rneasy kit  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    RNeasy Micro Kit
    Description:
    For purification of up to 45 µg total RNA from cell and tissue samples. Kit contents: Qiagen RNeasy Micro Kit, 50 preps, 10 to 14L Elution Volume, <5mg Sample, Tissue, Cells Sample, Total RNA Purification, Spin Column Format, Silica Technology, Ideal for Northern, Dot and Slot Blotting, End-point RT-PCR, Quantitative, Real-time RT-PCR, Includes 50 RNeasy MinElute Spin Columns, Collection Tubes (1.5mL and 2mL), RNase-free DNase I, Carrier RNA, RNase-free Reagents and Buffers. Benefits: Fast procedure delivering high-quality total RNA in minutes. Ready-to-use RNA for high performance in any downstream application. Consistent RNA yields from very small amounts of starting material. No phenol/chloroform extraction. No CsCl gradients, no LiCl or ethanol precipitation
    Catalog Number:
    74004
    Price:
    None
    Category:
    RNeasy Micro Kit
    Buy from Supplier


    Structured Review

    Qiagen rneasy kit
    RNeasy Micro Kit
    For purification of up to 45 µg total RNA from cell and tissue samples. Kit contents: Qiagen RNeasy Micro Kit, 50 preps, 10 to 14L Elution Volume, <5mg Sample, Tissue, Cells Sample, Total RNA Purification, Spin Column Format, Silica Technology, Ideal for Northern, Dot and Slot Blotting, End-point RT-PCR, Quantitative, Real-time RT-PCR, Includes 50 RNeasy MinElute Spin Columns, Collection Tubes (1.5mL and 2mL), RNase-free DNase I, Carrier RNA, RNase-free Reagents and Buffers. Benefits: Fast procedure delivering high-quality total RNA in minutes. Ready-to-use RNA for high performance in any downstream application. Consistent RNA yields from very small amounts of starting material. No phenol/chloroform extraction. No CsCl gradients, no LiCl or ethanol precipitation
    https://www.bioz.com/result/rneasy kit/product/Qiagen
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    rneasy kit - by Bioz Stars, 2019-09
    99/100 stars

    Images

    1) Product Images from "Modulation of Innate Immune Responses via Covalently Linked TLR Agonists"

    Article Title: Modulation of Innate Immune Responses via Covalently Linked TLR Agonists

    Journal: ACS Central Science

    doi: 10.1021/acscentsci.5b00274

    BMDC gene expression profile data. (a–d) BMDC gene expression profile illustrating second main trend observed, where Indole contributed to a decrease in CpG immune activity exhibited by Indole_Lox_CpG. BMDCs were incubated with each compound for 18 h at 37 °C. Total RNA was then isolated using RNeasy kit (Qiagen) and analyzed using NanoString Technology. Each figure illustrates the fold change of the specified agonist compared to the no agonist control and is the result of three independent experiments, where * p
    Figure Legend Snippet: BMDC gene expression profile data. (a–d) BMDC gene expression profile illustrating second main trend observed, where Indole contributed to a decrease in CpG immune activity exhibited by Indole_Lox_CpG. BMDCs were incubated with each compound for 18 h at 37 °C. Total RNA was then isolated using RNeasy kit (Qiagen) and analyzed using NanoString Technology. Each figure illustrates the fold change of the specified agonist compared to the no agonist control and is the result of three independent experiments, where * p

    Techniques Used: Expressing, Activity Assay, Incubation, Isolation

    BMDC gene expression profile data. (a) Heat map of immune function related genes. Each figure represents the average of three independent experiments. BMDCs were incubated with each compound for 18 h at 37 °C. Total RNA was then isolated using RNeasy kit (Qiagen) and analyzed using NanoString Technology. (b) Graph illustrating T H 1/T H 2 gene expression profile comparing the gene transcription level of Indole_Lox_CpG to Indole/Lox/CpG. (c) BMDC gene profile illustrating the main trend: Indole_Lox_CpG treated cells elicited the most upregulation in a subset of gene expression. Each figure illustrates the fold change of the specified agonist compared to the no agonist control and is the result of three independent experiments, where * p
    Figure Legend Snippet: BMDC gene expression profile data. (a) Heat map of immune function related genes. Each figure represents the average of three independent experiments. BMDCs were incubated with each compound for 18 h at 37 °C. Total RNA was then isolated using RNeasy kit (Qiagen) and analyzed using NanoString Technology. (b) Graph illustrating T H 1/T H 2 gene expression profile comparing the gene transcription level of Indole_Lox_CpG to Indole/Lox/CpG. (c) BMDC gene profile illustrating the main trend: Indole_Lox_CpG treated cells elicited the most upregulation in a subset of gene expression. Each figure illustrates the fold change of the specified agonist compared to the no agonist control and is the result of three independent experiments, where * p

    Techniques Used: Expressing, Incubation, Isolation

    2) Product Images from "2?-O Methylation of Internal Adenosine by Flavivirus NS5 Methyltransferase"

    Article Title: 2?-O Methylation of Internal Adenosine by Flavivirus NS5 Methyltransferase

    Journal: PLoS Pathogens

    doi: 10.1371/journal.ppat.1002642

    2′- O methylation of internal adenosine. (A) Incorporation of 3 H-methyl into polyA. Homopolymer RNAs (1 µg) were incubated with 2 µg of DENV-4 MTase in the presence of [ 3 H-methyl]-SAM. After the methylation reaction, the un-incorporated [ 3 H-methyl]-SAM was removed by RNeasy kit. The amount of 3 H-methyl incorporation was measured by a MicroBeta counting. (B) SPA-based methylation analysis of oligo (A) 12 , (Am) 12 , and (m 6 ,m 6 A) 12 . All three RNA oligos were 3′-end biotinylated to facilitate SPA analysis. Am indicates that the 2′-OH of adenosine is methylated. m 6 ,m 6 A indicates that the amino N 6 position of adenosine is double methylated. (C) SPA-based methylation analysis of DENV-1 RNA. pppA-RNAs, representing the 5′ 211 nt of DENV-1 genome, were in vitro transcribed using biotinylated-CTP plus unmodified ATP, 2′- O -methyladenosine triphosphate (AmTP), or N 6 methyl adenosine triphosphate (m 6 ATP). The transcription reactions generated pppA-RNA, ppp(Am)-RNA, and ppp(m 6 A)RNA, respectively. The RNAs were then subjected to SPA-based internal methylation analysis. Average results and standard deviations from three independent experiments are presented.
    Figure Legend Snippet: 2′- O methylation of internal adenosine. (A) Incorporation of 3 H-methyl into polyA. Homopolymer RNAs (1 µg) were incubated with 2 µg of DENV-4 MTase in the presence of [ 3 H-methyl]-SAM. After the methylation reaction, the un-incorporated [ 3 H-methyl]-SAM was removed by RNeasy kit. The amount of 3 H-methyl incorporation was measured by a MicroBeta counting. (B) SPA-based methylation analysis of oligo (A) 12 , (Am) 12 , and (m 6 ,m 6 A) 12 . All three RNA oligos were 3′-end biotinylated to facilitate SPA analysis. Am indicates that the 2′-OH of adenosine is methylated. m 6 ,m 6 A indicates that the amino N 6 position of adenosine is double methylated. (C) SPA-based methylation analysis of DENV-1 RNA. pppA-RNAs, representing the 5′ 211 nt of DENV-1 genome, were in vitro transcribed using biotinylated-CTP plus unmodified ATP, 2′- O -methyladenosine triphosphate (AmTP), or N 6 methyl adenosine triphosphate (m 6 ATP). The transcription reactions generated pppA-RNA, ppp(Am)-RNA, and ppp(m 6 A)RNA, respectively. The RNAs were then subjected to SPA-based internal methylation analysis. Average results and standard deviations from three independent experiments are presented.

    Techniques Used: Methylation, Incubation, In Vitro, Generated

    Comparison of internal methylation efficiencies between DENV RNAs and host ribosomal RNAs. (A) Full-length (FL) and 3′ truncated RNAs of DENV-1. pppAG-RNAs, representing the FL and a set of 3′ terminally truncated DENV-1 RNAs, were in vitro synthesized. Numbers indicate nucleoside positions of DENV-1 genome (GenBank accession number U88535). (B) Internal methylation analysis. An equal mass (0.5 µg) of FL and truncated DENV-1 RNAs, and human ribosomal 18 S and 28 S RNAs was treated with DENV MTase in the presence of [ 3 H-methyl]-SAM. The reactions were purified through an RNeasy column to remove unincorporated [ 3 H-methyl]-SAM. The purified RNAs were quantified for internal methylation by a MicroBeta counter. Average results from three experiments are shown; error bars represent standard deviations.
    Figure Legend Snippet: Comparison of internal methylation efficiencies between DENV RNAs and host ribosomal RNAs. (A) Full-length (FL) and 3′ truncated RNAs of DENV-1. pppAG-RNAs, representing the FL and a set of 3′ terminally truncated DENV-1 RNAs, were in vitro synthesized. Numbers indicate nucleoside positions of DENV-1 genome (GenBank accession number U88535). (B) Internal methylation analysis. An equal mass (0.5 µg) of FL and truncated DENV-1 RNAs, and human ribosomal 18 S and 28 S RNAs was treated with DENV MTase in the presence of [ 3 H-methyl]-SAM. The reactions were purified through an RNeasy column to remove unincorporated [ 3 H-methyl]-SAM. The purified RNAs were quantified for internal methylation by a MicroBeta counter. Average results from three experiments are shown; error bars represent standard deviations.

    Techniques Used: Methylation, In Vitro, Synthesized, Purification

    3) Product Images from "Modulation of Innate Immune Responses via Covalently Linked TLR Agonists"

    Article Title: Modulation of Innate Immune Responses via Covalently Linked TLR Agonists

    Journal: ACS Central Science

    doi: 10.1021/acscentsci.5b00274

    BMDC gene expression profile data. (a–d) BMDC gene expression profile illustrating second main trend observed, where Indole contributed to a decrease in CpG immune activity exhibited by Indole_Lox_CpG. BMDCs were incubated with each compound for 18 h at 37 °C. Total RNA was then isolated using RNeasy kit (Qiagen) and analyzed using NanoString Technology. Each figure illustrates the fold change of the specified agonist compared to the no agonist control and is the result of three independent experiments, where * p
    Figure Legend Snippet: BMDC gene expression profile data. (a–d) BMDC gene expression profile illustrating second main trend observed, where Indole contributed to a decrease in CpG immune activity exhibited by Indole_Lox_CpG. BMDCs were incubated with each compound for 18 h at 37 °C. Total RNA was then isolated using RNeasy kit (Qiagen) and analyzed using NanoString Technology. Each figure illustrates the fold change of the specified agonist compared to the no agonist control and is the result of three independent experiments, where * p

    Techniques Used: Expressing, Activity Assay, Incubation, Isolation

    BMDC gene expression profile data. (a) Heat map of immune function related genes. Each figure represents the average of three independent experiments. BMDCs were incubated with each compound for 18 h at 37 °C. Total RNA was then isolated using RNeasy kit (Qiagen) and analyzed using NanoString Technology. (b) Graph illustrating T H 1/T H 2 gene expression profile comparing the gene transcription level of Indole_Lox_CpG to Indole/Lox/CpG. (c) BMDC gene profile illustrating the main trend: Indole_Lox_CpG treated cells elicited the most upregulation in a subset of gene expression. Each figure illustrates the fold change of the specified agonist compared to the no agonist control and is the result of three independent experiments, where * p
    Figure Legend Snippet: BMDC gene expression profile data. (a) Heat map of immune function related genes. Each figure represents the average of three independent experiments. BMDCs were incubated with each compound for 18 h at 37 °C. Total RNA was then isolated using RNeasy kit (Qiagen) and analyzed using NanoString Technology. (b) Graph illustrating T H 1/T H 2 gene expression profile comparing the gene transcription level of Indole_Lox_CpG to Indole/Lox/CpG. (c) BMDC gene profile illustrating the main trend: Indole_Lox_CpG treated cells elicited the most upregulation in a subset of gene expression. Each figure illustrates the fold change of the specified agonist compared to the no agonist control and is the result of three independent experiments, where * p

    Techniques Used: Expressing, Incubation, Isolation

    4) Product Images from "Low-affinity binding in cis to P2Y2R mediates force-dependent integrin activation during hantavirus infection"

    Article Title: Low-affinity binding in cis to P2Y2R mediates force-dependent integrin activation during hantavirus infection

    Journal: Molecular Biology of the Cell

    doi: 10.1091/mbc.E17-01-0082

    P2Y 2 R expression in various cell lines. (A) Plot of P2ry2 mRNA expression in cell lines used in this study, namely P2Y 2 R-null wild type astrocytoma cells (WT1321N1), 1321N1 cells stably expressing an Arg95-Gly96-Glu97 (RGE) mutation of the Arg95-Gly96-Asp97 (RGD) sequence in the P2Y 2 R ( RGE P2Y 2 R) and 1321N1 cells expressing wild-type P2Y 2 R ( RGD P2Y 2 R), CHO-K1 and telomerase-immortalized human microvascular endothelium cell line (TIME). RNA was extracted from 150,000 cells in duplicate wells with RNeasy Qiagen kit. Quantitative RT–PCR was performed in triplicate for each well by Taqman assay as described under Materials and Methods . (B) Plot of P2ry2 mRNA knockdown in CHO-K1 stably transfected with α IIb β 3 –integrin measured 24 h after siRNA transfection, ** p
    Figure Legend Snippet: P2Y 2 R expression in various cell lines. (A) Plot of P2ry2 mRNA expression in cell lines used in this study, namely P2Y 2 R-null wild type astrocytoma cells (WT1321N1), 1321N1 cells stably expressing an Arg95-Gly96-Glu97 (RGE) mutation of the Arg95-Gly96-Asp97 (RGD) sequence in the P2Y 2 R ( RGE P2Y 2 R) and 1321N1 cells expressing wild-type P2Y 2 R ( RGD P2Y 2 R), CHO-K1 and telomerase-immortalized human microvascular endothelium cell line (TIME). RNA was extracted from 150,000 cells in duplicate wells with RNeasy Qiagen kit. Quantitative RT–PCR was performed in triplicate for each well by Taqman assay as described under Materials and Methods . (B) Plot of P2ry2 mRNA knockdown in CHO-K1 stably transfected with α IIb β 3 –integrin measured 24 h after siRNA transfection, ** p

    Techniques Used: Expressing, Stable Transfection, Mutagenesis, Sequencing, Quantitative RT-PCR, TaqMan Assay, Transfection

    5) Product Images from "Optimized Method for Robust Transcriptome Profiling of Minute Tissues Using Laser Capture Microdissection and Low-Input RNA-Seq"

    Article Title: Optimized Method for Robust Transcriptome Profiling of Minute Tissues Using Laser Capture Microdissection and Low-Input RNA-Seq

    Journal: Frontiers in Molecular Neuroscience

    doi: 10.3389/fnmol.2017.00185

    Comparison of RNA quality using different LCM methods. (A) Graph comparing RNA quality (RIN) from LCM RNA samples captured using the MMI CellCut or Arcturus PixCell Instrument and extracted with either the Arcturus PicoPure Isolation kit or QIAGEN Micro RNeasy kit. An overall significant effect was found for both conditions using a two-way analyses of variance (ANOVA; CellCut vs. PixCell F (1,119) = 114.6; PicoPure vs. QIAGEN F (1,119) = 732.5). Although, it is important to note that two groups (Pixcell PicoPure and CellCut QIAGEN) were solely represented by one tissue type (see Experimental Summary in Table 1 ). There was also a significant interaction between the two conditions (Interaction F (1,119) = 9.177, p = 0.003). (B) The same data shown in A plotted by tissue type. Each tissue (Hippocampus, Midbrain and Liver) showed a significant increase in RIN with the QIAGEN kits vs. PicoPure kits using Sidak’s multiple comparisons post hoc test. All data were normally distributed (passed KS normality test) and had similar variances as tested by Brown-Forsythe test. (C,D) Representative Bioanalyzer gel (top) and electropherogram traces (bottom) from PixCell LCM RNA samples extracted using either the (C) Arcturus PicoPure Isolation kit or (D) QIAGEN Micro RNeasy kit. Note that these LCM samples were acquired simultaneously from different brain regions (CA1 vs. CA2) on the same sections from three mouse brains (#2, #4 or #6). Graphs are plotted min to max with a line at the mean. Numbers in parentheses indicate technical replicates. #### Overall group effect; **** post hoc result p
    Figure Legend Snippet: Comparison of RNA quality using different LCM methods. (A) Graph comparing RNA quality (RIN) from LCM RNA samples captured using the MMI CellCut or Arcturus PixCell Instrument and extracted with either the Arcturus PicoPure Isolation kit or QIAGEN Micro RNeasy kit. An overall significant effect was found for both conditions using a two-way analyses of variance (ANOVA; CellCut vs. PixCell F (1,119) = 114.6; PicoPure vs. QIAGEN F (1,119) = 732.5). Although, it is important to note that two groups (Pixcell PicoPure and CellCut QIAGEN) were solely represented by one tissue type (see Experimental Summary in Table 1 ). There was also a significant interaction between the two conditions (Interaction F (1,119) = 9.177, p = 0.003). (B) The same data shown in A plotted by tissue type. Each tissue (Hippocampus, Midbrain and Liver) showed a significant increase in RIN with the QIAGEN kits vs. PicoPure kits using Sidak’s multiple comparisons post hoc test. All data were normally distributed (passed KS normality test) and had similar variances as tested by Brown-Forsythe test. (C,D) Representative Bioanalyzer gel (top) and electropherogram traces (bottom) from PixCell LCM RNA samples extracted using either the (C) Arcturus PicoPure Isolation kit or (D) QIAGEN Micro RNeasy kit. Note that these LCM samples were acquired simultaneously from different brain regions (CA1 vs. CA2) on the same sections from three mouse brains (#2, #4 or #6). Graphs are plotted min to max with a line at the mean. Numbers in parentheses indicate technical replicates. #### Overall group effect; **** post hoc result p

    Techniques Used: Laser Capture Microdissection, Isolation

    6) Product Images from "The embryonic type of SPP1 transcriptional regulation is re-activated in glioblastoma"

    Article Title: The embryonic type of SPP1 transcriptional regulation is re-activated in glioblastoma

