rneasy plus 96 kit  (Qiagen)

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    RNeasy Plus 96 Kit
    For 96 well purification of total RNA from cells using gDNA Eliminator plates Kit contents Qiagen RNeasy Plus 96 Kit 12 preps 45 to 140L Elution Volume 10 to 5 x 10e5 Cells Sample 1 3 to 3 1g Yield 96 well Plate Format Silica Technology Manual Processing For 96 well Purification of Total RNA from Cells using gDNA Eliminator Plates Ideal for End point RT PCR Quantitative Real time RT PCR Applications Includes 12 RNeasy 96 Plates 12 gDNA Eliminator 96 Plates Elution Microtubes CL Caps S Blocks AirPore Tape Sheets RNase free Reagents and Buffers Benefits Integrated removal of genomic DNA No need for DNase digestion Fast convenient sample processing Reproducible RNA yields from up to 2 000 000 cells Highly standardized procedur
    Catalog Number:
    RNeasy Plus 96 Kit
    Buy from Supplier

    Structured Review

    Qiagen rneasy plus 96 kit
    RNeasy Plus 96 Kit
    For 96 well purification of total RNA from cells using gDNA Eliminator plates Kit contents Qiagen RNeasy Plus 96 Kit 12 preps 45 to 140L Elution Volume 10 to 5 x 10e5 Cells Sample 1 3 to 3 1g Yield 96 well Plate Format Silica Technology Manual Processing For 96 well Purification of Total RNA from Cells using gDNA Eliminator Plates Ideal for End point RT PCR Quantitative Real time RT PCR Applications Includes 12 RNeasy 96 Plates 12 gDNA Eliminator 96 Plates Elution Microtubes CL Caps S Blocks AirPore Tape Sheets RNase free Reagents and Buffers Benefits Integrated removal of genomic DNA No need for DNase digestion Fast convenient sample processing Reproducible RNA yields from up to 2 000 000 cells Highly standardized procedur
    https://www.bioz.com/result/rneasy plus 96 kit/product/Qiagen
    Average 99 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    rneasy plus 96 kit - by Bioz Stars, 2020-08
    99/100 stars


    Related Articles

    RNA Extraction:

    Article Title: Host age and Plasmodium falciparum multiclonality are associated with gametocyte prevalence: a 1-year prospective cohort study
    Article Snippet: .. Total RNA extraction was performed using the RNeasy Plus 96 Kit (Qiagen), with an additional on-column DNase I treatment to eliminate any remaining contaminating genomic DNA (gDNA). ..

    Multiple Displacement Amplification:

    Article Title: Differential Functions of Splicing Factors in Mammary Transformation and Breast Cancer Metastasis
    Article Snippet: .. MCF-10A, MDA-MB231 or SUM159PT cells were harvested as described above and RNA was extracted using an RNAeasy kit (QIAGEN) including DNase I treatment. .. 1 μg of total RNA was reverse-transcribed with Superscript III reverse transcriptase (Invitrogen).


    Article Title: TNFα promotes mucosal wound repair through enhanced Platelet Activating Factor Receptor signaling in the epithelium
    Article Snippet: .. Total RNA was isolated from SKCO15 cells, T84 cells, human colonoids or colonic wounds using the RNeasy kit (Qiagen). ..

    Article Title: Toll-Like Receptor 8 Is a Major Sensor of Group B Streptococcus But Not Escherichia coli in Human Primary Monocytes and Macrophages
    Article Snippet: .. The transfection was repeated after 3 days, and the silenced MDM were infected with bacteria or stimulated with ligands for 4 h. RNA was isolated with an RNeasy 96 Plus kit (Qiagen), cDNA was transcribed with a Maxima cDNA synthesis kit (Thermo Fisher Scientific), and relative quantification by qPCR was done with StepOnePlus using TaqMan probes (Life Technologies) and Perfecta qPCR FastMix from Quanta. .. Probes used were: IFNβ, Hs01077958_s1; TNF, Hs00174128_m1; IL-6 Hs00985639_m1; IL-12A Hs1073447_m1; TBP, Hs00427620_m1, IKKβ Hs00233287_m1, cGAS/MB21D1 Hs00403553_m1, MyD88 Hs00182082_m1, STING/TMEM173 Hs00736958_m1, TLR7 Hs00152971_m1, TLR8 Hs00607866_mH, IRF5 Hs00158114_m1, and TBK1 Hs00179410_m1.

    Article Title: Engineered zinc-finger transcription factors activate OCT4 (POU5F1), SOX2, KLF4, c-MYC (MYC) and miR302/367
    Article Snippet: .. Total RNA was isolated from all cells using RNeasy Plus 96 Kit (Qiagen) or RNeasy Plus Mini Kit (Qiagen). .. The levels of target gene mRNA and PPIA (cyclophilin A) endogenous control mRNA were measured by real-time quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) using Quantitative RT-PCR ReadyMix (QR0100), as recommended by the manufacturer.


    Article Title: Toll-Like Receptor 8 Is a Major Sensor of Group B Streptococcus But Not Escherichia coli in Human Primary Monocytes and Macrophages
    Article Snippet: .. The transfection was repeated after 3 days, and the silenced MDM were infected with bacteria or stimulated with ligands for 4 h. RNA was isolated with an RNeasy 96 Plus kit (Qiagen), cDNA was transcribed with a Maxima cDNA synthesis kit (Thermo Fisher Scientific), and relative quantification by qPCR was done with StepOnePlus using TaqMan probes (Life Technologies) and Perfecta qPCR FastMix from Quanta. .. Probes used were: IFNβ, Hs01077958_s1; TNF, Hs00174128_m1; IL-6 Hs00985639_m1; IL-12A Hs1073447_m1; TBP, Hs00427620_m1, IKKβ Hs00233287_m1, cGAS/MB21D1 Hs00403553_m1, MyD88 Hs00182082_m1, STING/TMEM173 Hs00736958_m1, TLR7 Hs00152971_m1, TLR8 Hs00607866_mH, IRF5 Hs00158114_m1, and TBK1 Hs00179410_m1.


    Article Title: Toll-Like Receptor 8 Is a Major Sensor of Group B Streptococcus But Not Escherichia coli in Human Primary Monocytes and Macrophages
    Article Snippet: .. The transfection was repeated after 3 days, and the silenced MDM were infected with bacteria or stimulated with ligands for 4 h. RNA was isolated with an RNeasy 96 Plus kit (Qiagen), cDNA was transcribed with a Maxima cDNA synthesis kit (Thermo Fisher Scientific), and relative quantification by qPCR was done with StepOnePlus using TaqMan probes (Life Technologies) and Perfecta qPCR FastMix from Quanta. .. Probes used were: IFNβ, Hs01077958_s1; TNF, Hs00174128_m1; IL-6 Hs00985639_m1; IL-12A Hs1073447_m1; TBP, Hs00427620_m1, IKKβ Hs00233287_m1, cGAS/MB21D1 Hs00403553_m1, MyD88 Hs00182082_m1, STING/TMEM173 Hs00736958_m1, TLR7 Hs00152971_m1, TLR8 Hs00607866_mH, IRF5 Hs00158114_m1, and TBK1 Hs00179410_m1.

    Real-time Polymerase Chain Reaction:

    Article Title: Toll-Like Receptor 8 Is a Major Sensor of Group B Streptococcus But Not Escherichia coli in Human Primary Monocytes and Macrophages
    Article Snippet: .. The transfection was repeated after 3 days, and the silenced MDM were infected with bacteria or stimulated with ligands for 4 h. RNA was isolated with an RNeasy 96 Plus kit (Qiagen), cDNA was transcribed with a Maxima cDNA synthesis kit (Thermo Fisher Scientific), and relative quantification by qPCR was done with StepOnePlus using TaqMan probes (Life Technologies) and Perfecta qPCR FastMix from Quanta. .. Probes used were: IFNβ, Hs01077958_s1; TNF, Hs00174128_m1; IL-6 Hs00985639_m1; IL-12A Hs1073447_m1; TBP, Hs00427620_m1, IKKβ Hs00233287_m1, cGAS/MB21D1 Hs00403553_m1, MyD88 Hs00182082_m1, STING/TMEM173 Hs00736958_m1, TLR7 Hs00152971_m1, TLR8 Hs00607866_mH, IRF5 Hs00158114_m1, and TBK1 Hs00179410_m1.


    Article Title: Primary cell-based phenotypic assays to pharmacologically and genetically study fibrotic diseases in vitro
    Article Snippet: .. Gene expression analysis For determination of siRNA mediated gene knock down, cells were lysed and RNA was prepared using the RNeasy Plus 96 Kit according to the manufacture’s protocol. .. 2 μg of total RNA was reverse transcribed with the High-Capacity cDNA Reverse Transcription Kit as described in the supplier’s protocol. qPCR with 2μl of cDNA and gene-specific TaqMan Assays (TGFBR1: Hs00610320_m1; ACTA2: Hs00909449_m1, RNA-polymerase II amplification primers: GCAAGCGGATTCCATTTGG and TCTCAGGCCCGTAGTCATCCT, probe: AAGCACCGGACTCTTGCCTCACTTCATC) was performed as suggested in the manual.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Qiagen rneasy plus 96 kit
    Rneasy Plus 96 Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 820 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rneasy plus 96 kit/product/Qiagen
    Average 99 stars, based on 820 article reviews
    Price from $9.99 to $1999.99
    rneasy plus 96 kit - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    Image Search Results