Structured Review

Promega rnasin plus rnase inhibitor
Rnasin Plus Rnase Inhibitor, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 129 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rnasin plus rnase inhibitor/product/Promega
Average 99 stars, based on 129 article reviews
Price from $9.99 to $1999.99
rnasin plus rnase inhibitor - by Bioz Stars, 2020-03
99/100 stars

Images

Related Articles

Clone Assay:

Article Title: Splice Variant of Mouse Stam2 mRNA in Nervous and Muscle Tissue Contains Additional Exon with Stop Codon within Region Coding for VHS Domain
Article Snippet: Paragraph title: Reverse transcriptase-polymerase chain reaction, cloning, and sequencing ... First-strand cDNA synthesis was performed from 1-2 µg total RNA with 200 U of reverse transcriptase (Moloney Murine Leukemia Virus Reverse Transcriptase RNase H- , Promega, Madison, WI, USA), 15 U RNasin Plus RNase Inhibitor (Promega), 200 ng oligonucleotide primer specific for Stam2 (5′ TAAACAGCACACCCACAAAG 3′), and 0.5 mmol/L deoxynucleotide triphosphates (Promega) in 25-µL reaction mix.

Amplification:

Article Title: Asparagine Synthesis during Tobacco Leaf Curing
Article Snippet: The RNA was reverse-transcribed by using an oligo dT15 primer, dTNPs, RNasin Plus RNase inhibitor, and M-MLV reverse transcriptase, RNase (H-), Point Mutant (all from Promega, Madison, WI, USA). qRT-PCR was performed by using the Mx3005P system (Stratagene, Agilent, Waldbronn, Germany). .. Amplification reactions were performed by using ABsolute Blue SYBR Low Rox Mix (Thermo Scientific, Surrey, UK).

Article Title: Splice Variant of Mouse Stam2 mRNA in Nervous and Muscle Tissue Contains Additional Exon with Stop Codon within Region Coding for VHS Domain
Article Snippet: First-strand cDNA synthesis was performed from 1-2 µg total RNA with 200 U of reverse transcriptase (Moloney Murine Leukemia Virus Reverse Transcriptase RNase H- , Promega, Madison, WI, USA), 15 U RNasin Plus RNase Inhibitor (Promega), 200 ng oligonucleotide primer specific for Stam2 (5′ TAAACAGCACACCCACAAAG 3′), and 0.5 mmol/L deoxynucleotide triphosphates (Promega) in 25-µL reaction mix. .. The amplified products were electrophoresed on a 1.8%-agarose gel and visualized by ethidium bromide, using 100-bp DNA ladder (Promega) to estimate the band sizes.

Quantitative RT-PCR:

Article Title: Asparagine Synthesis during Tobacco Leaf Curing
Article Snippet: .. The RNA was reverse-transcribed by using an oligo dT15 primer, dTNPs, RNasin Plus RNase inhibitor, and M-MLV reverse transcriptase, RNase (H-), Point Mutant (all from Promega, Madison, WI, USA). qRT-PCR was performed by using the Mx3005P system (Stratagene, Agilent, Waldbronn, Germany). .. Amplification reactions were performed by using ABsolute Blue SYBR Low Rox Mix (Thermo Scientific, Surrey, UK).

CTL Assay:

Article Title: Human antimicrobial cytotoxic T lymphocytes, defined by NK receptors and antimicrobial proteins, kill intracellular bacteria
Article Snippet: Paragraph title: Cell sorting of CTL populations and RNA isolation from fixed and sorted cells ... All staining and sorting took place in DNase/RNase-free phosphate-buffered saline (PBS) supplemented with microbiology-grade bovine serum albumin (Gemini Bio-Products) in the constant presence of RNasin plus RNase inhibitor (Promega) 1:25 to 1:100 (1:100 for washes and 1:25 for staining and sorting).

Real-time Polymerase Chain Reaction:

Article Title: Asparagine Synthesis during Tobacco Leaf Curing
Article Snippet: Paragraph title: 4.7. qPCR Experiments ... The RNA was reverse-transcribed by using an oligo dT15 primer, dTNPs, RNasin Plus RNase inhibitor, and M-MLV reverse transcriptase, RNase (H-), Point Mutant (all from Promega, Madison, WI, USA). qRT-PCR was performed by using the Mx3005P system (Stratagene, Agilent, Waldbronn, Germany).

Article Title: The m6A pathway protects the transcriptome integrity by restricting RNA chimera formation in plants
Article Snippet: Fragmented RNA was incubated with 0.5 mg/ml anti-m6 A antibody (Cat. No. 202-003; Synaptic Systems) in IP buffer (150 mM NaCl, 0.1% Igepal CA-630, and 10 mM Tris–HCl, pH 7.4) supplemented with RNasin Plus RNase inhibitor (Cat. No. C2511; Promega) for 2 h at 4°C, and subsequently, protein A/G Plus-Agarose (Cat. No. sc-2003; Santa Cruz) that was pre-bound with BSA was added and incubated at 4°C for an additional 2 h. After extensive washing with IP buffer, bound RNA was eluted from the beads by incubation with 6.7 mM N6 -methyladenosine (Cat. No. M2780; Sigma-Aldrich) in IP buffer and precipitated by ethanol. .. Relative enrichment of each gene was determined by quantitative real-time PCR and calculated first by normalizing the amount of a target cDNA fragment against that of TUB2 as an internal control, and then by normalizing the value for immunoprecipitated sample against that for the input.

Article Title: The differential statin effect on cytokine production of monocytes or macrophages is mediated by differential geranylgeranylation-dependent Rac1 activation
Article Snippet: To the RNA, the kit components RT-buffer (2 µl), dNTP-mix (2 µl; 0.5 mM), and “Omniscript Reverse Transcriptase” (1 µl; 4 U), as well as separately obtained “Rnasin Plus Rnase Inhibitor” (1 µl; 10 U; Promega GmbH, Mannheim, Germany) and oligo(dT)18 primer (2 µl; 1 µM; Fermentas) were added (total volume of 20 µl). .. Real-time PCR was conducted in a volume of 25 µl consisting of 2.5 µl cDNA, 12.5 µl “GoTaq qPCR Master Mix” (Promega; including the proprietary double-strand DNA stain), 0.5 µl sense primer, 0.5 µl antisense primer (0.25 µM each), and 9 µl DEPC-treated water.

Article Title: Human Osteoblast Migration in DC Electrical Fields Depends on Store Operated Ca2+-Release and Is Correlated to Upregulation of Stretch-Activated TRPM7 Channels
Article Snippet: Paragraph title: Reverse Transcription and Semiquantitative Real-Time Polymerase Chain Reaction (rtPCR) ... 200 ng of total RNA were reverse-transcribed by adding random hexamers (3 μg/μl), dNTP mix (10 mM each; Invitrogen, Carlsbad, CA, USA), Moloney murine leukemia virus reverse transcriptase (200 U/μl) and RNasin plus RNase inhibitor (40 U/μl; both Promega Corporation, Madison, WI, USA).

Incubation:

Article Title: Comparison of human and murine enteroendocrine cells by transcriptomic and peptidomic profiling
Article Snippet: PFA-fixed cells were washed twice in nuclease free 1% w/v bovine serum albumin (BSA) in PBS, and if a FACS facility was not immediately available, were suspended in 1% w/v BSA and 4% v/v RNAsin plus RNAse inhibitor (Promega, WI, USA) in PBS at 4°C overnight. .. Cells were permeabilised with either a single 30 minute incubation with 0.1% v/v Triton x100 (Sigma-Aldrich) in 1% w/v BSA in PBS prior to antibody staining, or by the addition of 0.1% w/v Saponin (Sigma-Aldrich) to solutions in all steps from this point until after the first wash post-secondary antibody staining, with identical results.

Article Title: Detection of wild-type EGFR amplification and EGFRvIII mutation in CSF-derived extracellular vesicles of glioblastoma patients
Article Snippet: .. Four milliliters of CSF was added to a 13 × 51 mm polyallomer tube containing 8 µL RNasin Plus RNase Inhibitor (Promega), then adjusted to 5 mL with PBS and incubated for 5 min at room temperature. .. The samples were spun at 120000 × g for 80 minutes at 8°C (MLS-50 rotor in an Optima Max-XP bench top ultracentrifuge; Beckman).

Article Title: In vitro inhibition of feline coronavirus replication by small interfering RNAs.
Article Snippet: .. Samples were incubated at 65 8C for 5 min to denature RNA and then cooled on ice for 1 min. To this was added a mix consisting of 4.5 ml First Stand Buffer (Invitrogen), 20 units RNasin Plus RNase Inhibitor (Promega), and 100 units Superscript III. .. Tubes were incubated at 60 8C for 60 min followed by 15 min at 70 8C to inactivate the reverse transcriptase. cDNA was stored at À80 8C until use.

Article Title: The m6A pathway protects the transcriptome integrity by restricting RNA chimera formation in plants
Article Snippet: .. Fragmented RNA was incubated with 0.5 mg/ml anti-m6 A antibody (Cat. No. 202-003; Synaptic Systems) in IP buffer (150 mM NaCl, 0.1% Igepal CA-630, and 10 mM Tris–HCl, pH 7.4) supplemented with RNasin Plus RNase inhibitor (Cat. No. C2511; Promega) for 2 h at 4°C, and subsequently, protein A/G Plus-Agarose (Cat. No. sc-2003; Santa Cruz) that was pre-bound with BSA was added and incubated at 4°C for an additional 2 h. After extensive washing with IP buffer, bound RNA was eluted from the beads by incubation with 6.7 mM N6 -methyladenosine (Cat. No. M2780; Sigma-Aldrich) in IP buffer and precipitated by ethanol. .. The input and immunoprecipitated RNAs were reverse-transcribed with random hexamers (Cat. No. N8080127; Invitrogen) using M-MLV Reverse Transcriptase (Cat. No. M1701; Promega).

Article Title: Comparison of human and murine enteroendocrine cells by transcriptomic and peptidomic profiling
Article Snippet: PFA-fixed cells were washed twice in nuclease free 1% w/v bovine serum albumin (BSA) in PBS, and if a FACS facility was not immediately available, were suspended in 1% w/v BSA and 4% v/v RNAsin plus RNAse inhibitor (Promega, WI, USA) in PBS at 4°C overnight. .. Cells were permeabilised with either a single 30 minute incubation with 0.1% v/v Triton x100 (Sigma-Aldrich) in 1% w/v BSA in PBS prior to antibody staining, or by the addition of 0.1% w/v Saponin (Sigma-Aldrich) to solutions in all steps from this point until after the first wash post-secondary antibody staining, with identical results.

Article Title: RNA Arbitrarily Primed PCR and Fourier Transform Infrared Spectroscopy Reveal Plasticity in the Acid Tolerance Response of Streptococcus macedonicus ▿
Article Snippet: In brief, first-stand cDNA synthesis was performed using 1 μg of heat-denatured (10 min, 70°C) total RNA in reaction mixtures containing 1.0 μM of the arbitrarily chosen primer (5′-CGTATTCATAAGCTTCTCCCGA-3′), 0.5 mM of each deoxynucleoside triphosphate, 40 U of RNasin Plus RNase inhibitor (Promega Corp., Madison, WI), and 1× reverse transcription (RT) reaction buffer. .. After the mixture was equilibrated at 37°C for 5 min, 4 U of Omniscript reverse transcriptase (Qiagen Inc.) was added to a final volume of 20 μl, and the reaction mixture was incubated at 37°C for 1 h. Subsequently, the reverse transcriptase was heat inactivated at 90°C for 5 min, and the reaction mixture was placed on ice for 10 min. For second-strand synthesis, 10 μl of a 1:10 dilution of the cDNA preparation was used.

Luciferase:

Article Title: Toward a General Approach for RNA-Templated Hierarchical Assembly of Split-Proteins
Article Snippet: .. RNasin® Plus RNase Inhibitor, T7 RiboMAX™ Large Scale RNA Production kit, Rabbit Reticulocyte Lysate (Promega and Alator), and Steady-Glo® Luciferase Assay System were acquired from Promega. .. Nuclease-free H2 O (Ambion and Promega) was used in all preparations involving RNA.

Expressing:

Article Title: Human Osteoblast Migration in DC Electrical Fields Depends on Store Operated Ca2+-Release and Is Correlated to Upregulation of Stretch-Activated TRPM7 Channels
Article Snippet: Reverse Transcription and Semiquantitative Real-Time Polymerase Chain Reaction (rtPCR) To gauge the effect of DC stimulation on the expression of calcium-permeable channels, we conducted rtPCR analyses. .. 200 ng of total RNA were reverse-transcribed by adding random hexamers (3 μg/μl), dNTP mix (10 mM each; Invitrogen, Carlsbad, CA, USA), Moloney murine leukemia virus reverse transcriptase (200 U/μl) and RNasin plus RNase inhibitor (40 U/μl; both Promega Corporation, Madison, WI, USA).

Modification:

Article Title: Human antimicrobial cytotoxic T lymphocytes, defined by NK receptors and antimicrobial proteins, kill intracellular bacteria
Article Snippet: All staining and sorting took place in DNase/RNase-free phosphate-buffered saline (PBS) supplemented with microbiology-grade bovine serum albumin (Gemini Bio-Products) in the constant presence of RNasin plus RNase inhibitor (Promega) 1:25 to 1:100 (1:100 for washes and 1:25 for staining and sorting). .. After sorting, RNA was isolated using the RecoverAll Total Nucleic Acid Isolation Kit (Ambion), as per the manufacturer’s instructions, with the same modification to the protocol used as described by Hrvatin et al . ( ).

Article Title: In vitro inhibition of feline coronavirus replication by small interfering RNAs.
Article Snippet: Immunofluorescence assay 2.6.2. cDNA synthesis cDNA was generated from purified RNA using Superscript 1 III (Invitrogen), a modified Moloney Murine Leukaemia Virus reverse transcriptase in a final reaction volume of 20 ml. .. Samples were incubated at 65 8C for 5 min to denature RNA and then cooled on ice for 1 min. To this was added a mix consisting of 4.5 ml First Stand Buffer (Invitrogen), 20 units RNasin Plus RNase Inhibitor (Promega), and 100 units Superscript III.

Planar Chromatography:

Article Title: Simulated Microgravity Altered the Metabolism of Loureirin B and the Expression of Major Cytochrome P450 in Liver of Rats
Article Snippet: Oligo(dT) 15 primer, RNase-free water, RNasin Plus RNase Inhibitor, 5× M-MLV Reverse Transcriptase buffer, M-MLV Reverse Transcriptase and dNTPs were obtained from Promega Corporation (Madison, WI, United States). .. Oligo(dT) 15 primer, RNase-free water, RNasin Plus RNase Inhibitor, 5× M-MLV Reverse Transcriptase buffer, M-MLV Reverse Transcriptase and dNTPs were obtained from Promega Corporation (Madison, WI, United States).

High Performance Liquid Chromatography:

Article Title: Simulated Microgravity Altered the Metabolism of Loureirin B and the Expression of Major Cytochrome P450 in Liver of Rats
Article Snippet: Reagents and Drugs Trizol and HPLC-grade acetonitrile were purchased from Thermo Fisher Scientific (Waltham, MA, United States). .. Oligo(dT) 15 primer, RNase-free water, RNasin Plus RNase Inhibitor, 5× M-MLV Reverse Transcriptase buffer, M-MLV Reverse Transcriptase and dNTPs were obtained from Promega Corporation (Madison, WI, United States).

Electron Microscopy:

Article Title: Human antimicrobial cytotoxic T lymphocytes, defined by NK receptors and antimicrobial proteins, kill intracellular bacteria
Article Snippet: Before sorting, cells were fixed in 2% electron microscopy–grade paraformaldehyde (Electron Microscopy Sciences) and permeabilized with 0.5% deoxyribonuclease (DNase)/ribonuclease (RNase)–free saponin (Sigma) to permit intracellular staining. .. All staining and sorting took place in DNase/RNase-free phosphate-buffered saline (PBS) supplemented with microbiology-grade bovine serum albumin (Gemini Bio-Products) in the constant presence of RNasin plus RNase inhibitor (Promega) 1:25 to 1:100 (1:100 for washes and 1:25 for staining and sorting).

Sequencing:

Article Title: Splice Variant of Mouse Stam2 mRNA in Nervous and Muscle Tissue Contains Additional Exon with Stop Codon within Region Coding for VHS Domain
Article Snippet: Paragraph title: Reverse transcriptase-polymerase chain reaction, cloning, and sequencing ... First-strand cDNA synthesis was performed from 1-2 µg total RNA with 200 U of reverse transcriptase (Moloney Murine Leukemia Virus Reverse Transcriptase RNase H- , Promega, Madison, WI, USA), 15 U RNasin Plus RNase Inhibitor (Promega), 200 ng oligonucleotide primer specific for Stam2 (5′ TAAACAGCACACCCACAAAG 3′), and 0.5 mmol/L deoxynucleotide triphosphates (Promega) in 25-µL reaction mix.

Article Title: RNA Arbitrarily Primed PCR and Fourier Transform Infrared Spectroscopy Reveal Plasticity in the Acid Tolerance Response of Streptococcus macedonicus ▿
Article Snippet: In brief, first-stand cDNA synthesis was performed using 1 μg of heat-denatured (10 min, 70°C) total RNA in reaction mixtures containing 1.0 μM of the arbitrarily chosen primer (5′-CGTATTCATAAGCTTCTCCCGA-3′), 0.5 mM of each deoxynucleoside triphosphate, 40 U of RNasin Plus RNase inhibitor (Promega Corp., Madison, WI), and 1× reverse transcription (RT) reaction buffer. .. PCR thermal cycling was performed with one low-stringency cycle of 94°C for 3 min, 37°C for 5 min, and 72°C for 5 min, followed by 39 high-stringency cycles consisting of 94°C for 1 min, 47°C for 1 min, and 72°C for 1 min and a final extension at 72°C for 10 min. RAP-PCR products (8 μl) were separated on a 7% nondenaturing polyacrylamide sequencing gel, and cDNA bands were visualized after SYBR Gold staining (Molecular Probes Inc., Eugene, OR) with a Fluorchem 8800 (Alpha Innotech, CA) image analysis system.

Immunoprecipitation:

Article Title: The m6A pathway protects the transcriptome integrity by restricting RNA chimera formation in plants
Article Snippet: Fragmented RNA was incubated with 0.5 mg/ml anti-m6 A antibody (Cat. No. 202-003; Synaptic Systems) in IP buffer (150 mM NaCl, 0.1% Igepal CA-630, and 10 mM Tris–HCl, pH 7.4) supplemented with RNasin Plus RNase inhibitor (Cat. No. C2511; Promega) for 2 h at 4°C, and subsequently, protein A/G Plus-Agarose (Cat. No. sc-2003; Santa Cruz) that was pre-bound with BSA was added and incubated at 4°C for an additional 2 h. After extensive washing with IP buffer, bound RNA was eluted from the beads by incubation with 6.7 mM N6 -methyladenosine (Cat. No. M2780; Sigma-Aldrich) in IP buffer and precipitated by ethanol. .. The input and immunoprecipitated RNAs were reverse-transcribed with random hexamers (Cat. No. N8080127; Invitrogen) using M-MLV Reverse Transcriptase (Cat. No. M1701; Promega).

Generated:

Article Title: In vitro inhibition of feline coronavirus replication by small interfering RNAs.
Article Snippet: Immunofluorescence assay 2.6.2. cDNA synthesis cDNA was generated from purified RNA using Superscript 1 III (Invitrogen), a modified Moloney Murine Leukaemia Virus reverse transcriptase in a final reaction volume of 20 ml. .. Samples were incubated at 65 8C for 5 min to denature RNA and then cooled on ice for 1 min. To this was added a mix consisting of 4.5 ml First Stand Buffer (Invitrogen), 20 units RNasin Plus RNase Inhibitor (Promega), and 100 units Superscript III.

Isolation:

Article Title: Asparagine Synthesis during Tobacco Leaf Curing
Article Snippet: 4.7. qPCR Experiments Total RNA was isolated from tobacco leaf tissues by using the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany). .. The RNA was reverse-transcribed by using an oligo dT15 primer, dTNPs, RNasin Plus RNase inhibitor, and M-MLV reverse transcriptase, RNase (H-), Point Mutant (all from Promega, Madison, WI, USA). qRT-PCR was performed by using the Mx3005P system (Stratagene, Agilent, Waldbronn, Germany).

Article Title: Splice Variant of Mouse Stam2 mRNA in Nervous and Muscle Tissue Contains Additional Exon with Stop Codon within Region Coding for VHS Domain
Article Snippet: The RNA was isolated according to the manufacturer's instructions and dissolved in diethylpyrocarbonate (DEPC)-treated water. .. First-strand cDNA synthesis was performed from 1-2 µg total RNA with 200 U of reverse transcriptase (Moloney Murine Leukemia Virus Reverse Transcriptase RNase H- , Promega, Madison, WI, USA), 15 U RNasin Plus RNase Inhibitor (Promega), 200 ng oligonucleotide primer specific for Stam2 (5′ TAAACAGCACACCCACAAAG 3′), and 0.5 mmol/L deoxynucleotide triphosphates (Promega) in 25-µL reaction mix.

Article Title: Human antimicrobial cytotoxic T lymphocytes, defined by NK receptors and antimicrobial proteins, kill intracellular bacteria
Article Snippet: Paragraph title: Cell sorting of CTL populations and RNA isolation from fixed and sorted cells ... All staining and sorting took place in DNase/RNase-free phosphate-buffered saline (PBS) supplemented with microbiology-grade bovine serum albumin (Gemini Bio-Products) in the constant presence of RNasin plus RNase inhibitor (Promega) 1:25 to 1:100 (1:100 for washes and 1:25 for staining and sorting).

Article Title: Detection of wild-type EGFR amplification and EGFRvIII mutation in CSF-derived extracellular vesicles of glioblastoma patients
Article Snippet: Paragraph title: CSF Extracellular Vesicle Isolation ... Four milliliters of CSF was added to a 13 × 51 mm polyallomer tube containing 8 µL RNasin Plus RNase Inhibitor (Promega), then adjusted to 5 mL with PBS and incubated for 5 min at room temperature.

Polymerase Chain Reaction:

Article Title: Splice Variant of Mouse Stam2 mRNA in Nervous and Muscle Tissue Contains Additional Exon with Stop Codon within Region Coding for VHS Domain
Article Snippet: First-strand cDNA synthesis was performed from 1-2 µg total RNA with 200 U of reverse transcriptase (Moloney Murine Leukemia Virus Reverse Transcriptase RNase H- , Promega, Madison, WI, USA), 15 U RNasin Plus RNase Inhibitor (Promega), 200 ng oligonucleotide primer specific for Stam2 (5′ TAAACAGCACACCCACAAAG 3′), and 0.5 mmol/L deoxynucleotide triphosphates (Promega) in 25-µL reaction mix. .. Polymerase chain reactions (50 µL volume) were carried out using 1 U of DNA polymerase ( Taq DNA Polymerase; Promega), 0.2 mmol/L deoxynucleotide triphosphates, and 20 pmol of each primer in a PCR machine GeneAmp PCR System 2400 (Applied Biosystems, Foster City, CA, USA).

Article Title: The differential statin effect on cytokine production of monocytes or macrophages is mediated by differential geranylgeranylation-dependent Rac1 activation
Article Snippet: To the RNA, the kit components RT-buffer (2 µl), dNTP-mix (2 µl; 0.5 mM), and “Omniscript Reverse Transcriptase” (1 µl; 4 U), as well as separately obtained “Rnasin Plus Rnase Inhibitor” (1 µl; 10 U; Promega GmbH, Mannheim, Germany) and oligo(dT)18 primer (2 µl; 1 µM; Fermentas) were added (total volume of 20 µl). .. The reaction was performed using the Bio-Rad “iCycler iQ PCR Detection System” (Bio-Rad Laboratories, Munich, Germany).

Article Title: RNA Arbitrarily Primed PCR and Fourier Transform Infrared Spectroscopy Reveal Plasticity in the Acid Tolerance Response of Streptococcus macedonicus ▿
Article Snippet: In brief, first-stand cDNA synthesis was performed using 1 μg of heat-denatured (10 min, 70°C) total RNA in reaction mixtures containing 1.0 μM of the arbitrarily chosen primer (5′-CGTATTCATAAGCTTCTCCCGA-3′), 0.5 mM of each deoxynucleoside triphosphate, 40 U of RNasin Plus RNase inhibitor (Promega Corp., Madison, WI), and 1× reverse transcription (RT) reaction buffer. .. PCR was performed with Taq PCR Master Mix (Qiagen Inc.) at a final volume of 100 μl, with 1.0 μΜ of the same arbitrarily chosen primer.

Immunofluorescence:

Article Title: In vitro inhibition of feline coronavirus replication by small interfering RNAs.
Article Snippet: Paragraph title: Immunofluorescence assay ... Samples were incubated at 65 8C for 5 min to denature RNA and then cooled on ice for 1 min. To this was added a mix consisting of 4.5 ml First Stand Buffer (Invitrogen), 20 units RNasin Plus RNase Inhibitor (Promega), and 100 units Superscript III.

Nucleic Acid Electrophoresis:

Article Title: In vitro inhibition of feline coronavirus replication by small interfering RNAs.
Article Snippet: RNA yield and purity was determined by spectrophotometry (OD280/OD260) and the integrity of RNA checked with 1.2% agarose/formaldehyde denaturing gel electrophoresis. .. Samples were incubated at 65 8C for 5 min to denature RNA and then cooled on ice for 1 min. To this was added a mix consisting of 4.5 ml First Stand Buffer (Invitrogen), 20 units RNasin Plus RNase Inhibitor (Promega), and 100 units Superscript III.

Fluorescence:

Article Title: Human Osteoblast Migration in DC Electrical Fields Depends on Store Operated Ca2+-Release and Is Correlated to Upregulation of Stretch-Activated TRPM7 Channels
Article Snippet: 200 ng of total RNA were reverse-transcribed by adding random hexamers (3 μg/μl), dNTP mix (10 mM each; Invitrogen, Carlsbad, CA, USA), Moloney murine leukemia virus reverse transcriptase (200 U/μl) and RNasin plus RNase inhibitor (40 U/μl; both Promega Corporation, Madison, WI, USA). .. Real-time PCRs were performed using the ep mastercycler (software realplex 2.2, Eppendorf, Hamburg, Germany) with cycling parameters as follows: 95°C for 2 min once, followed by 95°C for 30 s and 59.2–62.5°C for 45 s, with normalized fluorescence read at 59.2–62.5°C (530 nm) for 40 cycles.

Mutagenesis:

Article Title: Asparagine Synthesis during Tobacco Leaf Curing
Article Snippet: .. The RNA was reverse-transcribed by using an oligo dT15 primer, dTNPs, RNasin Plus RNase inhibitor, and M-MLV reverse transcriptase, RNase (H-), Point Mutant (all from Promega, Madison, WI, USA). qRT-PCR was performed by using the Mx3005P system (Stratagene, Agilent, Waldbronn, Germany). .. Amplification reactions were performed by using ABsolute Blue SYBR Low Rox Mix (Thermo Scientific, Surrey, UK).

Cell Tracking Assay:

Article Title: Functional TCR T cell screening using single-cell droplet microfluidics
Article Snippet: RPMI 1640, IMDM (GlutaMAX Supplement), MEM Non-Essential Amino Acids (NEAA), sodium pyruvate, 200g/L glucose solution, Penicillin Streptomycin solution and cell tracking fluorescent dyes were purchased from Fisher Scientific. .. RNAsin Plus RNase Inhibitor was obtained from Promega.

Microscopy:

Article Title: Human antimicrobial cytotoxic T lymphocytes, defined by NK receptors and antimicrobial proteins, kill intracellular bacteria
Article Snippet: Before sorting, cells were fixed in 2% electron microscopy–grade paraformaldehyde (Electron Microscopy Sciences) and permeabilized with 0.5% deoxyribonuclease (DNase)/ribonuclease (RNase)–free saponin (Sigma) to permit intracellular staining. .. All staining and sorting took place in DNase/RNase-free phosphate-buffered saline (PBS) supplemented with microbiology-grade bovine serum albumin (Gemini Bio-Products) in the constant presence of RNasin plus RNase inhibitor (Promega) 1:25 to 1:100 (1:100 for washes and 1:25 for staining and sorting).

Mouse Assay:

Article Title: Splice Variant of Mouse Stam2 mRNA in Nervous and Muscle Tissue Contains Additional Exon with Stop Codon within Region Coding for VHS Domain
Article Snippet: Approximately 100 mg of 18 different tissues (cortex, hippocampus, olfactory bulb, medulla oblongata, spinal cord, cerebellum, heart, lungs, thymus, spleen, liver, pancreas, kidney, suprarenal gland, testis, muscle, bone and abdominal adipose tissue) of 3 C57Bl/6NCrl mice was isolated, frozen in liquid nitrogen and homogenized in 1 mL of cold TRI REAGENT solution (MRC Inc. Cincinnati, OH, USA) by tissue homogenizer (Ultra-turrax T25, Janke & Kunkel IKA Labortechnik, Staufen, Germany). .. First-strand cDNA synthesis was performed from 1-2 µg total RNA with 200 U of reverse transcriptase (Moloney Murine Leukemia Virus Reverse Transcriptase RNase H- , Promega, Madison, WI, USA), 15 U RNasin Plus RNase Inhibitor (Promega), 200 ng oligonucleotide primer specific for Stam2 (5′ TAAACAGCACACCCACAAAG 3′), and 0.5 mmol/L deoxynucleotide triphosphates (Promega) in 25-µL reaction mix.

Reverse Transcription Polymerase Chain Reaction:

Article Title: Splice Variant of Mouse Stam2 mRNA in Nervous and Muscle Tissue Contains Additional Exon with Stop Codon within Region Coding for VHS Domain
Article Snippet: First-strand cDNA synthesis was performed from 1-2 µg total RNA with 200 U of reverse transcriptase (Moloney Murine Leukemia Virus Reverse Transcriptase RNase H- , Promega, Madison, WI, USA), 15 U RNasin Plus RNase Inhibitor (Promega), 200 ng oligonucleotide primer specific for Stam2 (5′ TAAACAGCACACCCACAAAG 3′), and 0.5 mmol/L deoxynucleotide triphosphates (Promega) in 25-µL reaction mix. .. Five brain cDNA samples from 5 C57Bl/6NCrl mice were used for 40 RT-PCR reactions with different primer combinations covering the complete coding sequence of Stam2 ( ).

Article Title: Human Osteoblast Migration in DC Electrical Fields Depends on Store Operated Ca2+-Release and Is Correlated to Upregulation of Stretch-Activated TRPM7 Channels
Article Snippet: Paragraph title: Reverse Transcription and Semiquantitative Real-Time Polymerase Chain Reaction (rtPCR) ... 200 ng of total RNA were reverse-transcribed by adding random hexamers (3 μg/μl), dNTP mix (10 mM each; Invitrogen, Carlsbad, CA, USA), Moloney murine leukemia virus reverse transcriptase (200 U/μl) and RNasin plus RNase inhibitor (40 U/μl; both Promega Corporation, Madison, WI, USA).

FACS:

Article Title: Human antimicrobial cytotoxic T lymphocytes, defined by NK receptors and antimicrobial proteins, kill intracellular bacteria
Article Snippet: Paragraph title: Cell sorting of CTL populations and RNA isolation from fixed and sorted cells ... All staining and sorting took place in DNase/RNase-free phosphate-buffered saline (PBS) supplemented with microbiology-grade bovine serum albumin (Gemini Bio-Products) in the constant presence of RNasin plus RNase inhibitor (Promega) 1:25 to 1:100 (1:100 for washes and 1:25 for staining and sorting).

Article Title: Comparison of human and murine enteroendocrine cells by transcriptomic and peptidomic profiling
Article Snippet: .. PFA-fixed cells were washed twice in nuclease free 1% w/v bovine serum albumin (BSA) in PBS, and if a FACS facility was not immediately available, were suspended in 1% w/v BSA and 4% v/v RNAsin plus RNAse inhibitor (Promega, WI, USA) in PBS at 4°C overnight. .. Cells were permeabilised with either a single 30 minute incubation with 0.1% v/v Triton x100 (Sigma-Aldrich) in 1% w/v BSA in PBS prior to antibody staining, or by the addition of 0.1% w/v Saponin (Sigma-Aldrich) to solutions in all steps from this point until after the first wash post-secondary antibody staining, with identical results.

Article Title: Comparison of human and murine enteroendocrine cells by transcriptomic and peptidomic profiling
Article Snippet: .. PFA-fixed cells were washed twice in nuclease free 1% w/v bovine serum albumin (BSA) in PBS, and if a FACS facility was not immediately available, were suspended in 1% w/v BSA and 4% v/v RNAsin plus RNAse inhibitor (Promega, WI, USA) in PBS at 4°C overnight. .. Cells were permeabilised with either a single 30 minute incubation with 0.1% v/v Triton x100 (Sigma-Aldrich) in 1% w/v BSA in PBS prior to antibody staining, or by the addition of 0.1% w/v Saponin (Sigma-Aldrich) to solutions in all steps from this point until after the first wash post-secondary antibody staining, with identical results.

Lysis:

Article Title: Detection of wild-type EGFR amplification and EGFRvIII mutation in CSF-derived extracellular vesicles of glioblastoma patients
Article Snippet: Four milliliters of CSF was added to a 13 × 51 mm polyallomer tube containing 8 µL RNasin Plus RNase Inhibitor (Promega), then adjusted to 5 mL with PBS and incubated for 5 min at room temperature. .. Added to each sample was 700 μL Qiazol lysis buffer, and RNA was extracted using the miRNeasy micro isolation kit (Qiagen) according to manufacturer’s recommendation.

Article Title: Simulated Microgravity Altered the Metabolism of Loureirin B and the Expression of Major Cytochrome P450 in Liver of Rats
Article Snippet: Oligo(dT) 15 primer, RNase-free water, RNasin Plus RNase Inhibitor, 5× M-MLV Reverse Transcriptase buffer, M-MLV Reverse Transcriptase and dNTPs were obtained from Promega Corporation (Madison, WI, United States). .. Enhanced RIPA lysis buffer and protein loading buffer were purchased from Solarbio Life Sciences (Beijing, China).

Purification:

Article Title: Human antimicrobial cytotoxic T lymphocytes, defined by NK receptors and antimicrobial proteins, kill intracellular bacteria
Article Snippet: Briefly, we used FACS to obtain highly purified populations of T-CTLs, D-CTLs, M-CTLs, and N-CTLs from donors based on staining with CD3, GZMB, PRF, and GNLY, as described above. .. All staining and sorting took place in DNase/RNase-free phosphate-buffered saline (PBS) supplemented with microbiology-grade bovine serum albumin (Gemini Bio-Products) in the constant presence of RNasin plus RNase inhibitor (Promega) 1:25 to 1:100 (1:100 for washes and 1:25 for staining and sorting).

Article Title: In vitro inhibition of feline coronavirus replication by small interfering RNAs.
Article Snippet: The reactions consisted of 1 mg purified RNA, 100 ng random primers (Promega, Alexandria, NSW, Australia), 2.5 mmol of each dNTP (Promega), and RNase free water (Amresco) to a final volume of 14.5 ml. .. Samples were incubated at 65 8C for 5 min to denature RNA and then cooled on ice for 1 min. To this was added a mix consisting of 4.5 ml First Stand Buffer (Invitrogen), 20 units RNasin Plus RNase Inhibitor (Promega), and 100 units Superscript III.

Software:

Article Title: Human Osteoblast Migration in DC Electrical Fields Depends on Store Operated Ca2+-Release and Is Correlated to Upregulation of Stretch-Activated TRPM7 Channels
Article Snippet: 200 ng of total RNA were reverse-transcribed by adding random hexamers (3 μg/μl), dNTP mix (10 mM each; Invitrogen, Carlsbad, CA, USA), Moloney murine leukemia virus reverse transcriptase (200 U/μl) and RNasin plus RNase inhibitor (40 U/μl; both Promega Corporation, Madison, WI, USA). .. Real-time PCRs were performed using the ep mastercycler (software realplex 2.2, Eppendorf, Hamburg, Germany) with cycling parameters as follows: 95°C for 2 min once, followed by 95°C for 30 s and 59.2–62.5°C for 45 s, with normalized fluorescence read at 59.2–62.5°C (530 nm) for 40 cycles.

SYBR Green Assay:

Article Title: Human Osteoblast Migration in DC Electrical Fields Depends on Store Operated Ca2+-Release and Is Correlated to Upregulation of Stretch-Activated TRPM7 Channels
Article Snippet: 200 ng of total RNA were reverse-transcribed by adding random hexamers (3 μg/μl), dNTP mix (10 mM each; Invitrogen, Carlsbad, CA, USA), Moloney murine leukemia virus reverse transcriptase (200 U/μl) and RNasin plus RNase inhibitor (40 U/μl; both Promega Corporation, Madison, WI, USA). .. For real-time PCRs a mastermix containing 10x buffer, Mg2+ (4 mM), dNTPs (200 μM), Platinum taq polymerase (0.6 U/20 μl reaction, Invitrogen), and SYBR Green (concentration as recommended by manufacturer, Qiagen Inc., Valencia, CA, USA) were used.

RNA Extraction:

Article Title: In vitro inhibition of feline coronavirus replication by small interfering RNAs.
Article Snippet: RNA extraction Total RNA was extracted using RNeasy Mini spin columns (QIAGEN) as per manufacturer's protocol, including an on-column RNase-free DNase I (QIAGEN) treatment. .. Samples were incubated at 65 8C for 5 min to denature RNA and then cooled on ice for 1 min. To this was added a mix consisting of 4.5 ml First Stand Buffer (Invitrogen), 20 units RNasin Plus RNase Inhibitor (Promega), and 100 units Superscript III.

Spectrophotometry:

Article Title: In vitro inhibition of feline coronavirus replication by small interfering RNAs.
Article Snippet: RNA yield and purity was determined by spectrophotometry (OD280/OD260) and the integrity of RNA checked with 1.2% agarose/formaldehyde denaturing gel electrophoresis. .. Samples were incubated at 65 8C for 5 min to denature RNA and then cooled on ice for 1 min. To this was added a mix consisting of 4.5 ml First Stand Buffer (Invitrogen), 20 units RNasin Plus RNase Inhibitor (Promega), and 100 units Superscript III.

Concentration Assay:

Article Title: Human Osteoblast Migration in DC Electrical Fields Depends on Store Operated Ca2+-Release and Is Correlated to Upregulation of Stretch-Activated TRPM7 Channels
Article Snippet: 200 ng of total RNA were reverse-transcribed by adding random hexamers (3 μg/μl), dNTP mix (10 mM each; Invitrogen, Carlsbad, CA, USA), Moloney murine leukemia virus reverse transcriptase (200 U/μl) and RNasin plus RNase inhibitor (40 U/μl; both Promega Corporation, Madison, WI, USA). .. For real-time PCRs a mastermix containing 10x buffer, Mg2+ (4 mM), dNTPs (200 μM), Platinum taq polymerase (0.6 U/20 μl reaction, Invitrogen), and SYBR Green (concentration as recommended by manufacturer, Qiagen Inc., Valencia, CA, USA) were used.

Staining:

Article Title: Human antimicrobial cytotoxic T lymphocytes, defined by NK receptors and antimicrobial proteins, kill intracellular bacteria
Article Snippet: .. All staining and sorting took place in DNase/RNase-free phosphate-buffered saline (PBS) supplemented with microbiology-grade bovine serum albumin (Gemini Bio-Products) in the constant presence of RNasin plus RNase inhibitor (Promega) 1:25 to 1:100 (1:100 for washes and 1:25 for staining and sorting). .. After sorting, RNA was isolated using the RecoverAll Total Nucleic Acid Isolation Kit (Ambion), as per the manufacturer’s instructions, with the same modification to the protocol used as described by Hrvatin et al . ( ).

Article Title: Comparison of human and murine enteroendocrine cells by transcriptomic and peptidomic profiling
Article Snippet: PFA-fixed cells were washed twice in nuclease free 1% w/v bovine serum albumin (BSA) in PBS, and if a FACS facility was not immediately available, were suspended in 1% w/v BSA and 4% v/v RNAsin plus RNAse inhibitor (Promega, WI, USA) in PBS at 4°C overnight. .. Cells were permeabilised with either a single 30 minute incubation with 0.1% v/v Triton x100 (Sigma-Aldrich) in 1% w/v BSA in PBS prior to antibody staining, or by the addition of 0.1% w/v Saponin (Sigma-Aldrich) to solutions in all steps from this point until after the first wash post-secondary antibody staining, with identical results.

Article Title: The differential statin effect on cytokine production of monocytes or macrophages is mediated by differential geranylgeranylation-dependent Rac1 activation
Article Snippet: To the RNA, the kit components RT-buffer (2 µl), dNTP-mix (2 µl; 0.5 mM), and “Omniscript Reverse Transcriptase” (1 µl; 4 U), as well as separately obtained “Rnasin Plus Rnase Inhibitor” (1 µl; 10 U; Promega GmbH, Mannheim, Germany) and oligo(dT)18 primer (2 µl; 1 µM; Fermentas) were added (total volume of 20 µl). .. Real-time PCR was conducted in a volume of 25 µl consisting of 2.5 µl cDNA, 12.5 µl “GoTaq qPCR Master Mix” (Promega; including the proprietary double-strand DNA stain), 0.5 µl sense primer, 0.5 µl antisense primer (0.25 µM each), and 9 µl DEPC-treated water.

Article Title: Comparison of human and murine enteroendocrine cells by transcriptomic and peptidomic profiling
Article Snippet: PFA-fixed cells were washed twice in nuclease free 1% w/v bovine serum albumin (BSA) in PBS, and if a FACS facility was not immediately available, were suspended in 1% w/v BSA and 4% v/v RNAsin plus RNAse inhibitor (Promega, WI, USA) in PBS at 4°C overnight. .. Cells were permeabilised with either a single 30 minute incubation with 0.1% v/v Triton x100 (Sigma-Aldrich) in 1% w/v BSA in PBS prior to antibody staining, or by the addition of 0.1% w/v Saponin (Sigma-Aldrich) to solutions in all steps from this point until after the first wash post-secondary antibody staining, with identical results.

Article Title: RNA Arbitrarily Primed PCR and Fourier Transform Infrared Spectroscopy Reveal Plasticity in the Acid Tolerance Response of Streptococcus macedonicus ▿
Article Snippet: In brief, first-stand cDNA synthesis was performed using 1 μg of heat-denatured (10 min, 70°C) total RNA in reaction mixtures containing 1.0 μM of the arbitrarily chosen primer (5′-CGTATTCATAAGCTTCTCCCGA-3′), 0.5 mM of each deoxynucleoside triphosphate, 40 U of RNasin Plus RNase inhibitor (Promega Corp., Madison, WI), and 1× reverse transcription (RT) reaction buffer. .. PCR thermal cycling was performed with one low-stringency cycle of 94°C for 3 min, 37°C for 5 min, and 72°C for 5 min, followed by 39 high-stringency cycles consisting of 94°C for 1 min, 47°C for 1 min, and 72°C for 1 min and a final extension at 72°C for 10 min. RAP-PCR products (8 μl) were separated on a 7% nondenaturing polyacrylamide sequencing gel, and cDNA bands were visualized after SYBR Gold staining (Molecular Probes Inc., Eugene, OR) with a Fluorchem 8800 (Alpha Innotech, CA) image analysis system.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 83
    Promega human placental rnase inhibitor
    Figure 4. <t>RNase</t> activity in the presence of human placental RNase inhibitor. RNase activity of ( A ) MN-IgG-RNase and ( B ) CTX-IgG-RNase was measured in the presence of RNase inhibitor. 10 −10 M RNase incubated with up to 50-fold molar excess of RI (RNasin). ( C ) Bovine RNase was tested as control.
    Human Placental Rnase Inhibitor, supplied by Promega, used in various techniques. Bioz Stars score: 83/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/human placental rnase inhibitor/product/Promega
    Average 83 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    human placental rnase inhibitor - by Bioz Stars, 2020-03
    83/100 stars
      Buy from Supplier

    99
    Promega rnasin plus rnase inhibitor
    FUS forms a complex with itself, PABP and RNA. ( A ) Co-immunoprecipitation of HA-FUS, Myc-FUS and PABP from HEK293T cells. Immunoprecipitation with a Myc (mouse anti-Myc, CST) antibody pulled down PABP (mouse anti-PABP, Sigma) along with anti-HA-FUS (rabbit HA, CST). <t>RNasin</t> was added to block all <t>RNase</t> activity. ( B ) The interaction between HA-FUS and Myc-FUS was not altered by the addition of RNase, while the co-immunoprecipitation of PABP was completely abolished. ( C ) Immunoprecipitation of FUS (mouse anti-FUS, Santa Cruz) from untransfected cells shows that endogenous FUS (rabbit anti-FUS, Novus Biologicals) also interacts with PABP (mouse anti-PABP, Sigma) and treatment with RNase shows that this interaction is also dependent on RNA. ( D ) Mock immunoprecipitation experiments with either untransfected cells or a single transfection of either HA-FUS WT or Myc-FUS WT with no antibody showed that neither endogenous nor tagged FUS binds to the beads. ( E ) Immunoprecipitation of single transfections with an antibody to the wrong tag showed that a Myc antibody does not pull down HA-FUS and a HA antibody does not precipitate Myc-FUS. FT indicates flow-through of proteins that did not bind to the beads.
    Rnasin Plus Rnase Inhibitor, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 187 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rnasin plus rnase inhibitor/product/Promega
    Average 99 stars, based on 187 article reviews
    Price from $9.99 to $1999.99
    rnasin plus rnase inhibitor - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    99
    Promega rnasin
    Assessment of modified intracellular staining buffers. (A) Comparison of high salt buffer to standard permeabilization buffer (PB). Polyclonally stimulated splenocytes from C57BL/6 mice underwent ICS using two buffer conditions as indicated. Cells were then analyzed by flow cytometry and the expression of various cytokines by CD4 + for gating strategy. (B) Quality of RNA isolated from cells permeabilized with high salt buffer. CD4 + T cells were purified from naïve splenocytes, fixed with paraformaldehyde and permeabilized with high salt buffer. The cells were incubated for 16 hours in the same buffer before RNA isolation. Quality of isolated RNA was assessed by Agilent Bioanalyzer nano chips. nt, nucleotide, L, ladder; S, test sample. The number below the lane indicates corresponding RIN. (C) The experiments were performed as in Panel B except cells were permeabilized and incubated in permeabilization buffer containing <t>RNase</t> inhibitor. (D) CD4 + T cells isolated from naïve murine spleens underwent polyclonal stimulation and ICS staining for IFNγ using a permeabilization buffer containing RNase inhibitor. The cells were then analyzed with FACS Aria and IFNγ-producing CD4 + T cells were sorted into collection buffer containing 0.5 U/ml of RNase inhibitor. Quality of isolated RNA was assessed by Agilent Bioanalyzer pico chips which allows analysis of samples with low RNA concentration (0.05 – 5 ng/μl. s, seconds; L, ladder; S, test sample. The number below the lane indicates corresponding RIN. Results shown represent two independent experiments with n = 3 except the sorting experiments described in panel D which represents two independent experiments with n = 2.
    Rnasin, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 1171 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rnasin/product/Promega
    Average 99 stars, based on 1171 article reviews
    Price from $9.99 to $1999.99
    rnasin - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    Image Search Results


    Figure 4. RNase activity in the presence of human placental RNase inhibitor. RNase activity of ( A ) MN-IgG-RNase and ( B ) CTX-IgG-RNase was measured in the presence of RNase inhibitor. 10 −10 M RNase incubated with up to 50-fold molar excess of RI (RNasin). ( C ) Bovine RNase was tested as control.

    Journal: mAbs

    Article Title: Evaluation of human pancreatic RNase as effector molecule in a therapeutic antibody platform

    doi: 10.4161/mabs.27830

    Figure Lengend Snippet: Figure 4. RNase activity in the presence of human placental RNase inhibitor. RNase activity of ( A ) MN-IgG-RNase and ( B ) CTX-IgG-RNase was measured in the presence of RNase inhibitor. 10 −10 M RNase incubated with up to 50-fold molar excess of RI (RNasin). ( C ) Bovine RNase was tested as control.

    Article Snippet: In addition, RNase activity of MN-IgG-RNase was also tested in the presence of a concentration series of up to 50 fold molar excess of human placental RNase inhibitor (RNasin Plus, Promega).

    Techniques: Activity Assay, Incubation

    FUS forms a complex with itself, PABP and RNA. ( A ) Co-immunoprecipitation of HA-FUS, Myc-FUS and PABP from HEK293T cells. Immunoprecipitation with a Myc (mouse anti-Myc, CST) antibody pulled down PABP (mouse anti-PABP, Sigma) along with anti-HA-FUS (rabbit HA, CST). RNasin was added to block all RNase activity. ( B ) The interaction between HA-FUS and Myc-FUS was not altered by the addition of RNase, while the co-immunoprecipitation of PABP was completely abolished. ( C ) Immunoprecipitation of FUS (mouse anti-FUS, Santa Cruz) from untransfected cells shows that endogenous FUS (rabbit anti-FUS, Novus Biologicals) also interacts with PABP (mouse anti-PABP, Sigma) and treatment with RNase shows that this interaction is also dependent on RNA. ( D ) Mock immunoprecipitation experiments with either untransfected cells or a single transfection of either HA-FUS WT or Myc-FUS WT with no antibody showed that neither endogenous nor tagged FUS binds to the beads. ( E ) Immunoprecipitation of single transfections with an antibody to the wrong tag showed that a Myc antibody does not pull down HA-FUS and a HA antibody does not precipitate Myc-FUS. FT indicates flow-through of proteins that did not bind to the beads.

    Journal: Human Molecular Genetics

    Article Title: ALS mutant FUS disrupts nuclear localization and sequesters wild-type FUS within cytoplasmic stress granules

    doi: 10.1093/hmg/ddt117

    Figure Lengend Snippet: FUS forms a complex with itself, PABP and RNA. ( A ) Co-immunoprecipitation of HA-FUS, Myc-FUS and PABP from HEK293T cells. Immunoprecipitation with a Myc (mouse anti-Myc, CST) antibody pulled down PABP (mouse anti-PABP, Sigma) along with anti-HA-FUS (rabbit HA, CST). RNasin was added to block all RNase activity. ( B ) The interaction between HA-FUS and Myc-FUS was not altered by the addition of RNase, while the co-immunoprecipitation of PABP was completely abolished. ( C ) Immunoprecipitation of FUS (mouse anti-FUS, Santa Cruz) from untransfected cells shows that endogenous FUS (rabbit anti-FUS, Novus Biologicals) also interacts with PABP (mouse anti-PABP, Sigma) and treatment with RNase shows that this interaction is also dependent on RNA. ( D ) Mock immunoprecipitation experiments with either untransfected cells or a single transfection of either HA-FUS WT or Myc-FUS WT with no antibody showed that neither endogenous nor tagged FUS binds to the beads. ( E ) Immunoprecipitation of single transfections with an antibody to the wrong tag showed that a Myc antibody does not pull down HA-FUS and a HA antibody does not precipitate Myc-FUS. FT indicates flow-through of proteins that did not bind to the beads.

    Article Snippet: 5 µl of an RNase A/T1 mix (Fermentas, Yorkshire, UK) or RNasin Plus RNase inhibitor (Promega, Southampton, UK) was added to the tubes and incubated at 37°C for 5 min, then placed back on ice.

    Techniques: Immunoprecipitation, Blocking Assay, Activity Assay, Transfection, Flow Cytometry

    Type I interferon responses of chicken cells stimulated with ssRNA and dsRNA analogues. The effect of dsRNA and ssRNA (A to D), of triphosphorylated ssRNA (E to G), and of AIV (H) on IFN-β promoter induction (A, B, E, F, and H) and on type I chIFN bioactivity (C, D, and G) were analyzed in chicken DF-1 fibroblast cells (A, C, F, and H), in chicken macrophage-like HD-11 cells (D and G), and in human HEK293T cells (B and E). The induction of the IFN-β promoter-dependent firefly luciferase was normalized to that of Renilla luciferase and expressed as fold induction compared to that of unstimulated cells. The type I chIFN in the supernatant was quantified with the bioassay. For the analysis of type I IFN induction by dsRNA and ssRNA (A to D), the cells were stimulated with 2 μg/ml (high dose) and 0.5 μg/ml (low dose) of p(I:C) or t-p(I:C), with 1 μg/ml (high dose) and 0.25 μg/ml (low dose) of t-IVT-RNA, or with synthetic ssRNA of the same sequence (t-ssRNA). (E to G) The IVT-RNA and ssRNA concentrations were 0.25 μg/ml for DF-1 and HD-11 cells and 1 μg/ml for HEK293T cells. The cells were stimulated with t-IVT-RNA or with t-ssRNA that were previously dephosphorylated with calf intestinal phosphatase (CIP+) or digested with an RNase cocktail (RNase+) or the untreated RNAs (−), as indicated. (H) DF-1 cells were transfected with chIFN-β promoter reporters prior to infection with AIV. The data are representative of at least two independent experiments performed in triplicate wells, with the bars representing the mean values and the error bars showing the standard deviations.

    Journal: Journal of Virology

    Article Title: Chicken Cells Sense Influenza A Virus Infection through MDA5 and CARDIF Signaling Involving LGP2

    doi: 10.1128/JVI.00742-11

    Figure Lengend Snippet: Type I interferon responses of chicken cells stimulated with ssRNA and dsRNA analogues. The effect of dsRNA and ssRNA (A to D), of triphosphorylated ssRNA (E to G), and of AIV (H) on IFN-β promoter induction (A, B, E, F, and H) and on type I chIFN bioactivity (C, D, and G) were analyzed in chicken DF-1 fibroblast cells (A, C, F, and H), in chicken macrophage-like HD-11 cells (D and G), and in human HEK293T cells (B and E). The induction of the IFN-β promoter-dependent firefly luciferase was normalized to that of Renilla luciferase and expressed as fold induction compared to that of unstimulated cells. The type I chIFN in the supernatant was quantified with the bioassay. For the analysis of type I IFN induction by dsRNA and ssRNA (A to D), the cells were stimulated with 2 μg/ml (high dose) and 0.5 μg/ml (low dose) of p(I:C) or t-p(I:C), with 1 μg/ml (high dose) and 0.25 μg/ml (low dose) of t-IVT-RNA, or with synthetic ssRNA of the same sequence (t-ssRNA). (E to G) The IVT-RNA and ssRNA concentrations were 0.25 μg/ml for DF-1 and HD-11 cells and 1 μg/ml for HEK293T cells. The cells were stimulated with t-IVT-RNA or with t-ssRNA that were previously dephosphorylated with calf intestinal phosphatase (CIP+) or digested with an RNase cocktail (RNase+) or the untreated RNAs (−), as indicated. (H) DF-1 cells were transfected with chIFN-β promoter reporters prior to infection with AIV. The data are representative of at least two independent experiments performed in triplicate wells, with the bars representing the mean values and the error bars showing the standard deviations.

    Article Snippet: RNA was extracted using TRIzol (Invitrogen), DNase I (Ambion), and RNase inhibitor (RNasin Plus; Promega) or with the Nucleospin RNA II kit (Macherey-Nagel) and amplified with the SuperScript III platinum one-step quantitative RT-PCR system (Invitrogen) using oligonucleotide primers and probes ( ) purchased from Microsynth.

    Techniques: Luciferase, Sequencing, Transfection, Infection

    Assessment of modified intracellular staining buffers. (A) Comparison of high salt buffer to standard permeabilization buffer (PB). Polyclonally stimulated splenocytes from C57BL/6 mice underwent ICS using two buffer conditions as indicated. Cells were then analyzed by flow cytometry and the expression of various cytokines by CD4 + for gating strategy. (B) Quality of RNA isolated from cells permeabilized with high salt buffer. CD4 + T cells were purified from naïve splenocytes, fixed with paraformaldehyde and permeabilized with high salt buffer. The cells were incubated for 16 hours in the same buffer before RNA isolation. Quality of isolated RNA was assessed by Agilent Bioanalyzer nano chips. nt, nucleotide, L, ladder; S, test sample. The number below the lane indicates corresponding RIN. (C) The experiments were performed as in Panel B except cells were permeabilized and incubated in permeabilization buffer containing RNase inhibitor. (D) CD4 + T cells isolated from naïve murine spleens underwent polyclonal stimulation and ICS staining for IFNγ using a permeabilization buffer containing RNase inhibitor. The cells were then analyzed with FACS Aria and IFNγ-producing CD4 + T cells were sorted into collection buffer containing 0.5 U/ml of RNase inhibitor. Quality of isolated RNA was assessed by Agilent Bioanalyzer pico chips which allows analysis of samples with low RNA concentration (0.05 – 5 ng/μl. s, seconds; L, ladder; S, test sample. The number below the lane indicates corresponding RIN. Results shown represent two independent experiments with n = 3 except the sorting experiments described in panel D which represents two independent experiments with n = 2.

    Journal: Journal of immunological methods

    Article Title: Isolation of intact RNA from murine CD4+ T cells after intracellular cytokine staining and fluorescence-activated cell sorting

    doi: 10.1016/j.jim.2018.02.008

    Figure Lengend Snippet: Assessment of modified intracellular staining buffers. (A) Comparison of high salt buffer to standard permeabilization buffer (PB). Polyclonally stimulated splenocytes from C57BL/6 mice underwent ICS using two buffer conditions as indicated. Cells were then analyzed by flow cytometry and the expression of various cytokines by CD4 + for gating strategy. (B) Quality of RNA isolated from cells permeabilized with high salt buffer. CD4 + T cells were purified from naïve splenocytes, fixed with paraformaldehyde and permeabilized with high salt buffer. The cells were incubated for 16 hours in the same buffer before RNA isolation. Quality of isolated RNA was assessed by Agilent Bioanalyzer nano chips. nt, nucleotide, L, ladder; S, test sample. The number below the lane indicates corresponding RIN. (C) The experiments were performed as in Panel B except cells were permeabilized and incubated in permeabilization buffer containing RNase inhibitor. (D) CD4 + T cells isolated from naïve murine spleens underwent polyclonal stimulation and ICS staining for IFNγ using a permeabilization buffer containing RNase inhibitor. The cells were then analyzed with FACS Aria and IFNγ-producing CD4 + T cells were sorted into collection buffer containing 0.5 U/ml of RNase inhibitor. Quality of isolated RNA was assessed by Agilent Bioanalyzer pico chips which allows analysis of samples with low RNA concentration (0.05 – 5 ng/μl. s, seconds; L, ladder; S, test sample. The number below the lane indicates corresponding RIN. Results shown represent two independent experiments with n = 3 except the sorting experiments described in panel D which represents two independent experiments with n = 2.

    Article Snippet: For experiments involving buffer containing RNasin (RNasin® Plus RNase Inhibitor, Promega) , the cells were permeabilized, blocked and stained in RNasin containing buffer ( ).

    Techniques: Modification, Staining, Mouse Assay, Flow Cytometry, Cytometry, Expressing, Isolation, Purification, Incubation, FACS, Concentration Assay