    Journal: Oncotarget

    doi: 10.18632/oncotarget.14092

    SPP1 expression is up-regulated in glioma initiating cells ( A ) Representative examples of dot plots and histograms of Rhod 123(–) subpopulations from 5 glioma cell lines were acquired by flow cytometry. Glioma cells (1 × 10 7 ) were trypsinized and incubated with 0.1 μg/ml Rhod123 for 20 min in 37°C. After washing the cells were placed in 37°C for 90 min for Rhod123 exclusion in a dark compartment. Cells kept on ice to inhibit exclusion of Rhod123 were used as a positive control for gating in flow cytometry. Fractions of Rhod123(+) and Rhod123(–) cells were sorted using FACS Aria and a left panel shows a gating strategy. ( B ) Analysis of SPP1, OCT3/4 and NANOG gene expression in Rhod 123(–) subpopulations sorted from four human glioma cell lines. Total RNA was isolated from sorted cells using Qiagen RNeasy kit and the levels of SPP1, NANOG and OCT3/4 mRNA were determined by qPCR in Rhod 123(+) and Rhod 123(–) subpopulations; their expression in Rhod 123(+) subpopulations was taken as 1 (a red line). P values were calculated with a t-test and considered significant when *P ≤ 0.05 and * *P ≤ 0.01. ( C ) Quantification of the expression of Spp1, Oct3/4 and Nanog in Rhod 123(–) subpopulations isolated from rat C6 glioma cells versus their levels in Rhod 123(+) subpopulations taken as 1 (a red line); n = 3.
    Figure Legend Snippet: SPP1 expression is up-regulated in glioma initiating cells ( A ) Representative examples of dot plots and histograms of Rhod 123(–) subpopulations from 5 glioma cell lines were acquired by flow cytometry. Glioma cells (1 × 10 7 ) were trypsinized and incubated with 0.1 μg/ml Rhod123 for 20 min in 37°C. After washing the cells were placed in 37°C for 90 min for Rhod123 exclusion in a dark compartment. Cells kept on ice to inhibit exclusion of Rhod123 were used as a positive control for gating in flow cytometry. Fractions of Rhod123(+) and Rhod123(–) cells were sorted using FACS Aria and a left panel shows a gating strategy. ( B ) Analysis of SPP1, OCT3/4 and NANOG gene expression in Rhod 123(–) subpopulations sorted from four human glioma cell lines. Total RNA was isolated from sorted cells using Qiagen RNeasy kit and the levels of SPP1, NANOG and OCT3/4 mRNA were determined by qPCR in Rhod 123(+) and Rhod 123(–) subpopulations; their expression in Rhod 123(+) subpopulations was taken as 1 (a red line). P values were calculated with a t-test and considered significant when *P ≤ 0.05 and * *P ≤ 0.01. ( C ) Quantification of the expression of Spp1, Oct3/4 and Nanog in Rhod 123(–) subpopulations isolated from rat C6 glioma cells versus their levels in Rhod 123(+) subpopulations taken as 1 (a red line); n = 3.

    Techniques Used: Expressing, Flow Cytometry, Cytometry, Incubation, Positive Control, FACS, Isolation, Real-time Polymerase Chain Reaction

    7) Product Images from "Accessory Gene Regulator-1 Locus Is Essential for Virulence and Pathogenesis of Clostridium difficile"

    Article Title: Accessory Gene Regulator-1 Locus Is Essential for Virulence and Pathogenesis of Clostridium difficile

    Journal: mBio

    doi: 10.1128/mBio.01237-16

    Analysis of agr mutants for transcription of the toxin genes ( tcdA and tcdB ) in BHI and TY media. The 630 wild-type, agrB1D1 mutant, and complemented agrB1D1 mutant strains were cultured in either BHI (A) or TY (B) medium. The R20291 wild-type, agrB1D1 mutant, complemented agrB1D1 mutant, and agrB2D2 mutant strains were also cultured in either BHI (C) or TY (D) medium. The cultures were incubated for 16 h anaerobically at 37°C. Total RNA was isolated with the RNeasy kit (Qiagen), and this was followed by cDNA synthesis by reverse transcription using the ProtoScript AMV First Strand cDNA synthesis kit (New England Biolabs, Ipswich, MA) with 1 µg of the isolated total RNA. Quantitative PCR was performed with primers specific for tcdA , tcdB , and the cDNA used as the template. Known quantities of tcdA and tcdB DNA were used as standards. The difference between the tcdA and tcdB transcript levels detected in the wild-type and agrB1B1 mutant strains was significant ( P = 0.0001), but there was no significant difference ( P = 0.235) between the two culture media. Error bars represent the standard deviations of three independent experiments.
    Figure Legend Snippet: Analysis of agr mutants for transcription of the toxin genes ( tcdA and tcdB ) in BHI and TY media. The 630 wild-type, agrB1D1 mutant, and complemented agrB1D1 mutant strains were cultured in either BHI (A) or TY (B) medium. The R20291 wild-type, agrB1D1 mutant, complemented agrB1D1 mutant, and agrB2D2 mutant strains were also cultured in either BHI (C) or TY (D) medium. The cultures were incubated for 16 h anaerobically at 37°C. Total RNA was isolated with the RNeasy kit (Qiagen), and this was followed by cDNA synthesis by reverse transcription using the ProtoScript AMV First Strand cDNA synthesis kit (New England Biolabs, Ipswich, MA) with 1 µg of the isolated total RNA. Quantitative PCR was performed with primers specific for tcdA , tcdB , and the cDNA used as the template. Known quantities of tcdA and tcdB DNA were used as standards. The difference between the tcdA and tcdB transcript levels detected in the wild-type and agrB1B1 mutant strains was significant ( P = 0.0001), but there was no significant difference ( P = 0.235) between the two culture media. Error bars represent the standard deviations of three independent experiments.

    Techniques Used: Mutagenesis, Cell Culture, Incubation, Isolation, Real-time Polymerase Chain Reaction

    8) Product Images from "Techniques for the Isolation of High-Quality RNA from Cells Encapsulated in Chitosan Hydrogels"

    Article Title: Techniques for the Isolation of High-Quality RNA from Cells Encapsulated in Chitosan Hydrogels

    Journal:

    doi: 10.1089/ten.tec.2012.0693

    Relative PPARγ expression levels normalized to either GAPDH or TfR for each of the RNA isolation methods, based on densitometry analysis ( n =3). Similar results were obtained for both housekeeping genes for all of the extraction methods studied. Statistical significance was determined using a one-way ANOVA with a Tukey's post hoc comparison of means ( p < 0.05). *Statistically different than all other groups. **Statistically different than the freeze+cetyl trimethylammonium bromide (CTAB)+RNeasy® method, the TRIzol® +RNeasy® methods, and the TRIzol® +extended solvent methods. # Statistically different than the mince+CTAB+RNeasy® method and the lysozyme+CTAB+RNeasy® methods.
    Figure Legend Snippet: Relative PPARγ expression levels normalized to either GAPDH or TfR for each of the RNA isolation methods, based on densitometry analysis ( n =3). Similar results were obtained for both housekeeping genes for all of the extraction methods studied. Statistical significance was determined using a one-way ANOVA with a Tukey's post hoc comparison of means ( p < 0.05). *Statistically different than all other groups. **Statistically different than the freeze+cetyl trimethylammonium bromide (CTAB)+RNeasy® method, the TRIzol® +RNeasy® methods, and the TRIzol® +extended solvent methods. # Statistically different than the mince+CTAB+RNeasy® method and the lysozyme+CTAB+RNeasy® methods.

    Techniques Used: Expressing, Isolation

    9) Product Images from "Techniques for the Isolation of High-Quality RNA from Cells Encapsulated in Chitosan Hydrogels"

    Article Title: Techniques for the Isolation of High-Quality RNA from Cells Encapsulated in Chitosan Hydrogels

    Journal:

    doi: 10.1089/ten.tec.2012.0693

    Relative PPARγ expression levels normalized to either GAPDH or TfR for each of the RNA isolation methods, based on densitometry analysis ( n =3). Similar results were obtained for both housekeeping genes for all of the extraction methods studied. Statistical significance was determined using a one-way ANOVA with a Tukey's post hoc comparison of means ( p < 0.05). *Statistically different than all other groups. **Statistically different than the freeze+cetyl trimethylammonium bromide (CTAB)+RNeasy® method, the TRIzol® +RNeasy® methods, and the TRIzol® +extended solvent methods. # Statistically different than the mince+CTAB+RNeasy® method and the lysozyme+CTAB+RNeasy® methods.
    Figure Legend Snippet: Relative PPARγ expression levels normalized to either GAPDH or TfR for each of the RNA isolation methods, based on densitometry analysis ( n =3). Similar results were obtained for both housekeeping genes for all of the extraction methods studied. Statistical significance was determined using a one-way ANOVA with a Tukey's post hoc comparison of means ( p < 0.05). *Statistically different than all other groups. **Statistically different than the freeze+cetyl trimethylammonium bromide (CTAB)+RNeasy® method, the TRIzol® +RNeasy® methods, and the TRIzol® +extended solvent methods. # Statistically different than the mince+CTAB+RNeasy® method and the lysozyme+CTAB+RNeasy® methods.

    Techniques Used: Expressing, Isolation

    10) Product Images from "The highly expressed 5’isomiR of hsa-miR-140-3p contributes to the tumor-suppressive effects of miR-140 by reducing breast cancer proliferation and migration"

    Article Title: The highly expressed 5’isomiR of hsa-miR-140-3p contributes to the tumor-suppressive effects of miR-140 by reducing breast cancer proliferation and migration

    Journal: BMC Genomics

    doi: 10.1186/s12864-016-2869-x

    Validation of direct targeting by 3’ UTR luciferase assay and Taqman qRT-PCR. a Venn diagram containing genes that were found to be significantly downregulated in both MCF10A and MDA-MB-231 cells upon overexpression of has-miR-140-3p or 5’isomiR-140-3p to at least 65 % of the expression in control transfected cells. b and c MCF7 cells were transfected with the miRNA mimics and wildtype ( b ) or mutated ( c ) psiCHECK2 3’ UTR reporter plasmids as indicated. 72 h later, cells were lysed and the activity of renilla (480 nm) and firefly (560 nm) luciferase were measured. Renilla measurements were normalized to firefly and values were normalized to the negative control (mimic-ctrl2). Afterwards, values were normalized to the empty psiCHECK2 transfected with 5’ isomiR-140-3p or hsa-miR-140-3p. Bars represent the average of 6 biological replicates ± standard deviation indicated as error bars. d MCF10A and MDA-MB-231 cells were transfected with hsa-miR-140-3p, 5’ isomiR-140-3p or miRNA mimic negative control (mimic-ctrl2). 72 h later, cells were lysed and total mRNA was isolated and purified using RNeasy kit (Qiagen). The mRNA expression levels of the candidate genes were then assessed by Taqman qRT-PCR. Gene expression was normalized to HPRT and GAPDH housekeeping genes. Normalized gene expression is depicted as relative expression to cells transfected with mimic-ctrl2. Values represent the mean of three biological replicates (*** P ≤ 0.001, ** P ≤ 0.01, ns = non-significant compared to control, unpaired t test)
    Figure Legend Snippet: Validation of direct targeting by 3’ UTR luciferase assay and Taqman qRT-PCR. a Venn diagram containing genes that were found to be significantly downregulated in both MCF10A and MDA-MB-231 cells upon overexpression of has-miR-140-3p or 5’isomiR-140-3p to at least 65 % of the expression in control transfected cells. b and c MCF7 cells were transfected with the miRNA mimics and wildtype ( b ) or mutated ( c ) psiCHECK2 3’ UTR reporter plasmids as indicated. 72 h later, cells were lysed and the activity of renilla (480 nm) and firefly (560 nm) luciferase were measured. Renilla measurements were normalized to firefly and values were normalized to the negative control (mimic-ctrl2). Afterwards, values were normalized to the empty psiCHECK2 transfected with 5’ isomiR-140-3p or hsa-miR-140-3p. Bars represent the average of 6 biological replicates ± standard deviation indicated as error bars. d MCF10A and MDA-MB-231 cells were transfected with hsa-miR-140-3p, 5’ isomiR-140-3p or miRNA mimic negative control (mimic-ctrl2). 72 h later, cells were lysed and total mRNA was isolated and purified using RNeasy kit (Qiagen). The mRNA expression levels of the candidate genes were then assessed by Taqman qRT-PCR. Gene expression was normalized to HPRT and GAPDH housekeeping genes. Normalized gene expression is depicted as relative expression to cells transfected with mimic-ctrl2. Values represent the mean of three biological replicates (*** P ≤ 0.001, ** P ≤ 0.01, ns = non-significant compared to control, unpaired t test)

    Techniques Used: Luciferase, Quantitative RT-PCR, Multiple Displacement Amplification, Over Expression, Expressing, Transfection, Activity Assay, Negative Control, Standard Deviation, Isolation, Purification

    11) Product Images from "The Tumor Suppressive Role of eIF3f and Its Function in Translation Inhibition and rRNA Degradation"

    Article Title: The Tumor Suppressive Role of eIF3f and Its Function in Translation Inhibition and rRNA Degradation

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0034194

    eIF3f induced rRNA degradation in pancreatic cells. (A) Restoration of eIF3f expression in pancreatic cancer cells decreased the rRNA level. MiaPaCa-2 cells were transfected with pcDNA3-eIF3f or pcDNA3. Relative fold changes of rRNA and eIF3f levels were quantified by real time RT-PCR and normalized to GAPDH mRNA. (B)(C) Silencing of eIF3f expression increased the rRNA level during apoptosis. Control and eIF3f-silenced HPDE cells were treated with DMSO vehicle control or etoposide (10 µM) for indicated time to induce apoptosis. Cells were harvested and total RNA was isolated using RNeasy Kit. Relative fold changes of 28S (B) and 18S (C) rRNA levels were quantified by real time RT-PCR after DNase treatment. (D) Time course of cell survival after etoposide treatment. HPDE cells were treated with DMSO or etoposide (10 µM) for indicated time. Cell survival was measured using MTT assay. Relative percentages of survived cells compared to DMSO-treated cells were shown. (E) Silencing of eIF3f expression attenuated rRNA degradation. Control and eIF3f-silenced HPDE cells were treated with actinomycin D (0.5 µg/ml) to block transcription for 3, 6 and 8 h before harvest. Total RNA was isolated, treated with DNase, and relative 28S and 18S rRNAs fold changes compared to control were quantified by real time RT-PCR and normalized to GAPDH mRNA.
    Figure Legend Snippet: eIF3f induced rRNA degradation in pancreatic cells. (A) Restoration of eIF3f expression in pancreatic cancer cells decreased the rRNA level. MiaPaCa-2 cells were transfected with pcDNA3-eIF3f or pcDNA3. Relative fold changes of rRNA and eIF3f levels were quantified by real time RT-PCR and normalized to GAPDH mRNA. (B)(C) Silencing of eIF3f expression increased the rRNA level during apoptosis. Control and eIF3f-silenced HPDE cells were treated with DMSO vehicle control or etoposide (10 µM) for indicated time to induce apoptosis. Cells were harvested and total RNA was isolated using RNeasy Kit. Relative fold changes of 28S (B) and 18S (C) rRNA levels were quantified by real time RT-PCR after DNase treatment. (D) Time course of cell survival after etoposide treatment. HPDE cells were treated with DMSO or etoposide (10 µM) for indicated time. Cell survival was measured using MTT assay. Relative percentages of survived cells compared to DMSO-treated cells were shown. (E) Silencing of eIF3f expression attenuated rRNA degradation. Control and eIF3f-silenced HPDE cells were treated with actinomycin D (0.5 µg/ml) to block transcription for 3, 6 and 8 h before harvest. Total RNA was isolated, treated with DNase, and relative 28S and 18S rRNAs fold changes compared to control were quantified by real time RT-PCR and normalized to GAPDH mRNA.

    Techniques Used: Expressing, Transfection, Quantitative RT-PCR, Isolation, MTT Assay, Blocking Assay

    12) Product Images from "LEDGF1-326 Decreases P23H and Wild Type Rhodopsin Aggregates and P23H Rhodopsin Mediated Cell Damage in Human Retinal Pigment Epithelial Cells"

    Article Title: LEDGF1-326 Decreases P23H and Wild Type Rhodopsin Aggregates and P23H Rhodopsin Mediated Cell Damage in Human Retinal Pigment Epithelial Cells

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0024616

    LEDGF 1-326 does not alter the transcription level of P23H rhodopsin. mRNA was isolated from transfected ARPE-19 cells using the RNeasy kit. To remove contaminating genomic DNA, 10 µg RNA from each sample was treated with DNase using the Turbo DNA free kit. First strand synthesis was done using the high capacity RNA to DNA. PCR was performed to amplify the DNA on an ABI 7500 PCR machine. The threshold thermal cycle was used to calculate the mRNA level of rhodopsin and was normalized to GAPDH mRNA level. Data is expressed as mean ± S.D. for N = 3. Data was considered significant at p
    Figure Legend Snippet: LEDGF 1-326 does not alter the transcription level of P23H rhodopsin. mRNA was isolated from transfected ARPE-19 cells using the RNeasy kit. To remove contaminating genomic DNA, 10 µg RNA from each sample was treated with DNase using the Turbo DNA free kit. First strand synthesis was done using the high capacity RNA to DNA. PCR was performed to amplify the DNA on an ABI 7500 PCR machine. The threshold thermal cycle was used to calculate the mRNA level of rhodopsin and was normalized to GAPDH mRNA level. Data is expressed as mean ± S.D. for N = 3. Data was considered significant at p

    Techniques Used: Isolation, Transfection, Polymerase Chain Reaction

    13) Product Images from "2?-O Methylation of Internal Adenosine by Flavivirus NS5 Methyltransferase"

    Article Title: 2?-O Methylation of Internal Adenosine by Flavivirus NS5 Methyltransferase

    Journal: PLoS Pathogens

    doi: 10.1371/journal.ppat.1002642

    2′- O methylation of internal adenosine. (A) Incorporation of 3 H-methyl into polyA. Homopolymer RNAs (1 µg) were incubated with 2 µg of DENV-4 MTase in the presence of [ 3 H-methyl]-SAM. After the methylation reaction, the un-incorporated [ 3 H-methyl]-SAM was removed by RNeasy kit. The amount of 3 H-methyl incorporation was measured by a MicroBeta counting. (B) SPA-based methylation analysis of oligo (A) 12 , (Am) 12 , and (m 6 ,m 6 A) 12 . All three RNA oligos were 3′-end biotinylated to facilitate SPA analysis. Am indicates that the 2′-OH of adenosine is methylated. m 6 ,m 6 A indicates that the amino N 6 position of adenosine is double methylated. (C) SPA-based methylation analysis of DENV-1 RNA. pppA-RNAs, representing the 5′ 211 nt of DENV-1 genome, were in vitro transcribed using biotinylated-CTP plus unmodified ATP, 2′- O -methyladenosine triphosphate (AmTP), or N 6 methyl adenosine triphosphate (m 6 ATP). The transcription reactions generated pppA-RNA, ppp(Am)-RNA, and ppp(m 6 A)RNA, respectively. The RNAs were then subjected to SPA-based internal methylation analysis. Average results and standard deviations from three independent experiments are presented.
    Figure Legend Snippet: 2′- O methylation of internal adenosine. (A) Incorporation of 3 H-methyl into polyA. Homopolymer RNAs (1 µg) were incubated with 2 µg of DENV-4 MTase in the presence of [ 3 H-methyl]-SAM. After the methylation reaction, the un-incorporated [ 3 H-methyl]-SAM was removed by RNeasy kit. The amount of 3 H-methyl incorporation was measured by a MicroBeta counting. (B) SPA-based methylation analysis of oligo (A) 12 , (Am) 12 , and (m 6 ,m 6 A) 12 . All three RNA oligos were 3′-end biotinylated to facilitate SPA analysis. Am indicates that the 2′-OH of adenosine is methylated. m 6 ,m 6 A indicates that the amino N 6 position of adenosine is double methylated. (C) SPA-based methylation analysis of DENV-1 RNA. pppA-RNAs, representing the 5′ 211 nt of DENV-1 genome, were in vitro transcribed using biotinylated-CTP plus unmodified ATP, 2′- O -methyladenosine triphosphate (AmTP), or N 6 methyl adenosine triphosphate (m 6 ATP). The transcription reactions generated pppA-RNA, ppp(Am)-RNA, and ppp(m 6 A)RNA, respectively. The RNAs were then subjected to SPA-based internal methylation analysis. Average results and standard deviations from three independent experiments are presented.

    Techniques Used: Methylation, Incubation, In Vitro, Generated

    14) Product Images from "Quality Control of RNA Preservation and Extraction from Paraffin-Embedded Tissue: Implications for RT-PCR and Microarray Analysis"

    Article Title: Quality Control of RNA Preservation and Extraction from Paraffin-Embedded Tissue: Implications for RT-PCR and Microarray Analysis

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0070714

    Fixation has strong influence on RNA fragment size and impairs qRT-PCR results. Electropherograms show different RNA molecule size distribution in cryopreserved and FFPE/TFPE liver tissue samples. (A) In contrast to CRYO, ribosomal RNA peaks are absent and fragmentation of RNA has occurred in all fixed tissues. (B) RNA cleanup by Qiagen RNeasy Kit removes small (
    Figure Legend Snippet: Fixation has strong influence on RNA fragment size and impairs qRT-PCR results. Electropherograms show different RNA molecule size distribution in cryopreserved and FFPE/TFPE liver tissue samples. (A) In contrast to CRYO, ribosomal RNA peaks are absent and fragmentation of RNA has occurred in all fixed tissues. (B) RNA cleanup by Qiagen RNeasy Kit removes small (

    Techniques Used: Quantitative RT-PCR, Formalin-fixed Paraffin-Embedded

    15) Product Images from "Alpha-2 Heremans Schmid Glycoprotein (AHSG) Modulates Signaling Pathways in Head and Neck Squamous Cell Carcinoma Cell Line SQ20B"

    Article Title: Alpha-2 Heremans Schmid Glycoprotein (AHSG) Modulates Signaling Pathways in Head and Neck Squamous Cell Carcinoma Cell Line SQ20B

    Journal:

    doi: 10.1016/j.yexcr.2013.12.003

    AHSG message and protein levels in HNSCC cell lines. (A) HNSCC cell lines FaDu, SQ20B and UMSCC47 were serum-starved for 48 h. Cells were washed twice with PBS. RNA was extracted using the Qiagen RNeasy Kit. Equal concentrations of each RNA sample were
    Figure Legend Snippet: AHSG message and protein levels in HNSCC cell lines. (A) HNSCC cell lines FaDu, SQ20B and UMSCC47 were serum-starved for 48 h. Cells were washed twice with PBS. RNA was extracted using the Qiagen RNeasy Kit. Equal concentrations of each RNA sample were

    Techniques Used:

    16) Product Images from "Therapeutic effects of calcium dobesilate on diabetic nephropathy mediated through reduction of expression of PAI-1"

    Article Title: Therapeutic effects of calcium dobesilate on diabetic nephropathy mediated through reduction of expression of PAI-1

    Journal: Experimental and Therapeutic Medicine

    doi: 10.3892/etm.2012.755

    Quantitative RT-PCR analysis of PAI-1 mRNA levels in patients. The total RNA was harvested from the peripheral blood mononuclear cells using an RNeasy kit according to the manufacturer’s instructions. The RT-PCR experiments were repeated at least 3 times. RNA was reverse transcribed into cDNA using random primers in a Reverse Transcription II system according to the manufacturer’s instructions. The expression of PAI-1 mRNA was quantified by quantitative PCR using an ABI Prism Sequence Detection System. Template-negative and RT-negative conditions were used as controls. Amplification of the endogenous GAPDH cDNA was monitored. The levels (mean value) of PAI-1 transcripts in patients were calculated. RT-PCR, reverse-transcription-PCR, PAI-1, plasminogen activator inhibitor-1.
    Figure Legend Snippet: Quantitative RT-PCR analysis of PAI-1 mRNA levels in patients. The total RNA was harvested from the peripheral blood mononuclear cells using an RNeasy kit according to the manufacturer’s instructions. The RT-PCR experiments were repeated at least 3 times. RNA was reverse transcribed into cDNA using random primers in a Reverse Transcription II system according to the manufacturer’s instructions. The expression of PAI-1 mRNA was quantified by quantitative PCR using an ABI Prism Sequence Detection System. Template-negative and RT-negative conditions were used as controls. Amplification of the endogenous GAPDH cDNA was monitored. The levels (mean value) of PAI-1 transcripts in patients were calculated. RT-PCR, reverse-transcription-PCR, PAI-1, plasminogen activator inhibitor-1.

    Techniques Used: Quantitative RT-PCR, Reverse Transcription Polymerase Chain Reaction, Expressing, Real-time Polymerase Chain Reaction, Sequencing, Amplification, Polymerase Chain Reaction

    17) Product Images from ""

    Article Title:

    Journal:

    doi: 10.1074/jbc.M109.029462

    Effect of deletion mutations on the c-Src sequence-controlled translation of reporter RNAs. A , organization of in vitro transcribed uncapped wild type reporter RNA ( 5′Src-RFLuc ) and the mutants containing various lengths of deletions (Δ) in the c-Src sequences are shown; dashed line , extent of deletion. AUG , initiator codon is underlined. B , RNAs were translated for 1.5 h in HeLa lysates in the presence of [35 S]methionine, and the FLuc protein bands were visualized by autoradiography after SDS-PAGE. Lane M , 14 C-labeled protein markers. C , Stability of the reporter RNAs in HeLa translation lysates. The 32 P-labeled reporter RNAs (∼1 × 106 dpm) were added to a standard HeLa translation mixture for 1.5 h, and total RNAs were isolated by Qiagen RNeasy column method. Half of the eluted RNA samples (20 μl) were subjected to formaldehyde-agarose gel electrophoresis. The gel was photographed after ethidium bromide staining for detection of ribosomal RNAs ( lower panel ), dried, and autoradiographed ( upper panel ). Reporter RNAs are as indicated for each lane. D , comparison of the kinetics of translation between wild type 5′Src-FLuc and a deletion mutant ( 5′Src Δ 2-FLuc ). The RNAs were translated in a standard HeLa lysates mixture, and FLuc activities were assayed with an aliquot (2 μl) of the reaction at various time points. Control , translation lysates without exogenous RNA. E , transfection of uncapped monocistronic c-Src mutant RNAs. The Huh7 cells (80% confluent in 60-mm culture plates) were transfected in triplicate with uncapped RNAs as indicated, and FLuc activities were assayed 3 h post-transfection in the total lysates. F , relative stability of mutant reporter RNAs in the transfected cells. The 32 P-labeled mutant RNAs (as indicated) were transfected as above. The total RNAs were isolated, and the labeled RNAs were detected by agarose gel electrophoresis followed by autoradiography of the dried gel ( upper panel ). Lower panel , the same gel showing 18 S rRNA in each lane.
    Figure Legend Snippet: Effect of deletion mutations on the c-Src sequence-controlled translation of reporter RNAs. A , organization of in vitro transcribed uncapped wild type reporter RNA ( 5′Src-RFLuc ) and the mutants containing various lengths of deletions (Δ) in the c-Src sequences are shown; dashed line , extent of deletion. AUG , initiator codon is underlined. B , RNAs were translated for 1.5 h in HeLa lysates in the presence of [35 S]methionine, and the FLuc protein bands were visualized by autoradiography after SDS-PAGE. Lane M , 14 C-labeled protein markers. C , Stability of the reporter RNAs in HeLa translation lysates. The 32 P-labeled reporter RNAs (∼1 × 106 dpm) were added to a standard HeLa translation mixture for 1.5 h, and total RNAs were isolated by Qiagen RNeasy column method. Half of the eluted RNA samples (20 μl) were subjected to formaldehyde-agarose gel electrophoresis. The gel was photographed after ethidium bromide staining for detection of ribosomal RNAs ( lower panel ), dried, and autoradiographed ( upper panel ). Reporter RNAs are as indicated for each lane. D , comparison of the kinetics of translation between wild type 5′Src-FLuc and a deletion mutant ( 5′Src Δ 2-FLuc ). The RNAs were translated in a standard HeLa lysates mixture, and FLuc activities were assayed with an aliquot (2 μl) of the reaction at various time points. Control , translation lysates without exogenous RNA. E , transfection of uncapped monocistronic c-Src mutant RNAs. The Huh7 cells (80% confluent in 60-mm culture plates) were transfected in triplicate with uncapped RNAs as indicated, and FLuc activities were assayed 3 h post-transfection in the total lysates. F , relative stability of mutant reporter RNAs in the transfected cells. The 32 P-labeled mutant RNAs (as indicated) were transfected as above. The total RNAs were isolated, and the labeled RNAs were detected by agarose gel electrophoresis followed by autoradiography of the dried gel ( upper panel ). Lower panel , the same gel showing 18 S rRNA in each lane.

    Techniques Used: Sequencing, In Vitro, Autoradiography, SDS Page, Labeling, Isolation, Agarose Gel Electrophoresis, Staining, Mutagenesis, Transfection

    18) Product Images from "Mechanisms by which Porphyromonas gingivalis evades innate immunity"

    Article Title: Mechanisms by which Porphyromonas gingivalis evades innate immunity

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0182164

    Inflammatory cytokine production from DCs is extinguished in the presence of P . gingivalis . ( A ) DCs from B10.A-Rag2 -/- mice were either unstimulated (medium) or stimulated on the sixth day with 5x10 7 bacteria in a 24-well plate for 16h at 37°C. Cells were harvested, stained with directly labeled monoclonal antibodies and analyzed by FACS analysis. Cells were gated for the CD11c positive population and analyzed for the costimulatory molecules B7.1, B7.2 and CD40, and the antigen-presenting molecule, MHC class II. Numbers indicate the percentage of the population in the gate or quadrant ( B ) Same as (A) Culture CSN were analyzed for the presence of various cytokines using Searchlight protein arrays. ( C ) Same as (B) except the co-culture period was 6h, at which time we isolated total RNA using the RNeasy kit and analyzed it by Real-time RT-PCR. The data are expressed as the mean ± SD of three independent experiments.
    Figure Legend Snippet: Inflammatory cytokine production from DCs is extinguished in the presence of P . gingivalis . ( A ) DCs from B10.A-Rag2 -/- mice were either unstimulated (medium) or stimulated on the sixth day with 5x10 7 bacteria in a 24-well plate for 16h at 37°C. Cells were harvested, stained with directly labeled monoclonal antibodies and analyzed by FACS analysis. Cells were gated for the CD11c positive population and analyzed for the costimulatory molecules B7.1, B7.2 and CD40, and the antigen-presenting molecule, MHC class II. Numbers indicate the percentage of the population in the gate or quadrant ( B ) Same as (A) Culture CSN were analyzed for the presence of various cytokines using Searchlight protein arrays. ( C ) Same as (B) except the co-culture period was 6h, at which time we isolated total RNA using the RNeasy kit and analyzed it by Real-time RT-PCR. The data are expressed as the mean ± SD of three independent experiments.

    Techniques Used: Mouse Assay, Staining, Labeling, FACS, Co-Culture Assay, Isolation, Quantitative RT-PCR

    19) Product Images from "Ethyl Caffeate Ameliorates Collagen-Induced Arthritis by Suppressing Th1 Immune Response"

    Article Title: Ethyl Caffeate Ameliorates Collagen-Induced Arthritis by Suppressing Th1 Immune Response

    Journal: Journal of Immunology Research

    doi: 10.1155/2017/7416792

    ECF suppresses IFN- γ -related pathway in TCR engagement-mediated T lymphocyte activation. Purified CD4 + T cells were stimulated with anti-CD3 (5 μ g/ml) and anti-CD28 (2 μ g/ml) for 16 h. Total RNA was isolated using RNeasy kits, and 1 μ g of total RNA was used to synthesis cDNA. Real-time quantitative PCR assay was carried out using SYBR Premix Ex Taq II kit, and relative quantification of mRNA expression was calculated as the fold increase using the delta-delta Ct; the housekeeping gene is β -actin. Results presented are mean ± s.e.m., n = 3. ∗ P
    Figure Legend Snippet: ECF suppresses IFN- γ -related pathway in TCR engagement-mediated T lymphocyte activation. Purified CD4 + T cells were stimulated with anti-CD3 (5 μ g/ml) and anti-CD28 (2 μ g/ml) for 16 h. Total RNA was isolated using RNeasy kits, and 1 μ g of total RNA was used to synthesis cDNA. Real-time quantitative PCR assay was carried out using SYBR Premix Ex Taq II kit, and relative quantification of mRNA expression was calculated as the fold increase using the delta-delta Ct; the housekeeping gene is β -actin. Results presented are mean ± s.e.m., n = 3. ∗ P

    Techniques Used: Activation Assay, Purification, Isolation, Real-time Polymerase Chain Reaction, Expressing

    20) Product Images from "Techniques for the Isolation of High-Quality RNA from Cells Encapsulated in Chitosan Hydrogels"

    Article Title: Techniques for the Isolation of High-Quality RNA from Cells Encapsulated in Chitosan Hydrogels

    Journal:

    doi: 10.1089/ten.tec.2012.0693

    Relative PPARγ expression levels normalized to either GAPDH or TfR for each of the RNA isolation methods, based on densitometry analysis ( n =3). Similar results were obtained for both housekeeping genes for all of the extraction methods studied. Statistical significance was determined using a one-way ANOVA with a Tukey's post hoc comparison of means ( p < 0.05). *Statistically different than all other groups. **Statistically different than the freeze+cetyl trimethylammonium bromide (CTAB)+RNeasy® method, the TRIzol® +RNeasy® methods, and the TRIzol® +extended solvent methods. # Statistically different than the mince+CTAB+RNeasy® method and the lysozyme+CTAB+RNeasy® methods.
    Figure Legend Snippet: Relative PPARγ expression levels normalized to either GAPDH or TfR for each of the RNA isolation methods, based on densitometry analysis ( n =3). Similar results were obtained for both housekeeping genes for all of the extraction methods studied. Statistical significance was determined using a one-way ANOVA with a Tukey's post hoc comparison of means ( p < 0.05). *Statistically different than all other groups. **Statistically different than the freeze+cetyl trimethylammonium bromide (CTAB)+RNeasy® method, the TRIzol® +RNeasy® methods, and the TRIzol® +extended solvent methods. # Statistically different than the mince+CTAB+RNeasy® method and the lysozyme+CTAB+RNeasy® methods.

    Techniques Used: Expressing, Isolation

    Related Articles

    Amplification:

    Article Title: KLF5 controls glutathione metabolism to suppress p190-BCR-ABL+ B-cell lymphoblastic leukemia
    Article Snippet: For live cell gating analysis, we used 7-aminoactinomycin D (Invitrogen, ThermoFisher Scientific). .. Total mRNA was isolated from ALL cell line cells or p190-BCR-ABL expressing mouse B-cell precursors according to the manufacturer’s protocol (RNeasy Micro Kit, Qiagen Sciences Inc., Germantown, MD). mRNA was reverse-transcribed using TaqMan® Reverse Transcription Reagents (Applied Biosystems, Thermo Fisher Scientific), followed by amplification of cDNA (Taqman Universal PCR master mix, Applied Biosystems). .. Cycle threshold (Ct) values of individual genes were normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and values calculated using the 2−ΔCt method.

    Article Title: Analysis of Gene Expression Profiling in Meningioma: Deregulated Signaling Pathways Associated with Meningioma and EGFL6 Overexpression in Benign Meningioma Tissue and Serum
    Article Snippet: Total RNA was extracted from 3 brain arachnoidal tissues, 3 fibroblastic meningiomas, and 3 anaplastic meningiomas by using Trizol Reagent (Invitrogen), and then purified with RNeasy Micro kits (Qiagen). .. Total RNA was extracted from 3 brain arachnoidal tissues, 3 fibroblastic meningiomas, and 3 anaplastic meningiomas by using Trizol Reagent (Invitrogen), and then purified with RNeasy Micro kits (Qiagen).

    Article Title: Rather than by direct acquisition via lateral gene transfer, GHF5 cellulases were passed on from early Pratylenchidae to root-knot and cyst nematodes
    Article Snippet: Paragraph title: RNA extraction and cDNA cellulase amplification ... The lysate was used immediately for the RNA extraction according to RNeasy Micro kit protocol (Qiagen).

    Synthesized:

    Article Title: Rather than by direct acquisition via lateral gene transfer, GHF5 cellulases were passed on from early Pratylenchidae to root-knot and cyst nematodes
    Article Snippet: In order to support the chosen intron extraction approach, cDNA cellulase sequence for G. pallida was synthesized. .. The lysate was used immediately for the RNA extraction according to RNeasy Micro kit protocol (Qiagen).

    Cytometry:

    Article Title: Eomesodermin of Atlantic Salmon: An Important Regulator of Cytolytic Gene and Interferon Gamma Expression in Spleen Lymphocytes
    Article Snippet: Paragraph title: Flow Cytometry and RT-PCR of Sorted Cells ... Total RNA was isolated from 10,000 spleen lymphocytes using the RNeasy Micro Kit (Qiagen, including DNase digestion).

    Quantitative RT-PCR:

    Article Title: KLF5 controls glutathione metabolism to suppress p190-BCR-ABL+ B-cell lymphoblastic leukemia
    Article Snippet: Paragraph title: Quantitative RT-PCR analysis ... Total mRNA was isolated from ALL cell line cells or p190-BCR-ABL expressing mouse B-cell precursors according to the manufacturer’s protocol (RNeasy Micro Kit, Qiagen Sciences Inc., Germantown, MD). mRNA was reverse-transcribed using TaqMan® Reverse Transcription Reagents (Applied Biosystems, Thermo Fisher Scientific), followed by amplification of cDNA (Taqman Universal PCR master mix, Applied Biosystems).

    Article Title: Melanocortin 2 receptor antagonists in canine pituitary-dependent hypercortisolism: in vitro studies
    Article Snippet: Paragraph title: RT-qPCR ... After removing the culture medium, the wells for each condition were pooled and RNA was isolated from the cells with the RNeasy Micro Kit (QIAGEN, Venlo, the Netherlands), including the DNase treatment, according to the manufacturer’s instructions.

    Article Title: Single-cell expression analysis of BMP15 and GDF9 in mature oocytes and BMPR2 in cumulus cells of women with polycystic ovary syndrome undergoing controlled ovarian hyperstimulation
    Article Snippet: Eighteen MII-oocytes and their respective cumulus cells were obtained from 18 patients with PCOS, and 48 MII-oocytes and cumulus cells (CCs) from 35 controls, both subjected to controlled ovarian hyperstimulation (COH), and follicular fluid (FF) was collected from small (10–14 mm) and large ( > 18 mm) follicles. .. RNeasy Micro Kit (Qiagen® ) was used for RNA extraction and gene expression was quantified in each oocyte individually and in microdissected cumulus cells from cumulus-oocyte complexes retrieved from preovulatory follicles using qRT-PCR. .. Chemiluminescence and RIA assays were used for hormone assays.

    SYBR Green Assay:

    Article Title: Phosphorylated and Non-phosphorylated Leucine Rich Amelogenin Peptide Differentially Affect Ameloblast Mineralization
    Article Snippet: Total RNAs were extracted from cells at D0, D2, and D7, and also at D14 for ALC cells and from tooth germs at D0 and D9 using respectively RNeasy Mini Kits for the cells and RNeasy Micro Kits (Qiagen) for the molars. .. For quantitative PCR, mouse specific primers for Amelx (F: GATGGCTGCACCACCAAATC, R: CTGAAGGGTGTGACTCGGG), Actin (F: GTGGCATCCATGAAACTACAT, R: GGCATAGAGGTCTTTACGG), GAPDH (F: TGTGTCCGTCGTGGATCTGA, R: TTGCTGTTGAAGTCGCAGGAG) were used.

    Article Title: Nodal induces sequential restriction of germ cell factors during primordial germ cell specification
    Article Snippet: RNA was extracted from ∼150 embryos in each desired stage by using the RNeasy Micro kit (Qiagen). .. A reverse transcription reaction was performed using M-MLV Reverse Transcriptase (Promega) or M-MuLV Reverse Transcriptase (Thermoscientific, Maxima first-strand cDNA synthesis kit).

    Article Title: Mouse Basophils Reside in Extracellular Matrix-Enriched Bone Marrow Niches Which Control Their Motility
    Article Snippet: Total RNA was isolated from basophil-enriched population (95–98% of cells bearing the phenotype FcεRIαCD49b+ ) derived from IL-3-induced bone marrow cell cultures by using the RNeasy Micro Kit (Qiagen, Courtaboeuf, France) according to the manufacturer's instructions. .. Total RNA was isolated from basophil-enriched population (95–98% of cells bearing the phenotype FcεRIαCD49b+ ) derived from IL-3-induced bone marrow cell cultures by using the RNeasy Micro Kit (Qiagen, Courtaboeuf, France) according to the manufacturer's instructions.

    Article Title: Monocytes from Depressed Patients Display an Altered Pattern of Response to Endotoxin Challenge
    Article Snippet: Total cytoplasmic RNA was extracted using the RNeasy Micro kit (Qiagen, Hilden, Germany), which included 15 min DNAse treatment. .. Aliquots (0.1 µg) of RNA were converted to cDNA using random hexamer primers.

    Microarray:

    Article Title: MicroRNA-155 Protects Group 2 Innate Lymphoid Cells From Apoptosis to Promote Type-2 Immunity
    Article Snippet: RNA was extracted using chloroform phase separation, followed by DNase treatment and further purification using Qiagen RNeasy micro kits (performing washes with 100% ethanol to preserve short RNA sequences). .. RNA was extracted using chloroform phase separation, followed by DNase treatment and further purification using Qiagen RNeasy micro kits (performing washes with 100% ethanol to preserve short RNA sequences).

    Article Title: PERT: A Method for Expression Deconvolution of Human Blood Samples from Varied Microenvironmental and Developmental Conditions
    Article Snippet: Paragraph title: Microarray preparation for CFU-M and megakaryocytes ... Total RNA of the four samples was isolated using RNeasy Micro kit (Qiagen).

    Article Title: Analysis of Gene Expression Profiling in Meningioma: Deregulated Signaling Pathways Associated with Meningioma and EGFL6 Overexpression in Benign Meningioma Tissue and Serum
    Article Snippet: Paragraph title: Microarray analysis ... Total RNA was extracted from 3 brain arachnoidal tissues, 3 fibroblastic meningiomas, and 3 anaplastic meningiomas by using Trizol Reagent (Invitrogen), and then purified with RNeasy Micro kits (Qiagen).

    Article Title: Analysis of FGF-Dependent and FGF-Independent Pathways in Otic Placode Induction
    Article Snippet: Paragraph title: Microarray Analysis ... Cells lysis was performed using QIAshredder columns (Qiagen) and RNA isolated using the RNeasy Micro kits (Qiagen) according to the manufacturer’s protocols, although the DNAseI step was omitted and an additional RNA cleanup step was employed.

    Random Hexamer Labeling:

    Article Title: Monocytes from Depressed Patients Display an Altered Pattern of Response to Endotoxin Challenge
    Article Snippet: Total cytoplasmic RNA was extracted using the RNeasy Micro kit (Qiagen, Hilden, Germany), which included 15 min DNAse treatment. .. Total cytoplasmic RNA was extracted using the RNeasy Micro kit (Qiagen, Hilden, Germany), which included 15 min DNAse treatment.

    Expressing:

    Article Title: KLF5 controls glutathione metabolism to suppress p190-BCR-ABL+ B-cell lymphoblastic leukemia
    Article Snippet: For live cell gating analysis, we used 7-aminoactinomycin D (Invitrogen, ThermoFisher Scientific). .. Total mRNA was isolated from ALL cell line cells or p190-BCR-ABL expressing mouse B-cell precursors according to the manufacturer’s protocol (RNeasy Micro Kit, Qiagen Sciences Inc., Germantown, MD). mRNA was reverse-transcribed using TaqMan® Reverse Transcription Reagents (Applied Biosystems, Thermo Fisher Scientific), followed by amplification of cDNA (Taqman Universal PCR master mix, Applied Biosystems). .. Cycle threshold (Ct) values of individual genes were normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and values calculated using the 2−ΔCt method.

    Article Title: Gene expression of CCL8 and CXCL10 in peripheral blood leukocytes during early pregnancy in cows
    Article Snippet: Cultured leukocytes were further incubated in this medium with recombinant proteins as follows: bovine IFNT (100 ng/mL: 1.1 × 105 units/mg, generated from HEK293 cells as described previously [ ]) or recombinant human CCL16 (100 ng/mL: #TP723266, OriGene Technologies, Inc., Rockville, MD, USA). .. Total RNA from PBLs was extracted using an RNeasy Micro Kit (#74004, QIAGEN) in accordance with the manufacturer’s protocols, and used for the subsequent gene expression analysis. .. The expression ratio of each gene to GAPDH mRNA was calculated to adjust for variations in the PCR reaction.

    Article Title: Transforming Growth Factor-β and Interleukin-10 Synergistically Regulate Humoral Immunity via Modulating Metabolic Signals
    Article Snippet: Total RNAs were extracted with RNeasy Micro Kit (Qiagen) and were reverse-transcribed to cDNA with random primers (Invitrogen) and SuperScript III (Invitrogen), as described elsewhere ( ). .. Total RNAs were extracted with RNeasy Micro Kit (Qiagen) and were reverse-transcribed to cDNA with random primers (Invitrogen) and SuperScript III (Invitrogen), as described elsewhere ( ).

    Article Title: Melanocortin 2 receptor antagonists in canine pituitary-dependent hypercortisolism: in vitro studies
    Article Snippet: After removing the culture medium, the wells for each condition were pooled and RNA was isolated from the cells with the RNeasy Micro Kit (QIAGEN, Venlo, the Netherlands), including the DNase treatment, according to the manufacturer’s instructions. .. After removing the culture medium, the wells for each condition were pooled and RNA was isolated from the cells with the RNeasy Micro Kit (QIAGEN, Venlo, the Netherlands), including the DNase treatment, according to the manufacturer’s instructions.

    Article Title: Mouse Basophils Reside in Extracellular Matrix-Enriched Bone Marrow Niches Which Control Their Motility
    Article Snippet: Total RNA was isolated from basophil-enriched population (95–98% of cells bearing the phenotype FcεRIαCD49b+ ) derived from IL-3-induced bone marrow cell cultures by using the RNeasy Micro Kit (Qiagen, Courtaboeuf, France) according to the manufacturer's instructions. .. Total RNA was isolated from basophil-enriched population (95–98% of cells bearing the phenotype FcεRIαCD49b+ ) derived from IL-3-induced bone marrow cell cultures by using the RNeasy Micro Kit (Qiagen, Courtaboeuf, France) according to the manufacturer's instructions.

    Article Title: Single-cell expression analysis of BMP15 and GDF9 in mature oocytes and BMPR2 in cumulus cells of women with polycystic ovary syndrome undergoing controlled ovarian hyperstimulation
    Article Snippet: Eighteen MII-oocytes and their respective cumulus cells were obtained from 18 patients with PCOS, and 48 MII-oocytes and cumulus cells (CCs) from 35 controls, both subjected to controlled ovarian hyperstimulation (COH), and follicular fluid (FF) was collected from small (10–14 mm) and large ( > 18 mm) follicles. .. RNeasy Micro Kit (Qiagen® ) was used for RNA extraction and gene expression was quantified in each oocyte individually and in microdissected cumulus cells from cumulus-oocyte complexes retrieved from preovulatory follicles using qRT-PCR. .. Chemiluminescence and RIA assays were used for hormone assays.

    Article Title: Analysis of FGF-Dependent and FGF-Independent Pathways in Otic Placode Induction
    Article Snippet: Cells lysis was performed using QIAshredder columns (Qiagen) and RNA isolated using the RNeasy Micro kits (Qiagen) according to the manufacturer’s protocols, although the DNAseI step was omitted and an additional RNA cleanup step was employed. .. RNA was amplified and biotinylated using the Two-Cycle cDNA synthesis kit and IVT labeling kit (Affymetrix), before being hybridized with GeneChip Chicken Genome microarrays (Affymetrix).

    Article Title: A member of the CPW-WPC protein family is expressed in and localized to the surface of developing ookinetes
    Article Snippet: Total RNA was isolated from in vitro cultured ookinetes using the RNeasy Micro Kit (Qiagen). .. To obtain cDNA, total RNA was subjected to reverse transcription and subsequent PCR using the PrimeScript reagent kit (TAKARA, Japan).

    Article Title: HDAC3-Dependent Epigenetic Pathway Controls Lung Alveolar Epithelial Cell Remodeling and Spreading via miR-17-92 and TGF-β Signaling Regulation
    Article Snippet: For mRNA qPCR, total RNA was isolated from lungs or cells at indicated time points by an RNeasy Mini Kit (Qiagen) or RNeasy Micro Kit (Qiagen). .. First-strand cDNA synthesis was performed using SuperScript III Reverse Transcriptase (Life Technologies). qPCR was performed using the SYBR green system (Applied Biosystems).

    Modification:

    Article Title:
    Article Snippet: All 20 cell lines were grown to 70%–80% confluence. .. Twenty-four hours before RNA extraction using an RNeasy Micro kit (Qiagen, Valencia, CA), all cell lines were grown in Dulbecco’s modified Eagle’s medium/F12 (Invitrogen, Carlsbad, CA). .. The RNA was prepared and profiled as previously mentioned in the section entitled Validation of the 45 MDR-linked Genes as a Prognostic Signature for Poor Overall Survival .

    Derivative Assay:

    Article Title: Mouse Basophils Reside in Extracellular Matrix-Enriched Bone Marrow Niches Which Control Their Motility
    Article Snippet: The same procedure was applied with respect to type I collagen, fibronectin and laminin. .. Total RNA was isolated from basophil-enriched population (95–98% of cells bearing the phenotype FcεRIαCD49b+ ) derived from IL-3-induced bone marrow cell cultures by using the RNeasy Micro Kit (Qiagen, Courtaboeuf, France) according to the manufacturer's instructions. .. Total RNA concentration and purity were determined using a Nanodrop ND8000 spectrophotometer (Thermo Scientific NanoDrop Products, DE, EUA).

    Hybridization:

    Article Title: MicroRNA-155 Protects Group 2 Innate Lymphoid Cells From Apoptosis to Promote Type-2 Immunity
    Article Snippet: RNA was extracted using chloroform phase separation, followed by DNase treatment and further purification using Qiagen RNeasy micro kits (performing washes with 100% ethanol to preserve short RNA sequences). .. RNA was extracted using chloroform phase separation, followed by DNase treatment and further purification using Qiagen RNeasy micro kits (performing washes with 100% ethanol to preserve short RNA sequences).

    Article Title: PERT: A Method for Expression Deconvolution of Human Blood Samples from Varied Microenvironmental and Developmental Conditions
    Article Snippet: Total RNA of the four samples was isolated using RNeasy Micro kit (Qiagen). .. Total RNA of the four samples was isolated using RNeasy Micro kit (Qiagen).

    Flow Cytometry:

    Article Title: Eomesodermin of Atlantic Salmon: An Important Regulator of Cytolytic Gene and Interferon Gamma Expression in Spleen Lymphocytes
    Article Snippet: Paragraph title: Flow Cytometry and RT-PCR of Sorted Cells ... Total RNA was isolated from 10,000 spleen lymphocytes using the RNeasy Micro Kit (Qiagen, including DNase digestion).

    Cell Culture:

    Article Title: Gene expression of CCL8 and CXCL10 in peripheral blood leukocytes during early pregnancy in cows
    Article Snippet: Cultured leukocytes were further incubated in this medium with recombinant proteins as follows: bovine IFNT (100 ng/mL: 1.1 × 105 units/mg, generated from HEK293 cells as described previously [ ]) or recombinant human CCL16 (100 ng/mL: #TP723266, OriGene Technologies, Inc., Rockville, MD, USA). .. Total RNA from PBLs was extracted using an RNeasy Micro Kit (#74004, QIAGEN) in accordance with the manufacturer’s protocols, and used for the subsequent gene expression analysis.

    Article Title: PERT: A Method for Expression Deconvolution of Human Blood Samples from Varied Microenvironmental and Developmental Conditions
    Article Snippet: Lin- cells were cultured as described in . .. Total RNA of the four samples was isolated using RNeasy Micro kit (Qiagen).

    Article Title: Analysis of FGF-Dependent and FGF-Independent Pathways in Otic Placode Induction
    Article Snippet: Trigeminal ectoderm was isolated from embryos with between 0–4 pairs of somites, and cultured in collagen gels in the presence or absence of 50 ng/ml FGF2 for 18 hours. .. Cells lysis was performed using QIAshredder columns (Qiagen) and RNA isolated using the RNeasy Micro kits (Qiagen) according to the manufacturer’s protocols, although the DNAseI step was omitted and an additional RNA cleanup step was employed.

    Article Title: A member of the CPW-WPC protein family is expressed in and localized to the surface of developing ookinetes
    Article Snippet: Multiple sequence alignments of CPW-WPC family members were performed with ClustalW (MegAlign; Lasergene®). .. Total RNA was isolated from in vitro cultured ookinetes using the RNeasy Micro Kit (Qiagen). .. To obtain cDNA, total RNA was subjected to reverse transcription and subsequent PCR using the PrimeScript reagent kit (TAKARA, Japan).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Eomesodermin of Atlantic Salmon: An Important Regulator of Cytolytic Gene and Interferon Gamma Expression in Spleen Lymphocytes
    Article Snippet: Paragraph title: Flow Cytometry and RT-PCR of Sorted Cells ... Total RNA was isolated from 10,000 spleen lymphocytes using the RNeasy Micro Kit (Qiagen, including DNase digestion).

    Article Title: Rather than by direct acquisition via lateral gene transfer, GHF5 cellulases were passed on from early Pratylenchidae to root-knot and cyst nematodes
    Article Snippet: The lysate was used immediately for the RNA extraction according to RNeasy Micro kit protocol (Qiagen). .. Total RNA end concentration was approximately 7ng of RNA/μL of water.

    Article Title: A member of the CPW-WPC protein family is expressed in and localized to the surface of developing ookinetes
    Article Snippet: Paragraph title: RT-PCR of pycpw-wpc-1 and CPW-WPC family member transcripts ... Total RNA was isolated from in vitro cultured ookinetes using the RNeasy Micro Kit (Qiagen).

    Generated:

    Article Title: Gene expression of CCL8 and CXCL10 in peripheral blood leukocytes during early pregnancy in cows
    Article Snippet: Cultured leukocytes were further incubated in this medium with recombinant proteins as follows: bovine IFNT (100 ng/mL: 1.1 × 105 units/mg, generated from HEK293 cells as described previously [ ]) or recombinant human CCL16 (100 ng/mL: #TP723266, OriGene Technologies, Inc., Rockville, MD, USA). .. Total RNA from PBLs was extracted using an RNeasy Micro Kit (#74004, QIAGEN) in accordance with the manufacturer’s protocols, and used for the subsequent gene expression analysis.

    Sequencing:

    Article Title: Rather than by direct acquisition via lateral gene transfer, GHF5 cellulases were passed on from early Pratylenchidae to root-knot and cyst nematodes
    Article Snippet: In order to support the chosen intron extraction approach, cDNA cellulase sequence for G. pallida was synthesized. .. The lysate was used immediately for the RNA extraction according to RNeasy Micro kit protocol (Qiagen).

    Recombinant:

    Article Title: Gene expression of CCL8 and CXCL10 in peripheral blood leukocytes during early pregnancy in cows
    Article Snippet: Cultured leukocytes were further incubated in this medium with recombinant proteins as follows: bovine IFNT (100 ng/mL: 1.1 × 105 units/mg, generated from HEK293 cells as described previously [ ]) or recombinant human CCL16 (100 ng/mL: #TP723266, OriGene Technologies, Inc., Rockville, MD, USA). .. Total RNA from PBLs was extracted using an RNeasy Micro Kit (#74004, QIAGEN) in accordance with the manufacturer’s protocols, and used for the subsequent gene expression analysis.

    Fluorescence:

    Article Title: Eomesodermin of Atlantic Salmon: An Important Regulator of Cytolytic Gene and Interferon Gamma Expression in Spleen Lymphocytes
    Article Snippet: Fluorescence-activated cell sorting was performed based on PI exclusion, forward scatter (FS), and side scatter (SS) using BD FACSAria™ Flow Cytometer (BD Bioscience). .. Total RNA was isolated from 10,000 spleen lymphocytes using the RNeasy Micro Kit (Qiagen, including DNase digestion).

    Isolation:

    Article Title: KLF5 controls glutathione metabolism to suppress p190-BCR-ABL+ B-cell lymphoblastic leukemia
    Article Snippet: For live cell gating analysis, we used 7-aminoactinomycin D (Invitrogen, ThermoFisher Scientific). .. Total mRNA was isolated from ALL cell line cells or p190-BCR-ABL expressing mouse B-cell precursors according to the manufacturer’s protocol (RNeasy Micro Kit, Qiagen Sciences Inc., Germantown, MD). mRNA was reverse-transcribed using TaqMan® Reverse Transcription Reagents (Applied Biosystems, Thermo Fisher Scientific), followed by amplification of cDNA (Taqman Universal PCR master mix, Applied Biosystems). .. Cycle threshold (Ct) values of individual genes were normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and values calculated using the 2−ΔCt method.

    Article Title: MicroRNA-155 Protects Group 2 Innate Lymphoid Cells From Apoptosis to Promote Type-2 Immunity
    Article Snippet: ILC2 (CD3− CD4− Lin− ICOS+ cells) were isolated from naïve, IL-33 or N. brasiliensis treated mice using fluorescent cell sorting (Sony iCyt Synergy cell sorter) and stored after the addition of TRIzol LS. .. RNA was extracted using chloroform phase separation, followed by DNase treatment and further purification using Qiagen RNeasy micro kits (performing washes with 100% ethanol to preserve short RNA sequences).

    Article Title: Melanocortin 2 receptor antagonists in canine pituitary-dependent hypercortisolism: in vitro studies
    Article Snippet: The cortisol/DNA ratios were calculated of four wells per condition, of which the results were averaged prior to statistical analysis. .. After removing the culture medium, the wells for each condition were pooled and RNA was isolated from the cells with the RNeasy Micro Kit (QIAGEN, Venlo, the Netherlands), including the DNase treatment, according to the manufacturer’s instructions. .. RNA concentrations were measured with NanoDrop (ND-1000, Isogen Life Science, Utrecht, the Netherlands), after which cDNA was synthesized from 500 ng total RNA with the iScript™ cDNA Synthesis Kit (Bio-Rad) according to protocol.

    Article Title: Mouse Basophils Reside in Extracellular Matrix-Enriched Bone Marrow Niches Which Control Their Motility
    Article Snippet: The same procedure was applied with respect to type I collagen, fibronectin and laminin. .. Total RNA was isolated from basophil-enriched population (95–98% of cells bearing the phenotype FcεRIαCD49b+ ) derived from IL-3-induced bone marrow cell cultures by using the RNeasy Micro Kit (Qiagen, Courtaboeuf, France) according to the manufacturer's instructions. .. Total RNA concentration and purity were determined using a Nanodrop ND8000 spectrophotometer (Thermo Scientific NanoDrop Products, DE, EUA).

    Article Title: PERT: A Method for Expression Deconvolution of Human Blood Samples from Varied Microenvironmental and Developmental Conditions
    Article Snippet: Lin- cells were cultured as described in . .. Total RNA of the four samples was isolated using RNeasy Micro kit (Qiagen). .. RNA quality was tested on both NanoDrop (ND-1000) and BioAnalyzer machines. cDNA samples were prepared using Ambion IVT kit.

    Article Title: Analysis of FGF-Dependent and FGF-Independent Pathways in Otic Placode Induction
    Article Snippet: Approximately 80 ectoderm samples were used for each replicate, with two replicates being used for each experimental condition. .. Cells lysis was performed using QIAshredder columns (Qiagen) and RNA isolated using the RNeasy Micro kits (Qiagen) according to the manufacturer’s protocols, although the DNAseI step was omitted and an additional RNA cleanup step was employed. .. RNA was amplified and biotinylated using the Two-Cycle cDNA synthesis kit and IVT labeling kit (Affymetrix), before being hybridized with GeneChip Chicken Genome microarrays (Affymetrix).

    Article Title: The Maternal Transcriptome of the Crustacean Parhyale hawaiensis Is Inherited Asymmetrically to Invariant Cell Lineages of the Ectoderm and Mesoderm
    Article Snippet: Paragraph title: Isolation and Purification of Total RNA ... Subsequently, the resuspended RNA was purified using the RNeasy Micro Kit (Qiagen) as described in the manufacturer’s manual and resuspended in 14 µl RNase-free water.

    Article Title: A member of the CPW-WPC protein family is expressed in and localized to the surface of developing ookinetes
    Article Snippet: Multiple sequence alignments of CPW-WPC family members were performed with ClustalW (MegAlign; Lasergene®). .. Total RNA was isolated from in vitro cultured ookinetes using the RNeasy Micro Kit (Qiagen). .. To obtain cDNA, total RNA was subjected to reverse transcription and subsequent PCR using the PrimeScript reagent kit (TAKARA, Japan).

    Article Title: HDAC3-Dependent Epigenetic Pathway Controls Lung Alveolar Epithelial Cell Remodeling and Spreading via miR-17-92 and TGF-β Signaling Regulation
    Article Snippet: All animal work was performed in accordance to the guidance of the University of Pennsylvania Institutional Animal Care and Use Committee. .. For mRNA qPCR, total RNA was isolated from lungs or cells at indicated time points by an RNeasy Mini Kit (Qiagen) or RNeasy Micro Kit (Qiagen). .. First-strand cDNA synthesis was performed using SuperScript III Reverse Transcriptase (Life Technologies). qPCR was performed using the SYBR green system (Applied Biosystems).

    Labeling:

    Article Title: MicroRNA-155 Protects Group 2 Innate Lymphoid Cells From Apoptosis to Promote Type-2 Immunity
    Article Snippet: RNA was extracted using chloroform phase separation, followed by DNase treatment and further purification using Qiagen RNeasy micro kits (performing washes with 100% ethanol to preserve short RNA sequences). .. RNA was extracted using chloroform phase separation, followed by DNase treatment and further purification using Qiagen RNeasy micro kits (performing washes with 100% ethanol to preserve short RNA sequences).

    Article Title: Analysis of Gene Expression Profiling in Meningioma: Deregulated Signaling Pathways Associated with Meningioma and EGFL6 Overexpression in Benign Meningioma Tissue and Serum
    Article Snippet: Total RNA was extracted from 3 brain arachnoidal tissues, 3 fibroblastic meningiomas, and 3 anaplastic meningiomas by using Trizol Reagent (Invitrogen), and then purified with RNeasy Micro kits (Qiagen). .. Total RNA was extracted from 3 brain arachnoidal tissues, 3 fibroblastic meningiomas, and 3 anaplastic meningiomas by using Trizol Reagent (Invitrogen), and then purified with RNeasy Micro kits (Qiagen).

    Purification:

    Article Title: MicroRNA-155 Protects Group 2 Innate Lymphoid Cells From Apoptosis to Promote Type-2 Immunity
    Article Snippet: ILC2 (CD3− CD4− Lin− ICOS+ cells) were isolated from naïve, IL-33 or N. brasiliensis treated mice using fluorescent cell sorting (Sony iCyt Synergy cell sorter) and stored after the addition of TRIzol LS. .. RNA was extracted using chloroform phase separation, followed by DNase treatment and further purification using Qiagen RNeasy micro kits (performing washes with 100% ethanol to preserve short RNA sequences). .. RNA integrity was checked using a RNA6000 Pico Kit on an Agilent 2100 Bioanalyzer.

    Article Title: Analysis of Gene Expression Profiling in Meningioma: Deregulated Signaling Pathways Associated with Meningioma and EGFL6 Overexpression in Benign Meningioma Tissue and Serum
    Article Snippet: Brain arachnoidal tissue was generously supplied by Shanghai Body Donation Center, Shanghai, China. .. Total RNA was extracted from 3 brain arachnoidal tissues, 3 fibroblastic meningiomas, and 3 anaplastic meningiomas by using Trizol Reagent (Invitrogen), and then purified with RNeasy Micro kits (Qiagen). .. RNA quality and yield were assessed on an Agilent Bioanalyzer 2100 (Agilent Technologies).

    Article Title: The Maternal Transcriptome of the Crustacean Parhyale hawaiensis Is Inherited Asymmetrically to Invariant Cell Lineages of the Ectoderm and Mesoderm
    Article Snippet: The RNA pellet was air dried and resuspended in 100 µl DEPC-treated water. .. Subsequently, the resuspended RNA was purified using the RNeasy Micro Kit (Qiagen) as described in the manufacturer’s manual and resuspended in 14 µl RNase-free water. .. RNA concentration was measured on a Nanodrop spectrophotometer.

    Polymerase Chain Reaction:

    Article Title: KLF5 controls glutathione metabolism to suppress p190-BCR-ABL+ B-cell lymphoblastic leukemia
    Article Snippet: For live cell gating analysis, we used 7-aminoactinomycin D (Invitrogen, ThermoFisher Scientific). .. Total mRNA was isolated from ALL cell line cells or p190-BCR-ABL expressing mouse B-cell precursors according to the manufacturer’s protocol (RNeasy Micro Kit, Qiagen Sciences Inc., Germantown, MD). mRNA was reverse-transcribed using TaqMan® Reverse Transcription Reagents (Applied Biosystems, Thermo Fisher Scientific), followed by amplification of cDNA (Taqman Universal PCR master mix, Applied Biosystems). .. Cycle threshold (Ct) values of individual genes were normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and values calculated using the 2−ΔCt method.

    Article Title: Phosphorylated and Non-phosphorylated Leucine Rich Amelogenin Peptide Differentially Affect Ameloblast Mineralization
    Article Snippet: Total RNAs were extracted from cells at D0, D2, and D7, and also at D14 for ALC cells and from tooth germs at D0 and D9 using respectively RNeasy Mini Kits for the cells and RNeasy Micro Kits (Qiagen) for the molars. .. For quantitative PCR, mouse specific primers for Amelx (F: GATGGCTGCACCACCAAATC, R: CTGAAGGGTGTGACTCGGG), Actin (F: GTGGCATCCATGAAACTACAT, R: GGCATAGAGGTCTTTACGG), GAPDH (F: TGTGTCCGTCGTGGATCTGA, R: TTGCTGTTGAAGTCGCAGGAG) were used.

    Article Title: Mouse Basophils Reside in Extracellular Matrix-Enriched Bone Marrow Niches Which Control Their Motility
    Article Snippet: Total RNA was isolated from basophil-enriched population (95–98% of cells bearing the phenotype FcεRIαCD49b+ ) derived from IL-3-induced bone marrow cell cultures by using the RNeasy Micro Kit (Qiagen, Courtaboeuf, France) according to the manufacturer's instructions. .. Total RNA was isolated from basophil-enriched population (95–98% of cells bearing the phenotype FcεRIαCD49b+ ) derived from IL-3-induced bone marrow cell cultures by using the RNeasy Micro Kit (Qiagen, Courtaboeuf, France) according to the manufacturer's instructions.

    Article Title: Rather than by direct acquisition via lateral gene transfer, GHF5 cellulases were passed on from early Pratylenchidae to root-knot and cyst nematodes
    Article Snippet: For this purpose 100 individuals of G. pallida were collected into a 0.2 mL PCR tube containing 25 μL of sterile water and lysed as specified above. .. The lysate was used immediately for the RNA extraction according to RNeasy Micro kit protocol (Qiagen).

    Article Title: A member of the CPW-WPC protein family is expressed in and localized to the surface of developing ookinetes
    Article Snippet: Total RNA was isolated from in vitro cultured ookinetes using the RNeasy Micro Kit (Qiagen). .. To obtain cDNA, total RNA was subjected to reverse transcription and subsequent PCR using the PrimeScript reagent kit (TAKARA, Japan).

    FACS:

    Article Title: MicroRNA-155 Protects Group 2 Innate Lymphoid Cells From Apoptosis to Promote Type-2 Immunity
    Article Snippet: ILC2 (CD3− CD4− Lin− ICOS+ cells) were isolated from naïve, IL-33 or N. brasiliensis treated mice using fluorescent cell sorting (Sony iCyt Synergy cell sorter) and stored after the addition of TRIzol LS. .. RNA was extracted using chloroform phase separation, followed by DNase treatment and further purification using Qiagen RNeasy micro kits (performing washes with 100% ethanol to preserve short RNA sequences).

    Article Title: PERT: A Method for Expression Deconvolution of Human Blood Samples from Varied Microenvironmental and Developmental Conditions
    Article Snippet: CD34− CD33+ CD13+ colony forming unit-monocytes (CFU-M) and CD34− CD41+ CD61+ CD45− megakaryocytes were sorted from pooled fresh human umbilical cord blood samples on BD FACS Aria (CD34: PE; CD33: APC; CD13: PERCP; CD41: PE; CD61: FITC; CD45: APC. .. Total RNA of the four samples was isolated using RNeasy Micro kit (Qiagen).

    Article Title: Eomesodermin of Atlantic Salmon: An Important Regulator of Cytolytic Gene and Interferon Gamma Expression in Spleen Lymphocytes
    Article Snippet: Fluorescence-activated cell sorting was performed based on PI exclusion, forward scatter (FS), and side scatter (SS) using BD FACSAria™ Flow Cytometer (BD Bioscience). .. Total RNA was isolated from 10,000 spleen lymphocytes using the RNeasy Micro Kit (Qiagen, including DNase digestion).

    Lysis:

    Article Title: Analysis of FGF-Dependent and FGF-Independent Pathways in Otic Placode Induction
    Article Snippet: Approximately 80 ectoderm samples were used for each replicate, with two replicates being used for each experimental condition. .. Cells lysis was performed using QIAshredder columns (Qiagen) and RNA isolated using the RNeasy Micro kits (Qiagen) according to the manufacturer’s protocols, although the DNAseI step was omitted and an additional RNA cleanup step was employed. .. RNA was amplified and biotinylated using the Two-Cycle cDNA synthesis kit and IVT labeling kit (Affymetrix), before being hybridized with GeneChip Chicken Genome microarrays (Affymetrix).

    Mouse Assay:

    Article Title: MicroRNA-155 Protects Group 2 Innate Lymphoid Cells From Apoptosis to Promote Type-2 Immunity
    Article Snippet: ILC2 (CD3− CD4− Lin− ICOS+ cells) were isolated from naïve, IL-33 or N. brasiliensis treated mice using fluorescent cell sorting (Sony iCyt Synergy cell sorter) and stored after the addition of TRIzol LS. .. RNA was extracted using chloroform phase separation, followed by DNase treatment and further purification using Qiagen RNeasy micro kits (performing washes with 100% ethanol to preserve short RNA sequences).

    Chromatin Immunoprecipitation:

    Article Title: PERT: A Method for Expression Deconvolution of Human Blood Samples from Varied Microenvironmental and Developmental Conditions
    Article Snippet: Total RNA of the four samples was isolated using RNeasy Micro kit (Qiagen). .. Total RNA of the four samples was isolated using RNeasy Micro kit (Qiagen).

    Article Title: The Maternal Transcriptome of the Crustacean Parhyale hawaiensis Is Inherited Asymmetrically to Invariant Cell Lineages of the Ectoderm and Mesoderm
    Article Snippet: Subsequently, the resuspended RNA was purified using the RNeasy Micro Kit (Qiagen) as described in the manufacturer’s manual and resuspended in 14 µl RNase-free water. .. RNA concentration was measured on a Nanodrop spectrophotometer.

    Software:

    Article Title: Phosphorylated and Non-phosphorylated Leucine Rich Amelogenin Peptide Differentially Affect Ameloblast Mineralization
    Article Snippet: Total RNAs were extracted from cells at D0, D2, and D7, and also at D14 for ALC cells and from tooth germs at D0 and D9 using respectively RNeasy Mini Kits for the cells and RNeasy Micro Kits (Qiagen) for the molars. .. Total RNAs were extracted from cells at D0, D2, and D7, and also at D14 for ALC cells and from tooth germs at D0 and D9 using respectively RNeasy Mini Kits for the cells and RNeasy Micro Kits (Qiagen) for the molars.

    Article Title:
    Article Snippet: Twenty-four hours before RNA extraction using an RNeasy Micro kit (Qiagen, Valencia, CA), all cell lines were grown in Dulbecco’s modified Eagle’s medium/F12 (Invitrogen, Carlsbad, CA). .. Twenty-four hours before RNA extraction using an RNeasy Micro kit (Qiagen, Valencia, CA), all cell lines were grown in Dulbecco’s modified Eagle’s medium/F12 (Invitrogen, Carlsbad, CA).

    Real-time Polymerase Chain Reaction:

    Article Title: Transforming Growth Factor-β and Interleukin-10 Synergistically Regulate Humoral Immunity via Modulating Metabolic Signals
    Article Snippet: Paragraph title: Quantitative Real-Time PCR ... Total RNAs were extracted with RNeasy Micro Kit (Qiagen) and were reverse-transcribed to cDNA with random primers (Invitrogen) and SuperScript III (Invitrogen), as described elsewhere ( ).

    Article Title: Phosphorylated and Non-phosphorylated Leucine Rich Amelogenin Peptide Differentially Affect Ameloblast Mineralization
    Article Snippet: Paragraph title: RNA extraction and quantitative PCR ... Total RNAs were extracted from cells at D0, D2, and D7, and also at D14 for ALC cells and from tooth germs at D0 and D9 using respectively RNeasy Mini Kits for the cells and RNeasy Micro Kits (Qiagen) for the molars.

    Article Title: Nodal induces sequential restriction of germ cell factors during primordial germ cell specification
    Article Snippet: Paragraph title: qPCR analysis ... RNA was extracted from ∼150 embryos in each desired stage by using the RNeasy Micro kit (Qiagen).

    Article Title: Mouse Basophils Reside in Extracellular Matrix-Enriched Bone Marrow Niches Which Control Their Motility
    Article Snippet: Paragraph title: Real Time PCR ... Total RNA was isolated from basophil-enriched population (95–98% of cells bearing the phenotype FcεRIαCD49b+ ) derived from IL-3-induced bone marrow cell cultures by using the RNeasy Micro Kit (Qiagen, Courtaboeuf, France) according to the manufacturer's instructions.

    Article Title: Monocytes from Depressed Patients Display an Altered Pattern of Response to Endotoxin Challenge
    Article Snippet: Paragraph title: mRNA analysis in real time PCR ... Total cytoplasmic RNA was extracted using the RNeasy Micro kit (Qiagen, Hilden, Germany), which included 15 min DNAse treatment.

    Article Title: Genome Wide Analysis of Chromosomal Alterations in Oral Squamous Cell Carcinomas Revealed over Expression of MGAM and ADAM9
    Article Snippet: After histological confirmation those samples that had a tumor cell content greater than 70%, were further cryo-sectioned and were used directly for DNA and RNA extraction from the whole tissue using DNEasy Blood & Tissue Kit (Qiagen, GmBH Germany) and RNeasy micro kit (Qiagen, Hilden, Germany), respectively, according to the manufacturer’s instructions. .. The quality (A260/A280, A260/230) and concentration of the gDNA (ng/µl) was determined using the Nanodrop spectrophotometer ND-2000 (NanoDrop Technologies, Wilmington, DE, USA).

    Article Title: HDAC3-Dependent Epigenetic Pathway Controls Lung Alveolar Epithelial Cell Remodeling and Spreading via miR-17-92 and TGF-β Signaling Regulation
    Article Snippet: All animal work was performed in accordance to the guidance of the University of Pennsylvania Institutional Animal Care and Use Committee. .. For mRNA qPCR, total RNA was isolated from lungs or cells at indicated time points by an RNeasy Mini Kit (Qiagen) or RNeasy Micro Kit (Qiagen). .. First-strand cDNA synthesis was performed using SuperScript III Reverse Transcriptase (Life Technologies). qPCR was performed using the SYBR green system (Applied Biosystems).

    RNA Extraction:

    Article Title: Phosphorylated and Non-phosphorylated Leucine Rich Amelogenin Peptide Differentially Affect Ameloblast Mineralization
    Article Snippet: Paragraph title: RNA extraction and quantitative PCR ... Total RNAs were extracted from cells at D0, D2, and D7, and also at D14 for ALC cells and from tooth germs at D0 and D9 using respectively RNeasy Mini Kits for the cells and RNeasy Micro Kits (Qiagen) for the molars.

    Article Title: Single-cell expression analysis of BMP15 and GDF9 in mature oocytes and BMPR2 in cumulus cells of women with polycystic ovary syndrome undergoing controlled ovarian hyperstimulation
    Article Snippet: Eighteen MII-oocytes and their respective cumulus cells were obtained from 18 patients with PCOS, and 48 MII-oocytes and cumulus cells (CCs) from 35 controls, both subjected to controlled ovarian hyperstimulation (COH), and follicular fluid (FF) was collected from small (10–14 mm) and large ( > 18 mm) follicles. .. RNeasy Micro Kit (Qiagen® ) was used for RNA extraction and gene expression was quantified in each oocyte individually and in microdissected cumulus cells from cumulus-oocyte complexes retrieved from preovulatory follicles using qRT-PCR. .. Chemiluminescence and RIA assays were used for hormone assays.

    Article Title: Genome Wide Analysis of Chromosomal Alterations in Oral Squamous Cell Carcinomas Revealed over Expression of MGAM and ADAM9
    Article Snippet: The fresh snapped frozen tumor tissues were cryo-sectioned and stained with haematoxylin and eosin (H & E) for histological assessment by oral pathologists (TG and RBZ). .. After histological confirmation those samples that had a tumor cell content greater than 70%, were further cryo-sectioned and were used directly for DNA and RNA extraction from the whole tissue using DNEasy Blood & Tissue Kit (Qiagen, GmBH Germany) and RNeasy micro kit (Qiagen, Hilden, Germany), respectively, according to the manufacturer’s instructions. .. The quality (A260/A280, A260/230) and concentration of the gDNA (ng/µl) was determined using the Nanodrop spectrophotometer ND-2000 (NanoDrop Technologies, Wilmington, DE, USA).

    Article Title: Rather than by direct acquisition via lateral gene transfer, GHF5 cellulases were passed on from early Pratylenchidae to root-knot and cyst nematodes
    Article Snippet: For this purpose 100 individuals of G. pallida were collected into a 0.2 mL PCR tube containing 25 μL of sterile water and lysed as specified above. .. The lysate was used immediately for the RNA extraction according to RNeasy Micro kit protocol (Qiagen). .. Total RNA end concentration was approximately 7ng of RNA/μL of water.

    Article Title:
    Article Snippet: All 20 cell lines were grown to 70%–80% confluence. .. Twenty-four hours before RNA extraction using an RNeasy Micro kit (Qiagen, Valencia, CA), all cell lines were grown in Dulbecco’s modified Eagle’s medium/F12 (Invitrogen, Carlsbad, CA). .. The RNA was prepared and profiled as previously mentioned in the section entitled Validation of the 45 MDR-linked Genes as a Prognostic Signature for Poor Overall Survival .

    In Vitro:

    Article Title: A member of the CPW-WPC protein family is expressed in and localized to the surface of developing ookinetes
    Article Snippet: Multiple sequence alignments of CPW-WPC family members were performed with ClustalW (MegAlign; Lasergene®). .. Total RNA was isolated from in vitro cultured ookinetes using the RNeasy Micro Kit (Qiagen). .. To obtain cDNA, total RNA was subjected to reverse transcription and subsequent PCR using the PrimeScript reagent kit (TAKARA, Japan).

    Incubation:

    Article Title: Gene expression of CCL8 and CXCL10 in peripheral blood leukocytes during early pregnancy in cows
    Article Snippet: Cultured leukocytes were further incubated in this medium with recombinant proteins as follows: bovine IFNT (100 ng/mL: 1.1 × 105 units/mg, generated from HEK293 cells as described previously [ ]) or recombinant human CCL16 (100 ng/mL: #TP723266, OriGene Technologies, Inc., Rockville, MD, USA). .. Total RNA from PBLs was extracted using an RNeasy Micro Kit (#74004, QIAGEN) in accordance with the manufacturer’s protocols, and used for the subsequent gene expression analysis.

    Staining:

    Article Title: Eomesodermin of Atlantic Salmon: An Important Regulator of Cytolytic Gene and Interferon Gamma Expression in Spleen Lymphocytes
    Article Snippet: Following treatment of spleen leukocytes at different time intervals, propidium iodide, (PI) (50 µg/ml) was added to each 1 ml cell suspension to stain dead cells. .. Total RNA was isolated from 10,000 spleen lymphocytes using the RNeasy Micro Kit (Qiagen, including DNase digestion).

    Article Title: Genome Wide Analysis of Chromosomal Alterations in Oral Squamous Cell Carcinomas Revealed over Expression of MGAM and ADAM9
    Article Snippet: The fresh snapped frozen tumor tissues were cryo-sectioned and stained with haematoxylin and eosin (H & E) for histological assessment by oral pathologists (TG and RBZ). .. After histological confirmation those samples that had a tumor cell content greater than 70%, were further cryo-sectioned and were used directly for DNA and RNA extraction from the whole tissue using DNEasy Blood & Tissue Kit (Qiagen, GmBH Germany) and RNeasy micro kit (Qiagen, Hilden, Germany), respectively, according to the manufacturer’s instructions.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Qiagen rneasy mini kit
    Chemerin and IL-1β co-incubation; synergistic increase in cell adhesion molecule expression Serum starved <t>HMEC-1</t> cells were treated with chemerin (3nM) with or without IL-1β (10ng/ml) for 12 hours. ( A ) Representative western blots of E-selectin, VCAM-1 and ICAM-1 and their respective β-actin. ( B-D ) Densitometric analysis of western blots (cell protein lysates) of E-selectin, VCAM-1 and ICAM-1 immune complexes having normalized to β-actin, respectively, showed that protein expression of cell adhesion molecules, i.e. E-selectin, VCAM-1 and ICAM-1, were synergistically increased when compared to chemerin or IL-1β, alone (Figures 5A-5D: *** P
    Rneasy Mini Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rneasy mini kit/product/Qiagen
    Average 99 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    rneasy mini kit - by Bioz Stars, 2019-09
    99/100 stars
      Buy from Supplier

    78
    Qiagen flsirna
    Effect of iron, iron chelation, FHsiRNA, and <t>FLsiRNA</t> on VEGF accumulation in LEC conditioned medium. LECs were transfected, and 4 days after transfection, VEGF was measured in the CCM. In a parallel set of experiments, nontransfected cells (LECs) were
    Flsirna, supplied by Qiagen, used in various techniques. Bioz Stars score: 78/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/flsirna/product/Qiagen
    Average 78 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    flsirna - by Bioz Stars, 2019-09
    78/100 stars
      Buy from Supplier

    79
    Qiagen vehicle injected eiu rat eyes
    Ionized calcium-binding adaptor molecule 1 immunostaining on flatmounted retinas. A – B : Example of flatmounted retinas from rat eyes with endotoxin-induced uveitis <t>(EIU)</t> injected with vehicle ( A ) or with antivascular endothelial growth factor <t>(VEGF)</t> antibodies ( B ); Bar = 50 µm. Arrowhead show round reactive ionized calcium-binding adaptor molecule 1 (IBA1)-positive cells. C – D : Extraction of cell contours used for automatic labeling of IBA1 staining. E - F : Quantification of round and total IBA-1 positive cells on flat-mounted retina from EIU control and anti-VEGF treated eyes. Bar = 50 µm.
    Vehicle Injected Eiu Rat Eyes, supplied by Qiagen, used in various techniques. Bioz Stars score: 79/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/vehicle injected eiu rat eyes/product/Qiagen
    Average 79 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    vehicle injected eiu rat eyes - by Bioz Stars, 2019-09
    79/100 stars
      Buy from Supplier

    Image Search Results


    Chemerin and IL-1β co-incubation; synergistic increase in cell adhesion molecule expression Serum starved HMEC-1 cells were treated with chemerin (3nM) with or without IL-1β (10ng/ml) for 12 hours. ( A ) Representative western blots of E-selectin, VCAM-1 and ICAM-1 and their respective β-actin. ( B-D ) Densitometric analysis of western blots (cell protein lysates) of E-selectin, VCAM-1 and ICAM-1 immune complexes having normalized to β-actin, respectively, showed that protein expression of cell adhesion molecules, i.e. E-selectin, VCAM-1 and ICAM-1, were synergistically increased when compared to chemerin or IL-1β, alone (Figures 5A-5D: *** P

    Journal: Oncotarget

    Article Title: Chemerin induces endothelial cell inflammation: activation of nuclear factor-kappa beta and monocyte-endothelial adhesion

    doi: 10.18632/oncotarget.24659

    Figure Lengend Snippet: Chemerin and IL-1β co-incubation; synergistic increase in cell adhesion molecule expression Serum starved HMEC-1 cells were treated with chemerin (3nM) with or without IL-1β (10ng/ml) for 12 hours. ( A ) Representative western blots of E-selectin, VCAM-1 and ICAM-1 and their respective β-actin. ( B-D ) Densitometric analysis of western blots (cell protein lysates) of E-selectin, VCAM-1 and ICAM-1 immune complexes having normalized to β-actin, respectively, showed that protein expression of cell adhesion molecules, i.e. E-selectin, VCAM-1 and ICAM-1, were synergistically increased when compared to chemerin or IL-1β, alone (Figures 5A-5D: *** P

    Article Snippet: Total RNA was extracted from HMEC-1 cells Qiagen RNeasy Mini Kit according to the manufacturer's guidelines (Qiagen, Crawley, UK).

    Techniques: Incubation, Expressing, Western Blot

    Chemerin increases endothelial cell adhesion molecules mRNA expression in HMEC-1 cells Serum starved HMEC-1 cells were treated with chemerin (0-10nM) for 4 hours. Real-time quantitative RT-PCR analyses showed that mRNA expression of cell adhesion molecules, i.e. E-selectin, VCAM-1 and ICAM-1, were significantly up-regulated by chemerin in a concentration dependent manner at 4 hours (Figures 2A-2C : *** P

    Journal: Oncotarget

    Article Title: Chemerin induces endothelial cell inflammation: activation of nuclear factor-kappa beta and monocyte-endothelial adhesion

    doi: 10.18632/oncotarget.24659

    Figure Lengend Snippet: Chemerin increases endothelial cell adhesion molecules mRNA expression in HMEC-1 cells Serum starved HMEC-1 cells were treated with chemerin (0-10nM) for 4 hours. Real-time quantitative RT-PCR analyses showed that mRNA expression of cell adhesion molecules, i.e. E-selectin, VCAM-1 and ICAM-1, were significantly up-regulated by chemerin in a concentration dependent manner at 4 hours (Figures 2A-2C : *** P

    Article Snippet: Total RNA was extracted from HMEC-1 cells Qiagen RNeasy Mini Kit according to the manufacturer's guidelines (Qiagen, Crawley, UK).

    Techniques: Expressing, Quantitative RT-PCR, Concentration Assay

    Chemerin increases endothelial cell adhesion molecules protein expression in HMEC-1 cells Serum starved HMEC-1 cells were treated with chemerin (0-10nM) for 12 and 24 hours. Densitometric analysis of western blots (cell protein lysates) of E-selectin, VCAM-1 and ICAM-1 immune complexes having normalized to β-actin, respectively, showed that protein expression of cell adhesion molecules, i.e. E-selectin, VCAM-1 and ICAM-1, were significantly increased by chemerin in a concentration dependent manner at 12 hours (Figures 3A-3C : * P

    Journal: Oncotarget

    Article Title: Chemerin induces endothelial cell inflammation: activation of nuclear factor-kappa beta and monocyte-endothelial adhesion

    doi: 10.18632/oncotarget.24659

    Figure Lengend Snippet: Chemerin increases endothelial cell adhesion molecules protein expression in HMEC-1 cells Serum starved HMEC-1 cells were treated with chemerin (0-10nM) for 12 and 24 hours. Densitometric analysis of western blots (cell protein lysates) of E-selectin, VCAM-1 and ICAM-1 immune complexes having normalized to β-actin, respectively, showed that protein expression of cell adhesion molecules, i.e. E-selectin, VCAM-1 and ICAM-1, were significantly increased by chemerin in a concentration dependent manner at 12 hours (Figures 3A-3C : * P

    Article Snippet: Total RNA was extracted from HMEC-1 cells Qiagen RNeasy Mini Kit according to the manufacturer's guidelines (Qiagen, Crawley, UK).

    Techniques: Expressing, Western Blot, Concentration Assay

    Chemerin increases endothelial cell adhesion molecules protein secretion in HMEC-1 cells Serum starved HMEC-1 cells were treated with chemerin (0-10nM) for 12 hours. Densitometric analysis of western blots (conditioned media) of E-selectin, VCAM-1 and ICAM-1 immune complexes having normalized to β-actin, respectively, showed that secretion of cell adhesion molecules, i.e. E-selectin, VCAM-1 and ICAM-1, were significantly elevated by chemerin in a concentration dependent manner at 12 hours (Figures 4A-4C : * P

    Journal: Oncotarget

    Article Title: Chemerin induces endothelial cell inflammation: activation of nuclear factor-kappa beta and monocyte-endothelial adhesion

    doi: 10.18632/oncotarget.24659

    Figure Lengend Snippet: Chemerin increases endothelial cell adhesion molecules protein secretion in HMEC-1 cells Serum starved HMEC-1 cells were treated with chemerin (0-10nM) for 12 hours. Densitometric analysis of western blots (conditioned media) of E-selectin, VCAM-1 and ICAM-1 immune complexes having normalized to β-actin, respectively, showed that secretion of cell adhesion molecules, i.e. E-selectin, VCAM-1 and ICAM-1, were significantly elevated by chemerin in a concentration dependent manner at 12 hours (Figures 4A-4C : * P

    Article Snippet: Total RNA was extracted from HMEC-1 cells Qiagen RNeasy Mini Kit according to the manufacturer's guidelines (Qiagen, Crawley, UK).

    Techniques: Western Blot, Concentration Assay

    Chemerin stimulates monocyte-endothelial cell adhesion via NF-ĸB, MAPK and PI3K/Akt pathways Serum starved chemerin (0-10nM) treated HMEC-1 cells were co-cultured with THP-1 cells for 2 hours. Chemerin enhanced monocyte-endothelial adhesion in a concentration dependent fashion (Figure 6A : * P

    Journal: Oncotarget

    Article Title: Chemerin induces endothelial cell inflammation: activation of nuclear factor-kappa beta and monocyte-endothelial adhesion

    doi: 10.18632/oncotarget.24659

    Figure Lengend Snippet: Chemerin stimulates monocyte-endothelial cell adhesion via NF-ĸB, MAPK and PI3K/Akt pathways Serum starved chemerin (0-10nM) treated HMEC-1 cells were co-cultured with THP-1 cells for 2 hours. Chemerin enhanced monocyte-endothelial adhesion in a concentration dependent fashion (Figure 6A : * P

    Article Snippet: Total RNA was extracted from HMEC-1 cells Qiagen RNeasy Mini Kit according to the manufacturer's guidelines (Qiagen, Crawley, UK).

    Techniques: Cell Culture, Concentration Assay

    Chemerin activates NF-кB in HMEC-1 cells via MAPK and PI3K/Akt pathways; synergistic activation with IL-1β pathways Serum starved HMEC-1 cells stably transfected with pNFкB-Luciferase were treated with or without chemerin (0-10nM) for 2 hours. Cells were lysed and luciferase activities were measured. Chemerin induced a concentration dependent increase in luciferase activity after 2 hours of incubation ( ** P

    Journal: Oncotarget

    Article Title: Chemerin induces endothelial cell inflammation: activation of nuclear factor-kappa beta and monocyte-endothelial adhesion

    doi: 10.18632/oncotarget.24659

    Figure Lengend Snippet: Chemerin activates NF-кB in HMEC-1 cells via MAPK and PI3K/Akt pathways; synergistic activation with IL-1β pathways Serum starved HMEC-1 cells stably transfected with pNFкB-Luciferase were treated with or without chemerin (0-10nM) for 2 hours. Cells were lysed and luciferase activities were measured. Chemerin induced a concentration dependent increase in luciferase activity after 2 hours of incubation ( ** P

    Article Snippet: Total RNA was extracted from HMEC-1 cells Qiagen RNeasy Mini Kit according to the manufacturer's guidelines (Qiagen, Crawley, UK).

    Techniques: Activation Assay, Stable Transfection, Transfection, Luciferase, Concentration Assay, Activity Assay, Incubation

    Stimulation of an IFN-mediated antiviral response in human transformed or tumor cells upon Poly(I:C) transfection. ( A ) HEK293, HEK293T, NB324K and Hela cultures were transfected with 2 µg/ml of synthetic dsRNA Poly(I:C) (pI:C) or a 150 mM NaCl solution as control, using lipofectamine 2000 for the period indicated in the figure. The respective culture media were then collected, centrifuged to discard cellular debris, and analyzed by Enzyme-linked Immuno-Sorbent Assay (ELISA) for their content in human IFN-β. Each result is represented as mean+standard deviation of three independent experiments. ( B ) Expression of IFN-α and IFN-β transcripts in mock-treated or pI:C-transfected human cell lines was assessed by RT-PCRs. At the indicated time points, total RNAs were extracted from the respective cultures using the RNeasy kit. One µg of RNA was then treated by DNase I in order to remove potential contaminating DNA and reverse transcribed into cDNA. A fraction of the obtained cDNA (1/10) was then analyzed by PCR for its content in type-I IFN transcripts using specific primer pairs. Transcripts encoding the Human 18S ribosomal protein were used as internal loading controls. Data shown are representative of 3 experiments which gave similar results. ( C ) Assessment of the IFN-signaling (Jak/STAT) pathway activation in HEK293, HEK293T, NB324K and Hela cells upon pI:C transfection. At the time indicated mock-treated or pI:C-transfected (2 µg/ml) cultures were harvested by scraping in PBS and centrifuged. Cell pellets were then re-suspended in complete Ripa buffer supplemented with phosphatase and protease inhibitors. Total proteins were extracted from each sample as described in Materials and Methods . Fifty µg total proteins per sample were then subjected to bipartite 8/10% SDS-PAGE, transferred onto membranes, and probed with antibodies specific for phosphorylated and total isoforms of STAT 1 and STAT 2 as well as with an antibody specific to PKR. Actin was used as an internal loading control. Each presented blot is representative of 3 additional which gave similar results.

    Journal: PLoS ONE

    Article Title: TLR-9 Contributes to the Antiviral Innate Immune Sensing of Rodent Parvoviruses MVMp and H-1PV by Normal Human Immune Cells

    doi: 10.1371/journal.pone.0055086

    Figure Lengend Snippet: Stimulation of an IFN-mediated antiviral response in human transformed or tumor cells upon Poly(I:C) transfection. ( A ) HEK293, HEK293T, NB324K and Hela cultures were transfected with 2 µg/ml of synthetic dsRNA Poly(I:C) (pI:C) or a 150 mM NaCl solution as control, using lipofectamine 2000 for the period indicated in the figure. The respective culture media were then collected, centrifuged to discard cellular debris, and analyzed by Enzyme-linked Immuno-Sorbent Assay (ELISA) for their content in human IFN-β. Each result is represented as mean+standard deviation of three independent experiments. ( B ) Expression of IFN-α and IFN-β transcripts in mock-treated or pI:C-transfected human cell lines was assessed by RT-PCRs. At the indicated time points, total RNAs were extracted from the respective cultures using the RNeasy kit. One µg of RNA was then treated by DNase I in order to remove potential contaminating DNA and reverse transcribed into cDNA. A fraction of the obtained cDNA (1/10) was then analyzed by PCR for its content in type-I IFN transcripts using specific primer pairs. Transcripts encoding the Human 18S ribosomal protein were used as internal loading controls. Data shown are representative of 3 experiments which gave similar results. ( C ) Assessment of the IFN-signaling (Jak/STAT) pathway activation in HEK293, HEK293T, NB324K and Hela cells upon pI:C transfection. At the time indicated mock-treated or pI:C-transfected (2 µg/ml) cultures were harvested by scraping in PBS and centrifuged. Cell pellets were then re-suspended in complete Ripa buffer supplemented with phosphatase and protease inhibitors. Total proteins were extracted from each sample as described in Materials and Methods . Fifty µg total proteins per sample were then subjected to bipartite 8/10% SDS-PAGE, transferred onto membranes, and probed with antibodies specific for phosphorylated and total isoforms of STAT 1 and STAT 2 as well as with an antibody specific to PKR. Actin was used as an internal loading control. Each presented blot is representative of 3 additional which gave similar results.

    Article Snippet: Briefly, Total RNAs of mock-treated, parvovirus- or NDV-infected, and/or PolyI:C transfected cells were isolated using an RNeasy mini kit (QIAGEN, Hilden, Germany) according to the manufacturer's instructions.

    Techniques: Transformation Assay, Transfection, Enzyme-linked Immunosorbent Assay, Standard Deviation, Expressing, Polymerase Chain Reaction, Activation Assay, SDS Page

    Time-dependent transcriptional up-regulation of type-I IFN encoding mRNAs in MVMp- or H-1PV-infected human cell lines. ( A ) HEK293 and HEK293T, ( B ) NB324K and ( C ) Hela cells were mock-treated for 24 hrs, infected with parvoviruses (5 PFUs/cell) for the indicated times, or infected with NDV (6 HU/10 6 cells) or transfected with pI:C (2 µg/ml) for 15 hrs. At the indicated times, cells were harvested and total RNAs were extracted using the RNeasy kit. One µg was then reverse transcribed into cDNA and 10% of this product was subjected to PCR reactions using sets of primers specific to each indicated cytokine mRNA or viral transcripts. PCR product of 18S ribosomal RNA was used as housekeeping gene to normalize loading. No signal was detected in the samples when omitting the reverse transcriptase. Presented data are representative of 3 experiments which all gave similar results.

    Journal: PLoS ONE

    Article Title: TLR-9 Contributes to the Antiviral Innate Immune Sensing of Rodent Parvoviruses MVMp and H-1PV by Normal Human Immune Cells

    doi: 10.1371/journal.pone.0055086

    Figure Lengend Snippet: Time-dependent transcriptional up-regulation of type-I IFN encoding mRNAs in MVMp- or H-1PV-infected human cell lines. ( A ) HEK293 and HEK293T, ( B ) NB324K and ( C ) Hela cells were mock-treated for 24 hrs, infected with parvoviruses (5 PFUs/cell) for the indicated times, or infected with NDV (6 HU/10 6 cells) or transfected with pI:C (2 µg/ml) for 15 hrs. At the indicated times, cells were harvested and total RNAs were extracted using the RNeasy kit. One µg was then reverse transcribed into cDNA and 10% of this product was subjected to PCR reactions using sets of primers specific to each indicated cytokine mRNA or viral transcripts. PCR product of 18S ribosomal RNA was used as housekeeping gene to normalize loading. No signal was detected in the samples when omitting the reverse transcriptase. Presented data are representative of 3 experiments which all gave similar results.

    Article Snippet: Briefly, Total RNAs of mock-treated, parvovirus- or NDV-infected, and/or PolyI:C transfected cells were isolated using an RNeasy mini kit (QIAGEN, Hilden, Germany) according to the manufacturer's instructions.

    Techniques: Infection, Transfection, Polymerase Chain Reaction

    Activation of both IFN-producing and IFN-signaling pathways in hPBMCs upon parvovirus infection and comparison of their intensity to that triggered by NDV. ( A , B and D ) hPBMCs collected from the blood of healthy donors were distributed into 6-well plates at 1×10 7 cells/5 ml culture medium/well. They were then mock-treated or infected with MVMp or H-1PV at 20 PFUs/cell or with NDV (6 HU/10 6 cells). Cultures were harvested in PBS and centrifuged at the time p.i. indicated in each figure. ( A , D ) One half of each pellet was resuspended in Ripa buffer supplemented with phosphatase and protease inhibitors in order to perform Western blot experiments whereas ( B ) total RNAs were extracted from the rest of each cell pellet using the RNeasy kit. ( A , D ) Total proteins were extracted from each sample as described in Materials and Methods . Seventy µg total proteins per sample were then subjected to 10% SDS-PAGE, transferred onto membranes, and probed with antibodies specific for total and phosphorylated STAT 2 and STAT 1 polypeptides as well as for PKR. Actin was used as an internal loading control. Each presented blot is representative of 4 additional which gave similar results. ( B ). One µg of isolated total RNA was then reverse transcribed into cDNA and 10% of this product was subjected to PCR reactions using sets of primers specific to each indicated mRNA. PCR product of 18S ribosomal RNA was used as housekeeping gene to normalize loading. No signal was detected in the samples when omitting the reverse transcriptase. Presented data are representative of 4 experiments which all gave similar results. ( C ) hPBMCs collected from the blood of healthy donors were distributed into 24-well plates at 1×10 6 cells/500 µl culture medium/well. They were then mock-treated or infected with MVMp, H-1PV (20 PFUs/cell) or NDV (6 HU/10 6 cells). After a period of incubation of 24 hrs media were collected, centrifuged in order to discard cellular debris and analyzed by Enzyme-linked Immuno-Sorbent Assay (ELISA) for their content in IFN-α and IFN-β. Results are expressed as means+standard deviations of seven independent experiments.

    Journal: PLoS ONE

    Article Title: TLR-9 Contributes to the Antiviral Innate Immune Sensing of Rodent Parvoviruses MVMp and H-1PV by Normal Human Immune Cells

    doi: 10.1371/journal.pone.0055086

    Figure Lengend Snippet: Activation of both IFN-producing and IFN-signaling pathways in hPBMCs upon parvovirus infection and comparison of their intensity to that triggered by NDV. ( A , B and D ) hPBMCs collected from the blood of healthy donors were distributed into 6-well plates at 1×10 7 cells/5 ml culture medium/well. They were then mock-treated or infected with MVMp or H-1PV at 20 PFUs/cell or with NDV (6 HU/10 6 cells). Cultures were harvested in PBS and centrifuged at the time p.i. indicated in each figure. ( A , D ) One half of each pellet was resuspended in Ripa buffer supplemented with phosphatase and protease inhibitors in order to perform Western blot experiments whereas ( B ) total RNAs were extracted from the rest of each cell pellet using the RNeasy kit. ( A , D ) Total proteins were extracted from each sample as described in Materials and Methods . Seventy µg total proteins per sample were then subjected to 10% SDS-PAGE, transferred onto membranes, and probed with antibodies specific for total and phosphorylated STAT 2 and STAT 1 polypeptides as well as for PKR. Actin was used as an internal loading control. Each presented blot is representative of 4 additional which gave similar results. ( B ). One µg of isolated total RNA was then reverse transcribed into cDNA and 10% of this product was subjected to PCR reactions using sets of primers specific to each indicated mRNA. PCR product of 18S ribosomal RNA was used as housekeeping gene to normalize loading. No signal was detected in the samples when omitting the reverse transcriptase. Presented data are representative of 4 experiments which all gave similar results. ( C ) hPBMCs collected from the blood of healthy donors were distributed into 24-well plates at 1×10 6 cells/500 µl culture medium/well. They were then mock-treated or infected with MVMp, H-1PV (20 PFUs/cell) or NDV (6 HU/10 6 cells). After a period of incubation of 24 hrs media were collected, centrifuged in order to discard cellular debris and analyzed by Enzyme-linked Immuno-Sorbent Assay (ELISA) for their content in IFN-α and IFN-β. Results are expressed as means+standard deviations of seven independent experiments.

    Article Snippet: Briefly, Total RNAs of mock-treated, parvovirus- or NDV-infected, and/or PolyI:C transfected cells were isolated using an RNeasy mini kit (QIAGEN, Hilden, Germany) according to the manufacturer's instructions.

    Techniques: Activation Assay, Infection, Western Blot, SDS Page, Isolation, Polymerase Chain Reaction, Incubation, Enzyme-linked Immunosorbent Assay

    Activation of a TLR-9 dependent production of type-I IFNs in parvovirus-infected human Namalwa cells. The cells (1.10 6 cells/well of a 24-well plate) were either infected with MVMp or H-1PV (∼80 PFUs/cell equivalent to 1×10 4 virus genomes/cell), stimulated with the TLR-9 agonist ODN 2395 at 1 µM, or mock-treated. ( A ) At the indicated time points culture supernatants were collected from the respective wells and used to determine the quantity of type-I IFNs released in the culture medium by ELISA experiments. Results are expressed as means+standard deviations of three independent experiments. ( B ) Mock-treated, parvovirus-infected or ODN stimulated Namalwa cells were harvested at the indicated time points and total RNAs were extracted using the RNeasy kit as described previously in Figure 1 . Total RNAs extracted from parvovirus-infected (24 hrs p.i. at 80 PFUs/cell) or pI:C-transfected (15 hrs post-transfection with 2 µg dsRNA/ml) NB324K cells were used as positive or negative controls. Presented data are representative of 3 experiments which all gave similar results. ( C ) Total DNA was harvested at the indicated time points from parvovirus-infected (MOI of 80 PFUs/cell) or mock-treated Namalwa or HEK293T cultures to assess by Southern blot experiments as described in Figure 2 the replication of both parvoviruses (dRF, dimmer replicative form; mRF, monomeric replicative form; ssDNA, single-stranded DNA genome). The blot shown is representative of 3 experiments which gave similar results. ( D ) Cell pellets from mock-treated or parvovirus-infected Namalwa cultures were re-suspended in complete Ripa buffer and Western blotting was performed as described in Figure 6 . Actin was used as an internal loading control. Each presented blot is representative of 3 experiments which gave similar results.

    Journal: PLoS ONE

    Article Title: TLR-9 Contributes to the Antiviral Innate Immune Sensing of Rodent Parvoviruses MVMp and H-1PV by Normal Human Immune Cells

    doi: 10.1371/journal.pone.0055086

    Figure Lengend Snippet: Activation of a TLR-9 dependent production of type-I IFNs in parvovirus-infected human Namalwa cells. The cells (1.10 6 cells/well of a 24-well plate) were either infected with MVMp or H-1PV (∼80 PFUs/cell equivalent to 1×10 4 virus genomes/cell), stimulated with the TLR-9 agonist ODN 2395 at 1 µM, or mock-treated. ( A ) At the indicated time points culture supernatants were collected from the respective wells and used to determine the quantity of type-I IFNs released in the culture medium by ELISA experiments. Results are expressed as means+standard deviations of three independent experiments. ( B ) Mock-treated, parvovirus-infected or ODN stimulated Namalwa cells were harvested at the indicated time points and total RNAs were extracted using the RNeasy kit as described previously in Figure 1 . Total RNAs extracted from parvovirus-infected (24 hrs p.i. at 80 PFUs/cell) or pI:C-transfected (15 hrs post-transfection with 2 µg dsRNA/ml) NB324K cells were used as positive or negative controls. Presented data are representative of 3 experiments which all gave similar results. ( C ) Total DNA was harvested at the indicated time points from parvovirus-infected (MOI of 80 PFUs/cell) or mock-treated Namalwa or HEK293T cultures to assess by Southern blot experiments as described in Figure 2 the replication of both parvoviruses (dRF, dimmer replicative form; mRF, monomeric replicative form; ssDNA, single-stranded DNA genome). The blot shown is representative of 3 experiments which gave similar results. ( D ) Cell pellets from mock-treated or parvovirus-infected Namalwa cultures were re-suspended in complete Ripa buffer and Western blotting was performed as described in Figure 6 . Actin was used as an internal loading control. Each presented blot is representative of 3 experiments which gave similar results.

    Article Snippet: Briefly, Total RNAs of mock-treated, parvovirus- or NDV-infected, and/or PolyI:C transfected cells were isolated using an RNeasy mini kit (QIAGEN, Hilden, Germany) according to the manufacturer's instructions.

    Techniques: Activation Assay, Infection, Enzyme-linked Immunosorbent Assay, Transfection, Southern Blot, Western Blot

    Effect of iron, iron chelation, FHsiRNA, and FLsiRNA on VEGF accumulation in LEC conditioned medium. LECs were transfected, and 4 days after transfection, VEGF was measured in the CCM. In a parallel set of experiments, nontransfected cells (LECs) were

    Journal:

    Article Title: Altered Ferritin Subunit Composition: Change in Iron Metabolism in Lens Epithelial Cells and Downstream Effects on Glutathione Levels and VEGF Secretion

    doi: 10.1167/iovs.09-3861

    Figure Lengend Snippet: Effect of iron, iron chelation, FHsiRNA, and FLsiRNA on VEGF accumulation in LEC conditioned medium. LECs were transfected, and 4 days after transfection, VEGF was measured in the CCM. In a parallel set of experiments, nontransfected cells (LECs) were

    Article Snippet: Total RNA was extracted from cultured LECs, 24 hours after transfection with CTL, FH, or FLsiRNA (RNeasy kit and Qiashredders; Qiagen, Valencia CA) according to the manufacturer's protocol.

    Techniques: Transfection

    Ferritin chain degradation after siRNA knockdown. Twenty-four hours after transfection with a control nontargeting siRNA, FHsiRNA, or FLsiRNA, LECs were incubated for 18 hours with 60 μCi translabel 35 S-methionine. After the labeling period, the

    Journal:

    Article Title: Altered Ferritin Subunit Composition: Change in Iron Metabolism in Lens Epithelial Cells and Downstream Effects on Glutathione Levels and VEGF Secretion

    doi: 10.1167/iovs.09-3861

    Figure Lengend Snippet: Ferritin chain degradation after siRNA knockdown. Twenty-four hours after transfection with a control nontargeting siRNA, FHsiRNA, or FLsiRNA, LECs were incubated for 18 hours with 60 μCi translabel 35 S-methionine. After the labeling period, the

    Article Snippet: Total RNA was extracted from cultured LECs, 24 hours after transfection with CTL, FH, or FLsiRNA (RNeasy kit and Qiashredders; Qiagen, Valencia CA) according to the manufacturer's protocol.

    Techniques: Transfection, Incubation, Labeling

    Transfection with FH- or FLsiRNA altered the levels of ferritin chains as determined by immunolocalization. The cells were transfected with control nontargeting siRNA ( A , D , G , J ), FHsiRNA ( B , E , H , K , M – O ), or FLsiRNA ( C , F , I , L ) and immunolabeled

    Journal:

    Article Title: Altered Ferritin Subunit Composition: Change in Iron Metabolism in Lens Epithelial Cells and Downstream Effects on Glutathione Levels and VEGF Secretion

    doi: 10.1167/iovs.09-3861

    Figure Lengend Snippet: Transfection with FH- or FLsiRNA altered the levels of ferritin chains as determined by immunolocalization. The cells were transfected with control nontargeting siRNA ( A , D , G , J ), FHsiRNA ( B , E , H , K , M – O ), or FLsiRNA ( C , F , I , L ) and immunolabeled

    Article Snippet: Total RNA was extracted from cultured LECs, 24 hours after transfection with CTL, FH, or FLsiRNA (RNeasy kit and Qiashredders; Qiagen, Valencia CA) according to the manufacturer's protocol.

    Techniques: Transfection, Immunolabeling

    Effect of H- and L-chain siRNA on de novo ferritin subunit synthesis in LECs. ( A , B ) LECs were seeded in six-well plates, then transfected with nontargeting control or FH- or FLsiRNA. Two and 4 days later, the cells were incubated with 35 S-methionine

    Journal:

    Article Title: Altered Ferritin Subunit Composition: Change in Iron Metabolism in Lens Epithelial Cells and Downstream Effects on Glutathione Levels and VEGF Secretion

    doi: 10.1167/iovs.09-3861

    Figure Lengend Snippet: Effect of H- and L-chain siRNA on de novo ferritin subunit synthesis in LECs. ( A , B ) LECs were seeded in six-well plates, then transfected with nontargeting control or FH- or FLsiRNA. Two and 4 days later, the cells were incubated with 35 S-methionine

    Article Snippet: Total RNA was extracted from cultured LECs, 24 hours after transfection with CTL, FH, or FLsiRNA (RNeasy kit and Qiashredders; Qiagen, Valencia CA) according to the manufacturer's protocol.

    Techniques: Transfection, Incubation

    The effect of FH and FLsiRNA on FH and FL mRNA in cultured LECs. Total RNA was extracted from cultured LECs differentially transfected with siRNAs designed to suppress FH- or FLsiRNA expression or with nontargeting Ctl siRNA. Changes in the expression

    Journal:

    Article Title: Altered Ferritin Subunit Composition: Change in Iron Metabolism in Lens Epithelial Cells and Downstream Effects on Glutathione Levels and VEGF Secretion

    doi: 10.1167/iovs.09-3861

    Figure Lengend Snippet: The effect of FH and FLsiRNA on FH and FL mRNA in cultured LECs. Total RNA was extracted from cultured LECs differentially transfected with siRNAs designed to suppress FH- or FLsiRNA expression or with nontargeting Ctl siRNA. Changes in the expression

    Article Snippet: Total RNA was extracted from cultured LECs, 24 hours after transfection with CTL, FH, or FLsiRNA (RNeasy kit and Qiashredders; Qiagen, Valencia CA) according to the manufacturer's protocol.

    Techniques: Cell Culture, Transfection, Expressing, CTL Assay

    Effect of siRNA knockdown of ferritin H- and L-chain on transferrin receptor and iron uptake in LECs. ( A ) TfR Western blot. Twenty-four hours after transfection with a nontargeting control, FHsiRNA, or FLsiRNA, the cells were rinsed and incubated in serum-free

    Journal:

    Article Title: Altered Ferritin Subunit Composition: Change in Iron Metabolism in Lens Epithelial Cells and Downstream Effects on Glutathione Levels and VEGF Secretion

    doi: 10.1167/iovs.09-3861

    Figure Lengend Snippet: Effect of siRNA knockdown of ferritin H- and L-chain on transferrin receptor and iron uptake in LECs. ( A ) TfR Western blot. Twenty-four hours after transfection with a nontargeting control, FHsiRNA, or FLsiRNA, the cells were rinsed and incubated in serum-free

    Article Snippet: Total RNA was extracted from cultured LECs, 24 hours after transfection with CTL, FH, or FLsiRNA (RNeasy kit and Qiashredders; Qiagen, Valencia CA) according to the manufacturer's protocol.

    Techniques: Western Blot, Transfection, Incubation

    Effect of ferritin H- and L-chain siRNA on cystine uptake and GSH concentration 4 days after transfection. LECs were transfected with either nontargeting control, FHsiRNA, or FLsiRNA, lysed, and intracellular GSH measured in the lysates. In a parallel

    Journal:

    Article Title: Altered Ferritin Subunit Composition: Change in Iron Metabolism in Lens Epithelial Cells and Downstream Effects on Glutathione Levels and VEGF Secretion

    doi: 10.1167/iovs.09-3861

    Figure Lengend Snippet: Effect of ferritin H- and L-chain siRNA on cystine uptake and GSH concentration 4 days after transfection. LECs were transfected with either nontargeting control, FHsiRNA, or FLsiRNA, lysed, and intracellular GSH measured in the lysates. In a parallel

    Article Snippet: Total RNA was extracted from cultured LECs, 24 hours after transfection with CTL, FH, or FLsiRNA (RNeasy kit and Qiashredders; Qiagen, Valencia CA) according to the manufacturer's protocol.

    Techniques: Concentration Assay, Transfection

    Effect of H- and L-chain siRNA on iron incorporation into ferritin. ( A ) Two and 4 days after transfection with either nontargeting control, FHsiRNA, or FLsiRNA, LECs were incubated for 20 hours with 59 Fe-transferrin. After cell lysis, proteins were precipitated

    Journal:

    Article Title: Altered Ferritin Subunit Composition: Change in Iron Metabolism in Lens Epithelial Cells and Downstream Effects on Glutathione Levels and VEGF Secretion

    doi: 10.1167/iovs.09-3861

    Figure Lengend Snippet: Effect of H- and L-chain siRNA on iron incorporation into ferritin. ( A ) Two and 4 days after transfection with either nontargeting control, FHsiRNA, or FLsiRNA, LECs were incubated for 20 hours with 59 Fe-transferrin. After cell lysis, proteins were precipitated

    Article Snippet: Total RNA was extracted from cultured LECs, 24 hours after transfection with CTL, FH, or FLsiRNA (RNeasy kit and Qiashredders; Qiagen, Valencia CA) according to the manufacturer's protocol.

    Techniques: Transfection, Incubation, Lysis

    Ionized calcium-binding adaptor molecule 1 immunostaining on flatmounted retinas. A – B : Example of flatmounted retinas from rat eyes with endotoxin-induced uveitis (EIU) injected with vehicle ( A ) or with antivascular endothelial growth factor (VEGF) antibodies ( B ); Bar = 50 µm. Arrowhead show round reactive ionized calcium-binding adaptor molecule 1 (IBA1)-positive cells. C – D : Extraction of cell contours used for automatic labeling of IBA1 staining. E - F : Quantification of round and total IBA-1 positive cells on flat-mounted retina from EIU control and anti-VEGF treated eyes. Bar = 50 µm.

    Journal: Molecular Vision

    Article Title: Anti-vascular endothelial growth factor acts on retinal microglia/macrophage activation in a rat model of ocular inflammation

    doi:

    Figure Lengend Snippet: Ionized calcium-binding adaptor molecule 1 immunostaining on flatmounted retinas. A – B : Example of flatmounted retinas from rat eyes with endotoxin-induced uveitis (EIU) injected with vehicle ( A ) or with antivascular endothelial growth factor (VEGF) antibodies ( B ); Bar = 50 µm. Arrowhead show round reactive ionized calcium-binding adaptor molecule 1 (IBA1)-positive cells. C – D : Extraction of cell contours used for automatic labeling of IBA1 staining. E - F : Quantification of round and total IBA-1 positive cells on flat-mounted retina from EIU control and anti-VEGF treated eyes. Bar = 50 µm.

    Article Snippet: Total RNA was isolated from neuroretinas from anti-VEGF and vehicle-injected EIU rat eyes (n = 5 eyes of five rats per group; RNeasy Plus Mini Kit; Qiagen, Courtaboeuf, France).

    Techniques: Binding Assay, Immunostaining, Injection, Labeling, Staining

    Ionized calcium-binding adaptor molecule 1 immunostaining of microglia and macrophages in endotoxin-induced uveitis at 24 h after lipopolysaccharide injection A : Retina section after vehicle intravitreal injection; in green ionized calcium-binding adaptor molecule 1 (IBA1) staining and in blue nuclei are stained with 4’,6-diamidino-2-phenyl-indole (DAPI). Arrowheads indicates round IBA1-positive cells, magnified in the inset. Bar = 50 µm, GCL = ganglion cell layer, INL = inner nuclear layer, ONL = outer nuclear layer. B : Retina section after anti-vascular endothelial growth factor (VEGF) intravitreal injection. IBA1-positive cells (in green) are ramified and elongated in the inner retina as magnified in the inset. Nuclei are stained in blue with DAPI. Bar = 50 µm, GCL = ganglion cell layer, INL = inner nuclear layer, ONL = outer nuclear layer. D – F : Choroid section after vehicle intravitreal injection stained with IBA1 ( D ) and DAPI ( F ), showing round amoeboid cells (magnified in the inset). Bar = 50 µm, RPE = retinal pigment epithelial cells. E – G : Choroid section after anti-VEGF intravitreal injection stained with IBA1 ( E ) and DAPI ( G ), showing round elongated ramified cells (magnified in the inset). Bar = 50 µm, RPE = retinal pigment epithelial cells. C and H : Quantification of round IBA1-positive cells in the inner and outer retina and in the choroid of rat eyes with EIU at 24 h, injected either with vehicle or with anti-VEGF antibody ( C ) or with control rat isotype immunoglobulin G (IgG) antibodies ( H ) *p

    Journal: Molecular Vision

    Article Title: Anti-vascular endothelial growth factor acts on retinal microglia/macrophage activation in a rat model of ocular inflammation

    doi:

    Figure Lengend Snippet: Ionized calcium-binding adaptor molecule 1 immunostaining of microglia and macrophages in endotoxin-induced uveitis at 24 h after lipopolysaccharide injection A : Retina section after vehicle intravitreal injection; in green ionized calcium-binding adaptor molecule 1 (IBA1) staining and in blue nuclei are stained with 4’,6-diamidino-2-phenyl-indole (DAPI). Arrowheads indicates round IBA1-positive cells, magnified in the inset. Bar = 50 µm, GCL = ganglion cell layer, INL = inner nuclear layer, ONL = outer nuclear layer. B : Retina section after anti-vascular endothelial growth factor (VEGF) intravitreal injection. IBA1-positive cells (in green) are ramified and elongated in the inner retina as magnified in the inset. Nuclei are stained in blue with DAPI. Bar = 50 µm, GCL = ganglion cell layer, INL = inner nuclear layer, ONL = outer nuclear layer. D – F : Choroid section after vehicle intravitreal injection stained with IBA1 ( D ) and DAPI ( F ), showing round amoeboid cells (magnified in the inset). Bar = 50 µm, RPE = retinal pigment epithelial cells. E – G : Choroid section after anti-VEGF intravitreal injection stained with IBA1 ( E ) and DAPI ( G ), showing round elongated ramified cells (magnified in the inset). Bar = 50 µm, RPE = retinal pigment epithelial cells. C and H : Quantification of round IBA1-positive cells in the inner and outer retina and in the choroid of rat eyes with EIU at 24 h, injected either with vehicle or with anti-VEGF antibody ( C ) or with control rat isotype immunoglobulin G (IgG) antibodies ( H ) *p

    Article Snippet: Total RNA was isolated from neuroretinas from anti-VEGF and vehicle-injected EIU rat eyes (n = 5 eyes of five rats per group; RNeasy Plus Mini Kit; Qiagen, Courtaboeuf, France).

    Techniques: Binding Assay, Immunostaining, Injection, Staining

    VEGF-R1 and IBA1 co-immunostaining on retinal sections retinal sections of EIU rats injected with vehicle ( A – C ) or anti-VEGF ( D – F ). GCL = ganglion cell layer, INL = inner nuclear layer, ONL = outer nuclear layer, RPE = retinal pigment epithelial cells, Chor = choroid. Insets are increased magnification (5X) of regions delimited by squares. Bar = 50 µm.

    Journal: Molecular Vision

    Article Title: Anti-vascular endothelial growth factor acts on retinal microglia/macrophage activation in a rat model of ocular inflammation

    doi:

    Figure Lengend Snippet: VEGF-R1 and IBA1 co-immunostaining on retinal sections retinal sections of EIU rats injected with vehicle ( A – C ) or anti-VEGF ( D – F ). GCL = ganglion cell layer, INL = inner nuclear layer, ONL = outer nuclear layer, RPE = retinal pigment epithelial cells, Chor = choroid. Insets are increased magnification (5X) of regions delimited by squares. Bar = 50 µm.

    Article Snippet: Total RNA was isolated from neuroretinas from anti-VEGF and vehicle-injected EIU rat eyes (n = 5 eyes of five rats per group; RNeasy Plus Mini Kit; Qiagen, Courtaboeuf, France).

    Techniques: Immunostaining, Injection

    VEGF-R2 and IBA1 coimmunostaining on retinal sections retinal sections of EIU rats injected with vehicle ( A – C ) or anti-VEGF ( D – F ). GCL = ganglion cell layer, INL = inner nuclear layer, ONL = outer nuclear layer, RPE = retinal pigment epithelial cells, Chor = choroid. Insets are increased magnification (5X) of regions delimited by squares. Bar = 50 µm.

    Journal: Molecular Vision

    Article Title: Anti-vascular endothelial growth factor acts on retinal microglia/macrophage activation in a rat model of ocular inflammation

    doi:

    Figure Lengend Snippet: VEGF-R2 and IBA1 coimmunostaining on retinal sections retinal sections of EIU rats injected with vehicle ( A – C ) or anti-VEGF ( D – F ). GCL = ganglion cell layer, INL = inner nuclear layer, ONL = outer nuclear layer, RPE = retinal pigment epithelial cells, Chor = choroid. Insets are increased magnification (5X) of regions delimited by squares. Bar = 50 µm.

    Article Snippet: Total RNA was isolated from neuroretinas from anti-VEGF and vehicle-injected EIU rat eyes (n = 5 eyes of five rats per group; RNeasy Plus Mini Kit; Qiagen, Courtaboeuf, France).

    Techniques: Injection

    Clinical and biological effects of anti-VEGF on EIU in rats. A : Clinical scoring of endotoxin-induced uveitis (EIU; n = 5 rats per group, p > 0.05). B : vascular endothelial growth factor (VEGF) ocular levels (pg/ml) at 24 h (n = 5 rats per group, p = 0.0436). C : Polymorphonuclear cell infiltration in the anterior segment (AS) and in the posterior segment (PS) of rats (five sections/ eye, five eyes per group). D : Ocular levels of interleukin (IL)1-β (πγ/μλ; n = 5, p = 0.55), E : IL-6 (pg/ml; n = 5, p = 0.068). F : Monocyte chemoattractant protein-1 (MCP-1; pg/ml; n = 5, p = 0.3132). G : Tumor necrosis factor (TNF)-α (πγ/μλ; n = 5, p = 0.7273).

    Journal: Molecular Vision

    Article Title: Anti-vascular endothelial growth factor acts on retinal microglia/macrophage activation in a rat model of ocular inflammation

    doi:

    Figure Lengend Snippet: Clinical and biological effects of anti-VEGF on EIU in rats. A : Clinical scoring of endotoxin-induced uveitis (EIU; n = 5 rats per group, p > 0.05). B : vascular endothelial growth factor (VEGF) ocular levels (pg/ml) at 24 h (n = 5 rats per group, p = 0.0436). C : Polymorphonuclear cell infiltration in the anterior segment (AS) and in the posterior segment (PS) of rats (five sections/ eye, five eyes per group). D : Ocular levels of interleukin (IL)1-β (πγ/μλ; n = 5, p = 0.55), E : IL-6 (pg/ml; n = 5, p = 0.068). F : Monocyte chemoattractant protein-1 (MCP-1; pg/ml; n = 5, p = 0.3132). G : Tumor necrosis factor (TNF)-α (πγ/μλ; n = 5, p = 0.7273).

    Article Snippet: Total RNA was isolated from neuroretinas from anti-VEGF and vehicle-injected EIU rat eyes (n = 5 eyes of five rats per group; RNeasy Plus Mini Kit; Qiagen, Courtaboeuf, France).

    Techniques: