rneasy plant mini kit qiagen  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    RNeasy Plant Mini Kit
    Description:
    For purification of total RNA from plants and fungi. Kit contents: Qiagen RNeasy Plant Mini Kit, 20 preps, 10 to 100mg Sample, 30 to 100L Elution Volume, Plant Sample, Total RNA Purification, Spin Column Format, Silica Technology, Ideal for Northern, Dot and Slot Blotting, End-point RT-PCR, Quantitative, Real-time RT-PCR, Array Analysis, Includes 20 RNeasy Mini Spin Columns, 20 QIAshredder Mini Spin Columns, Collection Tubes (1.5mL and 2mL), RNase-free Reagents and Buffers. Benefits: High-quality total RNA in 30 minutes. No phenol/chloroform extraction. No CsCl gradients, no LiCl or ethanol precipitation. Excellent recovery of RNA. Ready-to-use RNA for any downstream applicatio
    Catalog Number:
    74903
    Price:
    None
    Category:
    RNeasy Plant Mini Kit
    Score:
    85
    Buy from Supplier


    Structured Review

    Qiagen rneasy plant mini kit qiagen
    RNeasy Plant Mini Kit
    For purification of total RNA from plants and fungi. Kit contents: Qiagen RNeasy Plant Mini Kit, 20 preps, 10 to 100mg Sample, 30 to 100L Elution Volume, Plant Sample, Total RNA Purification, Spin Column Format, Silica Technology, Ideal for Northern, Dot and Slot Blotting, End-point RT-PCR, Quantitative, Real-time RT-PCR, Array Analysis, Includes 20 RNeasy Mini Spin Columns, 20 QIAshredder Mini Spin Columns, Collection Tubes (1.5mL and 2mL), RNase-free Reagents and Buffers. Benefits: High-quality total RNA in 30 minutes. No phenol/chloroform extraction. No CsCl gradients, no LiCl or ethanol precipitation. Excellent recovery of RNA. Ready-to-use RNA for any downstream applicatio
    https://www.bioz.com/result/rneasy plant mini kit qiagen/product/Qiagen
    Average 99 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    rneasy plant mini kit qiagen - by Bioz Stars, 2019-10
    99/100 stars

    Images

    Related Articles

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Tissue-specific expression and post-translational modifications of plant- and bacterial-type phosphoenolpyruvate carboxylase isozymes of the castor oil plant, Ricinus communis L.
    Article Snippet: Paragraph title: Extraction of total RNA and RT-PCR ... Total RNA was isolated using the RNeasy Plant Mini Kit (Qiagen, Valencia, CA, USA) with an additional on-column DNase digestion step to eliminate genomic DNA. cDNA was synthesized with SuperScript III reverse transcriptase (Invitrogen, Carlsbad, CA, USA) as per the manufacturer’s protocol.

    Article Title: Post-Transcriptional Silencing of Flavonol Synthase mRNA in Tobacco Leads to Fruits with Arrested Seed Set
    Article Snippet: Semi-quantitative RT-PCR analysis was performed to test the effect of FLS silencing on the endogenous expression levels of flavonoid biosynthetic pathway genes. .. For this, total RNA was extracted from the leaf of control and silenced transgenics using RNeasy plant mini kit (Qiagen).

    Article Title: Flowering Time Genes Heading date 1 and Early heading date 1 Together Control Panicle Development in Rice
    Article Snippet: Paragraph title: mRNA sampling and quantitative RT–PCR analysis of gene expression ... Total RNA was extracted by using an RNeasy Plant Mini Kit (Qiagen) in accordance with the manufacturer's instructions.

    Article Title: The effects of disruption of phosphoglucose isomerase gene on carbon utilisation and cellulase production in Trichoderma reesei Rut-C30
    Article Snippet: Total RNA was isolated using the RNeasy Plant Mini kit (Qiagen, Spain). .. 250 ng of RNA samples were treated with 1 U of rDNAsa I (USB, Affymetrix, Inc) for 15 min at 25°C and the reactions were stopped with 1 μl of 50 mM EDTA and incubated at 65°C for 10 min. Total RNA concentration was estimated using a Nanodrop ND-1000 spectrophotometer (NanoDrop Technologies, Wilmintong, DE, USA).

    Article Title: Site-Directed Mutagenesis of IRX9, IRX9L and IRX14 Proteins Involved in Xylan Biosynthesis: Glycosyltransferase Activity Is Not Required for IRX9 Function in Arabidopsis
    Article Snippet: RT-PCR was used to confirm that the transgene was expressed in the selected plant lines. .. Total RNA was extracted from wild type and transgenic plants using the RNeasy Plant Mini Kit (QIAGEN).

    Article Title: Cloning and Functional Characterization of a Vacuolar Na+/H+ Antiporter Gene from Mungbean (VrNHX1) and Its Ectopic Expression Enhanced Salt Tolerance in Arabidopsis thaliana
    Article Snippet: Paragraph title: Expression analysis of VrNHX1 using semi-quantitative RT-PCR ... Total RNA was extracted using RNeasy Plant Mini Kit (Qiagen, Venlo, Limburg, Netherlands) and reverse transcribed using Revert Aid First Strand cDNA Synthesis Kit.

    Synthesized:

    Article Title: Tissue-specific expression and post-translational modifications of plant- and bacterial-type phosphoenolpyruvate carboxylase isozymes of the castor oil plant, Ricinus communis L.
    Article Snippet: Columbia) seeds were germinated on sterile agar plates containing half-strength Murashige–Skoog medium and 1% (w/v) sucrose and the seedlings were harvested after 7 d. .. Total RNA was isolated using the RNeasy Plant Mini Kit (Qiagen, Valencia, CA, USA) with an additional on-column DNase digestion step to eliminate genomic DNA. cDNA was synthesized with SuperScript III reverse transcriptase (Invitrogen, Carlsbad, CA, USA) as per the manufacturer’s protocol. .. Castor actin and PEPC isoforms were amplified with gene-specific primer pairs as follows: RcPpc1 (forward 5′-CATCACGATCTCCACCCATCCA-3′, reverse 5′-GATTCAAGCTGCATTCCGCACA-3′); RcPpc3 (forward 5′-TCCCCGTAAACTTGATGAGC-3′, reverse 5′-TATAGGAAACCGATCCAAAAGCAAA-3′); RcPpc4 (forward 5′-TGCTGGAGAAGCAGCTGGCATTGG-3′, reverse 5′-ACCTCCTGCTTGCAAACTGTGTCA-3′); and RcActin (forward 5′-TTGCAGACCGTATGAGCAAG-3′, reverse 5′-TATAGGTCATACTCGCCCTTGGAAA-3′).

    Article Title: Zebrafish Kr?ppel-Like Factor 4a Represses Intestinal Cell Proliferation and Promotes Differentiation of Intestinal Cell Lineages
    Article Snippet: Total RNA of 96-hpf wild type and klf4a morphant embryos were extracted with RNeasy Plant Mini Kit (Qiagen) and their qualities were verified by Bioanalyzer 2100 (Agilent). .. Total RNA of 96-hpf wild type and klf4a morphant embryos were extracted with RNeasy Plant Mini Kit (Qiagen) and their qualities were verified by Bioanalyzer 2100 (Agilent).

    Article Title: SlWUS1; An X-linked Gene Having No Homologous Y-Linked Copy in Silene latifolia
    Article Snippet: Leaves and flower buds were frozen in liquid nitrogen and stored at –80° before their use in DNA or RNA preparation. .. Total RNA was extracted from male and female flower buds using an RNeasy Plant Mini Kit (QIAGEN, Hilden, Germany). cDNA was synthesized from 3 mg of total RNA using Superscript II reverse transcriptase (Invitrogen by Life Technologies, Carlsbad, CA). .. A fraction of the cDNA preparation was then subjected to 30 cycles of PCR amplification (94° for 1 min, 50° for 1 min, and 70° for 1 min) with the degenerate primers 5′-TCY BCR TGC ATN GGR AAT AG-3′ and 5′-TGG TTY CAR AAY CAT AAA GC-3′.

    Quantitative RT-PCR:

    Article Title: Enhancement of carotenoids biosynthesis in Chlamydomonas reinhardtii by nuclear transformation using a phytoene synthase gene isolated from Chlorella zofingiensis
    Article Snippet: DNA and total RNA were isolated using DNeasy Plant Mini Kit and RNeasy Plant Mini Kit (Qiagen, Düsseldorf, Germany), respectively. .. The DNA isolation was performed by phenol-chloroform-isoamyl alcohol (50:48:2) extraction and selective precipitation with ethanol, according to previously described protocols (Anwaruzzaman et al. ).

    Real-time Polymerase Chain Reaction:

    Article Title: Enhancement of carotenoids biosynthesis in Chlamydomonas reinhardtii by nuclear transformation using a phytoene synthase gene isolated from Chlorella zofingiensis
    Article Snippet: DNA and total RNA were isolated using DNeasy Plant Mini Kit and RNeasy Plant Mini Kit (Qiagen, Düsseldorf, Germany), respectively. .. The DNA isolation was performed by phenol-chloroform-isoamyl alcohol (50:48:2) extraction and selective precipitation with ethanol, according to previously described protocols (Anwaruzzaman et al. ).

    Article Title: An atypical bHLH protein encoded by POSITIVE REGULATOR OF GRAIN LENGTH 2 is involved in controlling grain length and weight of rice through interaction with a typical bHLH protein APG
    Article Snippet: Paragraph title: Gene expression analysis by qPCR ... Lemma/palea and pistils at the preanthesis stage, leaves and roots of one-week old plants were separated and used for RNA extraction with a RNeasy plant mini kit (Qiagen).

    Article Title: Arabidopsis cell expansion is controlled by a photothermal switch
    Article Snippet: Paragraph title: Immunoblotting and quantitative PCR ... In short, the samples were harvested into RNAlater (Sigma), and total RNA was extracted using RNeasy Plant Mini Kit (Qiagen). cDNA synthesis was performed using SuperScript VILO cDNA Synthesis Kit (Invitrogen).

    Microarray:

    Article Title: Identification and characterization of wheat long non-protein coding RNAs responsive to powdery mildew infection and heat stress by using microarray analysis and SBS sequencing
    Article Snippet: Paragraph title: Microarray analysis ... Briefly, mRNA was enriched from 80~90 μg total RNA using the RNeasy Plant Mini Kit (QIAGEN) according to the protocol, and was subsequently reverse-transcribed to double stranded cDNA using the GeneChip® Two-Cycle cDNA Synthesis Kit.

    Article Title: Zebrafish Kr?ppel-Like Factor 4a Represses Intestinal Cell Proliferation and Promotes Differentiation of Intestinal Cell Lineages
    Article Snippet: Paragraph title: DNA Microarray and Gene Ontology (GO) Analyses ... Total RNA of 96-hpf wild type and klf4a morphant embryos were extracted with RNeasy Plant Mini Kit (Qiagen) and their qualities were verified by Bioanalyzer 2100 (Agilent).

    Incubation:

    Article Title: Zebrafish Kr?ppel-Like Factor 4a Represses Intestinal Cell Proliferation and Promotes Differentiation of Intestinal Cell Lineages
    Article Snippet: Total RNA of 96-hpf wild type and klf4a morphant embryos were extracted with RNeasy Plant Mini Kit (Qiagen) and their qualities were verified by Bioanalyzer 2100 (Agilent). .. Total RNA of 96-hpf wild type and klf4a morphant embryos were extracted with RNeasy Plant Mini Kit (Qiagen) and their qualities were verified by Bioanalyzer 2100 (Agilent).

    Article Title: RNA-Seq Analysis of Quercus pubescens Leaves: De Novo Transcriptome Assembly, Annotation and Functional Markers Development
    Article Snippet: Seven cDNA libraries (one from each sampling) were prepared using pooled mRNA. .. Total RNA of each sample was extracted separately from 100 mg of leaves using Qiagen RNeasy Plant Mini Kit (Qiagen, Valencia, CA) following manufacturer's instructions with minor modifications: 10% v/v of N-lauroyl sarcosine 20% w/v was added to RLC buffer for each sample followed by incubation at 70°C for 10 min with vigorous shaking before proceeding with the standard protocol. .. The RNA samples were treated with 2 units of DNase I (Ambion, Life Technologies, Gaithersburg, MD) for 30 min at 37°C to remove contaminating genomic DNA.

    Expressing:

    Article Title: Post-Transcriptional Silencing of Flavonol Synthase mRNA in Tobacco Leads to Fruits with Arrested Seed Set
    Article Snippet: Paragraph title: Expression analysis of flavonoid biosynthetic pathway genes ... For this, total RNA was extracted from the leaf of control and silenced transgenics using RNeasy plant mini kit (Qiagen).

    Article Title: Zebrafish Kr?ppel-Like Factor 4a Represses Intestinal Cell Proliferation and Promotes Differentiation of Intestinal Cell Lineages
    Article Snippet: Total RNA of 96-hpf wild type and klf4a morphant embryos were extracted with RNeasy Plant Mini Kit (Qiagen) and their qualities were verified by Bioanalyzer 2100 (Agilent). .. Total RNA of 96-hpf wild type and klf4a morphant embryos were extracted with RNeasy Plant Mini Kit (Qiagen) and their qualities were verified by Bioanalyzer 2100 (Agilent).

    Article Title: Flowering Time Genes Heading date 1 and Early heading date 1 Together Control Panicle Development in Rice
    Article Snippet: Paragraph title: mRNA sampling and quantitative RT–PCR analysis of gene expression ... Total RNA was extracted by using an RNeasy Plant Mini Kit (Qiagen) in accordance with the manufacturer's instructions.

    Article Title: The effects of disruption of phosphoglucose isomerase gene on carbon utilisation and cellulase production in Trichoderma reesei Rut-C30
    Article Snippet: Paragraph title: RNA isolation and expression ... Total RNA was isolated using the RNeasy Plant Mini kit (Qiagen, Spain).

    Article Title: An atypical bHLH protein encoded by POSITIVE REGULATOR OF GRAIN LENGTH 2 is involved in controlling grain length and weight of rice through interaction with a typical bHLH protein APG
    Article Snippet: Paragraph title: Gene expression analysis by qPCR ... Lemma/palea and pistils at the preanthesis stage, leaves and roots of one-week old plants were separated and used for RNA extraction with a RNeasy plant mini kit (Qiagen).

    Article Title: Cloning and Functional Characterization of a Vacuolar Na+/H+ Antiporter Gene from Mungbean (VrNHX1) and Its Ectopic Expression Enhanced Salt Tolerance in Arabidopsis thaliana
    Article Snippet: Paragraph title: Expression analysis of VrNHX1 using semi-quantitative RT-PCR ... Total RNA was extracted using RNeasy Plant Mini Kit (Qiagen, Venlo, Limburg, Netherlands) and reverse transcribed using Revert Aid First Strand cDNA Synthesis Kit.

    Hybridization:

    Article Title: Rhythmic Diel Pattern of Gene Expression in Juvenile Maize Leaf
    Article Snippet: Paragraph title: RNA preparation and hybridization ... RNA was isolated and purified from frozen leaf samples with RNeasy Plant Mini Kit (Qiagen) following manufacturer's manual.

    Countercurrent Chromatography:

    Article Title: SlWUS1; An X-linked Gene Having No Homologous Y-Linked Copy in Silene latifolia
    Article Snippet: Total RNA was extracted from male and female flower buds using an RNeasy Plant Mini Kit (QIAGEN, Hilden, Germany). cDNA was synthesized from 3 mg of total RNA using Superscript II reverse transcriptase (Invitrogen by Life Technologies, Carlsbad, CA). .. To determine the sequence of the full-length SlWUS cDNA, both 5′ and 3′ RACE (Rapid Amplification of cDNA Ends) were performed using GeneRacer (Invitrogen by Life Technologies).

    DNA Labeling:

    Article Title: Zebrafish Kr?ppel-Like Factor 4a Represses Intestinal Cell Proliferation and Promotes Differentiation of Intestinal Cell Lineages
    Article Snippet: Total RNA of 96-hpf wild type and klf4a morphant embryos were extracted with RNeasy Plant Mini Kit (Qiagen) and their qualities were verified by Bioanalyzer 2100 (Agilent). .. Total RNA of 96-hpf wild type and klf4a morphant embryos were extracted with RNeasy Plant Mini Kit (Qiagen) and their qualities were verified by Bioanalyzer 2100 (Agilent).

    Sequencing:

    Article Title: Flowering Time Genes Heading date 1 and Early heading date 1 Together Control Panicle Development in Rice
    Article Snippet: Total RNA was extracted by using an RNeasy Plant Mini Kit (Qiagen) in accordance with the manufacturer's instructions. .. Real-time quantitative reverse transcription–PCR (RT–PCR) analysis was performed as described previously.

    Article Title: SlWUS1; An X-linked Gene Having No Homologous Y-Linked Copy in Silene latifolia
    Article Snippet: Total RNA was extracted from male and female flower buds using an RNeasy Plant Mini Kit (QIAGEN, Hilden, Germany). cDNA was synthesized from 3 mg of total RNA using Superscript II reverse transcriptase (Invitrogen by Life Technologies, Carlsbad, CA). .. A fraction of the cDNA preparation was then subjected to 30 cycles of PCR amplification (94° for 1 min, 50° for 1 min, and 70° for 1 min) with the degenerate primers 5′-TCY BCR TGC ATN GGR AAT AG-3′ and 5′-TGG TTY CAR AAY CAT AAA GC-3′.

    Article Title: Vernalization Mediated Changes in the Lolium perenne Transcriptome
    Article Snippet: Total RNA was extracted using the RNeasy Plant Mini kit (Qiagen) following the manufacturer's protocol. .. The RNA quality and concentration were assessed with the Agilent RNA 6000 Nano kit on the Agilent 2100 Bioanalyzer (Agilent Technologies).

    Cellular Antioxidant Activity Assay:

    Article Title: SlWUS1; An X-linked Gene Having No Homologous Y-Linked Copy in Silene latifolia
    Article Snippet: Total RNA was extracted from male and female flower buds using an RNeasy Plant Mini Kit (QIAGEN, Hilden, Germany). cDNA was synthesized from 3 mg of total RNA using Superscript II reverse transcriptase (Invitrogen by Life Technologies, Carlsbad, CA). .. To determine the sequence of the full-length SlWUS cDNA, both 5′ and 3′ RACE (Rapid Amplification of cDNA Ends) were performed using GeneRacer (Invitrogen by Life Technologies).

    DNA Extraction:

    Article Title: Enhancement of carotenoids biosynthesis in Chlamydomonas reinhardtii by nuclear transformation using a phytoene synthase gene isolated from Chlorella zofingiensis
    Article Snippet: DNA and total RNA were isolated using DNeasy Plant Mini Kit and RNeasy Plant Mini Kit (Qiagen, Düsseldorf, Germany), respectively. .. For genomic DNA isolation for PCR screening of transformants from C. reinhardtii , a loopful of cells was scrapped from a plate and resuspended in 150 μL of cold distilled water and 350 μL of a buffered solution containing 50 mM Tris–HCl, pH 8, 0.3 M NaCl, 5 mM EDTA, and 2% SDS.

    Nucleic Acid Electrophoresis:

    Article Title: Transcriptome Sequencing and Identification of Cold Tolerance Genes in Hardy Corylus Species (C. heterophylla Fisch) Floral Buds
    Article Snippet: Total RNA was extracted from floral buds using the RNeasy Plant Mini kit (Qiagen, Valencia, CA, USA). .. RNA was concentrated and purified with an RNA MinElute kit (Qiagen).

    Mutagenesis:

    Article Title: Site-Directed Mutagenesis of IRX9, IRX9L and IRX14 Proteins Involved in Xylan Biosynthesis: Glycosyltransferase Activity Is Not Required for IRX9 Function in Arabidopsis
    Article Snippet: Positive transfomants were genotyped by PCR using gene-specific primers ( ) to verify the homozygous mutant background. .. Total RNA was extracted from wild type and transgenic plants using the RNeasy Plant Mini Kit (QIAGEN).

    Isolation:

    Article Title: Tissue-specific expression and post-translational modifications of plant- and bacterial-type phosphoenolpyruvate carboxylase isozymes of the castor oil plant, Ricinus communis L.
    Article Snippet: Columbia) seeds were germinated on sterile agar plates containing half-strength Murashige–Skoog medium and 1% (w/v) sucrose and the seedlings were harvested after 7 d. .. Total RNA was isolated using the RNeasy Plant Mini Kit (Qiagen, Valencia, CA, USA) with an additional on-column DNase digestion step to eliminate genomic DNA. cDNA was synthesized with SuperScript III reverse transcriptase (Invitrogen, Carlsbad, CA, USA) as per the manufacturer’s protocol. .. Castor actin and PEPC isoforms were amplified with gene-specific primer pairs as follows: RcPpc1 (forward 5′-CATCACGATCTCCACCCATCCA-3′, reverse 5′-GATTCAAGCTGCATTCCGCACA-3′); RcPpc3 (forward 5′-TCCCCGTAAACTTGATGAGC-3′, reverse 5′-TATAGGAAACCGATCCAAAAGCAAA-3′); RcPpc4 (forward 5′-TGCTGGAGAAGCAGCTGGCATTGG-3′, reverse 5′-ACCTCCTGCTTGCAAACTGTGTCA-3′); and RcActin (forward 5′-TTGCAGACCGTATGAGCAAG-3′, reverse 5′-TATAGGTCATACTCGCCCTTGGAAA-3′).

    Article Title: The effects of disruption of phosphoglucose isomerase gene on carbon utilisation and cellulase production in Trichoderma reesei Rut-C30
    Article Snippet: Mycelia were lysed in a Fast-Prep® -24 homogenizer (MP™Biomedicals LLC Europe, France) using zirconia microbeads by 2 pulses of 30 s at 6 m/s. .. Total RNA was isolated using the RNeasy Plant Mini kit (Qiagen, Spain). .. 250 ng of RNA samples were treated with 1 U of rDNAsa I (USB, Affymetrix, Inc) for 15 min at 25°C and the reactions were stopped with 1 μl of 50 mM EDTA and incubated at 65°C for 10 min. Total RNA concentration was estimated using a Nanodrop ND-1000 spectrophotometer (NanoDrop Technologies, Wilmintong, DE, USA).

    Article Title: Enhancement of carotenoids biosynthesis in Chlamydomonas reinhardtii by nuclear transformation using a phytoene synthase gene isolated from Chlorella zofingiensis
    Article Snippet: For the analysis of transformants, cells were grown in Erlenmeyer flasks of 100 mL capacity at 25°C under continuous illumination (50 μmol photons m−2 s−1 ) in liquid TAP medium. .. DNA and total RNA were isolated using DNeasy Plant Mini Kit and RNeasy Plant Mini Kit (Qiagen, Düsseldorf, Germany), respectively. .. For genomic DNA isolation for PCR screening of transformants from C. reinhardtii , a loopful of cells was scrapped from a plate and resuspended in 150 μL of cold distilled water and 350 μL of a buffered solution containing 50 mM Tris–HCl, pH 8, 0.3 M NaCl, 5 mM EDTA, and 2% SDS.

    Article Title: Rhythmic Diel Pattern of Gene Expression in Juvenile Maize Leaf
    Article Snippet: In some cases, however, two or even more probes corresponded to a single transcript (see ). .. RNA was isolated and purified from frozen leaf samples with RNeasy Plant Mini Kit (Qiagen) following manufacturer's manual. .. RNA isolation, amplification, labeling and hybridization to microarrays followed the procedure posted on the Maize Microarray Project website ( www.microarray.org ) with minor modifications .

    Article Title: SlWUS1; An X-linked Gene Having No Homologous Y-Linked Copy in Silene latifolia
    Article Snippet: Paragraph title: Isolation of S. latifolia WUSCHEL (SlWUS ) gene and orthologs in other Silene species ... Total RNA was extracted from male and female flower buds using an RNeasy Plant Mini Kit (QIAGEN, Hilden, Germany). cDNA was synthesized from 3 mg of total RNA using Superscript II reverse transcriptase (Invitrogen by Life Technologies, Carlsbad, CA).

    Article Title: RNA-Seq Analysis of Quercus pubescens Leaves: De Novo Transcriptome Assembly, Annotation and Functional Markers Development
    Article Snippet: Paragraph title: Plant materials and RNA isolation ... Total RNA of each sample was extracted separately from 100 mg of leaves using Qiagen RNeasy Plant Mini Kit (Qiagen, Valencia, CA) following manufacturer's instructions with minor modifications: 10% v/v of N-lauroyl sarcosine 20% w/v was added to RLC buffer for each sample followed by incubation at 70°C for 10 min with vigorous shaking before proceeding with the standard protocol.

    Article Title: Exploring the Genes of Yerba Mate (Ilex paraguariensis A. St.-Hil.) by NGS and De Novo Transcriptome Assembly
    Article Snippet: Leaf samples at emerging, young, fully expanded, and early and late senescent stages from I. paraguariensis breeding line Pg538 from INTA EEA-Cerro Azul, Misiones, Argentina, were collected and immediately frozen in liquid Nitrogen. .. Total RNA was isolated from pooled leaf tissue with the RNeasy Plant Mini Kit (Qiagen Inc.) and supplemented with RNase-free DNase (Qiagen Inc.). .. To increase the depth of depletion of ribosomal RNA, a process with the RiboMinus Plant Kit (Life Sciences Inc.) was performed with the isolated RNA.

    Article Title: Identification of candidate genes involved in early iron deficiency chlorosis signaling in soybean (Glycine max) roots and leaves
    Article Snippet: Paragraph title: RNA isolation ... RNA was extracted using a Qiagen® RNeasy® Plant Mini Kit (Qiagen®, Germantown, MD).

    Size-exclusion Chromatography:

    Article Title: Cloning and Functional Characterization of a Vacuolar Na+/H+ Antiporter Gene from Mungbean (VrNHX1) and Its Ectopic Expression Enhanced Salt Tolerance in Arabidopsis thaliana
    Article Snippet: Total RNA was extracted using RNeasy Plant Mini Kit (Qiagen, Venlo, Limburg, Netherlands) and reverse transcribed using Revert Aid First Strand cDNA Synthesis Kit. .. Semi-quantitative RT-PCR was performed using gene specific primers (RF: 5′- GTATTTCCACTGGCGTAGTCATTTTGC -3′ and RR: 5′- GCATCATTCACAGCACCCTCTCGG -3′ ).

    Labeling:

    Article Title: Zebrafish Kr?ppel-Like Factor 4a Represses Intestinal Cell Proliferation and Promotes Differentiation of Intestinal Cell Lineages
    Article Snippet: Total RNA of 96-hpf wild type and klf4a morphant embryos were extracted with RNeasy Plant Mini Kit (Qiagen) and their qualities were verified by Bioanalyzer 2100 (Agilent). .. Total RNA of 96-hpf wild type and klf4a morphant embryos were extracted with RNeasy Plant Mini Kit (Qiagen) and their qualities were verified by Bioanalyzer 2100 (Agilent).

    Article Title: Rhythmic Diel Pattern of Gene Expression in Juvenile Maize Leaf
    Article Snippet: RNA was isolated and purified from frozen leaf samples with RNeasy Plant Mini Kit (Qiagen) following manufacturer's manual. .. RNA was isolated and purified from frozen leaf samples with RNeasy Plant Mini Kit (Qiagen) following manufacturer's manual.

    Purification:

    Article Title: Medicago truncatula contains a second gene encoding a plastid located glutamine synthetase exclusively expressed in developing seeds
    Article Snippet: Genomic DNA was extracted and purified from young leaves of M. truncatula or M. album , and from BAC DNA clone mth2-53e90 essentially as described in Sambrook et al.[ ]. .. Total RNA was extracted from 100 mg of plant tissue, using the RNeasy Plant mini Kit (Qiagen) according to the manufacturer's instructions.

    Article Title: Rhythmic Diel Pattern of Gene Expression in Juvenile Maize Leaf
    Article Snippet: In some cases, however, two or even more probes corresponded to a single transcript (see ). .. RNA was isolated and purified from frozen leaf samples with RNeasy Plant Mini Kit (Qiagen) following manufacturer's manual. .. RNA isolation, amplification, labeling and hybridization to microarrays followed the procedure posted on the Maize Microarray Project website ( www.microarray.org ) with minor modifications .

    Article Title: Comparative Genomics in Perennial Ryegrass (Lolium perenne L.): Identification and Characterisation of an Orthologue for the Rice Plant Architecture-Controlling Gene OsABCG5
    Article Snippet: Root, crown, leaf, inflorescence, anther, and pistil tissues were harvested from specific perennial ryegrass genotypes (Aurora6 (AU6 ) and Impact04 ) which were established at DPI-Hamilton (Victoria, Australia) [ ]. .. The RNeasy Plant Mini Kit (QIAGEN) was used for the total RNA purification process, and contaminating genomic DNA was eliminated by the on-column DNase digestion method using DNase I (QIAGEN). .. A total of 150 ng extracted RNA samples were used for cDNA synthesis with the SMART PCR cDNA synthesis Kit (Clontech, Terra Bella Avenue, Calif, USA).

    Article Title: Transcriptome Sequencing and Identification of Cold Tolerance Genes in Hardy Corylus Species (C. heterophylla Fisch) Floral Buds
    Article Snippet: Total RNA was extracted from floral buds using the RNeasy Plant Mini kit (Qiagen, Valencia, CA, USA). .. Total RNA was extracted from floral buds using the RNeasy Plant Mini kit (Qiagen, Valencia, CA, USA).

    Polymerase Chain Reaction:

    Article Title: Tissue-specific expression and post-translational modifications of plant- and bacterial-type phosphoenolpyruvate carboxylase isozymes of the castor oil plant, Ricinus communis L.
    Article Snippet: Total RNA was isolated using the RNeasy Plant Mini Kit (Qiagen, Valencia, CA, USA) with an additional on-column DNase digestion step to eliminate genomic DNA. cDNA was synthesized with SuperScript III reverse transcriptase (Invitrogen, Carlsbad, CA, USA) as per the manufacturer’s protocol. .. Total RNA was isolated using the RNeasy Plant Mini Kit (Qiagen, Valencia, CA, USA) with an additional on-column DNase digestion step to eliminate genomic DNA. cDNA was synthesized with SuperScript III reverse transcriptase (Invitrogen, Carlsbad, CA, USA) as per the manufacturer’s protocol.

    Article Title: Post-Transcriptional Silencing of Flavonol Synthase mRNA in Tobacco Leads to Fruits with Arrested Seed Set
    Article Snippet: For this, total RNA was extracted from the leaf of control and silenced transgenics using RNeasy plant mini kit (Qiagen). .. For this, total RNA was extracted from the leaf of control and silenced transgenics using RNeasy plant mini kit (Qiagen).

    Article Title: Flowering Time Genes Heading date 1 and Early heading date 1 Together Control Panicle Development in Rice
    Article Snippet: Total RNA was extracted by using an RNeasy Plant Mini Kit (Qiagen) in accordance with the manufacturer's instructions. .. Real-time quantitative reverse transcription–PCR (RT–PCR) analysis was performed as described previously.

    Article Title: The effects of disruption of phosphoglucose isomerase gene on carbon utilisation and cellulase production in Trichoderma reesei Rut-C30
    Article Snippet: Total RNA was isolated using the RNeasy Plant Mini kit (Qiagen, Spain). .. Total RNA was isolated using the RNeasy Plant Mini kit (Qiagen, Spain).

    Article Title: SlWUS1; An X-linked Gene Having No Homologous Y-Linked Copy in Silene latifolia
    Article Snippet: Total RNA was extracted from male and female flower buds using an RNeasy Plant Mini Kit (QIAGEN, Hilden, Germany). cDNA was synthesized from 3 mg of total RNA using Superscript II reverse transcriptase (Invitrogen by Life Technologies, Carlsbad, CA). .. A fraction of the cDNA preparation was then subjected to 30 cycles of PCR amplification (94° for 1 min, 50° for 1 min, and 70° for 1 min) with the degenerate primers 5′-TCY BCR TGC ATN GGR AAT AG-3′ and 5′-TGG TTY CAR AAY CAT AAA GC-3′.

    Article Title: Site-Directed Mutagenesis of IRX9, IRX9L and IRX14 Proteins Involved in Xylan Biosynthesis: Glycosyltransferase Activity Is Not Required for IRX9 Function in Arabidopsis
    Article Snippet: Positive transfomants were genotyped by PCR using gene-specific primers ( ) to verify the homozygous mutant background. .. Total RNA was extracted from wild type and transgenic plants using the RNeasy Plant Mini Kit (QIAGEN).

    Article Title: Cloning and Functional Characterization of a Vacuolar Na+/H+ Antiporter Gene from Mungbean (VrNHX1) and Its Ectopic Expression Enhanced Salt Tolerance in Arabidopsis thaliana
    Article Snippet: Total RNA was extracted using RNeasy Plant Mini Kit (Qiagen, Venlo, Limburg, Netherlands) and reverse transcribed using Revert Aid First Strand cDNA Synthesis Kit. .. Semi-quantitative RT-PCR was performed using gene specific primers (RF: 5′- GTATTTCCACTGGCGTAGTCATTTTGC -3′ and RR: 5′- GCATCATTCACAGCACCCTCTCGG -3′ ).

    Microscopy:

    Article Title: Flowering Time Genes Heading date 1 and Early heading date 1 Together Control Panicle Development in Rice
    Article Snippet: A few shoot apices of plants for test sampling were observed for each plant line using microscopy to estimate the developmental stages every 2 d when leaves and SAMs are collected for RNA preparation. .. Total RNA was extracted by using an RNeasy Plant Mini Kit (Qiagen) in accordance with the manufacturer's instructions.

    Activated Clotting Time Assay:

    Article Title: SlWUS1; An X-linked Gene Having No Homologous Y-Linked Copy in Silene latifolia
    Article Snippet: Total RNA was extracted from male and female flower buds using an RNeasy Plant Mini Kit (QIAGEN, Hilden, Germany). cDNA was synthesized from 3 mg of total RNA using Superscript II reverse transcriptase (Invitrogen by Life Technologies, Carlsbad, CA). .. To determine the sequence of the full-length SlWUS cDNA, both 5′ and 3′ RACE (Rapid Amplification of cDNA Ends) were performed using GeneRacer (Invitrogen by Life Technologies).

    Article Title: An atypical bHLH protein encoded by POSITIVE REGULATOR OF GRAIN LENGTH 2 is involved in controlling grain length and weight of rice through interaction with a typical bHLH protein APG
    Article Snippet: Lemma/palea and pistils at the preanthesis stage, leaves and roots of one-week old plants were separated and used for RNA extraction with a RNeasy plant mini kit (Qiagen). .. Quantitative PCR (qPCR) for gene expression analysis was carried out with SYBR Thunderbird (Toyobo) using gene specific primers (FPGL2: 5′-ATGTCGAGCAGAAGGTCGTC-3′ and RPGL2: 5′-TCAGGAGCGGAGGATGCTGC-3′).

    Rapid Amplification of cDNA Ends:

    Article Title: SlWUS1; An X-linked Gene Having No Homologous Y-Linked Copy in Silene latifolia
    Article Snippet: Total RNA was extracted from male and female flower buds using an RNeasy Plant Mini Kit (QIAGEN, Hilden, Germany). cDNA was synthesized from 3 mg of total RNA using Superscript II reverse transcriptase (Invitrogen by Life Technologies, Carlsbad, CA). .. The PCR products were then subcloned into the pGEM-T Easy vector (Promega Corporation, Madison, WI) and sequenced using a Big Dye Terminator v. 3.1 Cycle Sequencing Kit (Applied Biosystems by Life Technologies, Foster City, CA) and a 3730xl DNA Analyzer (Applied Biosystems by Life Technologies) with M13 Forward and Reverse primers.

    Plasmid Preparation:

    Article Title: SlWUS1; An X-linked Gene Having No Homologous Y-Linked Copy in Silene latifolia
    Article Snippet: Total RNA was extracted from male and female flower buds using an RNeasy Plant Mini Kit (QIAGEN, Hilden, Germany). cDNA was synthesized from 3 mg of total RNA using Superscript II reverse transcriptase (Invitrogen by Life Technologies, Carlsbad, CA). .. A fraction of the cDNA preparation was then subjected to 30 cycles of PCR amplification (94° for 1 min, 50° for 1 min, and 70° for 1 min) with the degenerate primers 5′-TCY BCR TGC ATN GGR AAT AG-3′ and 5′-TGG TTY CAR AAY CAT AAA GC-3′.

    Article Title: Site-Directed Mutagenesis of IRX9, IRX9L and IRX14 Proteins Involved in Xylan Biosynthesis: Glycosyltransferase Activity Is Not Required for IRX9 Function in Arabidopsis
    Article Snippet: To confirm the presence of the transgene in positive transformants, primer pairs annealing in the destination vector and the respective IRX gene were used ( ). .. Total RNA was extracted from wild type and transgenic plants using the RNeasy Plant Mini Kit (QIAGEN).

    Software:

    Article Title: Arabidopsis cell expansion is controlled by a photothermal switch
    Article Snippet: ImageJ software was used for PIF4-HA quantification, which was normalized to the dark sample at 17 °C. .. In short, the samples were harvested into RNAlater (Sigma), and total RNA was extracted using RNeasy Plant Mini Kit (Qiagen). cDNA synthesis was performed using SuperScript VILO cDNA Synthesis Kit (Invitrogen).

    SYBR Green Assay:

    Article Title: The effects of disruption of phosphoglucose isomerase gene on carbon utilisation and cellulase production in Trichoderma reesei Rut-C30
    Article Snippet: Total RNA was isolated using the RNeasy Plant Mini kit (Qiagen, Spain). .. 250 ng of RNA samples were treated with 1 U of rDNAsa I (USB, Affymetrix, Inc) for 15 min at 25°C and the reactions were stopped with 1 μl of 50 mM EDTA and incubated at 65°C for 10 min. Total RNA concentration was estimated using a Nanodrop ND-1000 spectrophotometer (NanoDrop Technologies, Wilmintong, DE, USA).

    RNA Extraction:

    Article Title: An atypical bHLH protein encoded by POSITIVE REGULATOR OF GRAIN LENGTH 2 is involved in controlling grain length and weight of rice through interaction with a typical bHLH protein APG
    Article Snippet: Thousand seeds weight was calculated from the weights of 200 fully fertile seeds after drying at 41°C for one week after harvest ( ). .. Lemma/palea and pistils at the preanthesis stage, leaves and roots of one-week old plants were separated and used for RNA extraction with a RNeasy plant mini kit (Qiagen). .. Extracted RNA was treated with DNase (Wako) followed by phenol chloroform purification and stored at −80°C until used.

    Article Title: Exploring the Genes of Yerba Mate (Ilex paraguariensis A. St.-Hil.) by NGS and De Novo Transcriptome Assembly
    Article Snippet: Paragraph title: Plant materials and RNA extraction ... Total RNA was isolated from pooled leaf tissue with the RNeasy Plant Mini Kit (Qiagen Inc.) and supplemented with RNase-free DNase (Qiagen Inc.).

    Article Title: Transcriptome Sequencing and Identification of Cold Tolerance Genes in Hardy Corylus Species (C. heterophylla Fisch) Floral Buds
    Article Snippet: Paragraph title: Plant materials and RNA extraction ... Total RNA was extracted from floral buds using the RNeasy Plant Mini kit (Qiagen, Valencia, CA, USA).

    Article Title: Vernalization Mediated Changes in the Lolium perenne Transcriptome
    Article Snippet: Total RNA was extracted using the RNeasy Plant Mini kit (Qiagen) following the manufacturer's protocol. .. The RNA quality and concentration were assessed with the Agilent RNA 6000 Nano kit on the Agilent 2100 Bioanalyzer (Agilent Technologies).

    Agarose Gel Electrophoresis:

    Article Title: RNA-Seq Analysis of Quercus pubescens Leaves: De Novo Transcriptome Assembly, Annotation and Functional Markers Development
    Article Snippet: Total RNA of each sample was extracted separately from 100 mg of leaves using Qiagen RNeasy Plant Mini Kit (Qiagen, Valencia, CA) following manufacturer's instructions with minor modifications: 10% v/v of N-lauroyl sarcosine 20% w/v was added to RLC buffer for each sample followed by incubation at 70°C for 10 min with vigorous shaking before proceeding with the standard protocol. .. Total RNA of each sample was extracted separately from 100 mg of leaves using Qiagen RNeasy Plant Mini Kit (Qiagen, Valencia, CA) following manufacturer's instructions with minor modifications: 10% v/v of N-lauroyl sarcosine 20% w/v was added to RLC buffer for each sample followed by incubation at 70°C for 10 min with vigorous shaking before proceeding with the standard protocol.

    Article Title: Cloning and Functional Characterization of a Vacuolar Na+/H+ Antiporter Gene from Mungbean (VrNHX1) and Its Ectopic Expression Enhanced Salt Tolerance in Arabidopsis thaliana
    Article Snippet: Total RNA was extracted using RNeasy Plant Mini Kit (Qiagen, Venlo, Limburg, Netherlands) and reverse transcribed using Revert Aid First Strand cDNA Synthesis Kit. .. The PCR condition was: 94°C for 3 min; 94°C for 30 sec, 58°C for 30 sec, 72°C for 30 sec for 28 cycles, and a final extension at 72°C for 10 min. Semi-quantitative RT-PCR was repeated three times.

    Electrophoresis:

    Article Title: Exploring the Genes of Yerba Mate (Ilex paraguariensis A. St.-Hil.) by NGS and De Novo Transcriptome Assembly
    Article Snippet: Total RNA was isolated from pooled leaf tissue with the RNeasy Plant Mini Kit (Qiagen Inc.) and supplemented with RNase-free DNase (Qiagen Inc.). .. To increase the depth of depletion of ribosomal RNA, a process with the RiboMinus Plant Kit (Life Sciences Inc.) was performed with the isolated RNA.

    Article Title: Arabidopsis cell expansion is controlled by a photothermal switch
    Article Snippet: For immunoblotting, total protein samples from seedlings grown as indicated in the main text were separated on a 10% SDS–polyacrylamide electrophoresis gel and transferred to a nitrocellulose membrane as previously described . .. In short, the samples were harvested into RNAlater (Sigma), and total RNA was extracted using RNeasy Plant Mini Kit (Qiagen). cDNA synthesis was performed using SuperScript VILO cDNA Synthesis Kit (Invitrogen).

    Transgenic Assay:

    Article Title: Site-Directed Mutagenesis of IRX9, IRX9L and IRX14 Proteins Involved in Xylan Biosynthesis: Glycosyltransferase Activity Is Not Required for IRX9 Function in Arabidopsis
    Article Snippet: RT-PCR was used to confirm that the transgene was expressed in the selected plant lines. .. Total RNA was extracted from wild type and transgenic plants using the RNeasy Plant Mini Kit (QIAGEN). .. First-strand cDNA synthesis was performed using the SuperScript II RT Kit (Invitrogen) according to the manufacturer's protocol.

    Sampling:

    Article Title: Flowering Time Genes Heading date 1 and Early heading date 1 Together Control Panicle Development in Rice
    Article Snippet: Paragraph title: mRNA sampling and quantitative RT–PCR analysis of gene expression ... Total RNA was extracted by using an RNeasy Plant Mini Kit (Qiagen) in accordance with the manufacturer's instructions.

    Article Title: RNA-Seq Analysis of Quercus pubescens Leaves: De Novo Transcriptome Assembly, Annotation and Functional Markers Development
    Article Snippet: Seven cDNA libraries (one from each sampling) were prepared using pooled mRNA. .. Total RNA of each sample was extracted separately from 100 mg of leaves using Qiagen RNeasy Plant Mini Kit (Qiagen, Valencia, CA) following manufacturer's instructions with minor modifications: 10% v/v of N-lauroyl sarcosine 20% w/v was added to RLC buffer for each sample followed by incubation at 70°C for 10 min with vigorous shaking before proceeding with the standard protocol.

    Article Title: Vernalization Mediated Changes in the Lolium perenne Transcriptome
    Article Snippet: Total RNA was extracted using the RNeasy Plant Mini kit (Qiagen) following the manufacturer's protocol. .. Total RNA was extracted using the RNeasy Plant Mini kit (Qiagen) following the manufacturer's protocol.

    Concentration Assay:

    Article Title: Exploring the Genes of Yerba Mate (Ilex paraguariensis A. St.-Hil.) by NGS and De Novo Transcriptome Assembly
    Article Snippet: Total RNA was isolated from pooled leaf tissue with the RNeasy Plant Mini Kit (Qiagen Inc.) and supplemented with RNase-free DNase (Qiagen Inc.). .. To increase the depth of depletion of ribosomal RNA, a process with the RiboMinus Plant Kit (Life Sciences Inc.) was performed with the isolated RNA.

    BAC Assay:

    Article Title: Medicago truncatula contains a second gene encoding a plastid located glutamine synthetase exclusively expressed in developing seeds
    Article Snippet: Genomic DNA was extracted and purified from young leaves of M. truncatula or M. album , and from BAC DNA clone mth2-53e90 essentially as described in Sambrook et al.[ ]. .. Total RNA was extracted from 100 mg of plant tissue, using the RNeasy Plant mini Kit (Qiagen) according to the manufacturer's instructions.

    CTG Assay:

    Article Title: SlWUS1; An X-linked Gene Having No Homologous Y-Linked Copy in Silene latifolia
    Article Snippet: Total RNA was extracted from male and female flower buds using an RNeasy Plant Mini Kit (QIAGEN, Hilden, Germany). cDNA was synthesized from 3 mg of total RNA using Superscript II reverse transcriptase (Invitrogen by Life Technologies, Carlsbad, CA). .. To determine the sequence of the full-length SlWUS cDNA, both 5′ and 3′ RACE (Rapid Amplification of cDNA Ends) were performed using GeneRacer (Invitrogen by Life Technologies).

    Staining:

    Article Title: Cloning and Functional Characterization of a Vacuolar Na+/H+ Antiporter Gene from Mungbean (VrNHX1) and Its Ectopic Expression Enhanced Salt Tolerance in Arabidopsis thaliana
    Article Snippet: Total RNA was extracted using RNeasy Plant Mini Kit (Qiagen, Venlo, Limburg, Netherlands) and reverse transcribed using Revert Aid First Strand cDNA Synthesis Kit. .. The PCR condition was: 94°C for 3 min; 94°C for 30 sec, 58°C for 30 sec, 72°C for 30 sec for 28 cycles, and a final extension at 72°C for 10 min. Semi-quantitative RT-PCR was repeated three times.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Qiagen rneasy plant kit
    The Two-Step Synthesis of from . (A) In bacteria, is synthesized from by two distinct enzymes encoded by bioA and bioD genes, respectively, catalyzing successively and reactions. AdoMTOB, S -adenosyl-2-oxo-4-methylthiobutyric acid. (B) Representation of BIO3 (BioD ortholog) and BIO1 (BioA ortholog) domains of BIO3-BIO1 fusion protein and of separate BIO3 and BIO1 proteins, putatively encoded by <t>Arabidopsis</t> monocistronic and bicistronic BIO3-BIO1 transcripts, respectively. [See online article for color version of this figure.]
    Rneasy Plant Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rneasy plant kit/product/Qiagen
    Average 99 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    rneasy plant kit - by Bioz Stars, 2019-10
    99/100 stars
      Buy from Supplier

    99
    Qiagen rneasy plant mini kit
    The efficiency of filter paper for purification of nucleic acids from various sources using respective <t>Qiagen</t> kits. (A) Tomato genomic DNAs purified using Qiagen DNeasy plant mini kit. (B) Tomato total RNAs purified using Qiagen <t>RNeasy</t> plant mini kit. (C) PCR products of a GUS fragment purified using Qiagen QIAquick PCR purification kit. (D) PCR products of GUS fragment recovered from an agarose gel using a Qiagen QIAquick gel extraction kit. (E) pUC -19 plasmid DNAs purified using a Qiagen QIAprep spin miniprep kit. For each panel, from left to right are (Q) nucleic acid purified in experiments using original Qiagen spin column, (G) reassembled spin column using two layers of Whatman glass microfiber filters (Grade GF/F), and (P) reassembled spin column using two layers of Whatman qualitative filter paper, (Grade 3) respectively. Upper panel is quantification data based on three experimental replicates normalized according to performance of the Qiagen kit; lower panel is an image of agarose gel electrophoresis for the same volume of purified nucleic acids.
    Rneasy Plant Mini Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 400 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rneasy plant mini kit/product/Qiagen
    Average 99 stars, based on 400 article reviews
    Price from $9.99 to $1999.99
    rneasy plant mini kit - by Bioz Stars, 2019-10
    99/100 stars
      Buy from Supplier

    Image Search Results


    The Two-Step Synthesis of from . (A) In bacteria, is synthesized from by two distinct enzymes encoded by bioA and bioD genes, respectively, catalyzing successively and reactions. AdoMTOB, S -adenosyl-2-oxo-4-methylthiobutyric acid. (B) Representation of BIO3 (BioD ortholog) and BIO1 (BioA ortholog) domains of BIO3-BIO1 fusion protein and of separate BIO3 and BIO1 proteins, putatively encoded by Arabidopsis monocistronic and bicistronic BIO3-BIO1 transcripts, respectively. [See online article for color version of this figure.]

    Journal:

    Article Title: Biochemical and Structural Characterization of the Arabidopsis Bifunctional Enzyme Dethiobiotin Synthetase-Diaminopelargonic Acid Aminotransferase: Evidence for Substrate Channeling in Biotin Synthesis

    doi: 10.1105/tpc.112.097675

    Figure Lengend Snippet: The Two-Step Synthesis of from . (A) In bacteria, is synthesized from by two distinct enzymes encoded by bioA and bioD genes, respectively, catalyzing successively and reactions. AdoMTOB, S -adenosyl-2-oxo-4-methylthiobutyric acid. (B) Representation of BIO3 (BioD ortholog) and BIO1 (BioA ortholog) domains of BIO3-BIO1 fusion protein and of separate BIO3 and BIO1 proteins, putatively encoded by Arabidopsis monocistronic and bicistronic BIO3-BIO1 transcripts, respectively. [See online article for color version of this figure.]

    Article Snippet: Full-length monocistronic and bicistronic BIO3-BIO1 cDNAs and cDNA encoding mature BIO3-BIO1 protein (mBIO3-BIO1; residues 23 to 833) were obtained by PCR amplification of an RT reaction using total RNAs isolated from Arabidopsis seedlings (RNeasy plant mini kit from Qiagen).

    Techniques: Synthesized

    Analysis of the Expression of the Arabidopsis BIO3-BIO1 Locus at the Protein Level and Subcellular Distribution. (A) Immunological detection of BIO3-BIO1 gene products in Arabidopsis . Soluble proteins (40 µg) from aboveground organs from Arabidopsis plants (lane 1) and Arabidopsis cultured cells (lane 2) were separated by SDS-PAGE and analyzed by immunoblotting using affinity-purified antibodies raised against recombinant BIO3-BIO1 (BIO3-BIO1 Ab) or preimmune serum (for negative control). (B) Immunolocalization of BIO3-BIO1 in Arabidopsis . Soluble proteins (50 µg) from total plant extracts (T), chloroplast stroma (St), mitochondrial matrix (Ma), and cytosolic enriched fraction (Cy) were separated by SDS-PAGE and analyzed by immunoblotting as in (A) . Arrows in (A) and (B) point to the BIO3-BIO1 polypeptide band. (C) Expression of BIO3-BIO1 fused to in Arabidopsis protoplasts. Constructs encoding alone ( Control), fused to the C terminus of the small subunit of ribulose-1,5-bis-phosphate carboxylase/oxygenase transit peptide (a chloroplastic marker) from Arabidopsis (Cp Control), fused to the C terminus of the dihydropterin pyrophosphokinase-dihydropteroate synthase transit peptide (a mitochondrial marker) from pea ( Pisum sativum ; Mt Control), and fused to the C terminus of full-length BIO3-BIO1 (BIO3-BIO1) were introduced into Arabidopsis protoplasts. Images are optical photomicrographs (Optical), fluorescence ( ; green pseudocolor), and chlorophyll fluorescence (Chlorophyll; red pseudocolor). Bar = 10 µm.

    Journal:

    Article Title: Biochemical and Structural Characterization of the Arabidopsis Bifunctional Enzyme Dethiobiotin Synthetase-Diaminopelargonic Acid Aminotransferase: Evidence for Substrate Channeling in Biotin Synthesis

    doi: 10.1105/tpc.112.097675

    Figure Lengend Snippet: Analysis of the Expression of the Arabidopsis BIO3-BIO1 Locus at the Protein Level and Subcellular Distribution. (A) Immunological detection of BIO3-BIO1 gene products in Arabidopsis . Soluble proteins (40 µg) from aboveground organs from Arabidopsis plants (lane 1) and Arabidopsis cultured cells (lane 2) were separated by SDS-PAGE and analyzed by immunoblotting using affinity-purified antibodies raised against recombinant BIO3-BIO1 (BIO3-BIO1 Ab) or preimmune serum (for negative control). (B) Immunolocalization of BIO3-BIO1 in Arabidopsis . Soluble proteins (50 µg) from total plant extracts (T), chloroplast stroma (St), mitochondrial matrix (Ma), and cytosolic enriched fraction (Cy) were separated by SDS-PAGE and analyzed by immunoblotting as in (A) . Arrows in (A) and (B) point to the BIO3-BIO1 polypeptide band. (C) Expression of BIO3-BIO1 fused to in Arabidopsis protoplasts. Constructs encoding alone ( Control), fused to the C terminus of the small subunit of ribulose-1,5-bis-phosphate carboxylase/oxygenase transit peptide (a chloroplastic marker) from Arabidopsis (Cp Control), fused to the C terminus of the dihydropterin pyrophosphokinase-dihydropteroate synthase transit peptide (a mitochondrial marker) from pea ( Pisum sativum ; Mt Control), and fused to the C terminus of full-length BIO3-BIO1 (BIO3-BIO1) were introduced into Arabidopsis protoplasts. Images are optical photomicrographs (Optical), fluorescence ( ; green pseudocolor), and chlorophyll fluorescence (Chlorophyll; red pseudocolor). Bar = 10 µm.

    Article Snippet: Full-length monocistronic and bicistronic BIO3-BIO1 cDNAs and cDNA encoding mature BIO3-BIO1 protein (mBIO3-BIO1; residues 23 to 833) were obtained by PCR amplification of an RT reaction using total RNAs isolated from Arabidopsis seedlings (RNeasy plant mini kit from Qiagen).

    Techniques: Expressing, Cell Culture, SDS Page, Affinity Purification, Recombinant, Negative Control, Construct, Marker, Fluorescence

    Both yield and quality are variable within and across kit based methods, yet the modified CTAB protocol produces consistent high yield and quality in stored ‘d’Anjou tissues. a RINs are higher and more consistent across methods for stored ‘d’Anjou’ peel than cortex. b Excluding protocols with degraded RNA, yields are variable across kits with the highest yield using the CTAB protocol. c Excluding protocols with degraded RNA, A 260/280− ratios were also variable across methods, with CTAB again producing the cleanest RNA. Error bars are standard error of the mean, where applicable. Some data are missing due to very low yield or severely degraded individual samples. QRP RLC Qiagen RNeasy Plant using buffer RLC, CTAB our modified CTAB protocol see Additional file 1 , OHP Omega EZNA HP total RNA, TF thermo fisher, MN RAP Macherey–Nagel NucleoSpin Plant using buffer RAP, OTR Omega EZNA total RNA, QRP RLT Qiagen RNeasy Plant using buffer RLT, MN RA1 Macherey–Nagel NucleoSpin Plant using buffer RA1, ZR ZR plant RNA MiniPrep, OPR Omega EZNA plant RNA Kit 1, QRU Qiagen RNeasy plus universal

    Journal: BMC Research Notes

    Article Title: A practical examination of RNA isolation methods for European pear (Pyrus communis)

    doi: 10.1186/s13104-017-2564-2

    Figure Lengend Snippet: Both yield and quality are variable within and across kit based methods, yet the modified CTAB protocol produces consistent high yield and quality in stored ‘d’Anjou tissues. a RINs are higher and more consistent across methods for stored ‘d’Anjou’ peel than cortex. b Excluding protocols with degraded RNA, yields are variable across kits with the highest yield using the CTAB protocol. c Excluding protocols with degraded RNA, A 260/280− ratios were also variable across methods, with CTAB again producing the cleanest RNA. Error bars are standard error of the mean, where applicable. Some data are missing due to very low yield or severely degraded individual samples. QRP RLC Qiagen RNeasy Plant using buffer RLC, CTAB our modified CTAB protocol see Additional file 1 , OHP Omega EZNA HP total RNA, TF thermo fisher, MN RAP Macherey–Nagel NucleoSpin Plant using buffer RAP, OTR Omega EZNA total RNA, QRP RLT Qiagen RNeasy Plant using buffer RLT, MN RA1 Macherey–Nagel NucleoSpin Plant using buffer RA1, ZR ZR plant RNA MiniPrep, OPR Omega EZNA plant RNA Kit 1, QRU Qiagen RNeasy plus universal

    Article Snippet: However, high quality transcriptome data that followed successful RNA isolation using the Qiagen RNeasy Plant Kit™ [ ] has been reported for pear (Pyrus communis ‘Bartlett’).

    Techniques: Modification

    The efficiency of filter paper for purification of nucleic acids from various sources using respective Qiagen kits. (A) Tomato genomic DNAs purified using Qiagen DNeasy plant mini kit. (B) Tomato total RNAs purified using Qiagen RNeasy plant mini kit. (C) PCR products of a GUS fragment purified using Qiagen QIAquick PCR purification kit. (D) PCR products of GUS fragment recovered from an agarose gel using a Qiagen QIAquick gel extraction kit. (E) pUC -19 plasmid DNAs purified using a Qiagen QIAprep spin miniprep kit. For each panel, from left to right are (Q) nucleic acid purified in experiments using original Qiagen spin column, (G) reassembled spin column using two layers of Whatman glass microfiber filters (Grade GF/F), and (P) reassembled spin column using two layers of Whatman qualitative filter paper, (Grade 3) respectively. Upper panel is quantification data based on three experimental replicates normalized according to performance of the Qiagen kit; lower panel is an image of agarose gel electrophoresis for the same volume of purified nucleic acids.

    Journal: PLoS ONE

    Article Title: Filter paper-based spin column method for cost-efficient DNA or RNA purification

    doi: 10.1371/journal.pone.0203011

    Figure Lengend Snippet: The efficiency of filter paper for purification of nucleic acids from various sources using respective Qiagen kits. (A) Tomato genomic DNAs purified using Qiagen DNeasy plant mini kit. (B) Tomato total RNAs purified using Qiagen RNeasy plant mini kit. (C) PCR products of a GUS fragment purified using Qiagen QIAquick PCR purification kit. (D) PCR products of GUS fragment recovered from an agarose gel using a Qiagen QIAquick gel extraction kit. (E) pUC -19 plasmid DNAs purified using a Qiagen QIAprep spin miniprep kit. For each panel, from left to right are (Q) nucleic acid purified in experiments using original Qiagen spin column, (G) reassembled spin column using two layers of Whatman glass microfiber filters (Grade GF/F), and (P) reassembled spin column using two layers of Whatman qualitative filter paper, (Grade 3) respectively. Upper panel is quantification data based on three experimental replicates normalized according to performance of the Qiagen kit; lower panel is an image of agarose gel electrophoresis for the same volume of purified nucleic acids.

    Article Snippet: Plant total RNAs were purified using filter paper-based spin columns following the protocol of the Qiagen RNeasy Plant mini kit (RNeasy Mini Handbook.

    Techniques: Purification, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Gel Extraction, Plasmid Preparation

    Evaluation of purification of tobacco genomic DNA and total RNA using filter paper-based spin columns with respective Qiagen kit buffers and homemade buffers. (A) Agarose gel electrophoresis for 2.5 μl tobacco genomic DNAs elution from purification experiments using Qiagen DNeasy plant mini kit buffers with Qiagen original spin column (Lane Q/Q), filter paper recharged used spin column (Lane Q/R) and filter paper-based homemade spin column (Lane Q/H*), followed by tobacco genomic DNAs purified using homemade buffer with Qiagen original spin column (Lane H/Q), filter paper recharged used spin column (Lane H/R) and filter paper-based homemade spin column (Lane H/H*). (B) UV spectrum curve of tobacco DNAs purified using Qiagen kit (Q/Q, black curve), filter paper recharged spin columns with Qiagen kit buffers (Q/R, blue curve) or homemade buffers (H/R, red curve) from the same amount leaf tissue. Y-axis is UV absorbance, and X-axis is wavelength (nM). (C) Amplification plots for three duplicated qPCR reactions contain 20 ng DNA purified using Qiagen kit (Q/Q, Blue curves) or DNA purified from filter paper recharged spin column with homemade buffer (H/R, Red curves) respectively. The x-axis is PCR cycle numbers, Y-axis is the level of SYBR fluorescence, and the green line is an arbitrary threshold to determine the Cq value (the fractional cycle number at which amplification curve meet threshold level). (D) MOPS-formaldehyde denaturing agarose gel electrophoresis separated 5 μl RNA purified using Qiagen RNeasy plant mini kit buffers with a Qiagen original spin column (Lane Q/Q), filter paper recharged used spin column (Lane Q/R) and homemade filter paper-based spin column (Lane Q/H*), followed total tobacco RNAs purified by using homemade buffer with Qiagen original spin column (Lane H/Q), filter paper recharged used spin column (Lane H/R) and filter paper-based homemade spin column (Lane H/H*). (E) UV spectrum of tobacco total RNA purified using Qiagen kit (Q/Q, black curve), filter paper recharged spin column with Qiagen RNeasy plant mini kit buffers (Q/R, blue curve) or homemade buffers (H/R, red curve). Y-axis is UV absorbance, and the X-axis is wavelength. (F) Amplification plots of three duplicated qRT-PCR reactions for 2.5 ng RNA purified using Qiagen kit (Q/Q, Blue curves) or RNA purified using filter paper recharged spin column with homemade buffer (H/R, Red curves) respectively. Note: * The starting material amount is 100 mg tobacco leaf tissue for experiments using a Qiagen spin column or filter paper recharged spin column, and half amount of plant sample (50 mg) used for homemade spin column purification. All DNAs or RNAs were eluted using 100 ul elution solution.

    Journal: PLoS ONE

    Article Title: Filter paper-based spin column method for cost-efficient DNA or RNA purification

    doi: 10.1371/journal.pone.0203011

    Figure Lengend Snippet: Evaluation of purification of tobacco genomic DNA and total RNA using filter paper-based spin columns with respective Qiagen kit buffers and homemade buffers. (A) Agarose gel electrophoresis for 2.5 μl tobacco genomic DNAs elution from purification experiments using Qiagen DNeasy plant mini kit buffers with Qiagen original spin column (Lane Q/Q), filter paper recharged used spin column (Lane Q/R) and filter paper-based homemade spin column (Lane Q/H*), followed by tobacco genomic DNAs purified using homemade buffer with Qiagen original spin column (Lane H/Q), filter paper recharged used spin column (Lane H/R) and filter paper-based homemade spin column (Lane H/H*). (B) UV spectrum curve of tobacco DNAs purified using Qiagen kit (Q/Q, black curve), filter paper recharged spin columns with Qiagen kit buffers (Q/R, blue curve) or homemade buffers (H/R, red curve) from the same amount leaf tissue. Y-axis is UV absorbance, and X-axis is wavelength (nM). (C) Amplification plots for three duplicated qPCR reactions contain 20 ng DNA purified using Qiagen kit (Q/Q, Blue curves) or DNA purified from filter paper recharged spin column with homemade buffer (H/R, Red curves) respectively. The x-axis is PCR cycle numbers, Y-axis is the level of SYBR fluorescence, and the green line is an arbitrary threshold to determine the Cq value (the fractional cycle number at which amplification curve meet threshold level). (D) MOPS-formaldehyde denaturing agarose gel electrophoresis separated 5 μl RNA purified using Qiagen RNeasy plant mini kit buffers with a Qiagen original spin column (Lane Q/Q), filter paper recharged used spin column (Lane Q/R) and homemade filter paper-based spin column (Lane Q/H*), followed total tobacco RNAs purified by using homemade buffer with Qiagen original spin column (Lane H/Q), filter paper recharged used spin column (Lane H/R) and filter paper-based homemade spin column (Lane H/H*). (E) UV spectrum of tobacco total RNA purified using Qiagen kit (Q/Q, black curve), filter paper recharged spin column with Qiagen RNeasy plant mini kit buffers (Q/R, blue curve) or homemade buffers (H/R, red curve). Y-axis is UV absorbance, and the X-axis is wavelength. (F) Amplification plots of three duplicated qRT-PCR reactions for 2.5 ng RNA purified using Qiagen kit (Q/Q, Blue curves) or RNA purified using filter paper recharged spin column with homemade buffer (H/R, Red curves) respectively. Note: * The starting material amount is 100 mg tobacco leaf tissue for experiments using a Qiagen spin column or filter paper recharged spin column, and half amount of plant sample (50 mg) used for homemade spin column purification. All DNAs or RNAs were eluted using 100 ul elution solution.

    Article Snippet: Plant total RNAs were purified using filter paper-based spin columns following the protocol of the Qiagen RNeasy Plant mini kit (RNeasy Mini Handbook.

    Techniques: Purification, Agarose Gel Electrophoresis, Amplification, Real-time Polymerase Chain Reaction, Polymerase Chain Reaction, Fluorescence, Quantitative RT-PCR