rneasy mini kit  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    RNeasy Plus Kit
    Description:

    Catalog Number:
    74104
    Price:
    None
    Score:
    85
    Buy from Supplier


    Structured Review

    Qiagen rneasy mini kit
    A) Concentration of <t>RNA</t> extracted from HEK293 cells encapsulated in the four peptide hydrogels and cell-only controls using the three methods (see text for details). B Representative electrophoresis traces of total RNA extracted from cells encapsulated in the four peptide hydrogels and cell-only controls using the Tri Reagent and <t>RNeasy</t> MK methods and corresponding RIN values: cell-only controls (A+E), PGD-Alpha1 (B+F), PGD-Alpha2 (G), PGD-AlphaProB (C+H) and PGD-AlphaProC (D+I). C D) Representative UV spectra for RNA samples extracted using the TRI Reagent (C) and the RNeasy MK (D) methods from the four peptide hydrogels and cell-only control.

    https://www.bioz.com/result/rneasy mini kit/product/Qiagen
    Average 99 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    rneasy mini kit - by Bioz Stars, 2019-11
    99/100 stars

    Related Products / Commonly Used Together

    rnase-free dnase set

    Images

    1) Product Images from "RNA extraction from self-assembling peptide hydrogels to allow qPCR analysis of encapsulated cells"

    Article Title: RNA extraction from self-assembling peptide hydrogels to allow qPCR analysis of encapsulated cells

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0197517

    A) Concentration of RNA extracted from HEK293 cells encapsulated in the four peptide hydrogels and cell-only controls using the three methods (see text for details). B Representative electrophoresis traces of total RNA extracted from cells encapsulated in the four peptide hydrogels and cell-only controls using the Tri Reagent and RNeasy MK methods and corresponding RIN values: cell-only controls (A+E), PGD-Alpha1 (B+F), PGD-Alpha2 (G), PGD-AlphaProB (C+H) and PGD-AlphaProC (D+I). C D) Representative UV spectra for RNA samples extracted using the TRI Reagent (C) and the RNeasy MK (D) methods from the four peptide hydrogels and cell-only control.
    Figure Legend Snippet: A) Concentration of RNA extracted from HEK293 cells encapsulated in the four peptide hydrogels and cell-only controls using the three methods (see text for details). B Representative electrophoresis traces of total RNA extracted from cells encapsulated in the four peptide hydrogels and cell-only controls using the Tri Reagent and RNeasy MK methods and corresponding RIN values: cell-only controls (A+E), PGD-Alpha1 (B+F), PGD-Alpha2 (G), PGD-AlphaProB (C+H) and PGD-AlphaProC (D+I). C D) Representative UV spectra for RNA samples extracted using the TRI Reagent (C) and the RNeasy MK (D) methods from the four peptide hydrogels and cell-only control.

    Techniques Used: Concentration Assay, Electrophoresis

    Ct values obtained for RT-qPCR performed using RNA extracted from the four peptide hydrogels as a template. RNA isolated from cells in suspension was used as a control. The RNA extracted using either the TRI Reagent method (A-B) or RNeasy MK method (C+D) was used as templates for the amplification of two housekeeping genes: GAPDH (A+C) and RPL13A (B+D). The cycle threshold (Ct) value was determined for three independent samples measured in triplicate (or two independent samples for PGD-Alpha1 using the RNeasy method). Data is shown as mean ± SEM. The mean values were compared to the non-encapsulated cell controls using a t-test; *, P ≤ 0.05.
    Figure Legend Snippet: Ct values obtained for RT-qPCR performed using RNA extracted from the four peptide hydrogels as a template. RNA isolated from cells in suspension was used as a control. The RNA extracted using either the TRI Reagent method (A-B) or RNeasy MK method (C+D) was used as templates for the amplification of two housekeeping genes: GAPDH (A+C) and RPL13A (B+D). The cycle threshold (Ct) value was determined for three independent samples measured in triplicate (or two independent samples for PGD-Alpha1 using the RNeasy method). Data is shown as mean ± SEM. The mean values were compared to the non-encapsulated cell controls using a t-test; *, P ≤ 0.05.

    Techniques Used: Quantitative RT-PCR, Isolation, Amplification

    Ct values obtained for RT-qPCR performed using RNA extracted using RNeasy MK method from the four peptide hydrogels pre-treated with pronase enzyme solution and the cell-only control as a template. RNA extracted was used as templates for the amplification of five housekeeping genes: GAPDH (A), RPL13A (B), ACTB (C), B2M (D) and RRN18s (E) commonly expressed in HEK293 cells. The cycle threshold (Ct) values are presented as the mean ± SEM for three independent samples measured in triplicate. *, P
    Figure Legend Snippet: Ct values obtained for RT-qPCR performed using RNA extracted using RNeasy MK method from the four peptide hydrogels pre-treated with pronase enzyme solution and the cell-only control as a template. RNA extracted was used as templates for the amplification of five housekeeping genes: GAPDH (A), RPL13A (B), ACTB (C), B2M (D) and RRN18s (E) commonly expressed in HEK293 cells. The cycle threshold (Ct) values are presented as the mean ± SEM for three independent samples measured in triplicate. *, P

    Techniques Used: Quantitative RT-PCR, Amplification

    2) Product Images from "TLR-9 Contributes to the Antiviral Innate Immune Sensing of Rodent Parvoviruses MVMp and H-1PV by Normal Human Immune Cells"

    Article Title: TLR-9 Contributes to the Antiviral Innate Immune Sensing of Rodent Parvoviruses MVMp and H-1PV by Normal Human Immune Cells

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0055086

    Stimulation of an IFN-mediated antiviral response in human transformed or tumor cells upon Poly(I:C) transfection. ( A ) HEK293, HEK293T, NB324K and Hela cultures were transfected with 2 µg/ml of synthetic dsRNA Poly(I:C) (pI:C) or a 150 mM NaCl solution as control, using lipofectamine 2000 for the period indicated in the figure. The respective culture media were then collected, centrifuged to discard cellular debris, and analyzed by Enzyme-linked Immuno-Sorbent Assay (ELISA) for their content in human IFN-β. Each result is represented as mean+standard deviation of three independent experiments. ( B ) Expression of IFN-α and IFN-β transcripts in mock-treated or pI:C-transfected human cell lines was assessed by RT-PCRs. At the indicated time points, total RNAs were extracted from the respective cultures using the RNeasy kit. One µg of RNA was then treated by DNase I in order to remove potential contaminating DNA and reverse transcribed into cDNA. A fraction of the obtained cDNA (1/10) was then analyzed by PCR for its content in type-I IFN transcripts using specific primer pairs. Transcripts encoding the Human 18S ribosomal protein were used as internal loading controls. Data shown are representative of 3 experiments which gave similar results. ( C ) Assessment of the IFN-signaling (Jak/STAT) pathway activation in HEK293, HEK293T, NB324K and Hela cells upon pI:C transfection. At the time indicated mock-treated or pI:C-transfected (2 µg/ml) cultures were harvested by scraping in PBS and centrifuged. Cell pellets were then re-suspended in complete Ripa buffer supplemented with phosphatase and protease inhibitors. Total proteins were extracted from each sample as described in Materials and Methods . Fifty µg total proteins per sample were then subjected to bipartite 8/10% SDS-PAGE, transferred onto membranes, and probed with antibodies specific for phosphorylated and total isoforms of STAT 1 and STAT 2 as well as with an antibody specific to PKR. Actin was used as an internal loading control. Each presented blot is representative of 3 additional which gave similar results.
    Figure Legend Snippet: Stimulation of an IFN-mediated antiviral response in human transformed or tumor cells upon Poly(I:C) transfection. ( A ) HEK293, HEK293T, NB324K and Hela cultures were transfected with 2 µg/ml of synthetic dsRNA Poly(I:C) (pI:C) or a 150 mM NaCl solution as control, using lipofectamine 2000 for the period indicated in the figure. The respective culture media were then collected, centrifuged to discard cellular debris, and analyzed by Enzyme-linked Immuno-Sorbent Assay (ELISA) for their content in human IFN-β. Each result is represented as mean+standard deviation of three independent experiments. ( B ) Expression of IFN-α and IFN-β transcripts in mock-treated or pI:C-transfected human cell lines was assessed by RT-PCRs. At the indicated time points, total RNAs were extracted from the respective cultures using the RNeasy kit. One µg of RNA was then treated by DNase I in order to remove potential contaminating DNA and reverse transcribed into cDNA. A fraction of the obtained cDNA (1/10) was then analyzed by PCR for its content in type-I IFN transcripts using specific primer pairs. Transcripts encoding the Human 18S ribosomal protein were used as internal loading controls. Data shown are representative of 3 experiments which gave similar results. ( C ) Assessment of the IFN-signaling (Jak/STAT) pathway activation in HEK293, HEK293T, NB324K and Hela cells upon pI:C transfection. At the time indicated mock-treated or pI:C-transfected (2 µg/ml) cultures were harvested by scraping in PBS and centrifuged. Cell pellets were then re-suspended in complete Ripa buffer supplemented with phosphatase and protease inhibitors. Total proteins were extracted from each sample as described in Materials and Methods . Fifty µg total proteins per sample were then subjected to bipartite 8/10% SDS-PAGE, transferred onto membranes, and probed with antibodies specific for phosphorylated and total isoforms of STAT 1 and STAT 2 as well as with an antibody specific to PKR. Actin was used as an internal loading control. Each presented blot is representative of 3 additional which gave similar results.

    Techniques Used: Transformation Assay, Transfection, Enzyme-linked Immunosorbent Assay, Standard Deviation, Expressing, Polymerase Chain Reaction, Activation Assay, SDS Page

    Time-dependent transcriptional up-regulation of type-I IFN encoding mRNAs in MVMp- or H-1PV-infected human cell lines. ( A ) HEK293 and HEK293T, ( B ) NB324K and ( C ) Hela cells were mock-treated for 24 hrs, infected with parvoviruses (5 PFUs/cell) for the indicated times, or infected with NDV (6 HU/10 6 cells) or transfected with pI:C (2 µg/ml) for 15 hrs. At the indicated times, cells were harvested and total RNAs were extracted using the RNeasy kit. One µg was then reverse transcribed into cDNA and 10% of this product was subjected to PCR reactions using sets of primers specific to each indicated cytokine mRNA or viral transcripts. PCR product of 18S ribosomal RNA was used as housekeeping gene to normalize loading. No signal was detected in the samples when omitting the reverse transcriptase. Presented data are representative of 3 experiments which all gave similar results.
    Figure Legend Snippet: Time-dependent transcriptional up-regulation of type-I IFN encoding mRNAs in MVMp- or H-1PV-infected human cell lines. ( A ) HEK293 and HEK293T, ( B ) NB324K and ( C ) Hela cells were mock-treated for 24 hrs, infected with parvoviruses (5 PFUs/cell) for the indicated times, or infected with NDV (6 HU/10 6 cells) or transfected with pI:C (2 µg/ml) for 15 hrs. At the indicated times, cells were harvested and total RNAs were extracted using the RNeasy kit. One µg was then reverse transcribed into cDNA and 10% of this product was subjected to PCR reactions using sets of primers specific to each indicated cytokine mRNA or viral transcripts. PCR product of 18S ribosomal RNA was used as housekeeping gene to normalize loading. No signal was detected in the samples when omitting the reverse transcriptase. Presented data are representative of 3 experiments which all gave similar results.

    Techniques Used: Infection, Transfection, Polymerase Chain Reaction

    Activation of both IFN-producing and IFN-signaling pathways in hPBMCs upon parvovirus infection and comparison of their intensity to that triggered by NDV. ( A , B and D ) hPBMCs collected from the blood of healthy donors were distributed into 6-well plates at 1×10 7 cells/5 ml culture medium/well. They were then mock-treated or infected with MVMp or H-1PV at 20 PFUs/cell or with NDV (6 HU/10 6 cells). Cultures were harvested in PBS and centrifuged at the time p.i. indicated in each figure. ( A , D ) One half of each pellet was resuspended in Ripa buffer supplemented with phosphatase and protease inhibitors in order to perform Western blot experiments whereas ( B ) total RNAs were extracted from the rest of each cell pellet using the RNeasy kit. ( A , D ) Total proteins were extracted from each sample as described in Materials and Methods . Seventy µg total proteins per sample were then subjected to 10% SDS-PAGE, transferred onto membranes, and probed with antibodies specific for total and phosphorylated STAT 2 and STAT 1 polypeptides as well as for PKR. Actin was used as an internal loading control. Each presented blot is representative of 4 additional which gave similar results. ( B ). One µg of isolated total RNA was then reverse transcribed into cDNA and 10% of this product was subjected to PCR reactions using sets of primers specific to each indicated mRNA. PCR product of 18S ribosomal RNA was used as housekeeping gene to normalize loading. No signal was detected in the samples when omitting the reverse transcriptase. Presented data are representative of 4 experiments which all gave similar results. ( C ) hPBMCs collected from the blood of healthy donors were distributed into 24-well plates at 1×10 6 cells/500 µl culture medium/well. They were then mock-treated or infected with MVMp, H-1PV (20 PFUs/cell) or NDV (6 HU/10 6 cells). After a period of incubation of 24 hrs media were collected, centrifuged in order to discard cellular debris and analyzed by Enzyme-linked Immuno-Sorbent Assay (ELISA) for their content in IFN-α and IFN-β. Results are expressed as means+standard deviations of seven independent experiments.
    Figure Legend Snippet: Activation of both IFN-producing and IFN-signaling pathways in hPBMCs upon parvovirus infection and comparison of their intensity to that triggered by NDV. ( A , B and D ) hPBMCs collected from the blood of healthy donors were distributed into 6-well plates at 1×10 7 cells/5 ml culture medium/well. They were then mock-treated or infected with MVMp or H-1PV at 20 PFUs/cell or with NDV (6 HU/10 6 cells). Cultures were harvested in PBS and centrifuged at the time p.i. indicated in each figure. ( A , D ) One half of each pellet was resuspended in Ripa buffer supplemented with phosphatase and protease inhibitors in order to perform Western blot experiments whereas ( B ) total RNAs were extracted from the rest of each cell pellet using the RNeasy kit. ( A , D ) Total proteins were extracted from each sample as described in Materials and Methods . Seventy µg total proteins per sample were then subjected to 10% SDS-PAGE, transferred onto membranes, and probed with antibodies specific for total and phosphorylated STAT 2 and STAT 1 polypeptides as well as for PKR. Actin was used as an internal loading control. Each presented blot is representative of 4 additional which gave similar results. ( B ). One µg of isolated total RNA was then reverse transcribed into cDNA and 10% of this product was subjected to PCR reactions using sets of primers specific to each indicated mRNA. PCR product of 18S ribosomal RNA was used as housekeeping gene to normalize loading. No signal was detected in the samples when omitting the reverse transcriptase. Presented data are representative of 4 experiments which all gave similar results. ( C ) hPBMCs collected from the blood of healthy donors were distributed into 24-well plates at 1×10 6 cells/500 µl culture medium/well. They were then mock-treated or infected with MVMp, H-1PV (20 PFUs/cell) or NDV (6 HU/10 6 cells). After a period of incubation of 24 hrs media were collected, centrifuged in order to discard cellular debris and analyzed by Enzyme-linked Immuno-Sorbent Assay (ELISA) for their content in IFN-α and IFN-β. Results are expressed as means+standard deviations of seven independent experiments.

    Techniques Used: Activation Assay, Infection, Western Blot, SDS Page, Isolation, Polymerase Chain Reaction, Incubation, Enzyme-linked Immunosorbent Assay

    Activation of a TLR-9 dependent production of type-I IFNs in parvovirus-infected human Namalwa cells. The cells (1.10 6 cells/well of a 24-well plate) were either infected with MVMp or H-1PV (∼80 PFUs/cell equivalent to 1×10 4 virus genomes/cell), stimulated with the TLR-9 agonist ODN 2395 at 1 µM, or mock-treated. ( A ) At the indicated time points culture supernatants were collected from the respective wells and used to determine the quantity of type-I IFNs released in the culture medium by ELISA experiments. Results are expressed as means+standard deviations of three independent experiments. ( B ) Mock-treated, parvovirus-infected or ODN stimulated Namalwa cells were harvested at the indicated time points and total RNAs were extracted using the RNeasy kit as described previously in Figure 1 . Total RNAs extracted from parvovirus-infected (24 hrs p.i. at 80 PFUs/cell) or pI:C-transfected (15 hrs post-transfection with 2 µg dsRNA/ml) NB324K cells were used as positive or negative controls. Presented data are representative of 3 experiments which all gave similar results. ( C ) Total DNA was harvested at the indicated time points from parvovirus-infected (MOI of 80 PFUs/cell) or mock-treated Namalwa or HEK293T cultures to assess by Southern blot experiments as described in Figure 2 the replication of both parvoviruses (dRF, dimmer replicative form; mRF, monomeric replicative form; ssDNA, single-stranded DNA genome). The blot shown is representative of 3 experiments which gave similar results. ( D ) Cell pellets from mock-treated or parvovirus-infected Namalwa cultures were re-suspended in complete Ripa buffer and Western blotting was performed as described in Figure 6 . Actin was used as an internal loading control. Each presented blot is representative of 3 experiments which gave similar results.
    Figure Legend Snippet: Activation of a TLR-9 dependent production of type-I IFNs in parvovirus-infected human Namalwa cells. The cells (1.10 6 cells/well of a 24-well plate) were either infected with MVMp or H-1PV (∼80 PFUs/cell equivalent to 1×10 4 virus genomes/cell), stimulated with the TLR-9 agonist ODN 2395 at 1 µM, or mock-treated. ( A ) At the indicated time points culture supernatants were collected from the respective wells and used to determine the quantity of type-I IFNs released in the culture medium by ELISA experiments. Results are expressed as means+standard deviations of three independent experiments. ( B ) Mock-treated, parvovirus-infected or ODN stimulated Namalwa cells were harvested at the indicated time points and total RNAs were extracted using the RNeasy kit as described previously in Figure 1 . Total RNAs extracted from parvovirus-infected (24 hrs p.i. at 80 PFUs/cell) or pI:C-transfected (15 hrs post-transfection with 2 µg dsRNA/ml) NB324K cells were used as positive or negative controls. Presented data are representative of 3 experiments which all gave similar results. ( C ) Total DNA was harvested at the indicated time points from parvovirus-infected (MOI of 80 PFUs/cell) or mock-treated Namalwa or HEK293T cultures to assess by Southern blot experiments as described in Figure 2 the replication of both parvoviruses (dRF, dimmer replicative form; mRF, monomeric replicative form; ssDNA, single-stranded DNA genome). The blot shown is representative of 3 experiments which gave similar results. ( D ) Cell pellets from mock-treated or parvovirus-infected Namalwa cultures were re-suspended in complete Ripa buffer and Western blotting was performed as described in Figure 6 . Actin was used as an internal loading control. Each presented blot is representative of 3 experiments which gave similar results.

    Techniques Used: Activation Assay, Infection, Enzyme-linked Immunosorbent Assay, Transfection, Southern Blot, Western Blot

    3) Product Images from "HIV-1 gp120 induces type-1 programmed cell death through ER stress employing IRE1α, JNK and AP-1 pathway"

    Article Title: HIV-1 gp120 induces type-1 programmed cell death through ER stress employing IRE1α, JNK and AP-1 pathway

    Journal: Scientific Reports

    doi: 10.1038/srep18929

    HIV-1 gp120 increases XBP-1 splicing in time-dependent manner. ( A ) The schematic represents XBP-1 RNA processing. The loop represents the 26-nt region being removed during splicing of XBP-1 and theprimers were designed in order to amplify both the spliced and unspliced XBP-1. ( B ) SVGA cells were seeded at 2.5 × 10 5 cells/well in 12-well plates and transfected with pSyngp120 plasmid for 3, 6, 9 and 12 hours. The RNA were isolated using RNeasy mini kit and XBP-1 RNA were amplified using the primers shown in 3A. The amplified product was resolved using 3.5% agarose gel ( B ). The intensity of the spliced XBP-1 was measured and the mean ± S.E. was calculated from at least 3 experiments. The gel shown here is a representative of 3 independent experiments. The statistical significance was calculated using student’s t-test between 3H and respective time-points to show significant increase over time and the values were considered significant if p-value ≤ 0.01 (**).
    Figure Legend Snippet: HIV-1 gp120 increases XBP-1 splicing in time-dependent manner. ( A ) The schematic represents XBP-1 RNA processing. The loop represents the 26-nt region being removed during splicing of XBP-1 and theprimers were designed in order to amplify both the spliced and unspliced XBP-1. ( B ) SVGA cells were seeded at 2.5 × 10 5 cells/well in 12-well plates and transfected with pSyngp120 plasmid for 3, 6, 9 and 12 hours. The RNA were isolated using RNeasy mini kit and XBP-1 RNA were amplified using the primers shown in 3A. The amplified product was resolved using 3.5% agarose gel ( B ). The intensity of the spliced XBP-1 was measured and the mean ± S.E. was calculated from at least 3 experiments. The gel shown here is a representative of 3 independent experiments. The statistical significance was calculated using student’s t-test between 3H and respective time-points to show significant increase over time and the values were considered significant if p-value ≤ 0.01 (**).

    Techniques Used: Transfection, Plasmid Preparation, Isolation, Amplification, Agarose Gel Electrophoresis, IF-P

    4) Product Images from "Comparison of RNA Isolation Methods From Insect Larvae"

    Article Title: Comparison of RNA Isolation Methods From Insect Larvae

    Journal: Journal of Insect Science

    doi: 10.1093/jisesa/ieu130

    Agilent 2100 Bioanalyser electropherogram graphs showing RNA extracted using the RNeasy Mini Kit, a CTAB-based protocol, TRIzol reagent and the SV Total RNA kit Markers can be seen at 25 nt, 18S RNA subunit at 2,000 nt, the 28S large subunit at 3,800 nt, and a combination of 5S, 5.8S, and tRNAs at ± 180 nt.
    Figure Legend Snippet: Agilent 2100 Bioanalyser electropherogram graphs showing RNA extracted using the RNeasy Mini Kit, a CTAB-based protocol, TRIzol reagent and the SV Total RNA kit Markers can be seen at 25 nt, 18S RNA subunit at 2,000 nt, the 28S large subunit at 3,800 nt, and a combination of 5S, 5.8S, and tRNAs at ± 180 nt.

    Techniques Used:

    Pseudo-gel image produced using an Agilent 2100 Bioanalyser, showing the results of RNA extracted from T. leucotreta using the RNeasy Mini Kit, a CTAB-based protocol, TRIzol reagent, and the SV Total RNA kit. The 18S RNA subunit is visible at 2,000 nt, the 28S large subunit at 3,800 nt, and a combination of 5S, 5.8S, and tRNAs at ± 180 nt.
    Figure Legend Snippet: Pseudo-gel image produced using an Agilent 2100 Bioanalyser, showing the results of RNA extracted from T. leucotreta using the RNeasy Mini Kit, a CTAB-based protocol, TRIzol reagent, and the SV Total RNA kit. The 18S RNA subunit is visible at 2,000 nt, the 28S large subunit at 3,800 nt, and a combination of 5S, 5.8S, and tRNAs at ± 180 nt.

    Techniques Used: Produced

    5) Product Images from "Effect of Diabetes/Hyperglycemia on the Rat Retinal Adenosinergic System"

    Article Title: Effect of Diabetes/Hyperglycemia on the Rat Retinal Adenosinergic System

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0067499

    Adenosine kinase levels in cultured retinal cells and diabetic retinas. (A–B) Cells were treated as previously described in Figure 1 . The mean±SEM of 4–6 independent experiments was analyzed with one-way ANOVA and Tukey’s multiple comparison test. (C–D) Rats were subjected to an intraperitoneal injection of STZ and maintained for a period of 7 days and 30 days. ( A ) 50 µg of protein content from each sample was loaded into a 7.5% gel, electrophoresed and probed for the presence of AK. Total protein levels were normalized by the loading control (actin), and expressed as percentage of the control group. ( B ) Total RNA was isolated using the RNeasy Mini Kit from Qiagen according to the manufacturer’s instructions. Data from the target gene was normalized using the expression of three stable reference genes and the mRNA level ratios calculated using the altered Pfaffl model for normalizations with multiple reference genes. Experiments were carried out in triplicate. ( C ) 50 µg of protein content from each sample was loaded into a 7.5% gel, electrophoresed and probed for the presence of AK. Total protein levels were normalized by the loading control (actin), and expressed as percentage of the control group. The mean±SEM of 3–6 samples for each condition was analyzed with the Student’s t-test (diabetic vs control) and F test. * p
    Figure Legend Snippet: Adenosine kinase levels in cultured retinal cells and diabetic retinas. (A–B) Cells were treated as previously described in Figure 1 . The mean±SEM of 4–6 independent experiments was analyzed with one-way ANOVA and Tukey’s multiple comparison test. (C–D) Rats were subjected to an intraperitoneal injection of STZ and maintained for a period of 7 days and 30 days. ( A ) 50 µg of protein content from each sample was loaded into a 7.5% gel, electrophoresed and probed for the presence of AK. Total protein levels were normalized by the loading control (actin), and expressed as percentage of the control group. ( B ) Total RNA was isolated using the RNeasy Mini Kit from Qiagen according to the manufacturer’s instructions. Data from the target gene was normalized using the expression of three stable reference genes and the mRNA level ratios calculated using the altered Pfaffl model for normalizations with multiple reference genes. Experiments were carried out in triplicate. ( C ) 50 µg of protein content from each sample was loaded into a 7.5% gel, electrophoresed and probed for the presence of AK. Total protein levels were normalized by the loading control (actin), and expressed as percentage of the control group. The mean±SEM of 3–6 samples for each condition was analyzed with the Student’s t-test (diabetic vs control) and F test. * p

    Techniques Used: Cell Culture, Injection, Isolation, Expressing

    Adenosine receptor expression levels in cultured retinal cells. Cells were treated as previously described in Figure 1 . Total RNA was isolated using the RNeasy Mini Kit from Qiagen according to the manufacturer’s instructions. Data from the target genes were normalized using the expression of three stable reference genes and the mRNA level ratios calculated using the altered Pfaffl model for normalizations with multiple reference genes. Experiments were carried out in triplicate. The mean±SEM of 3–4 independent experiments was analyzed with one-way ANOVA test and Tukey’s multiple comparison test. **p
    Figure Legend Snippet: Adenosine receptor expression levels in cultured retinal cells. Cells were treated as previously described in Figure 1 . Total RNA was isolated using the RNeasy Mini Kit from Qiagen according to the manufacturer’s instructions. Data from the target genes were normalized using the expression of three stable reference genes and the mRNA level ratios calculated using the altered Pfaffl model for normalizations with multiple reference genes. Experiments were carried out in triplicate. The mean±SEM of 3–4 independent experiments was analyzed with one-way ANOVA test and Tukey’s multiple comparison test. **p

    Techniques Used: Expressing, Cell Culture, Isolation

    6) Product Images from "Thyroid Cancer Resistance to Vitamin D Receptor Activation Is Associated with 24-Hydroxylase Levels But Not the ff FokI Polymorphism"

    Article Title: Thyroid Cancer Resistance to Vitamin D Receptor Activation Is Associated with 24-Hydroxylase Levels But Not the ff FokI Polymorphism

    Journal:

    doi: 10.1089/thy.2010.0096

    Baseline 24-hydroxylase mRNA levels are higher in resistant thyroid cancer cells and/or have less stimulation after calcitriol/DP006 treatment than in sensitive thyroid cancer cells. Total RNA was isolated from cells using the RNeasy Mini Kit (Qiagen)
    Figure Legend Snippet: Baseline 24-hydroxylase mRNA levels are higher in resistant thyroid cancer cells and/or have less stimulation after calcitriol/DP006 treatment than in sensitive thyroid cancer cells. Total RNA was isolated from cells using the RNeasy Mini Kit (Qiagen)

    Techniques Used: Isolation

    1-α-Hydroxylase mRNA expression is higher in resistant than in sensitive thyroid cancer cells. Total RNA was isolated from cells using the RNeasy Mini Kit (Qiagen) after 24-hour treatment with 100 nM calcitriol or volume equivalent vehicle.
    Figure Legend Snippet: 1-α-Hydroxylase mRNA expression is higher in resistant than in sensitive thyroid cancer cells. Total RNA was isolated from cells using the RNeasy Mini Kit (Qiagen) after 24-hour treatment with 100 nM calcitriol or volume equivalent vehicle.

    Techniques Used: Expressing, Isolation

    7) Product Images from "Comparison of RNA Isolation Methods From Insect Larvae"

    Article Title: Comparison of RNA Isolation Methods From Insect Larvae

    Journal: Journal of Insect Science

    doi: 10.1093/jisesa/ieu130

    Agilent 2100 Bioanalyser electropherogram graphs showing RNA extracted using the RNeasy Mini Kit, a CTAB-based protocol, TRIzol reagent and the SV Total RNA kit Markers can be seen at 25 nt, 18S RNA subunit at 2,000 nt, the 28S large subunit at 3,800 nt, and a combination of 5S, 5.8S, and tRNAs at ± 180 nt.
    Figure Legend Snippet: Agilent 2100 Bioanalyser electropherogram graphs showing RNA extracted using the RNeasy Mini Kit, a CTAB-based protocol, TRIzol reagent and the SV Total RNA kit Markers can be seen at 25 nt, 18S RNA subunit at 2,000 nt, the 28S large subunit at 3,800 nt, and a combination of 5S, 5.8S, and tRNAs at ± 180 nt.

    Techniques Used:

    Pseudo-gel image produced using an Agilent 2100 Bioanalyser, showing the results of RNA extracted from T. leucotreta using the RNeasy Mini Kit, a CTAB-based protocol, TRIzol reagent, and the SV Total RNA kit. The 18S RNA subunit is visible at 2,000 nt, the 28S large subunit at 3,800 nt, and a combination of 5S, 5.8S, and tRNAs at ± 180 nt.
    Figure Legend Snippet: Pseudo-gel image produced using an Agilent 2100 Bioanalyser, showing the results of RNA extracted from T. leucotreta using the RNeasy Mini Kit, a CTAB-based protocol, TRIzol reagent, and the SV Total RNA kit. The 18S RNA subunit is visible at 2,000 nt, the 28S large subunit at 3,800 nt, and a combination of 5S, 5.8S, and tRNAs at ± 180 nt.

    Techniques Used: Produced

    8) Product Images from "Development of a low resource RNA extraction cassette based on surface tension valves"

    Article Title: Development of a low resource RNA extraction cassette based on surface tension valves

    Journal: ACS applied materials & interfaces

    doi: 10.1021/am2004009

    Comparison of RNA extracted from RSV infected (black bars) and uninfected (gray bars) HEp-2 cell lysates using the extraction cassette and RNeasy kit. Unextracted samples failed to report RSV RNA in either sample (mean ± s.d, n = 3).
    Figure Legend Snippet: Comparison of RNA extracted from RSV infected (black bars) and uninfected (gray bars) HEp-2 cell lysates using the extraction cassette and RNeasy kit. Unextracted samples failed to report RSV RNA in either sample (mean ± s.d, n = 3).

    Techniques Used: Infection

    The limit of detection of RNA detectable by RT-PCR after extraction from HEp-2 cell lysates spiked with known amounts of RSV RNA using either the continuous tubing extraction cassette (●) or the RNeasy kit (○) (mean ± s.d, n=3).
    Figure Legend Snippet: The limit of detection of RNA detectable by RT-PCR after extraction from HEp-2 cell lysates spiked with known amounts of RSV RNA using either the continuous tubing extraction cassette (●) or the RNeasy kit (○) (mean ± s.d, n=3).

    Techniques Used: Reverse Transcription Polymerase Chain Reaction

    The number of copies of RNA per μL extracted from RSV positive (black bars) and RSV negative (gray bars) nasal wash samples using five extraction methods were compared. Extractions were performed using prototype extraction cassette, RNeasy Mini
    Figure Legend Snippet: The number of copies of RNA per μL extracted from RSV positive (black bars) and RSV negative (gray bars) nasal wash samples using five extraction methods were compared. Extractions were performed using prototype extraction cassette, RNeasy Mini

    Techniques Used:

    Comparison of the percent of RSV RNA recovered after addition to TE buffer (A) or HEp-2 cell lysates (B) using the extraction cassette (left bars), RNeasy kit (middle bars), or no extraction (right bars) (mean ± s.d., n = 9). The recovery efficiency
    Figure Legend Snippet: Comparison of the percent of RSV RNA recovered after addition to TE buffer (A) or HEp-2 cell lysates (B) using the extraction cassette (left bars), RNeasy kit (middle bars), or no extraction (right bars) (mean ± s.d., n = 9). The recovery efficiency

    Techniques Used:

    9) Product Images from "The Orphan Nuclear Receptor NR4A1 Protects Pancreatic β-Cells from Endoplasmic Reticulum (ER) Stress-mediated Apoptosis"

    Article Title: The Orphan Nuclear Receptor NR4A1 Protects Pancreatic β-Cells from Endoplasmic Reticulum (ER) Stress-mediated Apoptosis

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M115.654863

    Analysis of the effect of TG or PA on NR4A1 expression in mouse islets. Mouse islets were isolated from C57BL/6J mice, and total RNA of mouse islets was prepared using an RNeasy Mini Kit. A–D , relative mRNA levels of CHOP and NR4A1 in response to 0.5 μ m TG ( A and B ) or 0.4 m m PA ( C and D ) at various time points were determined by qPCR. E , determination of the induced NR4A1 expression in pancreatic β-cells upon TG or PA treatment. Mouse islets were treated with 0.5 μ m TG for 6 h, and double immunofluorescence staining was performed with anti-insulin and anti-NR4A1 antibodies from different species. The top panel is an islet treated with DMSO as a control, and the lower panel is an islet treated with TG. Blue represents DAPI, green represents NR4A1, red represents insulin, and MERGE of the three colors. The histograms indicate relative fluorescence intensity (=total red densitometry value/islet surface area). The data show the means of three independent experiments, *, p
    Figure Legend Snippet: Analysis of the effect of TG or PA on NR4A1 expression in mouse islets. Mouse islets were isolated from C57BL/6J mice, and total RNA of mouse islets was prepared using an RNeasy Mini Kit. A–D , relative mRNA levels of CHOP and NR4A1 in response to 0.5 μ m TG ( A and B ) or 0.4 m m PA ( C and D ) at various time points were determined by qPCR. E , determination of the induced NR4A1 expression in pancreatic β-cells upon TG or PA treatment. Mouse islets were treated with 0.5 μ m TG for 6 h, and double immunofluorescence staining was performed with anti-insulin and anti-NR4A1 antibodies from different species. The top panel is an islet treated with DMSO as a control, and the lower panel is an islet treated with TG. Blue represents DAPI, green represents NR4A1, red represents insulin, and MERGE of the three colors. The histograms indicate relative fluorescence intensity (=total red densitometry value/islet surface area). The data show the means of three independent experiments, *, p

    Techniques Used: Expressing, Isolation, Mouse Assay, Real-time Polymerase Chain Reaction, Double Immunofluorescence Staining, Fluorescence

    10) Product Images from "Development of a low resource RNA extraction cassette based on surface tension valves"

    Article Title: Development of a low resource RNA extraction cassette based on surface tension valves

    Journal: ACS applied materials & interfaces

    doi: 10.1021/am2004009

    Comparison of RNA extracted from RSV infected (black bars) and uninfected (gray bars) HEp-2 cell lysates using the extraction cassette and RNeasy kit. Unextracted samples failed to report RSV RNA in either sample (mean ± s.d, n = 3).
    Figure Legend Snippet: Comparison of RNA extracted from RSV infected (black bars) and uninfected (gray bars) HEp-2 cell lysates using the extraction cassette and RNeasy kit. Unextracted samples failed to report RSV RNA in either sample (mean ± s.d, n = 3).

    Techniques Used: Infection

    The limit of detection of RNA detectable by RT-PCR after extraction from HEp-2 cell lysates spiked with known amounts of RSV RNA using either the continuous tubing extraction cassette (●) or the RNeasy kit (○) (mean ± s.d, n=3).
    Figure Legend Snippet: The limit of detection of RNA detectable by RT-PCR after extraction from HEp-2 cell lysates spiked with known amounts of RSV RNA using either the continuous tubing extraction cassette (●) or the RNeasy kit (○) (mean ± s.d, n=3).

    Techniques Used: Reverse Transcription Polymerase Chain Reaction

    The number of copies of RNA per μL extracted from RSV positive (black bars) and RSV negative (gray bars) nasal wash samples using five extraction methods were compared. Extractions were performed using prototype extraction cassette, RNeasy Mini
    Figure Legend Snippet: The number of copies of RNA per μL extracted from RSV positive (black bars) and RSV negative (gray bars) nasal wash samples using five extraction methods were compared. Extractions were performed using prototype extraction cassette, RNeasy Mini

    Techniques Used:

    Comparison of the percent of RSV RNA recovered after addition to TE buffer (A) or HEp-2 cell lysates (B) using the extraction cassette (left bars), RNeasy kit (middle bars), or no extraction (right bars) (mean ± s.d., n = 9). The recovery efficiency
    Figure Legend Snippet: Comparison of the percent of RSV RNA recovered after addition to TE buffer (A) or HEp-2 cell lysates (B) using the extraction cassette (left bars), RNeasy kit (middle bars), or no extraction (right bars) (mean ± s.d., n = 9). The recovery efficiency

    Techniques Used:

    11) Product Images from "Comparison of RNA Isolation Methods From Insect Larvae"

    Article Title: Comparison of RNA Isolation Methods From Insect Larvae

    Journal: Journal of Insect Science

    doi: 10.1093/jisesa/ieu130

    Agilent 2100 Bioanalyser electropherogram graphs showing RNA extracted using the RNeasy Mini Kit, a CTAB-based protocol, TRIzol reagent and the SV Total RNA kit Markers can be seen at 25 nt, 18S RNA subunit at 2,000 nt, the 28S large subunit at 3,800 nt, and a combination of 5S, 5.8S, and tRNAs at ± 180 nt.
    Figure Legend Snippet: Agilent 2100 Bioanalyser electropherogram graphs showing RNA extracted using the RNeasy Mini Kit, a CTAB-based protocol, TRIzol reagent and the SV Total RNA kit Markers can be seen at 25 nt, 18S RNA subunit at 2,000 nt, the 28S large subunit at 3,800 nt, and a combination of 5S, 5.8S, and tRNAs at ± 180 nt.

    Techniques Used:

    Pseudo-gel image produced using an Agilent 2100 Bioanalyser, showing the results of RNA extracted from T. leucotreta using the RNeasy Mini Kit, a CTAB-based protocol, TRIzol reagent, and the SV Total RNA kit. The 18S RNA subunit is visible at 2,000 nt, the 28S large subunit at 3,800 nt, and a combination of 5S, 5.8S, and tRNAs at ± 180 nt.
    Figure Legend Snippet: Pseudo-gel image produced using an Agilent 2100 Bioanalyser, showing the results of RNA extracted from T. leucotreta using the RNeasy Mini Kit, a CTAB-based protocol, TRIzol reagent, and the SV Total RNA kit. The 18S RNA subunit is visible at 2,000 nt, the 28S large subunit at 3,800 nt, and a combination of 5S, 5.8S, and tRNAs at ± 180 nt.

    Techniques Used: Produced

    12) Product Images from "Comparison of RNA Isolation Methods From Insect Larvae"

    Article Title: Comparison of RNA Isolation Methods From Insect Larvae

    Journal: Journal of Insect Science

    doi: 10.1093/jisesa/ieu130

    Agilent 2100 Bioanalyser electropherogram graphs showing RNA extracted using the RNeasy Mini Kit, a CTAB-based protocol, TRIzol reagent and the SV Total RNA kit Markers can be seen at 25 nt, 18S RNA subunit at 2,000 nt, the 28S large subunit at 3,800 nt, and a combination of 5S, 5.8S, and tRNAs at ± 180 nt.
    Figure Legend Snippet: Agilent 2100 Bioanalyser electropherogram graphs showing RNA extracted using the RNeasy Mini Kit, a CTAB-based protocol, TRIzol reagent and the SV Total RNA kit Markers can be seen at 25 nt, 18S RNA subunit at 2,000 nt, the 28S large subunit at 3,800 nt, and a combination of 5S, 5.8S, and tRNAs at ± 180 nt.

    Techniques Used:

    Pseudo-gel image produced using an Agilent 2100 Bioanalyser, showing the results of RNA extracted from T. leucotreta using the RNeasy Mini Kit, a CTAB-based protocol, TRIzol reagent, and the SV Total RNA kit. The 18S RNA subunit is visible at 2,000 nt, the 28S large subunit at 3,800 nt, and a combination of 5S, 5.8S, and tRNAs at ± 180 nt.
    Figure Legend Snippet: Pseudo-gel image produced using an Agilent 2100 Bioanalyser, showing the results of RNA extracted from T. leucotreta using the RNeasy Mini Kit, a CTAB-based protocol, TRIzol reagent, and the SV Total RNA kit. The 18S RNA subunit is visible at 2,000 nt, the 28S large subunit at 3,800 nt, and a combination of 5S, 5.8S, and tRNAs at ± 180 nt.

    Techniques Used: Produced

    13) Product Images from "Long non-coding RNA MUC5B-AS1 promotes metastasis through mutually regulating MUC5B expression in lung adenocarcinoma"

    Article Title: Long non-coding RNA MUC5B-AS1 promotes metastasis through mutually regulating MUC5B expression in lung adenocarcinoma

    Journal: Cell Death & Disease

    doi: 10.1038/s41419-018-0472-6

    MUC5B-AS1 increases the stability of MUC5B mRNA by forming a protective RNA duplex. a Schematic representation of the PCR amplification regions for overlapping (OL) and non-overlapping (non-OL) regions of MUC5B. We designed two pairs of primers to amplify the OL regions (OL1 and OL2) and non-OL (non-OL1 and non-OL2) regions of MUC5B, respectively. F forward primer, R reverse primer. b RT-PCR products of OL and non-OL regions of MUC5B. Total RNA samples were treated with RNAse A + T cocktail and then cleaned up RNA using RNeasy kits. RT-PCR was conducted using the primers to detect the OL and non-OL regions of the MUC5B mRNA. OL and non-OL regions of KRT7-AS were used as a positive control. c Stability of MUC5B mRNA over 12 h was measured by qRT-PCR relative to time 0 h after blocking new RNA synthesis with Actinomycin D (1 μg/mL; indicated with black arrow). H1299 cells with MUC5B-AS1 or empty vector stable expression were treated with 1 μg/mL ActD, and then harvested cells for RNA purification at 12 h after addition of ActD. Then, MUC5B mRNA stability were subsequently measured by qRT-PCR and were normalized against a synthesized exogenous reference λ polyA + RNA. Student’s t -test, * P
    Figure Legend Snippet: MUC5B-AS1 increases the stability of MUC5B mRNA by forming a protective RNA duplex. a Schematic representation of the PCR amplification regions for overlapping (OL) and non-overlapping (non-OL) regions of MUC5B. We designed two pairs of primers to amplify the OL regions (OL1 and OL2) and non-OL (non-OL1 and non-OL2) regions of MUC5B, respectively. F forward primer, R reverse primer. b RT-PCR products of OL and non-OL regions of MUC5B. Total RNA samples were treated with RNAse A + T cocktail and then cleaned up RNA using RNeasy kits. RT-PCR was conducted using the primers to detect the OL and non-OL regions of the MUC5B mRNA. OL and non-OL regions of KRT7-AS were used as a positive control. c Stability of MUC5B mRNA over 12 h was measured by qRT-PCR relative to time 0 h after blocking new RNA synthesis with Actinomycin D (1 μg/mL; indicated with black arrow). H1299 cells with MUC5B-AS1 or empty vector stable expression were treated with 1 μg/mL ActD, and then harvested cells for RNA purification at 12 h after addition of ActD. Then, MUC5B mRNA stability were subsequently measured by qRT-PCR and were normalized against a synthesized exogenous reference λ polyA + RNA. Student’s t -test, * P

    Techniques Used: Polymerase Chain Reaction, Amplification, Reverse Transcription Polymerase Chain Reaction, Positive Control, Quantitative RT-PCR, Blocking Assay, Plasmid Preparation, Expressing, Purification, Synthesized

    14) Product Images from "Comparison of RNA Isolation Methods From Insect Larvae"

    Article Title: Comparison of RNA Isolation Methods From Insect Larvae

    Journal: Journal of Insect Science

    doi: 10.1093/jisesa/ieu130

    Agilent 2100 Bioanalyser electropherogram graphs showing RNA extracted using the RNeasy Mini Kit, a CTAB-based protocol, TRIzol reagent and the SV Total RNA kit Markers can be seen at 25 nt, 18S RNA subunit at 2,000 nt, the 28S large subunit at 3,800 nt, and a combination of 5S, 5.8S, and tRNAs at ± 180 nt.
    Figure Legend Snippet: Agilent 2100 Bioanalyser electropherogram graphs showing RNA extracted using the RNeasy Mini Kit, a CTAB-based protocol, TRIzol reagent and the SV Total RNA kit Markers can be seen at 25 nt, 18S RNA subunit at 2,000 nt, the 28S large subunit at 3,800 nt, and a combination of 5S, 5.8S, and tRNAs at ± 180 nt.

    Techniques Used:

    Pseudo-gel image produced using an Agilent 2100 Bioanalyser, showing the results of RNA extracted from T. leucotreta using the RNeasy Mini Kit, a CTAB-based protocol, TRIzol reagent, and the SV Total RNA kit. The 18S RNA subunit is visible at 2,000 nt, the 28S large subunit at 3,800 nt, and a combination of 5S, 5.8S, and tRNAs at ± 180 nt.
    Figure Legend Snippet: Pseudo-gel image produced using an Agilent 2100 Bioanalyser, showing the results of RNA extracted from T. leucotreta using the RNeasy Mini Kit, a CTAB-based protocol, TRIzol reagent, and the SV Total RNA kit. The 18S RNA subunit is visible at 2,000 nt, the 28S large subunit at 3,800 nt, and a combination of 5S, 5.8S, and tRNAs at ± 180 nt.

    Techniques Used: Produced

    15) Product Images from "Development of a low resource RNA extraction cassette based on surface tension valves"

    Article Title: Development of a low resource RNA extraction cassette based on surface tension valves

    Journal: ACS applied materials & interfaces

    doi: 10.1021/am2004009

    Comparison of RNA extracted from RSV infected (black bars) and uninfected (gray bars) HEp-2 cell lysates using the extraction cassette and RNeasy kit. Unextracted samples failed to report RSV RNA in either sample (mean ± s.d, n = 3).
    Figure Legend Snippet: Comparison of RNA extracted from RSV infected (black bars) and uninfected (gray bars) HEp-2 cell lysates using the extraction cassette and RNeasy kit. Unextracted samples failed to report RSV RNA in either sample (mean ± s.d, n = 3).

    Techniques Used: Infection

    The limit of detection of RNA detectable by RT-PCR after extraction from HEp-2 cell lysates spiked with known amounts of RSV RNA using either the continuous tubing extraction cassette (●) or the RNeasy kit (○) (mean ± s.d, n=3).
    Figure Legend Snippet: The limit of detection of RNA detectable by RT-PCR after extraction from HEp-2 cell lysates spiked with known amounts of RSV RNA using either the continuous tubing extraction cassette (●) or the RNeasy kit (○) (mean ± s.d, n=3).

    Techniques Used: Reverse Transcription Polymerase Chain Reaction

    The number of copies of RNA per μL extracted from RSV positive (black bars) and RSV negative (gray bars) nasal wash samples using five extraction methods were compared. Extractions were performed using prototype extraction cassette, RNeasy Mini
    Figure Legend Snippet: The number of copies of RNA per μL extracted from RSV positive (black bars) and RSV negative (gray bars) nasal wash samples using five extraction methods were compared. Extractions were performed using prototype extraction cassette, RNeasy Mini

    Techniques Used:

    Comparison of the percent of RSV RNA recovered after addition to TE buffer (A) or HEp-2 cell lysates (B) using the extraction cassette (left bars), RNeasy kit (middle bars), or no extraction (right bars) (mean ± s.d., n = 9). The recovery efficiency
    Figure Legend Snippet: Comparison of the percent of RSV RNA recovered after addition to TE buffer (A) or HEp-2 cell lysates (B) using the extraction cassette (left bars), RNeasy kit (middle bars), or no extraction (right bars) (mean ± s.d., n = 9). The recovery efficiency

    Techniques Used:

    16) Product Images from "Comparison of RNA Isolation Methods From Insect Larvae"

    Article Title: Comparison of RNA Isolation Methods From Insect Larvae

    Journal: Journal of Insect Science

    doi: 10.1093/jisesa/ieu130

    Agilent 2100 Bioanalyser electropherogram graphs showing RNA extracted using the RNeasy Mini Kit, a CTAB-based protocol, TRIzol reagent and the SV Total RNA kit Markers can be seen at 25 nt, 18S RNA subunit at 2,000 nt, the 28S large subunit at 3,800 nt, and a combination of 5S, 5.8S, and tRNAs at ± 180 nt.
    Figure Legend Snippet: Agilent 2100 Bioanalyser electropherogram graphs showing RNA extracted using the RNeasy Mini Kit, a CTAB-based protocol, TRIzol reagent and the SV Total RNA kit Markers can be seen at 25 nt, 18S RNA subunit at 2,000 nt, the 28S large subunit at 3,800 nt, and a combination of 5S, 5.8S, and tRNAs at ± 180 nt.

    Techniques Used:

    Pseudo-gel image produced using an Agilent 2100 Bioanalyser, showing the results of RNA extracted from T. leucotreta using the RNeasy Mini Kit, a CTAB-based protocol, TRIzol reagent, and the SV Total RNA kit. The 18S RNA subunit is visible at 2,000 nt, the 28S large subunit at 3,800 nt, and a combination of 5S, 5.8S, and tRNAs at ± 180 nt.
    Figure Legend Snippet: Pseudo-gel image produced using an Agilent 2100 Bioanalyser, showing the results of RNA extracted from T. leucotreta using the RNeasy Mini Kit, a CTAB-based protocol, TRIzol reagent, and the SV Total RNA kit. The 18S RNA subunit is visible at 2,000 nt, the 28S large subunit at 3,800 nt, and a combination of 5S, 5.8S, and tRNAs at ± 180 nt.

    Techniques Used: Produced

    17) Product Images from "Optimizing exosomal RNA isolation for RNA-Seq analyses of archival sera specimens"

    Article Title: Optimizing exosomal RNA isolation for RNA-Seq analyses of archival sera specimens

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0196913

    Comparison of sera exosomal RNA using four different RNA extraction methods. (A) Total RNA yield from ultracentrifugation (UC) and ExoQuick (EQ) treated samples using the RNeasy Mini Kit combined with TRIzol LS, the RNeasy Mini Kit alone, conventional RNA precipitation, and AllPrep DNA/RNA Mini Kit. (B) Demonstration of RNA quality measured by OD 260 /OD 280 in EQ and UC treated samples. Data are shown as the mean ± SD from six independent patient samples. *** P
    Figure Legend Snippet: Comparison of sera exosomal RNA using four different RNA extraction methods. (A) Total RNA yield from ultracentrifugation (UC) and ExoQuick (EQ) treated samples using the RNeasy Mini Kit combined with TRIzol LS, the RNeasy Mini Kit alone, conventional RNA precipitation, and AllPrep DNA/RNA Mini Kit. (B) Demonstration of RNA quality measured by OD 260 /OD 280 in EQ and UC treated samples. Data are shown as the mean ± SD from six independent patient samples. *** P

    Techniques Used: RNA Extraction

    Exosomal RNAs are stable over two decades. Dot plots of total RNA yield and OD 260 /OD 280 from 105 EQ-treated archival patient samples using the RNeasy Mini Kit combined with TRIzol LS. Storage time for each sample is indicated on the x-axis. The Spearman’s rank correlations for RNA yield versus storing time and OD 260 /OD 280 versus storage time are 0.185 ( P = 0.06) and 0.04 ( P = 0.70), respectively.
    Figure Legend Snippet: Exosomal RNAs are stable over two decades. Dot plots of total RNA yield and OD 260 /OD 280 from 105 EQ-treated archival patient samples using the RNeasy Mini Kit combined with TRIzol LS. Storage time for each sample is indicated on the x-axis. The Spearman’s rank correlations for RNA yield versus storing time and OD 260 /OD 280 versus storage time are 0.185 ( P = 0.06) and 0.04 ( P = 0.70), respectively.

    Techniques Used:

    18) Product Images from "Commensal Microbiota Contributes to Chronic Endocarditis in TAX1BP1 Deficient Mice"

    Article Title: Commensal Microbiota Contributes to Chronic Endocarditis in TAX1BP1 Deficient Mice

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0073205

    Elevated inflammatory profiles in the multiple organs of TAX1BP1 -KO mice. Mitral valve tissues from either 8 or 16(-wk) TAX1BP1 -KO mice or their wild-type littermates were collected by Arcturus XT LCM system and total RNAs were prepared by RNeasy mini kit (Qiagen). Each cDNA pool was generated from the individual RNA sample and gene expression profiles were evaluated using Whole Mouse Genome Microarray Kit (Agilent). A ) Principal component analysis (PCA) by conditions was performed on R statistical package (Version 2.15.1) and represented as a scatterplots of whole gene expression profiles of 8- or 16-wk TAX1BP1 -KO mice (8wKO #1- #3 or 16wKO #1-#3, surrounded by red circles) and their WT littermates (8wWT #1- #3 or 16wWT #1-#3, blue circles). The PCA plot showed that samples clustered based on their genetic backgrounds. Data represent n = 12. Component % variance; PC1 = 34.95%, PC2 = 19.48%. B ) Heat map representation of differentially expressed genes in the mitral valves from either 8- or 16-wk TAX1BP1 -KO mice or their WT littermates. 588 genes were differentially expressed in TAX1BP1 -KO vs. WT littermates (P
    Figure Legend Snippet: Elevated inflammatory profiles in the multiple organs of TAX1BP1 -KO mice. Mitral valve tissues from either 8 or 16(-wk) TAX1BP1 -KO mice or their wild-type littermates were collected by Arcturus XT LCM system and total RNAs were prepared by RNeasy mini kit (Qiagen). Each cDNA pool was generated from the individual RNA sample and gene expression profiles were evaluated using Whole Mouse Genome Microarray Kit (Agilent). A ) Principal component analysis (PCA) by conditions was performed on R statistical package (Version 2.15.1) and represented as a scatterplots of whole gene expression profiles of 8- or 16-wk TAX1BP1 -KO mice (8wKO #1- #3 or 16wKO #1-#3, surrounded by red circles) and their WT littermates (8wWT #1- #3 or 16wWT #1-#3, blue circles). The PCA plot showed that samples clustered based on their genetic backgrounds. Data represent n = 12. Component % variance; PC1 = 34.95%, PC2 = 19.48%. B ) Heat map representation of differentially expressed genes in the mitral valves from either 8- or 16-wk TAX1BP1 -KO mice or their WT littermates. 588 genes were differentially expressed in TAX1BP1 -KO vs. WT littermates (P

    Techniques Used: Gene Knockout, Mouse Assay, Laser Capture Microdissection, Generated, Expressing, Microarray

    19) Product Images from "A Comparative Study on In Vitro Osteogenic Priming Potential of Electron Spun Scaffold PLLA/HA/Col, PLLA/HA, and PLLA/Col for Tissue Engineering Application"

    Article Title: A Comparative Study on In Vitro Osteogenic Priming Potential of Electron Spun Scaffold PLLA/HA/Col, PLLA/HA, and PLLA/Col for Tissue Engineering Application

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0104389

    Quantitative gene expression of PLLA/HA at different time points during differentiation process. (a) Gene expression of beta-catenin, frizzled, alkaline phosphatase, and osteopontin. (b) OC (BGALP), osteonectin, Runx2, and Col. (c) Bone sialoprotein, integrin, bone morphogenic protein 2, PP2A (serine/threonine phosphatase), and c-fos. The total RNA was extracted from hMSCs cultured on the substrates (n = 6) at different time points (0, 7, 14, and 21 days) using the RNeasy Mini kit (Qiagen, Chatsworth, CA, USA). Following cDNA synthesis and qPCR, the relative gene expression was normalized to GAPDH and baseline expression. The P value was set at level
    Figure Legend Snippet: Quantitative gene expression of PLLA/HA at different time points during differentiation process. (a) Gene expression of beta-catenin, frizzled, alkaline phosphatase, and osteopontin. (b) OC (BGALP), osteonectin, Runx2, and Col. (c) Bone sialoprotein, integrin, bone morphogenic protein 2, PP2A (serine/threonine phosphatase), and c-fos. The total RNA was extracted from hMSCs cultured on the substrates (n = 6) at different time points (0, 7, 14, and 21 days) using the RNeasy Mini kit (Qiagen, Chatsworth, CA, USA). Following cDNA synthesis and qPCR, the relative gene expression was normalized to GAPDH and baseline expression. The P value was set at level

    Techniques Used: Expressing, Hemagglutination Assay, Cell Culture, Real-time Polymerase Chain Reaction

    Quantitative gene expression of PLLA/Col/HA at different time points during the differentiation process. (a) Gene expression of beta-catenin, frizzled, alkaline phosphatase, and osteopontin. (b) OC (BGALP), osteonectin, Runx2, and Col. (c) Bone sialoprotein, integrin, bone morphogenic protein 2, PP2A (serine/threonine phosphatase), and c-fos. The total RNA was extracted from hMSCs cultured on the substrates (n = 6) at different time points (0, 7, 14, and 21 days) using the RNeasy Mini kit (Qiagen, Chatsworth, CA, USA). Following cDNA synthesis and qPCR, the relative gene expression was normalized to GAPDH and baseline expression. The P value was set at level
    Figure Legend Snippet: Quantitative gene expression of PLLA/Col/HA at different time points during the differentiation process. (a) Gene expression of beta-catenin, frizzled, alkaline phosphatase, and osteopontin. (b) OC (BGALP), osteonectin, Runx2, and Col. (c) Bone sialoprotein, integrin, bone morphogenic protein 2, PP2A (serine/threonine phosphatase), and c-fos. The total RNA was extracted from hMSCs cultured on the substrates (n = 6) at different time points (0, 7, 14, and 21 days) using the RNeasy Mini kit (Qiagen, Chatsworth, CA, USA). Following cDNA synthesis and qPCR, the relative gene expression was normalized to GAPDH and baseline expression. The P value was set at level

    Techniques Used: Expressing, Hemagglutination Assay, Cell Culture, Real-time Polymerase Chain Reaction

    Quantitative gene expression of PLLA/Col at different time points during differentiation process. (a) Gene expression of beta-catenin, frizzled, alkaline phosphatase and osteopontin. (b) OC (BGALP), osteonectin, Runx2, and Col. (c) Bone sialoprotein, integrin, bone morphogenic protein 2, PP2A (serine/threonine phosphatase), and c-fos. The total RNA was extracted from hMSCs cultured on the substrates (n = 6) at different time points (0, 7, 14, and 21 days) using the RNeasy Mini kit (Qiagen, Chatsworth, CA, USA). Following cDNA synthesis and qPCR, the relative gene expression was normalized to GAPDH and baseline expression. The P value was set at level
    Figure Legend Snippet: Quantitative gene expression of PLLA/Col at different time points during differentiation process. (a) Gene expression of beta-catenin, frizzled, alkaline phosphatase and osteopontin. (b) OC (BGALP), osteonectin, Runx2, and Col. (c) Bone sialoprotein, integrin, bone morphogenic protein 2, PP2A (serine/threonine phosphatase), and c-fos. The total RNA was extracted from hMSCs cultured on the substrates (n = 6) at different time points (0, 7, 14, and 21 days) using the RNeasy Mini kit (Qiagen, Chatsworth, CA, USA). Following cDNA synthesis and qPCR, the relative gene expression was normalized to GAPDH and baseline expression. The P value was set at level

    Techniques Used: Expressing, Cell Culture, Real-time Polymerase Chain Reaction

    20) Product Images from "Optimizing exosomal RNA isolation for RNA-Seq analyses of archival sera specimens"

    Article Title: Optimizing exosomal RNA isolation for RNA-Seq analyses of archival sera specimens

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0196913

    Comparison of sera exosomal RNA using four different RNA extraction methods. (A) Total RNA yield from ultracentrifugation (UC) and ExoQuick (EQ) treated samples using the RNeasy Mini Kit combined with TRIzol LS, the RNeasy Mini Kit alone, conventional RNA precipitation, and AllPrep DNA/RNA Mini Kit. (B) Demonstration of RNA quality measured by OD 260 /OD 280 in EQ and UC treated samples. Data are shown as the mean ± SD from six independent patient samples. *** P
    Figure Legend Snippet: Comparison of sera exosomal RNA using four different RNA extraction methods. (A) Total RNA yield from ultracentrifugation (UC) and ExoQuick (EQ) treated samples using the RNeasy Mini Kit combined with TRIzol LS, the RNeasy Mini Kit alone, conventional RNA precipitation, and AllPrep DNA/RNA Mini Kit. (B) Demonstration of RNA quality measured by OD 260 /OD 280 in EQ and UC treated samples. Data are shown as the mean ± SD from six independent patient samples. *** P

    Techniques Used: RNA Extraction

    Exosomal RNAs are stable over two decades. Dot plots of total RNA yield and OD 260 /OD 280 from 105 EQ-treated archival patient samples using the RNeasy Mini Kit combined with TRIzol LS. Storage time for each sample is indicated on the x-axis. The Spearman’s rank correlations for RNA yield versus storing time and OD 260 /OD 280 versus storage time are 0.185 ( P = 0.06) and 0.04 ( P = 0.70), respectively.
    Figure Legend Snippet: Exosomal RNAs are stable over two decades. Dot plots of total RNA yield and OD 260 /OD 280 from 105 EQ-treated archival patient samples using the RNeasy Mini Kit combined with TRIzol LS. Storage time for each sample is indicated on the x-axis. The Spearman’s rank correlations for RNA yield versus storing time and OD 260 /OD 280 versus storage time are 0.185 ( P = 0.06) and 0.04 ( P = 0.70), respectively.

    Techniques Used:

    Comparison of sera exosomal RNA using four different RNA extraction methods. (A) Total RNA yield from ultracentrifugation (UC) and ExoQuick (EQ) treated samples using the RNeasy Mini Kit combined with TRIzol LS, the RNeasy Mini Kit alone, conventional RNA precipitation, and AllPrep DNA/RNA Mini Kit. (B) Demonstration of RNA quality measured by OD 260 /OD 280 in EQ and UC treated samples. Data are shown as the mean ± SD from six independent patient samples. *** P
    Figure Legend Snippet: Comparison of sera exosomal RNA using four different RNA extraction methods. (A) Total RNA yield from ultracentrifugation (UC) and ExoQuick (EQ) treated samples using the RNeasy Mini Kit combined with TRIzol LS, the RNeasy Mini Kit alone, conventional RNA precipitation, and AllPrep DNA/RNA Mini Kit. (B) Demonstration of RNA quality measured by OD 260 /OD 280 in EQ and UC treated samples. Data are shown as the mean ± SD from six independent patient samples. *** P

    Techniques Used: RNA Extraction

    Exosomal RNAs are stable over two decades. Dot plots of total RNA yield and OD 260 /OD 280 from 105 EQ-treated archival patient samples using the RNeasy Mini Kit combined with TRIzol LS. Storage time for each sample is indicated on the x-axis. The Spearman’s rank correlations for RNA yield versus storing time and OD 260 /OD 280 versus storage time are 0.185 ( P = 0.06) and 0.04 ( P = 0.70), respectively.
    Figure Legend Snippet: Exosomal RNAs are stable over two decades. Dot plots of total RNA yield and OD 260 /OD 280 from 105 EQ-treated archival patient samples using the RNeasy Mini Kit combined with TRIzol LS. Storage time for each sample is indicated on the x-axis. The Spearman’s rank correlations for RNA yield versus storing time and OD 260 /OD 280 versus storage time are 0.185 ( P = 0.06) and 0.04 ( P = 0.70), respectively.

    Techniques Used:

    Related Articles

    Centrifugation:

    Article Title: Mep72, a Metzincin Protease That Is Preferentially Secreted by Biofilms of Pseudomonas aeruginosa
    Article Snippet: The culture-RNAlater mixture was thawed on ice, and a suitable amount of cells was sedimented by centrifugation. .. RNA was extracted using an RNeasy Mini purification kit (Qiagen) by following the manufacturer's instructions.

    Article Title: Antibody-Directed Lentiviral Gene Transduction for Live-Cell Monitoring and Selection of Human iPS and hES Cells
    Article Snippet: Human iPS cells were harvested by cell scraper and plated on Ultra low adhesion plate (STEMCELL Technologies) in DMEM/F12 (Gibco) consisting of 15% fetal bovine serum (FBS; Atlanta Biologicals), 15% knockout serum replacement (Invitrogen), 0.1 mM nonessential amino acids and 0.5% penicillin and streptomycin. .. Ten days post-differentiation, EBs in the supernatant were harvested by centrifugation (BeckmanAllegra-6R, 1000 rpm, 5 min) and RNA was isolated using the RNeasy Micro Kit (Qiagen). .. Total RNA (500 ng) was reverse-transcribed using Superscript III Reverse Transcriptase primed with oligo(dT)12–18 and used as template in subsequent PCR with Taq DNA Polymerase.

    Amplification:

    Article Title: Prophylactic melatonin significantly reduces Alzheimer’s neuropathology and associated cognitive deficits independent of antioxidant pathways in AβPPswe/PS1 mice
    Article Snippet: Isolation of mouse brain mRNA and real-time qPCR Total cellular RNA was extracted from homogenized frontal cortices with QIAShredder™ columns in QIAGEN’s buffer RLT and β-mercaptoethanol in a 100:1 ratio followed by processing with the QIAGEN® RNeasy Kit® and DNase Set treatment kits according to the manufacturer’s protocols. .. Isolation of mouse brain mRNA and real-time qPCR Total cellular RNA was extracted from homogenized frontal cortices with QIAShredder™ columns in QIAGEN’s buffer RLT and β-mercaptoethanol in a 100:1 ratio followed by processing with the QIAGEN® RNeasy Kit® and DNase Set treatment kits according to the manufacturer’s protocols.

    Article Title: Targeting EGF-receptor(s) - STAT1 axis attenuates tumor growth and metastasis through downregulation of MUC4 mucin in human pancreatic cancer
    Article Snippet: RNA isolation and PCR amplification conditions were followed as described previously [ ]. .. RNA was isolated using the QIAGEN RNeasy mini kit (Qiagen, Valenica, CA, U.S.A.) and its concentration was determined using a NanoDrop ND 1000 Spectrophotometer. cDNA was synthesized using 2 μg RNA, oligo(dT)18 primer, and Super Script II RNase reverse transcriptase (Invitrogen).

    Article Title: Mep72, a Metzincin Protease That Is Preferentially Secreted by Biofilms of Pseudomonas aeruginosa
    Article Snippet: RNA was extracted using an RNeasy Mini purification kit (Qiagen) by following the manufacturer's instructions. .. Quantitative real-time reverse-transcription PCR (qRT-PCR) was performed on the cDNA using 1× SYBR green PCR master mix (Applied Biosystems) with 10 pmol of the appropriate primers (see Table S2 in the supplemental material).

    Article Title: Antibody-Directed Lentiviral Gene Transduction for Live-Cell Monitoring and Selection of Human iPS and hES Cells
    Article Snippet: Ten days post-differentiation, EBs in the supernatant were harvested by centrifugation (BeckmanAllegra-6R, 1000 rpm, 5 min) and RNA was isolated using the RNeasy Micro Kit (Qiagen). .. Total RNA (500 ng) was reverse-transcribed using Superscript III Reverse Transcriptase primed with oligo(dT)12–18 and used as template in subsequent PCR with Taq DNA Polymerase.

    Synthesized:

    Article Title: Targeting EGF-receptor(s) - STAT1 axis attenuates tumor growth and metastasis through downregulation of MUC4 mucin in human pancreatic cancer
    Article Snippet: RNA isolation and PCR amplification conditions were followed as described previously [ ]. .. RNA was isolated using the QIAGEN RNeasy mini kit (Qiagen, Valenica, CA, U.S.A.) and its concentration was determined using a NanoDrop ND 1000 Spectrophotometer. cDNA was synthesized using 2 μg RNA, oligo(dT)18 primer, and Super Script II RNase reverse transcriptase (Invitrogen). .. PCR was performed for MUC4 using the primer sequences: Forward primer 5′-CGCGGTGGTGGAGGCGTTCTT-3′ and reverse primer 5′-GAAGAATCCTGACAGCCTTCA-3′. β-actin was used as an internal control [ ].

    Quantitative RT-PCR:

    Article Title: Targeting of Liver Mannan-Binding Lectin–Associated Serine Protease-3 with RNA Interference Ameliorates Disease in a Mouse Model of Rheumatoid Arthritis
    Article Snippet: The mRNA was isolated using RNeasy Plus Mini Kit (Qiagen). .. The mRNA was isolated using RNeasy Plus Mini Kit (Qiagen).

    Article Title: Mep72, a Metzincin Protease That Is Preferentially Secreted by Biofilms of Pseudomonas aeruginosa
    Article Snippet: Paragraph title: qRT-PCR. ... RNA was extracted using an RNeasy Mini purification kit (Qiagen) by following the manufacturer's instructions.

    Article Title: Type 2 innate lymphoid cells control eosinophil homeostasis
    Article Snippet: Bead fluorescence was captured on an LSRII (BD) and analyzed using Flow Cytometric Analysis Program (FCAP) Array software (BD). .. Quantitative RT-PCR ILC2 (see above), lung macrophages (CD11b+CD11c+), blood eosinophils (SiglecF+CD11b+SSC-hi), and blood and intestinal CD4+ cells were sorted on a MoFlo XDP and RNA was isolated using the Micro RNeasy kit (Qiagen). .. The RNA was reverse transcribed with SuperScript III (Invitrogen), and the resulting cDNA was used as template for quantitative PCR with the Power SYBR Green kit on a StepOnePlus cycler (Applied Biosystems).

    Article Title: Transmembrane Protease TMPRSS11B Promotes Lung Cancer Growth by Enhancing Lactate Export and Glycolytic Metabolism
    Article Snippet: Paragraph title: RT-qPCR ... RNA was then extracted according to the RNeasy protocol (QIAGEN) with on-column DNase digest and resuspended in 50 mL nuclease-free H2 O. RNA (1 mg) served as template for reverse transcription with SuperScript IV VILO (Invitrogen, Cat. No. 11756050).

    SYBR Green Assay:

    Article Title: Prophylactic melatonin significantly reduces Alzheimer’s neuropathology and associated cognitive deficits independent of antioxidant pathways in AβPPswe/PS1 mice
    Article Snippet: Isolation of mouse brain mRNA and real-time qPCR Total cellular RNA was extracted from homogenized frontal cortices with QIAShredder™ columns in QIAGEN’s buffer RLT and β-mercaptoethanol in a 100:1 ratio followed by processing with the QIAGEN® RNeasy Kit® and DNase Set treatment kits according to the manufacturer’s protocols. .. Isolation of mouse brain mRNA and real-time qPCR Total cellular RNA was extracted from homogenized frontal cortices with QIAShredder™ columns in QIAGEN’s buffer RLT and β-mercaptoethanol in a 100:1 ratio followed by processing with the QIAGEN® RNeasy Kit® and DNase Set treatment kits according to the manufacturer’s protocols.

    Article Title: Mep72, a Metzincin Protease That Is Preferentially Secreted by Biofilms of Pseudomonas aeruginosa
    Article Snippet: RNA was extracted using an RNeasy Mini purification kit (Qiagen) by following the manufacturer's instructions. .. RNA was extracted using an RNeasy Mini purification kit (Qiagen) by following the manufacturer's instructions.

    Ex Vivo:

    Article Title: The Initiation, but Not the Persistence, of Experimental Spondyloarthritis Is Dependent on Interleukin-23 Signaling
    Article Snippet: RNA was isolated using TRIzol and an automated homogenizer followed by RNeasy micro column isolation (Qiagen kit). .. The relative expression was calculated with the “2−ddCt method” ( ).

    Formalin-fixed Paraffin-Embedded:

    Article Title: Quantity and quality of nucleic acids extracted from archival formalin fixed paraffin embedded prostate biopsies
    Article Snippet: Samples extracted with the RNeasy® FFPE kit yielded lower CT -values compared to samples extracted with the High Pure kit (mean CT 25.4 versus 26.4), however this difference was not statistically significant (Table ). .. Figure a-c shows a comparison of RNA yields, purity (A260/A280) and RIN-values obtained from samples extracted with the High Pure FFPE RNA Micro kit and the RNeasy® FFPE kit, respectively. .. A fixed difference was indicated by a mean difference of − 10.71 (limits of agreement: − 16.96 – − 4.46) when investigating the agreement in yields between the two kits.

    Cell Culture:

    Article Title: Transmembrane Protease TMPRSS11B Promotes Lung Cancer Growth by Enhancing Lactate Export and Glycolytic Metabolism
    Article Snippet: Cells with inducible shRNA were cultured in 2 mg/mL dox for > 3 days with fresh dox added every 2 days. .. RNA was then extracted according to the RNeasy protocol (QIAGEN) with on-column DNase digest and resuspended in 50 mL nuclease-free H2 O. RNA (1 mg) served as template for reverse transcription with SuperScript IV VILO (Invitrogen, Cat. No. 11756050).

    Expressing:

    Article Title: Targeting of Liver Mannan-Binding Lectin–Associated Serine Protease-3 with RNA Interference Ameliorates Disease in a Mouse Model of Rheumatoid Arthritis
    Article Snippet: The mRNA was isolated using RNeasy Plus Mini Kit (Qiagen). .. The mRNA was isolated using RNeasy Plus Mini Kit (Qiagen).

    Article Title: Lysosomal protease deficiency or substrate overload induces an oxidative-stress mediated STAT3-dependent pathway of lysosomal homeostasis
    Article Snippet: Total RNA from WT MEF, treated or untreated with 50 μM MVO26630 overnight, and AEP−/− MEFs, WT and STAT3c 3T3s was purified using RNeasy mini kit (Qiagen) following the manufacturer’s instructions. .. Total RNA concentration was determined using a NanoDrop 1000 spectrophotometer (Thermo) and 1 μg of total RNA per sample was used to synthesise cDNA using the qScript Flex cDNA kit (Quanta Biosciences) according to the manufacturer’s conditions.

    Article Title: Lysosomal protease deficiency or substrate overload induces an oxidative-stress mediated STAT3-dependent pathway of lysosomal homeostasis
    Article Snippet: Finally, the mRNA expression levels of different lysosomal proteases were determined by PCR, quantified using ImageJ (imagej. nih.gov) and normalised using β-actin or Tubulin 5 as loading control. .. Total RNA from HKC-8 WT or TFEB KOs was purified using RNeasy mini kit (Qiagen) following the manufacturer’s instructions.

    Article Title: Building a better neonatal mouse model to understand infant respiratory syncytial virus disease
    Article Snippet: Cytokine levels in the airways or the lung The kinetics of IL13 expression in the lung after primary infection was measured using real-time qPCR. .. Total lung RNA was isolated using Qiagen RNeasy plus mini kit and reverse-transcribed to cDNA using SuperScript III first-strand synthesis system.

    Article Title: Optimized microRNA purification from TRIzol-treated plasma
    Article Snippet: All kit protocols facilitated quick and easy RNA isolation, but the Zymo Direct-zol kit, which takes plasma-TRIzol lysate without phase separation as input, took significantly less time to complete. .. We tested this monophase input with the QIAGEN RNeasy and miRNeasy kits to decrease extraction time, but observed greater variability in miRNA expression. .. We therefore recommend phase separation for miRNA profiling studies.

    Article Title: Stat3 is indispensable for damage-induced crypt regeneration but not for Wnt-driven intestinal tumorigenesis
    Article Snippet: Paragraph title: Expression analyses ... Total RNA was extracted from isolated crypts using an RNeasy Plus Micro Extraction Kit (Qiagen, Hilden, Germany).

    Article Title: Mep72, a Metzincin Protease That Is Preferentially Secreted by Biofilms of Pseudomonas aeruginosa
    Article Snippet: RNA was extracted using an RNeasy Mini purification kit (Qiagen) by following the manufacturer's instructions. .. Amplification was carried out using an ABI PRISM 7300 real-time PCR system, and fluorescence data were processed using SDS software (ABI).

    Article Title: The Initiation, but Not the Persistence, of Experimental Spondyloarthritis Is Dependent on Interleukin-23 Signaling
    Article Snippet: RNA was isolated using TRIzol and an automated homogenizer followed by RNeasy micro column isolation (Qiagen kit). .. Gene expression was measured in duplex reactions using SYBR green primers for il17a, il22, il17f, tnf, il6, ifng with gapdh as a housekeeping gene (primer sequences are available upon request).

    Modification:

    Article Title: Targeting of Liver Mannan-Binding Lectin–Associated Serine Protease-3 with RNA Interference Ameliorates Disease in a Mouse Model of Rheumatoid Arthritis
    Article Snippet: The effect of MASP-3 siRNA by duplex 1 (duplex 3) and duplex 2 (duplex 4) was initially characterized in 8-wk-old naive C57BL/6J mice (Charles River Laboratories), and later on, these duplexes were further chemically modified. .. The mRNA was isolated using RNeasy Plus Mini Kit (Qiagen).

    Article Title: Optimized microRNA purification from TRIzol-treated plasma
    Article Snippet: Manufacturers’ protocols were modified where necessary to isolate total RNA, as expression profiling using only the small RNA fraction ( < 200 nt) was shown to be inferior to using total RNA, with 65-88% apparent expression loss after small RNA enrichment [ ]. .. We tested this monophase input with the QIAGEN RNeasy and miRNeasy kits to decrease extraction time, but observed greater variability in miRNA expression.

    Activation Assay:

    Article Title: Prophylactic melatonin significantly reduces Alzheimer’s neuropathology and associated cognitive deficits independent of antioxidant pathways in AβPPswe/PS1 mice
    Article Snippet: Isolation of mouse brain mRNA and real-time qPCR Total cellular RNA was extracted from homogenized frontal cortices with QIAShredder™ columns in QIAGEN’s buffer RLT and β-mercaptoethanol in a 100:1 ratio followed by processing with the QIAGEN® RNeasy Kit® and DNase Set treatment kits according to the manufacturer’s protocols. .. Amplification of the cDNA was performed on a Bio-Rad CFX96 Touch™ Real-Time PCR Detection System using the iQ SYBR® Green Supermix protocol according to the manufacturer specifications.

    Infection:

    Article Title: The purinergic receptor P2RX7 directs metabolic fitness of long-lived memory CD8+ T cells
    Article Snippet: The population purity after cell sorting was > 95% in all experiments. .. 8-day post-LCMV infection MPECs and SLECs were first homogenized using QIAshredder columns (Qiagen) and RNA was then extracted using an RNeasy kit (Qiagen) following manufacturer instructions. .. Following quality control, total RNA samples were processed with the Illumina TotalPrep-96 RNA Amplification Kit for HighThroughput RNA Amplification for Array Analysis, and read in a HiSeq 2500 System (High Output sequencing, Paired End Read, 125 bp).

    Article Title: Building a better neonatal mouse model to understand infant respiratory syncytial virus disease
    Article Snippet: Cytokine levels in the airways or the lung The kinetics of IL13 expression in the lung after primary infection was measured using real-time qPCR. .. Total lung RNA was isolated using Qiagen RNeasy plus mini kit and reverse-transcribed to cDNA using SuperScript III first-strand synthesis system.

    Polymerase Chain Reaction:

    Article Title: Evolution of mosquito preference for humans linked to an odorant receptor
    Article Snippet: We stored tubes at -80°C and then extracted total RNA using an RNeasy kit (Qiagen). .. For colonies, we prepared sequencing libraries from 1 - 3 μg total RNA with an mRNA-Sequencing Sample Prep Kit (Illumina).

    Article Title: Targeting EGF-receptor(s) - STAT1 axis attenuates tumor growth and metastasis through downregulation of MUC4 mucin in human pancreatic cancer
    Article Snippet: Paragraph title: RNA isolation and reverse transcription PCR analysis ... RNA was isolated using the QIAGEN RNeasy mini kit (Qiagen, Valenica, CA, U.S.A.) and its concentration was determined using a NanoDrop ND 1000 Spectrophotometer. cDNA was synthesized using 2 μg RNA, oligo(dT)18 primer, and Super Script II RNase reverse transcriptase (Invitrogen).

    Article Title: Lysosomal protease deficiency or substrate overload induces an oxidative-stress mediated STAT3-dependent pathway of lysosomal homeostasis
    Article Snippet: Total RNA from WT MEF, treated or untreated with 50 μM MVO26630 overnight, and AEP−/− MEFs, WT and STAT3c 3T3s was purified using RNeasy mini kit (Qiagen) following the manufacturer’s instructions. .. Total RNA concentration was determined using a NanoDrop 1000 spectrophotometer (Thermo) and 1 μg of total RNA per sample was used to synthesise cDNA using the qScript Flex cDNA kit (Quanta Biosciences) according to the manufacturer’s conditions.

    Article Title: Lysosomal protease deficiency or substrate overload induces an oxidative-stress mediated STAT3-dependent pathway of lysosomal homeostasis
    Article Snippet: Finally, the mRNA expression levels of different lysosomal proteases were determined by PCR, quantified using ImageJ (imagej. nih.gov) and normalised using β-actin or Tubulin 5 as loading control. .. Total RNA from HKC-8 WT or TFEB KOs was purified using RNeasy mini kit (Qiagen) following the manufacturer’s instructions.

    Article Title: Mep72, a Metzincin Protease That Is Preferentially Secreted by Biofilms of Pseudomonas aeruginosa
    Article Snippet: RNA was extracted using an RNeasy Mini purification kit (Qiagen) by following the manufacturer's instructions. .. RNA was extracted using an RNeasy Mini purification kit (Qiagen) by following the manufacturer's instructions.

    Sequencing:

    Article Title: Evolution of mosquito preference for humans linked to an odorant receptor
    Article Snippet: We stored tubes at -80°C and then extracted total RNA using an RNeasy kit (Qiagen). .. We selected 200 base pair (bp) inserts on a 2% agarose gel both prior to PCR enrichment, per kit instructions, and after PCR enrichment, to further narrow the insert size distribution.

    Injection:

    Article Title: Targeting of Liver Mannan-Binding Lectin–Associated Serine Protease-3 with RNA Interference Ameliorates Disease in a Mouse Model of Rheumatoid Arthritis
    Article Snippet: The mRNA was isolated using RNeasy Plus Mini Kit (Qiagen). .. The mRNA was isolated using RNeasy Plus Mini Kit (Qiagen).

    TaqMan Assay:

    Article Title: Targeting of Liver Mannan-Binding Lectin–Associated Serine Protease-3 with RNA Interference Ameliorates Disease in a Mouse Model of Rheumatoid Arthritis
    Article Snippet: The mRNA was isolated using RNeasy Plus Mini Kit (Qiagen). .. Levels of MASP3 expression were analyzed using qRT-PCR reagents compatible with Roche Lightcycler 480.

    In Vivo:

    Article Title: Targeting of Liver Mannan-Binding Lectin–Associated Serine Protease-3 with RNA Interference Ameliorates Disease in a Mouse Model of Rheumatoid Arthritis
    Article Snippet: Paragraph title: In vivo selection of active GalNAc–MASP-3–siRNA duplexes ... The mRNA was isolated using RNeasy Plus Mini Kit (Qiagen).

    RNA Sequencing Assay:

    Article Title: The purinergic receptor P2RX7 directs metabolic fitness of long-lived memory CD8+ T cells
    Article Snippet: Paragraph title: RNA-seq analysis ... 8-day post-LCMV infection MPECs and SLECs were first homogenized using QIAshredder columns (Qiagen) and RNA was then extracted using an RNeasy kit (Qiagen) following manufacturer instructions.

    Fluorescence:

    Article Title: Mep72, a Metzincin Protease That Is Preferentially Secreted by Biofilms of Pseudomonas aeruginosa
    Article Snippet: RNA was extracted using an RNeasy Mini purification kit (Qiagen) by following the manufacturer's instructions. .. Quantitative real-time reverse-transcription PCR (qRT-PCR) was performed on the cDNA using 1× SYBR green PCR master mix (Applied Biosystems) with 10 pmol of the appropriate primers (see Table S2 in the supplemental material).

    Isolation:

    Article Title: Surface L-type Ca2+ channel expression levels are increased in aged hippocampus
    Article Snippet: CA1, CA3, and DG regions were isolated from young and aged rats in pairs, homogenized in RPLT-Plus Lysis Buffer (Qiagen, Valencia, CA, USA) and stored at −80 °C until RNA isolation. .. Samples were further dissociated with QiaShredder columns, and the total RNA was isolated via Qiagen RNEasy Plus Kit according to manufacturer’s directions. .. RNA was dissolved into 60 μl RNAse-free water, stored on ice, and the yield was determined with a nanodrop spectrophotometer (Thermo-Scientific, Rockford, IL, USA).

    Article Title: Prophylactic melatonin significantly reduces Alzheimer’s neuropathology and associated cognitive deficits independent of antioxidant pathways in AβPPswe/PS1 mice
    Article Snippet: The protein concentration was determined by a BCA protein assay (Pierce) and the respiratory rate was normalized to protein concentration. .. Isolation of mouse brain mRNA and real-time qPCR Total cellular RNA was extracted from homogenized frontal cortices with QIAShredder™ columns in QIAGEN’s buffer RLT and β-mercaptoethanol in a 100:1 ratio followed by processing with the QIAGEN® RNeasy Kit® and DNase Set treatment kits according to the manufacturer’s protocols. .. The RNA concentration was measured with a Thermo Scientific Nanodrop photometer.

    Article Title: Targeting of Liver Mannan-Binding Lectin–Associated Serine Protease-3 with RNA Interference Ameliorates Disease in a Mouse Model of Rheumatoid Arthritis
    Article Snippet: Single 1 or 10 mg/kg doses of duplex 1 and duplex 2 were administered s.c. Livers were collected on day 7 postinjection. .. The mRNA was isolated using RNeasy Plus Mini Kit (Qiagen). .. High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) was used to convert the mRNA samples.

    Article Title: Targeting EGF-receptor(s) - STAT1 axis attenuates tumor growth and metastasis through downregulation of MUC4 mucin in human pancreatic cancer
    Article Snippet: RNA isolation and PCR amplification conditions were followed as described previously [ ]. .. RNA was isolated using the QIAGEN RNeasy mini kit (Qiagen, Valenica, CA, U.S.A.) and its concentration was determined using a NanoDrop ND 1000 Spectrophotometer. cDNA was synthesized using 2 μg RNA, oligo(dT)18 primer, and Super Script II RNase reverse transcriptase (Invitrogen). .. PCR was performed for MUC4 using the primer sequences: Forward primer 5′-CGCGGTGGTGGAGGCGTTCTT-3′ and reverse primer 5′-GAAGAATCCTGACAGCCTTCA-3′. β-actin was used as an internal control [ ].

    Article Title: Building a better neonatal mouse model to understand infant respiratory syncytial virus disease
    Article Snippet: Cytokine levels in the airways or the lung The kinetics of IL13 expression in the lung after primary infection was measured using real-time qPCR. .. Total lung RNA was isolated using Qiagen RNeasy plus mini kit and reverse-transcribed to cDNA using SuperScript III first-strand synthesis system. .. Real-time PCR was then performed using Power Sybr green PCR master mix (Life Technologies) and the relative expression of IL13 were normalized to Hprt using ∆∆Ct method.

    Article Title: Optimized microRNA purification from TRIzol-treated plasma
    Article Snippet: All kit protocols facilitated quick and easy RNA isolation, but the Zymo Direct-zol kit, which takes plasma-TRIzol lysate without phase separation as input, took significantly less time to complete. .. We tested this monophase input with the QIAGEN RNeasy and miRNeasy kits to decrease extraction time, but observed greater variability in miRNA expression.

    Article Title: Stat3 is indispensable for damage-induced crypt regeneration but not for Wnt-driven intestinal tumorigenesis
    Article Snippet: The efficiency of metastasis was scored by the measurement of the areas of metastasized foci per total liver on H & E-stained sections. .. Total RNA was extracted from isolated crypts using an RNeasy Plus Micro Extraction Kit (Qiagen, Hilden, Germany). .. An expression analysis was performed using the RT2 Profiler PCR Array (Mouse Cell Junction Pathway Finder).

    Article Title: Antibody-Directed Lentiviral Gene Transduction for Live-Cell Monitoring and Selection of Human iPS and hES Cells
    Article Snippet: Human iPS cells were harvested by cell scraper and plated on Ultra low adhesion plate (STEMCELL Technologies) in DMEM/F12 (Gibco) consisting of 15% fetal bovine serum (FBS; Atlanta Biologicals), 15% knockout serum replacement (Invitrogen), 0.1 mM nonessential amino acids and 0.5% penicillin and streptomycin. .. Ten days post-differentiation, EBs in the supernatant were harvested by centrifugation (BeckmanAllegra-6R, 1000 rpm, 5 min) and RNA was isolated using the RNeasy Micro Kit (Qiagen). .. Total RNA (500 ng) was reverse-transcribed using Superscript III Reverse Transcriptase primed with oligo(dT)12–18 and used as template in subsequent PCR with Taq DNA Polymerase.

    Article Title: Type 2 innate lymphoid cells control eosinophil homeostasis
    Article Snippet: Bead fluorescence was captured on an LSRII (BD) and analyzed using Flow Cytometric Analysis Program (FCAP) Array software (BD). .. Quantitative RT-PCR ILC2 (see above), lung macrophages (CD11b+CD11c+), blood eosinophils (SiglecF+CD11b+SSC-hi), and blood and intestinal CD4+ cells were sorted on a MoFlo XDP and RNA was isolated using the Micro RNeasy kit (Qiagen). .. The RNA was reverse transcribed with SuperScript III (Invitrogen), and the resulting cDNA was used as template for quantitative PCR with the Power SYBR Green kit on a StepOnePlus cycler (Applied Biosystems).

    Article Title: Acute pyelonephritis and renal scarring are caused by dysfunctional innate immunity in mCxcr2 heterozygous mice
    Article Snippet: Paragraph title: mRNA isolation ... Total RNA was purified with RNeasy Protect Animal Blood Kit (Qiagen) according to the manufacturer's instructions.

    Article Title: The Initiation, but Not the Persistence, of Experimental Spondyloarthritis Is Dependent on Interleukin-23 Signaling
    Article Snippet: Popliteal lymph nodes were collected for RNA isolation. .. RNA was isolated using TRIzol and an automated homogenizer followed by RNeasy micro column isolation (Qiagen kit). .. Gene expression was measured in duplex reactions using SYBR green primers for il17a, il22, il17f, tnf, il6, ifng with gapdh as a housekeeping gene (primer sequences are available upon request).

    Mouse Assay:

    Article Title: Targeting of Liver Mannan-Binding Lectin–Associated Serine Protease-3 with RNA Interference Ameliorates Disease in a Mouse Model of Rheumatoid Arthritis
    Article Snippet: The effect of MASP-3 siRNA by duplex 1 (duplex 3) and duplex 2 (duplex 4) was initially characterized in 8-wk-old naive C57BL/6J mice (Charles River Laboratories), and later on, these duplexes were further chemically modified. .. The mRNA was isolated using RNeasy Plus Mini Kit (Qiagen).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Lysosomal protease deficiency or substrate overload induces an oxidative-stress mediated STAT3-dependent pathway of lysosomal homeostasis
    Article Snippet: Paragraph title: Semi-quantitative reverse transcription-polymerase chain reaction (RT-PCR) ... Total RNA from WT MEF, treated or untreated with 50 μM MVO26630 overnight, and AEP−/− MEFs, WT and STAT3c 3T3s was purified using RNeasy mini kit (Qiagen) following the manufacturer’s instructions.

    Article Title: Optimized microRNA purification from TRIzol-treated plasma
    Article Snippet: Based on RT-PCR assays for spiked-in and endogenous sequences, the QIAGEN RNeasy and miRNeasy kits performed best. .. We tested this monophase input with the QIAGEN RNeasy and miRNeasy kits to decrease extraction time, but observed greater variability in miRNA expression.

    Selection:

    Article Title: Targeting of Liver Mannan-Binding Lectin–Associated Serine Protease-3 with RNA Interference Ameliorates Disease in a Mouse Model of Rheumatoid Arthritis
    Article Snippet: Paragraph title: In vivo selection of active GalNAc–MASP-3–siRNA duplexes ... The mRNA was isolated using RNeasy Plus Mini Kit (Qiagen).

    Spectrophotometry:

    Article Title: Targeting EGF-receptor(s) - STAT1 axis attenuates tumor growth and metastasis through downregulation of MUC4 mucin in human pancreatic cancer
    Article Snippet: RNA isolation and PCR amplification conditions were followed as described previously [ ]. .. RNA was isolated using the QIAGEN RNeasy mini kit (Qiagen, Valenica, CA, U.S.A.) and its concentration was determined using a NanoDrop ND 1000 Spectrophotometer. cDNA was synthesized using 2 μg RNA, oligo(dT)18 primer, and Super Script II RNase reverse transcriptase (Invitrogen). .. PCR was performed for MUC4 using the primer sequences: Forward primer 5′-CGCGGTGGTGGAGGCGTTCTT-3′ and reverse primer 5′-GAAGAATCCTGACAGCCTTCA-3′. β-actin was used as an internal control [ ].

    Article Title: Lysosomal protease deficiency or substrate overload induces an oxidative-stress mediated STAT3-dependent pathway of lysosomal homeostasis
    Article Snippet: Total RNA concentration was determined using a NanoDrop 1000 spectrophotometer (Thermo) and 1 μg of total RNA per sample was used to synthesise cDNA using the qScript Flex cDNA kit (Quanta Biosciences) according to the manufacturer’s conditions. .. Total RNA from HKC-8 WT or TFEB KOs was purified using RNeasy mini kit (Qiagen) following the manufacturer’s instructions.

    Staining:

    Article Title: The Initiation, but Not the Persistence, of Experimental Spondyloarthritis Is Dependent on Interleukin-23 Signaling
    Article Snippet: RNA was isolated using TRIzol and an automated homogenizer followed by RNeasy micro column isolation (Qiagen kit). .. From the repetitive experiments (one prophylactic and one therapeutic experiment), popliteal lymph nodes cells were also used directly ex vivo for qPCR array analysis (Rat Th17 gene array from Qiagen) according to the manufacturer’s instruction.

    Agarose Gel Electrophoresis:

    Article Title: Evolution of mosquito preference for humans linked to an odorant receptor
    Article Snippet: We stored tubes at -80°C and then extracted total RNA using an RNeasy kit (Qiagen). .. For colonies, we prepared sequencing libraries from 1 - 3 μg total RNA with an mRNA-Sequencing Sample Prep Kit (Illumina).

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Genome-wide identification of genic and intergenic neuronal DNA regions bound by Tau protein under physiological and stress conditions
    Article Snippet: The cortex and hippocampus were dissected and flash frozen in liquid nitrogen. .. Total RNA of cortex and hippocampus from 17m KOTau and WT littermates, and hippocampal CA1 region from 6m THY-TAU22 and WT littermates were extracted using the RNeasy lipid tissue kit (QIAGEN, cat74804) according to the manufacturer's recommendations. .. After elution, RNAs were treated with 1 unit/μl of DNAse I (Sigma) to remove genomic DNA.

    Purification:

    Article Title: Lysosomal protease deficiency or substrate overload induces an oxidative-stress mediated STAT3-dependent pathway of lysosomal homeostasis
    Article Snippet: The mean intensity of CellROX Orange per LysoTracker Green DND26 positive structure, normalised for lysosomal size (µm2 ) and per cell was calculated and the standard error calculated using 15 cells per experimental condition. .. Total RNA from WT MEF, treated or untreated with 50 μM MVO26630 overnight, and AEP−/− MEFs, WT and STAT3c 3T3s was purified using RNeasy mini kit (Qiagen) following the manufacturer’s instructions. .. Total RNA concentration was determined using a NanoDrop 1000 spectrophotometer (Thermo) and 1 μg of total RNA per sample was used to synthesise cDNA using the qScript Flex cDNA kit (Quanta Biosciences) according to the manufacturer’s conditions.

    Article Title: Lysosomal protease deficiency or substrate overload induces an oxidative-stress mediated STAT3-dependent pathway of lysosomal homeostasis
    Article Snippet: The following primers were used: β-actin: forward (ATCATGTTTGAGACCTTCAACA), reverse (CATCTCCTGCTCGAAGTCTA); Tubb5: forward (TGTACTATAATGAAGCCACAGGTGG), reverse (CAGTAGGTCTCATCCGTGTTCTCAA); AEP: forward (ATGACCTGGAGAGTGGCTG), reverse (CGTTGATGTCGTCGGGCA); CtsB: forward (GGGTACTTAGGAGTGCACGG), reverse (CCAAATGCCCAACAAGAGCC); CtsD: forward (TCAGGAAGCCTCTCTGGGTA), reverse (CTGCAGCTCCTTCACCTCTT); CtsH: forward (ATGACGAGGCTGCAATGGTT), reverse (TCCCTTGGTCTGCCAATCAG); CtsL: forward (ATGGCACGAATGAGGAAGAG), reverse (GAAAAAGCCTCCCCTTCTTG) and CtsZ: forward (CAGCGGATCTCCCCAAGAAT), reverse (GTCCTTGGCCTGGTAGTTGT). .. Total RNA from HKC-8 WT or TFEB KOs was purified using RNeasy mini kit (Qiagen) following the manufacturer’s instructions. .. Total RNA concentration was determined using a NanoDrop 1000 spectrophotometer (Thermo) and 1 μg of total RNA per sample was used to synthesise cDNA using the qScript Flex cDNA kit (Quanta Biosciences) according to the manufacturer’s conditions.

    Article Title: Optimized microRNA purification from TRIzol-treated plasma
    Article Snippet: Instead, we chose to optimize TRIzol-treated plasma lysate as the input to five column-based RNA purification kits. .. We tested this monophase input with the QIAGEN RNeasy and miRNeasy kits to decrease extraction time, but observed greater variability in miRNA expression.

    Article Title: Mep72, a Metzincin Protease That Is Preferentially Secreted by Biofilms of Pseudomonas aeruginosa
    Article Snippet: The culture-RNAlater mixture was thawed on ice, and a suitable amount of cells was sedimented by centrifugation. .. RNA was extracted using an RNeasy Mini purification kit (Qiagen) by following the manufacturer's instructions. .. The resulting RNA (200 ng) was used as a template for reverse transcription and conversion into cDNA using Superscript II reverse transcriptase (Invitrogen) by following the manufacturer's instructions.

    Article Title: Acute pyelonephritis and renal scarring are caused by dysfunctional innate immunity in mCxcr2 heterozygous mice
    Article Snippet: Blood was collected with heparinized RNAprotect Animal Blood Tubes (Qiagen, Sollentuna, Sweden) to prevent the blood from coagulating. .. Total RNA was purified with RNeasy Protect Animal Blood Kit (Qiagen) according to the manufacturer's instructions. .. The RNA was converted to complimentary DNA by reverse transcription using SuperScript III First-Strand Synthesis System for RT-PCR (Invitrogen).

    Software:

    Article Title: Mep72, a Metzincin Protease That Is Preferentially Secreted by Biofilms of Pseudomonas aeruginosa
    Article Snippet: RNA was extracted using an RNeasy Mini purification kit (Qiagen) by following the manufacturer's instructions. .. Quantitative real-time reverse-transcription PCR (qRT-PCR) was performed on the cDNA using 1× SYBR green PCR master mix (Applied Biosystems) with 10 pmol of the appropriate primers (see Table S2 in the supplemental material).

    Real-time Polymerase Chain Reaction:

    Article Title: Prophylactic melatonin significantly reduces Alzheimer’s neuropathology and associated cognitive deficits independent of antioxidant pathways in AβPPswe/PS1 mice
    Article Snippet: The protein concentration was determined by a BCA protein assay (Pierce) and the respiratory rate was normalized to protein concentration. .. Isolation of mouse brain mRNA and real-time qPCR Total cellular RNA was extracted from homogenized frontal cortices with QIAShredder™ columns in QIAGEN’s buffer RLT and β-mercaptoethanol in a 100:1 ratio followed by processing with the QIAGEN® RNeasy Kit® and DNase Set treatment kits according to the manufacturer’s protocols. .. The RNA concentration was measured with a Thermo Scientific Nanodrop photometer.

    Article Title: Building a better neonatal mouse model to understand infant respiratory syncytial virus disease
    Article Snippet: Cytokine levels in the airways or the lung The kinetics of IL13 expression in the lung after primary infection was measured using real-time qPCR. .. Total lung RNA was isolated using Qiagen RNeasy plus mini kit and reverse-transcribed to cDNA using SuperScript III first-strand synthesis system.

    Article Title: Mep72, a Metzincin Protease That Is Preferentially Secreted by Biofilms of Pseudomonas aeruginosa
    Article Snippet: RNA was extracted using an RNeasy Mini purification kit (Qiagen) by following the manufacturer's instructions. .. Quantitative real-time reverse-transcription PCR (qRT-PCR) was performed on the cDNA using 1× SYBR green PCR master mix (Applied Biosystems) with 10 pmol of the appropriate primers (see Table S2 in the supplemental material).

    Article Title: The Initiation, but Not the Persistence, of Experimental Spondyloarthritis Is Dependent on Interleukin-23 Signaling
    Article Snippet: RNA was isolated using TRIzol and an automated homogenizer followed by RNeasy micro column isolation (Qiagen kit). .. The relative expression was calculated with the “2−ddCt method” ( ).

    shRNA:

    Article Title: Transmembrane Protease TMPRSS11B Promotes Lung Cancer Growth by Enhancing Lactate Export and Glycolytic Metabolism
    Article Snippet: Cells with inducible shRNA were cultured in 2 mg/mL dox for > 3 days with fresh dox added every 2 days. .. RNA was then extracted according to the RNeasy protocol (QIAGEN) with on-column DNase digest and resuspended in 50 mL nuclease-free H2 O. RNA (1 mg) served as template for reverse transcription with SuperScript IV VILO (Invitrogen, Cat. No. 11756050).

    Sample Prep:

    Article Title: Evolution of mosquito preference for humans linked to an odorant receptor
    Article Snippet: We stored tubes at -80°C and then extracted total RNA using an RNeasy kit (Qiagen). .. We selected 200 base pair (bp) inserts on a 2% agarose gel both prior to PCR enrichment, per kit instructions, and after PCR enrichment, to further narrow the insert size distribution.

    Enzyme-linked Immunosorbent Assay:

    Article Title: Building a better neonatal mouse model to understand infant respiratory syncytial virus disease
    Article Snippet: Total lung RNA was isolated using Qiagen RNeasy plus mini kit and reverse-transcribed to cDNA using SuperScript III first-strand synthesis system. .. Total lung RNA was isolated using Qiagen RNeasy plus mini kit and reverse-transcribed to cDNA using SuperScript III first-strand synthesis system.

    Knock-Out:

    Article Title: Antibody-Directed Lentiviral Gene Transduction for Live-Cell Monitoring and Selection of Human iPS and hES Cells
    Article Snippet: Human iPS cells were harvested by cell scraper and plated on Ultra low adhesion plate (STEMCELL Technologies) in DMEM/F12 (Gibco) consisting of 15% fetal bovine serum (FBS; Atlanta Biologicals), 15% knockout serum replacement (Invitrogen), 0.1 mM nonessential amino acids and 0.5% penicillin and streptomycin. .. Ten days post-differentiation, EBs in the supernatant were harvested by centrifugation (BeckmanAllegra-6R, 1000 rpm, 5 min) and RNA was isolated using the RNeasy Micro Kit (Qiagen).

    Concentration Assay:

    Article Title: Targeting EGF-receptor(s) - STAT1 axis attenuates tumor growth and metastasis through downregulation of MUC4 mucin in human pancreatic cancer
    Article Snippet: RNA isolation and PCR amplification conditions were followed as described previously [ ]. .. RNA was isolated using the QIAGEN RNeasy mini kit (Qiagen, Valenica, CA, U.S.A.) and its concentration was determined using a NanoDrop ND 1000 Spectrophotometer. cDNA was synthesized using 2 μg RNA, oligo(dT)18 primer, and Super Script II RNase reverse transcriptase (Invitrogen). .. PCR was performed for MUC4 using the primer sequences: Forward primer 5′-CGCGGTGGTGGAGGCGTTCTT-3′ and reverse primer 5′-GAAGAATCCTGACAGCCTTCA-3′. β-actin was used as an internal control [ ].

    Article Title: Lysosomal protease deficiency or substrate overload induces an oxidative-stress mediated STAT3-dependent pathway of lysosomal homeostasis
    Article Snippet: Total RNA concentration was determined using a NanoDrop 1000 spectrophotometer (Thermo) and 1 μg of total RNA per sample was used to synthesise cDNA using the qScript Flex cDNA kit (Quanta Biosciences) according to the manufacturer’s conditions. .. Total RNA from HKC-8 WT or TFEB KOs was purified using RNeasy mini kit (Qiagen) following the manufacturer’s instructions.

    Article Title: Genome-wide identification of genic and intergenic neuronal DNA regions bound by Tau protein under physiological and stress conditions
    Article Snippet: Total RNA of cortex and hippocampus from 17m KOTau and WT littermates, and hippocampal CA1 region from 6m THY-TAU22 and WT littermates were extracted using the RNeasy lipid tissue kit (QIAGEN, cat#74804) according to the manufacturer's recommendations. .. Total RNA of cortex and hippocampus from 17m KOTau and WT littermates, and hippocampal CA1 region from 6m THY-TAU22 and WT littermates were extracted using the RNeasy lipid tissue kit (QIAGEN, cat#74804) according to the manufacturer's recommendations.

    Lysis:

    Article Title: Surface L-type Ca2+ channel expression levels are increased in aged hippocampus
    Article Snippet: CA1, CA3, and DG regions were isolated from young and aged rats in pairs, homogenized in RPLT-Plus Lysis Buffer (Qiagen, Valencia, CA, USA) and stored at −80 °C until RNA isolation. .. Samples were further dissociated with QiaShredder columns, and the total RNA was isolated via Qiagen RNEasy Plus Kit according to manufacturer’s directions.

    FACS:

    Article Title: The Initiation, but Not the Persistence, of Experimental Spondyloarthritis Is Dependent on Interleukin-23 Signaling
    Article Snippet: RNA was isolated using TRIzol and an automated homogenizer followed by RNeasy micro column isolation (Qiagen kit). .. From the repetitive experiments (one prophylactic and one therapeutic experiment), popliteal lymph nodes cells were also used directly ex vivo for qPCR array analysis (Rat Th17 gene array from Qiagen) according to the manufacturer’s instruction.

    Luminex:

    Article Title: Building a better neonatal mouse model to understand infant respiratory syncytial virus disease
    Article Snippet: Total lung RNA was isolated using Qiagen RNeasy plus mini kit and reverse-transcribed to cDNA using SuperScript III first-strand synthesis system. .. Total lung RNA was isolated using Qiagen RNeasy plus mini kit and reverse-transcribed to cDNA using SuperScript III first-strand synthesis system.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Qiagen hmec 1 cells
    Chemerin and IL-1β co-incubation; synergistic increase in cell adhesion molecule expression Serum starved <t>HMEC-1</t> cells were treated with chemerin (3nM) with or without IL-1β (10ng/ml) for 12 hours. ( A ) Representative western blots of E-selectin, VCAM-1 and ICAM-1 and their respective β-actin. ( B-D ) Densitometric analysis of western blots (cell protein lysates) of E-selectin, VCAM-1 and ICAM-1 immune complexes having normalized to β-actin, respectively, showed that protein expression of cell adhesion molecules, i.e. E-selectin, VCAM-1 and ICAM-1, were synergistically increased when compared to chemerin or IL-1β, alone (Figures 5A-5D: *** P
    Hmec 1 Cells, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hmec 1 cells/product/Qiagen
    Average 99 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    hmec 1 cells - by Bioz Stars, 2019-11
    99/100 stars
      Buy from Supplier

    79
    Qiagen vehicle injected eiu rat eyes
    Ionized calcium-binding adaptor molecule 1 immunostaining on flatmounted retinas. A – B : Example of flatmounted retinas from rat eyes with endotoxin-induced uveitis <t>(EIU)</t> injected with vehicle ( A ) or with antivascular endothelial growth factor <t>(VEGF)</t> antibodies ( B ); Bar = 50 µm. Arrowhead show round reactive ionized calcium-binding adaptor molecule 1 (IBA1)-positive cells. C – D : Extraction of cell contours used for automatic labeling of IBA1 staining. E - F : Quantification of round and total IBA-1 positive cells on flat-mounted retina from EIU control and anti-VEGF treated eyes. Bar = 50 µm.
    Vehicle Injected Eiu Rat Eyes, supplied by Qiagen, used in various techniques. Bioz Stars score: 79/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/vehicle injected eiu rat eyes/product/Qiagen
    Average 79 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    vehicle injected eiu rat eyes - by Bioz Stars, 2019-11
    79/100 stars
      Buy from Supplier

    Image Search Results


    Chemerin and IL-1β co-incubation; synergistic increase in cell adhesion molecule expression Serum starved HMEC-1 cells were treated with chemerin (3nM) with or without IL-1β (10ng/ml) for 12 hours. ( A ) Representative western blots of E-selectin, VCAM-1 and ICAM-1 and their respective β-actin. ( B-D ) Densitometric analysis of western blots (cell protein lysates) of E-selectin, VCAM-1 and ICAM-1 immune complexes having normalized to β-actin, respectively, showed that protein expression of cell adhesion molecules, i.e. E-selectin, VCAM-1 and ICAM-1, were synergistically increased when compared to chemerin or IL-1β, alone (Figures 5A-5D: *** P

    Journal: Oncotarget

    Article Title: Chemerin induces endothelial cell inflammation: activation of nuclear factor-kappa beta and monocyte-endothelial adhesion

    doi: 10.18632/oncotarget.24659

    Figure Lengend Snippet: Chemerin and IL-1β co-incubation; synergistic increase in cell adhesion molecule expression Serum starved HMEC-1 cells were treated with chemerin (3nM) with or without IL-1β (10ng/ml) for 12 hours. ( A ) Representative western blots of E-selectin, VCAM-1 and ICAM-1 and their respective β-actin. ( B-D ) Densitometric analysis of western blots (cell protein lysates) of E-selectin, VCAM-1 and ICAM-1 immune complexes having normalized to β-actin, respectively, showed that protein expression of cell adhesion molecules, i.e. E-selectin, VCAM-1 and ICAM-1, were synergistically increased when compared to chemerin or IL-1β, alone (Figures 5A-5D: *** P

    Article Snippet: Total RNA was extracted from HMEC-1 cells Qiagen RNeasy Mini Kit according to the manufacturer's guidelines (Qiagen, Crawley, UK).

    Techniques: Incubation, Expressing, Western Blot

    Chemerin increases endothelial cell adhesion molecules mRNA expression in HMEC-1 cells Serum starved HMEC-1 cells were treated with chemerin (0-10nM) for 4 hours. Real-time quantitative RT-PCR analyses showed that mRNA expression of cell adhesion molecules, i.e. E-selectin, VCAM-1 and ICAM-1, were significantly up-regulated by chemerin in a concentration dependent manner at 4 hours (Figures 2A-2C : *** P

    Journal: Oncotarget

    Article Title: Chemerin induces endothelial cell inflammation: activation of nuclear factor-kappa beta and monocyte-endothelial adhesion

    doi: 10.18632/oncotarget.24659

    Figure Lengend Snippet: Chemerin increases endothelial cell adhesion molecules mRNA expression in HMEC-1 cells Serum starved HMEC-1 cells were treated with chemerin (0-10nM) for 4 hours. Real-time quantitative RT-PCR analyses showed that mRNA expression of cell adhesion molecules, i.e. E-selectin, VCAM-1 and ICAM-1, were significantly up-regulated by chemerin in a concentration dependent manner at 4 hours (Figures 2A-2C : *** P

    Article Snippet: Total RNA was extracted from HMEC-1 cells Qiagen RNeasy Mini Kit according to the manufacturer's guidelines (Qiagen, Crawley, UK).

    Techniques: Expressing, Quantitative RT-PCR, Concentration Assay

    Chemerin increases endothelial cell adhesion molecules protein expression in HMEC-1 cells Serum starved HMEC-1 cells were treated with chemerin (0-10nM) for 12 and 24 hours. Densitometric analysis of western blots (cell protein lysates) of E-selectin, VCAM-1 and ICAM-1 immune complexes having normalized to β-actin, respectively, showed that protein expression of cell adhesion molecules, i.e. E-selectin, VCAM-1 and ICAM-1, were significantly increased by chemerin in a concentration dependent manner at 12 hours (Figures 3A-3C : * P

    Journal: Oncotarget

    Article Title: Chemerin induces endothelial cell inflammation: activation of nuclear factor-kappa beta and monocyte-endothelial adhesion

    doi: 10.18632/oncotarget.24659

    Figure Lengend Snippet: Chemerin increases endothelial cell adhesion molecules protein expression in HMEC-1 cells Serum starved HMEC-1 cells were treated with chemerin (0-10nM) for 12 and 24 hours. Densitometric analysis of western blots (cell protein lysates) of E-selectin, VCAM-1 and ICAM-1 immune complexes having normalized to β-actin, respectively, showed that protein expression of cell adhesion molecules, i.e. E-selectin, VCAM-1 and ICAM-1, were significantly increased by chemerin in a concentration dependent manner at 12 hours (Figures 3A-3C : * P

    Article Snippet: Total RNA was extracted from HMEC-1 cells Qiagen RNeasy Mini Kit according to the manufacturer's guidelines (Qiagen, Crawley, UK).

    Techniques: Expressing, Western Blot, Concentration Assay

    Chemerin increases endothelial cell adhesion molecules protein secretion in HMEC-1 cells Serum starved HMEC-1 cells were treated with chemerin (0-10nM) for 12 hours. Densitometric analysis of western blots (conditioned media) of E-selectin, VCAM-1 and ICAM-1 immune complexes having normalized to β-actin, respectively, showed that secretion of cell adhesion molecules, i.e. E-selectin, VCAM-1 and ICAM-1, were significantly elevated by chemerin in a concentration dependent manner at 12 hours (Figures 4A-4C : * P

    Journal: Oncotarget

    Article Title: Chemerin induces endothelial cell inflammation: activation of nuclear factor-kappa beta and monocyte-endothelial adhesion

    doi: 10.18632/oncotarget.24659

    Figure Lengend Snippet: Chemerin increases endothelial cell adhesion molecules protein secretion in HMEC-1 cells Serum starved HMEC-1 cells were treated with chemerin (0-10nM) for 12 hours. Densitometric analysis of western blots (conditioned media) of E-selectin, VCAM-1 and ICAM-1 immune complexes having normalized to β-actin, respectively, showed that secretion of cell adhesion molecules, i.e. E-selectin, VCAM-1 and ICAM-1, were significantly elevated by chemerin in a concentration dependent manner at 12 hours (Figures 4A-4C : * P

    Article Snippet: Total RNA was extracted from HMEC-1 cells Qiagen RNeasy Mini Kit according to the manufacturer's guidelines (Qiagen, Crawley, UK).

    Techniques: Western Blot, Concentration Assay

    Chemerin stimulates monocyte-endothelial cell adhesion via NF-ĸB, MAPK and PI3K/Akt pathways Serum starved chemerin (0-10nM) treated HMEC-1 cells were co-cultured with THP-1 cells for 2 hours. Chemerin enhanced monocyte-endothelial adhesion in a concentration dependent fashion (Figure 6A : * P

    Journal: Oncotarget

    Article Title: Chemerin induces endothelial cell inflammation: activation of nuclear factor-kappa beta and monocyte-endothelial adhesion

    doi: 10.18632/oncotarget.24659

    Figure Lengend Snippet: Chemerin stimulates monocyte-endothelial cell adhesion via NF-ĸB, MAPK and PI3K/Akt pathways Serum starved chemerin (0-10nM) treated HMEC-1 cells were co-cultured with THP-1 cells for 2 hours. Chemerin enhanced monocyte-endothelial adhesion in a concentration dependent fashion (Figure 6A : * P

    Article Snippet: Total RNA was extracted from HMEC-1 cells Qiagen RNeasy Mini Kit according to the manufacturer's guidelines (Qiagen, Crawley, UK).

    Techniques: Cell Culture, Concentration Assay

    Chemerin activates NF-кB in HMEC-1 cells via MAPK and PI3K/Akt pathways; synergistic activation with IL-1β pathways Serum starved HMEC-1 cells stably transfected with pNFкB-Luciferase were treated with or without chemerin (0-10nM) for 2 hours. Cells were lysed and luciferase activities were measured. Chemerin induced a concentration dependent increase in luciferase activity after 2 hours of incubation ( ** P

    Journal: Oncotarget

    Article Title: Chemerin induces endothelial cell inflammation: activation of nuclear factor-kappa beta and monocyte-endothelial adhesion

    doi: 10.18632/oncotarget.24659

    Figure Lengend Snippet: Chemerin activates NF-кB in HMEC-1 cells via MAPK and PI3K/Akt pathways; synergistic activation with IL-1β pathways Serum starved HMEC-1 cells stably transfected with pNFкB-Luciferase were treated with or without chemerin (0-10nM) for 2 hours. Cells were lysed and luciferase activities were measured. Chemerin induced a concentration dependent increase in luciferase activity after 2 hours of incubation ( ** P

    Article Snippet: Total RNA was extracted from HMEC-1 cells Qiagen RNeasy Mini Kit according to the manufacturer's guidelines (Qiagen, Crawley, UK).

    Techniques: Activation Assay, Stable Transfection, Transfection, Luciferase, Concentration Assay, Activity Assay, Incubation

    Stimulation of an IFN-mediated antiviral response in human transformed or tumor cells upon Poly(I:C) transfection. ( A ) HEK293, HEK293T, NB324K and Hela cultures were transfected with 2 µg/ml of synthetic dsRNA Poly(I:C) (pI:C) or a 150 mM NaCl solution as control, using lipofectamine 2000 for the period indicated in the figure. The respective culture media were then collected, centrifuged to discard cellular debris, and analyzed by Enzyme-linked Immuno-Sorbent Assay (ELISA) for their content in human IFN-β. Each result is represented as mean+standard deviation of three independent experiments. ( B ) Expression of IFN-α and IFN-β transcripts in mock-treated or pI:C-transfected human cell lines was assessed by RT-PCRs. At the indicated time points, total RNAs were extracted from the respective cultures using the RNeasy kit. One µg of RNA was then treated by DNase I in order to remove potential contaminating DNA and reverse transcribed into cDNA. A fraction of the obtained cDNA (1/10) was then analyzed by PCR for its content in type-I IFN transcripts using specific primer pairs. Transcripts encoding the Human 18S ribosomal protein were used as internal loading controls. Data shown are representative of 3 experiments which gave similar results. ( C ) Assessment of the IFN-signaling (Jak/STAT) pathway activation in HEK293, HEK293T, NB324K and Hela cells upon pI:C transfection. At the time indicated mock-treated or pI:C-transfected (2 µg/ml) cultures were harvested by scraping in PBS and centrifuged. Cell pellets were then re-suspended in complete Ripa buffer supplemented with phosphatase and protease inhibitors. Total proteins were extracted from each sample as described in Materials and Methods . Fifty µg total proteins per sample were then subjected to bipartite 8/10% SDS-PAGE, transferred onto membranes, and probed with antibodies specific for phosphorylated and total isoforms of STAT 1 and STAT 2 as well as with an antibody specific to PKR. Actin was used as an internal loading control. Each presented blot is representative of 3 additional which gave similar results.

    Journal: PLoS ONE

    Article Title: TLR-9 Contributes to the Antiviral Innate Immune Sensing of Rodent Parvoviruses MVMp and H-1PV by Normal Human Immune Cells

    doi: 10.1371/journal.pone.0055086

    Figure Lengend Snippet: Stimulation of an IFN-mediated antiviral response in human transformed or tumor cells upon Poly(I:C) transfection. ( A ) HEK293, HEK293T, NB324K and Hela cultures were transfected with 2 µg/ml of synthetic dsRNA Poly(I:C) (pI:C) or a 150 mM NaCl solution as control, using lipofectamine 2000 for the period indicated in the figure. The respective culture media were then collected, centrifuged to discard cellular debris, and analyzed by Enzyme-linked Immuno-Sorbent Assay (ELISA) for their content in human IFN-β. Each result is represented as mean+standard deviation of three independent experiments. ( B ) Expression of IFN-α and IFN-β transcripts in mock-treated or pI:C-transfected human cell lines was assessed by RT-PCRs. At the indicated time points, total RNAs were extracted from the respective cultures using the RNeasy kit. One µg of RNA was then treated by DNase I in order to remove potential contaminating DNA and reverse transcribed into cDNA. A fraction of the obtained cDNA (1/10) was then analyzed by PCR for its content in type-I IFN transcripts using specific primer pairs. Transcripts encoding the Human 18S ribosomal protein were used as internal loading controls. Data shown are representative of 3 experiments which gave similar results. ( C ) Assessment of the IFN-signaling (Jak/STAT) pathway activation in HEK293, HEK293T, NB324K and Hela cells upon pI:C transfection. At the time indicated mock-treated or pI:C-transfected (2 µg/ml) cultures were harvested by scraping in PBS and centrifuged. Cell pellets were then re-suspended in complete Ripa buffer supplemented with phosphatase and protease inhibitors. Total proteins were extracted from each sample as described in Materials and Methods . Fifty µg total proteins per sample were then subjected to bipartite 8/10% SDS-PAGE, transferred onto membranes, and probed with antibodies specific for phosphorylated and total isoforms of STAT 1 and STAT 2 as well as with an antibody specific to PKR. Actin was used as an internal loading control. Each presented blot is representative of 3 additional which gave similar results.

    Article Snippet: Briefly, Total RNAs of mock-treated, parvovirus- or NDV-infected, and/or PolyI:C transfected cells were isolated using an RNeasy mini kit (QIAGEN, Hilden, Germany) according to the manufacturer's instructions.

    Techniques: Transformation Assay, Transfection, Enzyme-linked Immunosorbent Assay, Standard Deviation, Expressing, Polymerase Chain Reaction, Activation Assay, SDS Page

    Time-dependent transcriptional up-regulation of type-I IFN encoding mRNAs in MVMp- or H-1PV-infected human cell lines. ( A ) HEK293 and HEK293T, ( B ) NB324K and ( C ) Hela cells were mock-treated for 24 hrs, infected with parvoviruses (5 PFUs/cell) for the indicated times, or infected with NDV (6 HU/10 6 cells) or transfected with pI:C (2 µg/ml) for 15 hrs. At the indicated times, cells were harvested and total RNAs were extracted using the RNeasy kit. One µg was then reverse transcribed into cDNA and 10% of this product was subjected to PCR reactions using sets of primers specific to each indicated cytokine mRNA or viral transcripts. PCR product of 18S ribosomal RNA was used as housekeeping gene to normalize loading. No signal was detected in the samples when omitting the reverse transcriptase. Presented data are representative of 3 experiments which all gave similar results.

    Journal: PLoS ONE

    Article Title: TLR-9 Contributes to the Antiviral Innate Immune Sensing of Rodent Parvoviruses MVMp and H-1PV by Normal Human Immune Cells

    doi: 10.1371/journal.pone.0055086

    Figure Lengend Snippet: Time-dependent transcriptional up-regulation of type-I IFN encoding mRNAs in MVMp- or H-1PV-infected human cell lines. ( A ) HEK293 and HEK293T, ( B ) NB324K and ( C ) Hela cells were mock-treated for 24 hrs, infected with parvoviruses (5 PFUs/cell) for the indicated times, or infected with NDV (6 HU/10 6 cells) or transfected with pI:C (2 µg/ml) for 15 hrs. At the indicated times, cells were harvested and total RNAs were extracted using the RNeasy kit. One µg was then reverse transcribed into cDNA and 10% of this product was subjected to PCR reactions using sets of primers specific to each indicated cytokine mRNA or viral transcripts. PCR product of 18S ribosomal RNA was used as housekeeping gene to normalize loading. No signal was detected in the samples when omitting the reverse transcriptase. Presented data are representative of 3 experiments which all gave similar results.

    Article Snippet: Briefly, Total RNAs of mock-treated, parvovirus- or NDV-infected, and/or PolyI:C transfected cells were isolated using an RNeasy mini kit (QIAGEN, Hilden, Germany) according to the manufacturer's instructions.

    Techniques: Infection, Transfection, Polymerase Chain Reaction

    Activation of both IFN-producing and IFN-signaling pathways in hPBMCs upon parvovirus infection and comparison of their intensity to that triggered by NDV. ( A , B and D ) hPBMCs collected from the blood of healthy donors were distributed into 6-well plates at 1×10 7 cells/5 ml culture medium/well. They were then mock-treated or infected with MVMp or H-1PV at 20 PFUs/cell or with NDV (6 HU/10 6 cells). Cultures were harvested in PBS and centrifuged at the time p.i. indicated in each figure. ( A , D ) One half of each pellet was resuspended in Ripa buffer supplemented with phosphatase and protease inhibitors in order to perform Western blot experiments whereas ( B ) total RNAs were extracted from the rest of each cell pellet using the RNeasy kit. ( A , D ) Total proteins were extracted from each sample as described in Materials and Methods . Seventy µg total proteins per sample were then subjected to 10% SDS-PAGE, transferred onto membranes, and probed with antibodies specific for total and phosphorylated STAT 2 and STAT 1 polypeptides as well as for PKR. Actin was used as an internal loading control. Each presented blot is representative of 4 additional which gave similar results. ( B ). One µg of isolated total RNA was then reverse transcribed into cDNA and 10% of this product was subjected to PCR reactions using sets of primers specific to each indicated mRNA. PCR product of 18S ribosomal RNA was used as housekeeping gene to normalize loading. No signal was detected in the samples when omitting the reverse transcriptase. Presented data are representative of 4 experiments which all gave similar results. ( C ) hPBMCs collected from the blood of healthy donors were distributed into 24-well plates at 1×10 6 cells/500 µl culture medium/well. They were then mock-treated or infected with MVMp, H-1PV (20 PFUs/cell) or NDV (6 HU/10 6 cells). After a period of incubation of 24 hrs media were collected, centrifuged in order to discard cellular debris and analyzed by Enzyme-linked Immuno-Sorbent Assay (ELISA) for their content in IFN-α and IFN-β. Results are expressed as means+standard deviations of seven independent experiments.

    Journal: PLoS ONE

    Article Title: TLR-9 Contributes to the Antiviral Innate Immune Sensing of Rodent Parvoviruses MVMp and H-1PV by Normal Human Immune Cells

    doi: 10.1371/journal.pone.0055086

    Figure Lengend Snippet: Activation of both IFN-producing and IFN-signaling pathways in hPBMCs upon parvovirus infection and comparison of their intensity to that triggered by NDV. ( A , B and D ) hPBMCs collected from the blood of healthy donors were distributed into 6-well plates at 1×10 7 cells/5 ml culture medium/well. They were then mock-treated or infected with MVMp or H-1PV at 20 PFUs/cell or with NDV (6 HU/10 6 cells). Cultures were harvested in PBS and centrifuged at the time p.i. indicated in each figure. ( A , D ) One half of each pellet was resuspended in Ripa buffer supplemented with phosphatase and protease inhibitors in order to perform Western blot experiments whereas ( B ) total RNAs were extracted from the rest of each cell pellet using the RNeasy kit. ( A , D ) Total proteins were extracted from each sample as described in Materials and Methods . Seventy µg total proteins per sample were then subjected to 10% SDS-PAGE, transferred onto membranes, and probed with antibodies specific for total and phosphorylated STAT 2 and STAT 1 polypeptides as well as for PKR. Actin was used as an internal loading control. Each presented blot is representative of 4 additional which gave similar results. ( B ). One µg of isolated total RNA was then reverse transcribed into cDNA and 10% of this product was subjected to PCR reactions using sets of primers specific to each indicated mRNA. PCR product of 18S ribosomal RNA was used as housekeeping gene to normalize loading. No signal was detected in the samples when omitting the reverse transcriptase. Presented data are representative of 4 experiments which all gave similar results. ( C ) hPBMCs collected from the blood of healthy donors were distributed into 24-well plates at 1×10 6 cells/500 µl culture medium/well. They were then mock-treated or infected with MVMp, H-1PV (20 PFUs/cell) or NDV (6 HU/10 6 cells). After a period of incubation of 24 hrs media were collected, centrifuged in order to discard cellular debris and analyzed by Enzyme-linked Immuno-Sorbent Assay (ELISA) for their content in IFN-α and IFN-β. Results are expressed as means+standard deviations of seven independent experiments.

    Article Snippet: Briefly, Total RNAs of mock-treated, parvovirus- or NDV-infected, and/or PolyI:C transfected cells were isolated using an RNeasy mini kit (QIAGEN, Hilden, Germany) according to the manufacturer's instructions.

    Techniques: Activation Assay, Infection, Western Blot, SDS Page, Isolation, Polymerase Chain Reaction, Incubation, Enzyme-linked Immunosorbent Assay

    Activation of a TLR-9 dependent production of type-I IFNs in parvovirus-infected human Namalwa cells. The cells (1.10 6 cells/well of a 24-well plate) were either infected with MVMp or H-1PV (∼80 PFUs/cell equivalent to 1×10 4 virus genomes/cell), stimulated with the TLR-9 agonist ODN 2395 at 1 µM, or mock-treated. ( A ) At the indicated time points culture supernatants were collected from the respective wells and used to determine the quantity of type-I IFNs released in the culture medium by ELISA experiments. Results are expressed as means+standard deviations of three independent experiments. ( B ) Mock-treated, parvovirus-infected or ODN stimulated Namalwa cells were harvested at the indicated time points and total RNAs were extracted using the RNeasy kit as described previously in Figure 1 . Total RNAs extracted from parvovirus-infected (24 hrs p.i. at 80 PFUs/cell) or pI:C-transfected (15 hrs post-transfection with 2 µg dsRNA/ml) NB324K cells were used as positive or negative controls. Presented data are representative of 3 experiments which all gave similar results. ( C ) Total DNA was harvested at the indicated time points from parvovirus-infected (MOI of 80 PFUs/cell) or mock-treated Namalwa or HEK293T cultures to assess by Southern blot experiments as described in Figure 2 the replication of both parvoviruses (dRF, dimmer replicative form; mRF, monomeric replicative form; ssDNA, single-stranded DNA genome). The blot shown is representative of 3 experiments which gave similar results. ( D ) Cell pellets from mock-treated or parvovirus-infected Namalwa cultures were re-suspended in complete Ripa buffer and Western blotting was performed as described in Figure 6 . Actin was used as an internal loading control. Each presented blot is representative of 3 experiments which gave similar results.

    Journal: PLoS ONE

    Article Title: TLR-9 Contributes to the Antiviral Innate Immune Sensing of Rodent Parvoviruses MVMp and H-1PV by Normal Human Immune Cells

    doi: 10.1371/journal.pone.0055086

    Figure Lengend Snippet: Activation of a TLR-9 dependent production of type-I IFNs in parvovirus-infected human Namalwa cells. The cells (1.10 6 cells/well of a 24-well plate) were either infected with MVMp or H-1PV (∼80 PFUs/cell equivalent to 1×10 4 virus genomes/cell), stimulated with the TLR-9 agonist ODN 2395 at 1 µM, or mock-treated. ( A ) At the indicated time points culture supernatants were collected from the respective wells and used to determine the quantity of type-I IFNs released in the culture medium by ELISA experiments. Results are expressed as means+standard deviations of three independent experiments. ( B ) Mock-treated, parvovirus-infected or ODN stimulated Namalwa cells were harvested at the indicated time points and total RNAs were extracted using the RNeasy kit as described previously in Figure 1 . Total RNAs extracted from parvovirus-infected (24 hrs p.i. at 80 PFUs/cell) or pI:C-transfected (15 hrs post-transfection with 2 µg dsRNA/ml) NB324K cells were used as positive or negative controls. Presented data are representative of 3 experiments which all gave similar results. ( C ) Total DNA was harvested at the indicated time points from parvovirus-infected (MOI of 80 PFUs/cell) or mock-treated Namalwa or HEK293T cultures to assess by Southern blot experiments as described in Figure 2 the replication of both parvoviruses (dRF, dimmer replicative form; mRF, monomeric replicative form; ssDNA, single-stranded DNA genome). The blot shown is representative of 3 experiments which gave similar results. ( D ) Cell pellets from mock-treated or parvovirus-infected Namalwa cultures were re-suspended in complete Ripa buffer and Western blotting was performed as described in Figure 6 . Actin was used as an internal loading control. Each presented blot is representative of 3 experiments which gave similar results.

    Article Snippet: Briefly, Total RNAs of mock-treated, parvovirus- or NDV-infected, and/or PolyI:C transfected cells were isolated using an RNeasy mini kit (QIAGEN, Hilden, Germany) according to the manufacturer's instructions.

    Techniques: Activation Assay, Infection, Enzyme-linked Immunosorbent Assay, Transfection, Southern Blot, Western Blot

    Comparison of sera exosomal RNA using four different RNA extraction methods. (A) Total RNA yield from ultracentrifugation (UC) and ExoQuick (EQ) treated samples using the RNeasy Mini Kit combined with TRIzol LS, the RNeasy Mini Kit alone, conventional RNA precipitation, and AllPrep DNA/RNA Mini Kit. (B) Demonstration of RNA quality measured by OD 260 /OD 280 in EQ and UC treated samples. Data are shown as the mean ± SD from six independent patient samples. *** P

    Journal: PLoS ONE

    Article Title: Optimizing exosomal RNA isolation for RNA-Seq analyses of archival sera specimens

    doi: 10.1371/journal.pone.0196913

    Figure Lengend Snippet: Comparison of sera exosomal RNA using four different RNA extraction methods. (A) Total RNA yield from ultracentrifugation (UC) and ExoQuick (EQ) treated samples using the RNeasy Mini Kit combined with TRIzol LS, the RNeasy Mini Kit alone, conventional RNA precipitation, and AllPrep DNA/RNA Mini Kit. (B) Demonstration of RNA quality measured by OD 260 /OD 280 in EQ and UC treated samples. Data are shown as the mean ± SD from six independent patient samples. *** P

    Article Snippet: RNA yield and OD260 /OD280 ratios were therefore compared for exosomal RNA isolated using four different RNA extraction methods: the RNeasy Mini Kit combined with TRIzol LS, the RNeasy Mini Kit alone, conventional RNA precipitation, and the AllPrep DNA/RNA Mini Kit ( ).

    Techniques: RNA Extraction

    Exosomal RNAs are stable over two decades. Dot plots of total RNA yield and OD 260 /OD 280 from 105 EQ-treated archival patient samples using the RNeasy Mini Kit combined with TRIzol LS. Storage time for each sample is indicated on the x-axis. The Spearman’s rank correlations for RNA yield versus storing time and OD 260 /OD 280 versus storage time are 0.185 ( P = 0.06) and 0.04 ( P = 0.70), respectively.

    Journal: PLoS ONE

    Article Title: Optimizing exosomal RNA isolation for RNA-Seq analyses of archival sera specimens

    doi: 10.1371/journal.pone.0196913

    Figure Lengend Snippet: Exosomal RNAs are stable over two decades. Dot plots of total RNA yield and OD 260 /OD 280 from 105 EQ-treated archival patient samples using the RNeasy Mini Kit combined with TRIzol LS. Storage time for each sample is indicated on the x-axis. The Spearman’s rank correlations for RNA yield versus storing time and OD 260 /OD 280 versus storage time are 0.185 ( P = 0.06) and 0.04 ( P = 0.70), respectively.

    Article Snippet: RNA yield and OD260 /OD280 ratios were therefore compared for exosomal RNA isolated using four different RNA extraction methods: the RNeasy Mini Kit combined with TRIzol LS, the RNeasy Mini Kit alone, conventional RNA precipitation, and the AllPrep DNA/RNA Mini Kit ( ).

    Techniques:

    Ionized calcium-binding adaptor molecule 1 immunostaining on flatmounted retinas. A – B : Example of flatmounted retinas from rat eyes with endotoxin-induced uveitis (EIU) injected with vehicle ( A ) or with antivascular endothelial growth factor (VEGF) antibodies ( B ); Bar = 50 µm. Arrowhead show round reactive ionized calcium-binding adaptor molecule 1 (IBA1)-positive cells. C – D : Extraction of cell contours used for automatic labeling of IBA1 staining. E - F : Quantification of round and total IBA-1 positive cells on flat-mounted retina from EIU control and anti-VEGF treated eyes. Bar = 50 µm.

    Journal: Molecular Vision

    Article Title: Anti-vascular endothelial growth factor acts on retinal microglia/macrophage activation in a rat model of ocular inflammation

    doi:

    Figure Lengend Snippet: Ionized calcium-binding adaptor molecule 1 immunostaining on flatmounted retinas. A – B : Example of flatmounted retinas from rat eyes with endotoxin-induced uveitis (EIU) injected with vehicle ( A ) or with antivascular endothelial growth factor (VEGF) antibodies ( B ); Bar = 50 µm. Arrowhead show round reactive ionized calcium-binding adaptor molecule 1 (IBA1)-positive cells. C – D : Extraction of cell contours used for automatic labeling of IBA1 staining. E - F : Quantification of round and total IBA-1 positive cells on flat-mounted retina from EIU control and anti-VEGF treated eyes. Bar = 50 µm.

    Article Snippet: Total RNA was isolated from neuroretinas from anti-VEGF and vehicle-injected EIU rat eyes (n = 5 eyes of five rats per group; RNeasy Plus Mini Kit; Qiagen, Courtaboeuf, France).

    Techniques: Binding Assay, Immunostaining, Injection, Labeling, Staining

    Ionized calcium-binding adaptor molecule 1 immunostaining of microglia and macrophages in endotoxin-induced uveitis at 24 h after lipopolysaccharide injection A : Retina section after vehicle intravitreal injection; in green ionized calcium-binding adaptor molecule 1 (IBA1) staining and in blue nuclei are stained with 4’,6-diamidino-2-phenyl-indole (DAPI). Arrowheads indicates round IBA1-positive cells, magnified in the inset. Bar = 50 µm, GCL = ganglion cell layer, INL = inner nuclear layer, ONL = outer nuclear layer. B : Retina section after anti-vascular endothelial growth factor (VEGF) intravitreal injection. IBA1-positive cells (in green) are ramified and elongated in the inner retina as magnified in the inset. Nuclei are stained in blue with DAPI. Bar = 50 µm, GCL = ganglion cell layer, INL = inner nuclear layer, ONL = outer nuclear layer. D – F : Choroid section after vehicle intravitreal injection stained with IBA1 ( D ) and DAPI ( F ), showing round amoeboid cells (magnified in the inset). Bar = 50 µm, RPE = retinal pigment epithelial cells. E – G : Choroid section after anti-VEGF intravitreal injection stained with IBA1 ( E ) and DAPI ( G ), showing round elongated ramified cells (magnified in the inset). Bar = 50 µm, RPE = retinal pigment epithelial cells. C and H : Quantification of round IBA1-positive cells in the inner and outer retina and in the choroid of rat eyes with EIU at 24 h, injected either with vehicle or with anti-VEGF antibody ( C ) or with control rat isotype immunoglobulin G (IgG) antibodies ( H ) *p

    Journal: Molecular Vision

    Article Title: Anti-vascular endothelial growth factor acts on retinal microglia/macrophage activation in a rat model of ocular inflammation

    doi:

    Figure Lengend Snippet: Ionized calcium-binding adaptor molecule 1 immunostaining of microglia and macrophages in endotoxin-induced uveitis at 24 h after lipopolysaccharide injection A : Retina section after vehicle intravitreal injection; in green ionized calcium-binding adaptor molecule 1 (IBA1) staining and in blue nuclei are stained with 4’,6-diamidino-2-phenyl-indole (DAPI). Arrowheads indicates round IBA1-positive cells, magnified in the inset. Bar = 50 µm, GCL = ganglion cell layer, INL = inner nuclear layer, ONL = outer nuclear layer. B : Retina section after anti-vascular endothelial growth factor (VEGF) intravitreal injection. IBA1-positive cells (in green) are ramified and elongated in the inner retina as magnified in the inset. Nuclei are stained in blue with DAPI. Bar = 50 µm, GCL = ganglion cell layer, INL = inner nuclear layer, ONL = outer nuclear layer. D – F : Choroid section after vehicle intravitreal injection stained with IBA1 ( D ) and DAPI ( F ), showing round amoeboid cells (magnified in the inset). Bar = 50 µm, RPE = retinal pigment epithelial cells. E – G : Choroid section after anti-VEGF intravitreal injection stained with IBA1 ( E ) and DAPI ( G ), showing round elongated ramified cells (magnified in the inset). Bar = 50 µm, RPE = retinal pigment epithelial cells. C and H : Quantification of round IBA1-positive cells in the inner and outer retina and in the choroid of rat eyes with EIU at 24 h, injected either with vehicle or with anti-VEGF antibody ( C ) or with control rat isotype immunoglobulin G (IgG) antibodies ( H ) *p

    Article Snippet: Total RNA was isolated from neuroretinas from anti-VEGF and vehicle-injected EIU rat eyes (n = 5 eyes of five rats per group; RNeasy Plus Mini Kit; Qiagen, Courtaboeuf, France).

    Techniques: Binding Assay, Immunostaining, Injection, Staining

    VEGF-R1 and IBA1 co-immunostaining on retinal sections retinal sections of EIU rats injected with vehicle ( A – C ) or anti-VEGF ( D – F ). GCL = ganglion cell layer, INL = inner nuclear layer, ONL = outer nuclear layer, RPE = retinal pigment epithelial cells, Chor = choroid. Insets are increased magnification (5X) of regions delimited by squares. Bar = 50 µm.

    Journal: Molecular Vision

    Article Title: Anti-vascular endothelial growth factor acts on retinal microglia/macrophage activation in a rat model of ocular inflammation

    doi:

    Figure Lengend Snippet: VEGF-R1 and IBA1 co-immunostaining on retinal sections retinal sections of EIU rats injected with vehicle ( A – C ) or anti-VEGF ( D – F ). GCL = ganglion cell layer, INL = inner nuclear layer, ONL = outer nuclear layer, RPE = retinal pigment epithelial cells, Chor = choroid. Insets are increased magnification (5X) of regions delimited by squares. Bar = 50 µm.

    Article Snippet: Total RNA was isolated from neuroretinas from anti-VEGF and vehicle-injected EIU rat eyes (n = 5 eyes of five rats per group; RNeasy Plus Mini Kit; Qiagen, Courtaboeuf, France).

    Techniques: Immunostaining, Injection

    VEGF-R2 and IBA1 coimmunostaining on retinal sections retinal sections of EIU rats injected with vehicle ( A – C ) or anti-VEGF ( D – F ). GCL = ganglion cell layer, INL = inner nuclear layer, ONL = outer nuclear layer, RPE = retinal pigment epithelial cells, Chor = choroid. Insets are increased magnification (5X) of regions delimited by squares. Bar = 50 µm.

    Journal: Molecular Vision

    Article Title: Anti-vascular endothelial growth factor acts on retinal microglia/macrophage activation in a rat model of ocular inflammation

    doi:

    Figure Lengend Snippet: VEGF-R2 and IBA1 coimmunostaining on retinal sections retinal sections of EIU rats injected with vehicle ( A – C ) or anti-VEGF ( D – F ). GCL = ganglion cell layer, INL = inner nuclear layer, ONL = outer nuclear layer, RPE = retinal pigment epithelial cells, Chor = choroid. Insets are increased magnification (5X) of regions delimited by squares. Bar = 50 µm.

    Article Snippet: Total RNA was isolated from neuroretinas from anti-VEGF and vehicle-injected EIU rat eyes (n = 5 eyes of five rats per group; RNeasy Plus Mini Kit; Qiagen, Courtaboeuf, France).

    Techniques: Injection

    Clinical and biological effects of anti-VEGF on EIU in rats. A : Clinical scoring of endotoxin-induced uveitis (EIU; n = 5 rats per group, p > 0.05). B : vascular endothelial growth factor (VEGF) ocular levels (pg/ml) at 24 h (n = 5 rats per group, p = 0.0436). C : Polymorphonuclear cell infiltration in the anterior segment (AS) and in the posterior segment (PS) of rats (five sections/ eye, five eyes per group). D : Ocular levels of interleukin (IL)1-β (πγ/μλ; n = 5, p = 0.55), E : IL-6 (pg/ml; n = 5, p = 0.068). F : Monocyte chemoattractant protein-1 (MCP-1; pg/ml; n = 5, p = 0.3132). G : Tumor necrosis factor (TNF)-α (πγ/μλ; n = 5, p = 0.7273).

    Journal: Molecular Vision

    Article Title: Anti-vascular endothelial growth factor acts on retinal microglia/macrophage activation in a rat model of ocular inflammation

    doi:

    Figure Lengend Snippet: Clinical and biological effects of anti-VEGF on EIU in rats. A : Clinical scoring of endotoxin-induced uveitis (EIU; n = 5 rats per group, p > 0.05). B : vascular endothelial growth factor (VEGF) ocular levels (pg/ml) at 24 h (n = 5 rats per group, p = 0.0436). C : Polymorphonuclear cell infiltration in the anterior segment (AS) and in the posterior segment (PS) of rats (five sections/ eye, five eyes per group). D : Ocular levels of interleukin (IL)1-β (πγ/μλ; n = 5, p = 0.55), E : IL-6 (pg/ml; n = 5, p = 0.068). F : Monocyte chemoattractant protein-1 (MCP-1; pg/ml; n = 5, p = 0.3132). G : Tumor necrosis factor (TNF)-α (πγ/μλ; n = 5, p = 0.7273).

    Article Snippet: Total RNA was isolated from neuroretinas from anti-VEGF and vehicle-injected EIU rat eyes (n = 5 eyes of five rats per group; RNeasy Plus Mini Kit; Qiagen, Courtaboeuf, France).

    Techniques: