Qiagen, Valencia, CA).


    Article Title: The Transcriptional Landscape of p53 Signalling Pathway
    Article Snippet: For RNA extraction from bone marrow, we used the RNeasy Plus Mini Kit (QIAGEN). .. We selected 280 samples for RNA sequencing analysis based on RNA quality and quantity, which were evaluated using a Bioanalyzer (Agilent) and Nanodrop (Thermo Fisher Scientific).


    Article Title: Ribonuclease L mediates the cell-lethal phenotype of double-stranded RNA editing enzyme ADAR1 deficiency in a human cell line
    Article Snippet: U6 primers for normalization are 5’ GCTTCGGCAGCACATATACTA 3’ (forward) and 5’ CGAATTTGCGTGTCATCCTTG 3’ (reverse). .. Cells were treated with 10 U/ml of IFN-α (PBL) and 24 hr post treatment, cells were lysed in RLT Plus RNA lysis buffer (Qiagen), and RNA was isolated using the RNeasy Plus Mini Kit (Qiagen) as previously described ( ). .. Relative IFN-α, IFN-λ, OAS2, IFIT2 mRNA expression levels were quantified as ΔCT values relative to actin mRNA [ΔCT = CT (gene of interest) − CT (β-actin) ] and expressed using the formula 2−ΔCT .

    Article Title: Argininosuccinate synthase 1 is an intrinsic Akt repressor transactivated by p53
    Article Snippet: Bone marrow was resolved in RLT Plus reagent provided by the RNeasy Plus Mini Kit (Qiagen) and homogenized using a QIAshredder column (Qiagen). .. The lysates were stored at −80°C until RNA purification.

    Article Title: The Transcriptional Landscape of p53 Signalling Pathway
    Article Snippet: 2.2 Tissues were homogenized in QIAzol lysis reagent (QIAGEN) using Precellys 24 (Bertin Corporation). .. For RNA extraction from bone marrow, we used the RNeasy Plus Mini Kit (QIAGEN).

    Mouse Assay:

    Article Title: Argininosuccinate synthase 1 is an intrinsic Akt repressor transactivated by p53
    Article Snippet: Paragraph title: Mice and x-ray treatment and RNA-seq ... Bone marrow was resolved in RLT Plus reagent provided by the RNeasy Plus Mini Kit (Qiagen) and homogenized using a QIAshredder column (Qiagen).

    Article Title: Neutrophil stunning by metoprolol reduces infarct size
    Article Snippet: Adrb1 expression in circulating neutrophils was examined in blood drawn from wild-type or Adrb1 KO mice 20 min after injection of heparin (50 μl of 50 U per ml). .. Total RNA from whole hearts, BM and purified neutrophils samples was isolated with the Qiagen RNeasy Plus Mini Kit.


    Article Title: WRN conditioned media is sufficient for in vitro propagation of intestinal organoids from large farm and small companion animals
    Article Snippet: RNA from enteroids, control tissue, and kidney epithelial cells (CRFK and MDBK) was isolated using the RNeasy Plus mini kit (Qiagen) according to the manufacturer's protocol, with DNase treatment (Qiagen) on the tissue controls samples. .. RNA from enteroids, control tissue, and kidney epithelial cells (CRFK and MDBK) was isolated using the RNeasy Plus mini kit (Qiagen) according to the manufacturer's protocol, with DNase treatment (Qiagen) on the tissue controls samples.

    Article Title: “Inflamm‐aging” influences immune cell survival factors in human bone marrow
    Article Snippet: RNA was isolated from purified BMMCs using the RNeasy Plus mini kit (Qiagen). .. First‐strand cDNA synthesis was performed using a Reverse Transcription system (Promega). qRT‐PCR experiments were performed using the LightCycler 480 System (Roche Diagnostics), 2X SYBR Green 1 Master (Roche Diagnostics), and β‐actin as housekeeping gene for relative quantification of effector/memory cell survival factors.

    Article Title: Genome-wide mapping of DNase I hypersensitive sites reveals chromatin accessibility changes in Arabidopsis euchromatin and heterochromatin regions under extended darkness
    Article Snippet: Total RNA was extracted using TRIZOL reagent (Invitrogen) and purified using RNeasy Mini Kits (Qiagen). .. Total RNA was extracted using TRIZOL reagent (Invitrogen) and purified using RNeasy Mini Kits (Qiagen).

    Real-time Polymerase Chain Reaction:

    Article Title: Self-cytoplasmic DNA upregulates the mutator enzyme APOBEC3A leading to chromosomal DNA damage
    Article Snippet: Paragraph title: Real-time PCR and SYBR Green quantitative PCR ... Total RNA was extracted from THP-1 cells using RNeasy Plus Mini Kit (Qiagen) according to the manufacturer's instructions.

    Article Title: Melanocortin receptor agonists MCR1‐5 protect photoreceptors from high‐glucose damage and restore antioxidant enzymes in primary retinal cell culture
    Article Snippet: Total RNA was extracted using RNeasy Plus Mini Kit (Qiagen, West Sussex, UK), according to the manufacturer's instructions. .. Total RNA was extracted using RNeasy Plus Mini Kit (Qiagen, West Sussex, UK), according to the manufacturer's instructions.

    Article Title: Enhanced generation of human induced pluripotent stem cells by ectopic expression of Connexin 45
    Article Snippet: Paragraph title: Real-time PCR ... Total RNA was purified with the RNeasy Plus Mini kit (Qiagen) according to the manufacturer’s instructions.

    Article Title: WRN conditioned media is sufficient for in vitro propagation of intestinal organoids from large farm and small companion animals
    Article Snippet: Paragraph title: RNA isolation and qPCR ... RNA from enteroids, control tissue, and kidney epithelial cells (CRFK and MDBK) was isolated using the RNeasy Plus mini kit (Qiagen) according to the manufacturer's protocol, with DNase treatment (Qiagen) on the tissue controls samples.

    Article Title: Neutrophil stunning by metoprolol reduces infarct size
    Article Snippet: Total RNA from whole hearts, BM and purified neutrophils samples was isolated with the Qiagen RNeasy Plus Mini Kit. .. Total RNA from whole hearts, BM and purified neutrophils samples was isolated with the Qiagen RNeasy Plus Mini Kit.

    Article Title: Sensitive detection of viable circulating tumor cells using a novel conditionally telomerase-selective replicating adenovirus in non-small cell lung cancer patients
    Article Snippet: Fixed cells were analyzed using a MACSQuant® Analyzer (Miltenyi Biotec, Bergisch-Gladbach, Germany) to determine the ratio of GFP+ cells. .. Total RNA was extracted from human NSCLC cell lines using the RNeasy Plus Mini Kit (Cat No. 74134, Qiagen, Venlo, The Netherlands). qRT-PCR was performed using the PrimeScript RT reagent kit (TaKaRa, Shiga, Japan) and SYBR Premix EX Taq II (Tli RNaseH Plus, TaKaRa) on a 7500 Fast real-time PCR system (Applied Biosystems, Foster City, CA). .. The following gene-specific primers were used: hTERT F (5′-CGG AAG AGT GTC TGG AGC AA-3′), R (5′-GGA TGA AGC GGA GTC TGG A-3′), GAPDH F (5′-TCG ACA GTC AGC CGC ATC TTC TTT-3′), R (5′-ACC AAA TCC GTT GAC TCC GAC CTT-3′).

    Article Title: Nox2 contributes to hyperinsulinemia-induced redox imbalance and impaired vascular function
    Article Snippet: Paragraph title: Real-time PCR ... 2.7 Total RNA was extracted using RNeasy mini kits (Qiagen, Germantown, MD).

    Article Title: De novo assembly and comparative transcriptome analysis of the foot from Chinese green mussel (Perna viridis) in response to cadmium stimulation
    Article Snippet: Quantitative real-time PCR (qRT-PCR) was frequently used to confirm the data generated by high-throughput sequencing [ , ]. .. Total RNAs from the foot gland samples were extracted and purified by RNeasy Animal Mini Kit (Qiagen, Valencia, CA).

    Article Title: Platelet-rich plasma respectively reduces and promotes adipogenic and myofibroblastic differentiation of human adipose-derived stromal cells via the TGFβ signalling pathway
    Article Snippet: Adipogenic-and myofibroblast-gene expression was performed by quantitative PCR. .. RNAs were purified on RNeasy columns (Qiagen, France).

    RNA Extraction:

    Article Title: Argininosuccinate synthase 1 is an intrinsic Akt repressor transactivated by p53
    Article Snippet: Bone marrow was resolved in RLT Plus reagent provided by the RNeasy Plus Mini Kit (Qiagen) and homogenized using a QIAshredder column (Qiagen). .. Bone marrow was resolved in RLT Plus reagent provided by the RNeasy Plus Mini Kit (Qiagen) and homogenized using a QIAshredder column (Qiagen).

    Article Title: The Transcriptional Landscape of p53 Signalling Pathway
    Article Snippet: Total RNA was recovered using the RNeasy Plus Universal Mini Kit (QIAGEN). .. For RNA extraction from bone marrow, we used the RNeasy Plus Mini Kit (QIAGEN). .. We selected 280 samples for RNA sequencing analysis based on RNA quality and quantity, which were evaluated using a Bioanalyzer (Agilent) and Nanodrop (Thermo Fisher Scientific).


    Article Title: The Transcriptional Landscape of p53 Signalling Pathway
    Article Snippet: For RNA extraction from bone marrow, we used the RNeasy Plus Mini Kit (QIAGEN). .. We selected 280 samples for RNA sequencing analysis based on RNA quality and quantity, which were evaluated using a Bioanalyzer (Agilent) and Nanodrop (Thermo Fisher Scientific).

    Article Title: Genome-wide mapping of DNase I hypersensitive sites reveals chromatin accessibility changes in Arabidopsis euchromatin and heterochromatin regions under extended darkness
    Article Snippet: Total RNA was extracted using TRIZOL reagent (Invitrogen) and purified using RNeasy Mini Kits (Qiagen). .. Total RNA was extracted using TRIZOL reagent (Invitrogen) and purified using RNeasy Mini Kits (Qiagen).

    Agarose Gel Electrophoresis:

    Article Title: Neutrophil stunning by metoprolol reduces infarct size
    Article Snippet: Total RNA from whole hearts, BM and purified neutrophils samples was isolated with the Qiagen RNeasy Plus Mini Kit. .. Total RNA from whole hearts, BM and purified neutrophils samples was isolated with the Qiagen RNeasy Plus Mini Kit.

    Concentration Assay:

    Article Title: Melanocortin receptor agonists MCR1‐5 protect photoreceptors from high‐glucose damage and restore antioxidant enzymes in primary retinal cell culture
    Article Snippet: Total RNA was extracted using RNeasy Plus Mini Kit (Qiagen, West Sussex, UK), according to the manufacturer's instructions. .. Total RNA was extracted using RNeasy Plus Mini Kit (Qiagen, West Sussex, UK), according to the manufacturer's instructions.


    Article Title: The lncRNA VELUCT strongly regulates viability of lung cancer cells despite its extremely low abundance
    Article Snippet: Paragraph title: Subcellular fractionation, RNA isolation and DNase treatment ... Whole cell RNA that was used for RNA-seq experiments was isolated using RNeasy Mini columns (Qiagen).

    High Throughput Screening Assay:

    Article Title: De novo assembly and comparative transcriptome analysis of the foot from Chinese green mussel (Perna viridis) in response to cadmium stimulation
    Article Snippet: Quantitative real-time PCR (qRT-PCR) was frequently used to confirm the data generated by high-throughput sequencing [ , ]. .. Total RNAs from the foot gland samples were extracted and purified by RNeasy Animal Mini Kit (Qiagen, Valencia, CA).


    Article Title: JunB is essential for IL-23-dependent pathogenicity of Th17 cells
    Article Snippet: Total RNA was isolated from cells using an RNeasy Plus Mini Kit (74136, Qiagen). .. Total RNA was isolated from cells using an RNeasy Plus Mini Kit (74136, Qiagen).

    Article Title: Platelet-rich plasma respectively reduces and promotes adipogenic and myofibroblastic differentiation of human adipose-derived stromal cells via the TGFβ signalling pathway
    Article Snippet: Then, Oil Red O stained cells were quantified by washing in water and lipid-bound Oil Red-O was dissolved in isopropanol for 15 min. .. RNAs were purified on RNeasy columns (Qiagen, France).

    Gradient Centrifugation:

    Article Title: Genome-wide gene expression array identifies novel genes related to disease severity and excessive daytime sleepiness in patients with obstructive sleep apnea
    Article Snippet: The PBMCs were isolated by Ficoll-Hypaque gradient centrifugation (HISTOPAQUE® -119, Sigma-Aldrich, Inc., St. Louis, MO USA) within 90 min of drawing blood, washed in PBS, and then stored in RNAlater (Ambion Inc., Austin, TX, USA) at -80°C until RNA isolation. .. An RNeasy® Plus Mini Kit (Qiagen, Hilden, Germany) was used for isolation of high quality total RNA, and treated with DNase according to the manufacture protocol.

    Article Title: Neutrophil stunning by metoprolol reduces infarct size
    Article Snippet: Whole blood was filtered and pooled, and polymorphonuclear leukocytes were purified by gradient-centrifugation (800g , 20 min, 4 °C) in 65% Percoll Plus in Hanks balanced salt solution (HBSS). .. Total RNA from whole hearts, BM and purified neutrophils samples was isolated with the Qiagen RNeasy Plus Mini Kit.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Qiagen rneasy mini kit
    A) Concentration of <t>RNA</t> extracted from HEK293 cells encapsulated in the four peptide hydrogels and cell-only controls using the three methods (see text for details). B Representative electrophoresis traces of total RNA extracted from cells encapsulated in the four peptide hydrogels and cell-only controls using the Tri Reagent and <t>RNeasy</t> MK methods and corresponding RIN values: cell-only controls (A+E), PGD-Alpha1 (B+F), PGD-Alpha2 (G), PGD-AlphaProB (C+H) and PGD-AlphaProC (D+I). C D) Representative UV spectra for RNA samples extracted using the TRI Reagent (C) and the RNeasy MK (D) methods from the four peptide hydrogels and cell-only control.
    Rneasy Mini Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 94 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rneasy mini kit/product/Qiagen
    Average 99 stars, based on 94 article reviews
    Price from $9.99 to $1999.99
    rneasy mini kit - by Bioz Stars, 2019-12
    99/100 stars
      Buy from Supplier

    Qiagen vehicle injected eiu rat eyes
    Ionized calcium-binding adaptor molecule 1 immunostaining on flatmounted retinas. A – B : Example of flatmounted retinas from rat eyes with endotoxin-induced uveitis <t>(EIU)</t> injected with vehicle ( A ) or with antivascular endothelial growth factor <t>(VEGF)</t> antibodies ( B ); Bar = 50 µm. Arrowhead show round reactive ionized calcium-binding adaptor molecule 1 (IBA1)-positive cells. C – D : Extraction of cell contours used for automatic labeling of IBA1 staining. E - F : Quantification of round and total IBA-1 positive cells on flat-mounted retina from EIU control and anti-VEGF treated eyes. Bar = 50 µm.
    Vehicle Injected Eiu Rat Eyes, supplied by Qiagen, used in various techniques. Bioz Stars score: 79/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/vehicle injected eiu rat eyes/product/Qiagen
    Average 79 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    vehicle injected eiu rat eyes - by Bioz Stars, 2019-12
    79/100 stars
      Buy from Supplier

    Image Search Results

    A) Concentration of RNA extracted from HEK293 cells encapsulated in the four peptide hydrogels and cell-only controls using the three methods (see text for details). B Representative electrophoresis traces of total RNA extracted from cells encapsulated in the four peptide hydrogels and cell-only controls using the Tri Reagent and RNeasy MK methods and corresponding RIN values: cell-only controls (A+E), PGD-Alpha1 (B+F), PGD-Alpha2 (G), PGD-AlphaProB (C+H) and PGD-AlphaProC (D+I). C D) Representative UV spectra for RNA samples extracted using the TRI Reagent (C) and the RNeasy MK (D) methods from the four peptide hydrogels and cell-only control.

    Journal: PLoS ONE

    Article Title: RNA extraction from self-assembling peptide hydrogels to allow qPCR analysis of encapsulated cells

    doi: 10.1371/journal.pone.0197517

    Figure Lengend Snippet: A) Concentration of RNA extracted from HEK293 cells encapsulated in the four peptide hydrogels and cell-only controls using the three methods (see text for details). B Representative electrophoresis traces of total RNA extracted from cells encapsulated in the four peptide hydrogels and cell-only controls using the Tri Reagent and RNeasy MK methods and corresponding RIN values: cell-only controls (A+E), PGD-Alpha1 (B+F), PGD-Alpha2 (G), PGD-AlphaProB (C+H) and PGD-AlphaProC (D+I). C D) Representative UV spectra for RNA samples extracted using the TRI Reagent (C) and the RNeasy MK (D) methods from the four peptide hydrogels and cell-only control.

    Article Snippet: RNA extraction RNA was extracted using the following commercial kits: RNeasy Mini Kit® (Qiagen, Manchester, UK) or TRI Reagent® (Sigma-Aldrich, Dorset, UK).

    Techniques: Concentration Assay, Electrophoresis

    Ct values obtained for RT-qPCR performed using RNA extracted from the four peptide hydrogels as a template. RNA isolated from cells in suspension was used as a control. The RNA extracted using either the TRI Reagent method (A-B) or RNeasy MK method (C+D) was used as templates for the amplification of two housekeeping genes: GAPDH (A+C) and RPL13A (B+D). The cycle threshold (Ct) value was determined for three independent samples measured in triplicate (or two independent samples for PGD-Alpha1 using the RNeasy method). Data is shown as mean ± SEM. The mean values were compared to the non-encapsulated cell controls using a t-test; *, P ≤ 0.05.

    Journal: PLoS ONE

    Article Title: RNA extraction from self-assembling peptide hydrogels to allow qPCR analysis of encapsulated cells

    doi: 10.1371/journal.pone.0197517

    Figure Lengend Snippet: Ct values obtained for RT-qPCR performed using RNA extracted from the four peptide hydrogels as a template. RNA isolated from cells in suspension was used as a control. The RNA extracted using either the TRI Reagent method (A-B) or RNeasy MK method (C+D) was used as templates for the amplification of two housekeeping genes: GAPDH (A+C) and RPL13A (B+D). The cycle threshold (Ct) value was determined for three independent samples measured in triplicate (or two independent samples for PGD-Alpha1 using the RNeasy method). Data is shown as mean ± SEM. The mean values were compared to the non-encapsulated cell controls using a t-test; *, P ≤ 0.05.

    Article Snippet: RNA extraction RNA was extracted using the following commercial kits: RNeasy Mini Kit® (Qiagen, Manchester, UK) or TRI Reagent® (Sigma-Aldrich, Dorset, UK).

    Techniques: Quantitative RT-PCR, Isolation, Amplification

    Ct values obtained for RT-qPCR performed using RNA extracted using RNeasy MK method from the four peptide hydrogels pre-treated with pronase enzyme solution and the cell-only control as a template. RNA extracted was used as templates for the amplification of five housekeeping genes: GAPDH (A), RPL13A (B), ACTB (C), B2M (D) and RRN18s (E) commonly expressed in HEK293 cells. The cycle threshold (Ct) values are presented as the mean ± SEM for three independent samples measured in triplicate. *, P

    Journal: PLoS ONE

    Article Title: RNA extraction from self-assembling peptide hydrogels to allow qPCR analysis of encapsulated cells

    doi: 10.1371/journal.pone.0197517

    Figure Lengend Snippet: Ct values obtained for RT-qPCR performed using RNA extracted using RNeasy MK method from the four peptide hydrogels pre-treated with pronase enzyme solution and the cell-only control as a template. RNA extracted was used as templates for the amplification of five housekeeping genes: GAPDH (A), RPL13A (B), ACTB (C), B2M (D) and RRN18s (E) commonly expressed in HEK293 cells. The cycle threshold (Ct) values are presented as the mean ± SEM for three independent samples measured in triplicate. *, P

    Article Snippet: RNA extraction RNA was extracted using the following commercial kits: RNeasy Mini Kit® (Qiagen, Manchester, UK) or TRI Reagent® (Sigma-Aldrich, Dorset, UK).

    Techniques: Quantitative RT-PCR, Amplification

    STAT3 expression is lowered in the PBMCs of post-traumatic stress disorder (PTSD) patients. ( a , b ) Network showing predicted transcription factors for AGO2 and DCR1. ( c ) Transcript level of the three reported STAT3 variants in the PBMCs of PTSD patients as analyzed by RNA-seq (the values above the bars indicate log 2 fold-change). ( d ) Relative abundance of STAT3 transcripts in the PBMCs of PTSD patients after analysis by qRT-PCR with 22 control and 18 PTSD samples. Here, 18S rRNA was used as an internal control. ( e ) Relative abundance of AGO2, DCR1 and STAT3 transcripts 72 h post-knockdown of STAT3. ( f ) STAT3 was knocked down using siRNA in THP-1 cells and miRNAs were quantified after 72 h. The figure shows RE of miRNAs after knockdown of STAT3. (RE: relative enrichment). PBMC, peripheral blood mononuclear cell.

    Journal: Translational Psychiatry

    Article Title: Decreased AGO2 and DCR1 in PBMCs from War Veterans with PTSD leads to diminished miRNA resulting in elevated inflammation

    doi: 10.1038/tp.2017.185

    Figure Lengend Snippet: STAT3 expression is lowered in the PBMCs of post-traumatic stress disorder (PTSD) patients. ( a , b ) Network showing predicted transcription factors for AGO2 and DCR1. ( c ) Transcript level of the three reported STAT3 variants in the PBMCs of PTSD patients as analyzed by RNA-seq (the values above the bars indicate log 2 fold-change). ( d ) Relative abundance of STAT3 transcripts in the PBMCs of PTSD patients after analysis by qRT-PCR with 22 control and 18 PTSD samples. Here, 18S rRNA was used as an internal control. ( e ) Relative abundance of AGO2, DCR1 and STAT3 transcripts 72 h post-knockdown of STAT3. ( f ) STAT3 was knocked down using siRNA in THP-1 cells and miRNAs were quantified after 72 h. The figure shows RE of miRNAs after knockdown of STAT3. (RE: relative enrichment). PBMC, peripheral blood mononuclear cell.

    Article Snippet: Briefly, total RNA was purified from PBMCs using the Qiagen RNA easy kit.

    Techniques: Expressing, RNA Sequencing Assay, Quantitative RT-PCR

    Argonaute 2 ( AGO2 ) and Dicer1 ( DCR1 ) transcript is lower in PBMCs of post-traumatic stress disorder (PTSD) patients and the abundance of mature miRNAs is reduced upon decreased expression of AGO2 and DCR1. ( a ) RNA-Seq analysis expression values of only the genes significantly dysregulated with log 2 fold-change of at least 1 or more (readers are requested to refer Bam et al. 10 for the complete list of the genes), and different variants of AGO2 , DCR1 and STAT3 . The green dots indicate the position (expression values) of the different variants of AGO2 , DCR1 and STAT3 . The red dot is the position of DCR1 variant 5. ( b ) The FPKM values of the variants of AGO2 and DCR1 in control and PTSD samples after RNA-sequencing (RNA-Seq) analysis. The values above the bars indicate log 2 fold-change when compared between PTSD and controls. (FPKM: Fragments per kilobase of transcript per million mapped reads). ( c , d ) Quantitative real time PCR validation result of AGO2 and DCR1 transcripts in 22 controls and 18 PTSD PBMC RNA samples. The difference in expression level is provided as relative expression (RE) value by taking the controls as 1. In this assay, 18S rRNA was used as an internal control. ( e ) Linear fold-change values of 35 miRNAs, after microarray analysis, which were selected for further analysis by in vitro experiments. miRNA-451 was also included in the figure as a positive control because it was reported previously to be processed specifically through the AGO2-dependent pathway. ( f ) Relative expression levels of 34 miRNAs, listed in Figure 3a, after knockdown of AGO2 for 72 h by employing siRNA in THP-1 cells. The expression level is expressed relative to control which was taken as 1. PBMC, peripheral blood monnuclear cell.

    Journal: Translational Psychiatry

    Article Title: Decreased AGO2 and DCR1 in PBMCs from War Veterans with PTSD leads to diminished miRNA resulting in elevated inflammation

    doi: 10.1038/tp.2017.185

    Figure Lengend Snippet: Argonaute 2 ( AGO2 ) and Dicer1 ( DCR1 ) transcript is lower in PBMCs of post-traumatic stress disorder (PTSD) patients and the abundance of mature miRNAs is reduced upon decreased expression of AGO2 and DCR1. ( a ) RNA-Seq analysis expression values of only the genes significantly dysregulated with log 2 fold-change of at least 1 or more (readers are requested to refer Bam et al. 10 for the complete list of the genes), and different variants of AGO2 , DCR1 and STAT3 . The green dots indicate the position (expression values) of the different variants of AGO2 , DCR1 and STAT3 . The red dot is the position of DCR1 variant 5. ( b ) The FPKM values of the variants of AGO2 and DCR1 in control and PTSD samples after RNA-sequencing (RNA-Seq) analysis. The values above the bars indicate log 2 fold-change when compared between PTSD and controls. (FPKM: Fragments per kilobase of transcript per million mapped reads). ( c , d ) Quantitative real time PCR validation result of AGO2 and DCR1 transcripts in 22 controls and 18 PTSD PBMC RNA samples. The difference in expression level is provided as relative expression (RE) value by taking the controls as 1. In this assay, 18S rRNA was used as an internal control. ( e ) Linear fold-change values of 35 miRNAs, after microarray analysis, which were selected for further analysis by in vitro experiments. miRNA-451 was also included in the figure as a positive control because it was reported previously to be processed specifically through the AGO2-dependent pathway. ( f ) Relative expression levels of 34 miRNAs, listed in Figure 3a, after knockdown of AGO2 for 72 h by employing siRNA in THP-1 cells. The expression level is expressed relative to control which was taken as 1. PBMC, peripheral blood monnuclear cell.

    Article Snippet: Briefly, total RNA was purified from PBMCs using the Qiagen RNA easy kit.

    Techniques: Expressing, RNA Sequencing Assay, Variant Assay, Real-time Polymerase Chain Reaction, Microarray, In Vitro, Positive Control

    Transcriptome profiling of four cell types isolated from mouse retinas. ( A ) Scheme used to generate transcriptome and methylation datasets at the resolution of single cell types. Cell populations of rods, cones, horizontal cells and starburst amacrine cells are isolated by cell sorting from mouse transgenic lines carrying fluorescent markers that label these particular cell types of the retina. From cell isolates, whole genome methylation maps and expression datasets are generated. ( B ) Known cell specific expression markers reproducibly discriminate between cell isolates illustrating the reproducibility of the FACS procedure. Expression levels for markers of the studied retinal cell types. RPKM values for genic RNA-seq signal for samples issued from independent cell sorts. Side bar depicts the cell type associated with the marker (Siegert et al , 2009) (rods: dark green; cones: light green; HCs: orange; SACs: purple). Levels Rhodopsin in non-rod samples shows a particularly high degree of systematic contamination of cone samples with rods, as previously observed (Siegert et al , 2012; Mo et al , 2016). ( C ) The tested cell types show divergence in their expression profiles. Correlation heatmap comparing transcriptomes of the four studied cell types. Pearson correlation for genic RNA-seq signal merged across three biological replicates for each cell type. ( D ) Transcription factors showing differential expression between the tested cell types. Heatmap depicting the expression level of the most differentially expressed transcription factors between the tested cell types (top 10% variance). Shown are the RPKM values for genic RNA-seq merged across three biological replicates for each cell type. The heatmap was organized by hierarchical clustering.

    Journal: Nucleic Acids Research

    Article Title: Cis-regulatory landscapes of four cell types of the retina

    doi: 10.1093/nar/gkx923

    Figure Lengend Snippet: Transcriptome profiling of four cell types isolated from mouse retinas. ( A ) Scheme used to generate transcriptome and methylation datasets at the resolution of single cell types. Cell populations of rods, cones, horizontal cells and starburst amacrine cells are isolated by cell sorting from mouse transgenic lines carrying fluorescent markers that label these particular cell types of the retina. From cell isolates, whole genome methylation maps and expression datasets are generated. ( B ) Known cell specific expression markers reproducibly discriminate between cell isolates illustrating the reproducibility of the FACS procedure. Expression levels for markers of the studied retinal cell types. RPKM values for genic RNA-seq signal for samples issued from independent cell sorts. Side bar depicts the cell type associated with the marker (Siegert et al , 2009) (rods: dark green; cones: light green; HCs: orange; SACs: purple). Levels Rhodopsin in non-rod samples shows a particularly high degree of systematic contamination of cone samples with rods, as previously observed (Siegert et al , 2012; Mo et al , 2016). ( C ) The tested cell types show divergence in their expression profiles. Correlation heatmap comparing transcriptomes of the four studied cell types. Pearson correlation for genic RNA-seq signal merged across three biological replicates for each cell type. ( D ) Transcription factors showing differential expression between the tested cell types. Heatmap depicting the expression level of the most differentially expressed transcription factors between the tested cell types (top 10% variance). Shown are the RPKM values for genic RNA-seq merged across three biological replicates for each cell type. The heatmap was organized by hierarchical clustering.

    Article Snippet: After retina dissection and dissociation, cells were FACS-sorted directly in lysis buffer of the RNA-easy mini kit (Quiagen) that was used for RNA extraction.

    Techniques: Isolation, Methylation, FACS, Transgenic Assay, Expressing, Generated, RNA Sequencing Assay, Marker

    Parallelized reporter assay in specific retinal cell types. ( A ) Schematic representation of the procedure used to perform parallel reporter assays at the resolution of single cell types. Putative CREs are selected based on the detection of cell type-specific low methylation. Subsets of CREs are batch-cloned in front of a minimal promoter driving transcription of a GFP cassette followed by a unique barcode. These libraries are packaged into adeno-associated viruses and injected as pools in retinas of transgenic mice labeled for the cell types of interest. Three weeks following injection, cell populations are FACS sorted and RNA is extracted. CRE activity is determined as function of the barcode counts in the RNA normalized to the barcode counts in the AAV gDNA. ( B ) Histogram representing the distribution of activities observed for putative rod CREs (lowly methylated - green) and control regions (highly methylated - grey). Fragment activity was determined as ratio of barcode abundance in RNA sample versus abundance in the AAV pool used for infection. Displayed are average activity values derived from at least 3 biological replicates. CREs that were tested with an individual GFP reporter system are marked in the plot at their respective activity group. ( C – E ) Comparison of activity levels measured by PRA with trans-membrane GFP reporter signal for individual CREs. Immunohistochemical staining of whole mount and vibratome sections from wild type mouse retinas injected with individual constructs showing no (C), intermediate (D) or high (E) activity in the PRA assay. Green: GFP, white: Hoechst staining of DNA.

    Journal: Nucleic Acids Research

    Article Title: Cis-regulatory landscapes of four cell types of the retina

    doi: 10.1093/nar/gkx923

    Figure Lengend Snippet: Parallelized reporter assay in specific retinal cell types. ( A ) Schematic representation of the procedure used to perform parallel reporter assays at the resolution of single cell types. Putative CREs are selected based on the detection of cell type-specific low methylation. Subsets of CREs are batch-cloned in front of a minimal promoter driving transcription of a GFP cassette followed by a unique barcode. These libraries are packaged into adeno-associated viruses and injected as pools in retinas of transgenic mice labeled for the cell types of interest. Three weeks following injection, cell populations are FACS sorted and RNA is extracted. CRE activity is determined as function of the barcode counts in the RNA normalized to the barcode counts in the AAV gDNA. ( B ) Histogram representing the distribution of activities observed for putative rod CREs (lowly methylated - green) and control regions (highly methylated - grey). Fragment activity was determined as ratio of barcode abundance in RNA sample versus abundance in the AAV pool used for infection. Displayed are average activity values derived from at least 3 biological replicates. CREs that were tested with an individual GFP reporter system are marked in the plot at their respective activity group. ( C – E ) Comparison of activity levels measured by PRA with trans-membrane GFP reporter signal for individual CREs. Immunohistochemical staining of whole mount and vibratome sections from wild type mouse retinas injected with individual constructs showing no (C), intermediate (D) or high (E) activity in the PRA assay. Green: GFP, white: Hoechst staining of DNA.

    Article Snippet: After retina dissection and dissociation, cells were FACS-sorted directly in lysis buffer of the RNA-easy mini kit (Quiagen) that was used for RNA extraction.

    Techniques: Reporter Assay, Methylation, Clone Assay, Injection, Transgenic Assay, Mouse Assay, Labeling, FACS, Activity Assay, Infection, Derivative Assay, Immunohistochemistry, Staining, Construct

    Ionized calcium-binding adaptor molecule 1 immunostaining on flatmounted retinas. A – B : Example of flatmounted retinas from rat eyes with endotoxin-induced uveitis (EIU) injected with vehicle ( A ) or with antivascular endothelial growth factor (VEGF) antibodies ( B ); Bar = 50 µm. Arrowhead show round reactive ionized calcium-binding adaptor molecule 1 (IBA1)-positive cells. C – D : Extraction of cell contours used for automatic labeling of IBA1 staining. E - F : Quantification of round and total IBA-1 positive cells on flat-mounted retina from EIU control and anti-VEGF treated eyes. Bar = 50 µm.

    Journal: Molecular Vision

    Article Title: Anti-vascular endothelial growth factor acts on retinal microglia/macrophage activation in a rat model of ocular inflammation


    Figure Lengend Snippet: Ionized calcium-binding adaptor molecule 1 immunostaining on flatmounted retinas. A – B : Example of flatmounted retinas from rat eyes with endotoxin-induced uveitis (EIU) injected with vehicle ( A ) or with antivascular endothelial growth factor (VEGF) antibodies ( B ); Bar = 50 µm. Arrowhead show round reactive ionized calcium-binding adaptor molecule 1 (IBA1)-positive cells. C – D : Extraction of cell contours used for automatic labeling of IBA1 staining. E - F : Quantification of round and total IBA-1 positive cells on flat-mounted retina from EIU control and anti-VEGF treated eyes. Bar = 50 µm.

    Article Snippet: Total RNA was isolated from neuroretinas from anti-VEGF and vehicle-injected EIU rat eyes (n = 5 eyes of five rats per group; RNeasy Plus Mini Kit; Qiagen, Courtaboeuf, France).

    Techniques: Binding Assay, Immunostaining, Injection, Labeling, Staining

    Ionized calcium-binding adaptor molecule 1 immunostaining of microglia and macrophages in endotoxin-induced uveitis at 24 h after lipopolysaccharide injection A : Retina section after vehicle intravitreal injection; in green ionized calcium-binding adaptor molecule 1 (IBA1) staining and in blue nuclei are stained with 4’,6-diamidino-2-phenyl-indole (DAPI). Arrowheads indicates round IBA1-positive cells, magnified in the inset. Bar = 50 µm, GCL = ganglion cell layer, INL = inner nuclear layer, ONL = outer nuclear layer. B : Retina section after anti-vascular endothelial growth factor (VEGF) intravitreal injection. IBA1-positive cells (in green) are ramified and elongated in the inner retina as magnified in the inset. Nuclei are stained in blue with DAPI. Bar = 50 µm, GCL = ganglion cell layer, INL = inner nuclear layer, ONL = outer nuclear layer. D – F : Choroid section after vehicle intravitreal injection stained with IBA1 ( D ) and DAPI ( F ), showing round amoeboid cells (magnified in the inset). Bar = 50 µm, RPE = retinal pigment epithelial cells. E – G : Choroid section after anti-VEGF intravitreal injection stained with IBA1 ( E ) and DAPI ( G ), showing round elongated ramified cells (magnified in the inset). Bar = 50 µm, RPE = retinal pigment epithelial cells. C and H : Quantification of round IBA1-positive cells in the inner and outer retina and in the choroid of rat eyes with EIU at 24 h, injected either with vehicle or with anti-VEGF antibody ( C ) or with control rat isotype immunoglobulin G (IgG) antibodies ( H ) *p

    Journal: Molecular Vision

    Article Title: Anti-vascular endothelial growth factor acts on retinal microglia/macrophage activation in a rat model of ocular inflammation


    Figure Lengend Snippet: Ionized calcium-binding adaptor molecule 1 immunostaining of microglia and macrophages in endotoxin-induced uveitis at 24 h after lipopolysaccharide injection A : Retina section after vehicle intravitreal injection; in green ionized calcium-binding adaptor molecule 1 (IBA1) staining and in blue nuclei are stained with 4’,6-diamidino-2-phenyl-indole (DAPI). Arrowheads indicates round IBA1-positive cells, magnified in the inset. Bar = 50 µm, GCL = ganglion cell layer, INL = inner nuclear layer, ONL = outer nuclear layer. B : Retina section after anti-vascular endothelial growth factor (VEGF) intravitreal injection. IBA1-positive cells (in green) are ramified and elongated in the inner retina as magnified in the inset. Nuclei are stained in blue with DAPI. Bar = 50 µm, GCL = ganglion cell layer, INL = inner nuclear layer, ONL = outer nuclear layer. D – F : Choroid section after vehicle intravitreal injection stained with IBA1 ( D ) and DAPI ( F ), showing round amoeboid cells (magnified in the inset). Bar = 50 µm, RPE = retinal pigment epithelial cells. E – G : Choroid section after anti-VEGF intravitreal injection stained with IBA1 ( E ) and DAPI ( G ), showing round elongated ramified cells (magnified in the inset). Bar = 50 µm, RPE = retinal pigment epithelial cells. C and H : Quantification of round IBA1-positive cells in the inner and outer retina and in the choroid of rat eyes with EIU at 24 h, injected either with vehicle or with anti-VEGF antibody ( C ) or with control rat isotype immunoglobulin G (IgG) antibodies ( H ) *p

    Article Snippet: Total RNA was isolated from neuroretinas from anti-VEGF and vehicle-injected EIU rat eyes (n = 5 eyes of five rats per group; RNeasy Plus Mini Kit; Qiagen, Courtaboeuf, France).

    Techniques: Binding Assay, Immunostaining, Injection, Staining

    VEGF-R1 and IBA1 co-immunostaining on retinal sections retinal sections of EIU rats injected with vehicle ( A – C ) or anti-VEGF ( D – F ). GCL = ganglion cell layer, INL = inner nuclear layer, ONL = outer nuclear layer, RPE = retinal pigment epithelial cells, Chor = choroid. Insets are increased magnification (5X) of regions delimited by squares. Bar = 50 µm.

    Journal: Molecular Vision

    Article Title: Anti-vascular endothelial growth factor acts on retinal microglia/macrophage activation in a rat model of ocular inflammation


    Figure Lengend Snippet: VEGF-R1 and IBA1 co-immunostaining on retinal sections retinal sections of EIU rats injected with vehicle ( A – C ) or anti-VEGF ( D – F ). GCL = ganglion cell layer, INL = inner nuclear layer, ONL = outer nuclear layer, RPE = retinal pigment epithelial cells, Chor = choroid. Insets are increased magnification (5X) of regions delimited by squares. Bar = 50 µm.

    Article Snippet: Total RNA was isolated from neuroretinas from anti-VEGF and vehicle-injected EIU rat eyes (n = 5 eyes of five rats per group; RNeasy Plus Mini Kit; Qiagen, Courtaboeuf, France).

    Techniques: Immunostaining, Injection

    VEGF-R2 and IBA1 coimmunostaining on retinal sections retinal sections of EIU rats injected with vehicle ( A – C ) or anti-VEGF ( D – F ). GCL = ganglion cell layer, INL = inner nuclear layer, ONL = outer nuclear layer, RPE = retinal pigment epithelial cells, Chor = choroid. Insets are increased magnification (5X) of regions delimited by squares. Bar = 50 µm.

    Journal: Molecular Vision

    Article Title: Anti-vascular endothelial growth factor acts on retinal microglia/macrophage activation in a rat model of ocular inflammation


    Figure Lengend Snippet: VEGF-R2 and IBA1 coimmunostaining on retinal sections retinal sections of EIU rats injected with vehicle ( A – C ) or anti-VEGF ( D – F ). GCL = ganglion cell layer, INL = inner nuclear layer, ONL = outer nuclear layer, RPE = retinal pigment epithelial cells, Chor = choroid. Insets are increased magnification (5X) of regions delimited by squares. Bar = 50 µm.

    Article Snippet: Total RNA was isolated from neuroretinas from anti-VEGF and vehicle-injected EIU rat eyes (n = 5 eyes of five rats per group; RNeasy Plus Mini Kit; Qiagen, Courtaboeuf, France).

    Techniques: Injection

    Clinical and biological effects of anti-VEGF on EIU in rats. A : Clinical scoring of endotoxin-induced uveitis (EIU; n = 5 rats per group, p > 0.05). B : vascular endothelial growth factor (VEGF) ocular levels (pg/ml) at 24 h (n = 5 rats per group, p = 0.0436). C : Polymorphonuclear cell infiltration in the anterior segment (AS) and in the posterior segment (PS) of rats (five sections/ eye, five eyes per group). D : Ocular levels of interleukin (IL)1-β (πγ/μλ; n = 5, p = 0.55), E : IL-6 (pg/ml; n = 5, p = 0.068). F : Monocyte chemoattractant protein-1 (MCP-1; pg/ml; n = 5, p = 0.3132). G : Tumor necrosis factor (TNF)-α (πγ/μλ; n = 5, p = 0.7273).

    Journal: Molecular Vision

    Article Title: Anti-vascular endothelial growth factor acts on retinal microglia/macrophage activation in a rat model of ocular inflammation


    Figure Lengend Snippet: Clinical and biological effects of anti-VEGF on EIU in rats. A : Clinical scoring of endotoxin-induced uveitis (EIU; n = 5 rats per group, p > 0.05). B : vascular endothelial growth factor (VEGF) ocular levels (pg/ml) at 24 h (n = 5 rats per group, p = 0.0436). C : Polymorphonuclear cell infiltration in the anterior segment (AS) and in the posterior segment (PS) of rats (five sections/ eye, five eyes per group). D : Ocular levels of interleukin (IL)1-β (πγ/μλ; n = 5, p = 0.55), E : IL-6 (pg/ml; n = 5, p = 0.068). F : Monocyte chemoattractant protein-1 (MCP-1; pg/ml; n = 5, p = 0.3132). G : Tumor necrosis factor (TNF)-α (πγ/μλ; n = 5, p = 0.7273).

    Article Snippet: Total RNA was isolated from neuroretinas from anti-VEGF and vehicle-injected EIU rat eyes (n = 5 eyes of five rats per group; RNeasy Plus Mini Kit; Qiagen, Courtaboeuf, France).
