Structured Review

Promega rnasea
RT-PCR after removal of ssRNA using <t>RNAseA</t> to demonstrate the presence of annealed <t>v-ATPaseA</t> and GFP dsRNA in transplastomic plants. 1, WT plant; 2, v-ATPAseA dsRNA producing plant; 3, GFP dsRNA producing plant; and 4, No template control. Tobacco EF1-α gene specific primers were used to ensure that all ssRNA was removed by the RNAseA treatment.
Rnasea, supplied by Promega, used in various techniques. Bioz Stars score: 93/100, based on 43 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rnasea/product/Promega
Average 93 stars, based on 43 article reviews
Price from $9.99 to $1999.99
rnasea - by Bioz Stars, 2020-09
93/100 stars

Images

1) Product Images from "RNA Interference in the Tobacco Hornworm, Manduca sexta, Using Plastid-Encoded Long Double-Stranded RNA"

Article Title: RNA Interference in the Tobacco Hornworm, Manduca sexta, Using Plastid-Encoded Long Double-Stranded RNA

Journal: Frontiers in Plant Science

doi: 10.3389/fpls.2019.00313

RT-PCR after removal of ssRNA using RNAseA to demonstrate the presence of annealed v-ATPaseA and GFP dsRNA in transplastomic plants. 1, WT plant; 2, v-ATPAseA dsRNA producing plant; 3, GFP dsRNA producing plant; and 4, No template control. Tobacco EF1-α gene specific primers were used to ensure that all ssRNA was removed by the RNAseA treatment.
Figure Legend Snippet: RT-PCR after removal of ssRNA using RNAseA to demonstrate the presence of annealed v-ATPaseA and GFP dsRNA in transplastomic plants. 1, WT plant; 2, v-ATPAseA dsRNA producing plant; 3, GFP dsRNA producing plant; and 4, No template control. Tobacco EF1-α gene specific primers were used to ensure that all ssRNA was removed by the RNAseA treatment.

Techniques Used: Reverse Transcription Polymerase Chain Reaction

Related Articles

MTT Assay:

Article Title: Tumor Necrosis Factor-α Sensitizes Breast Cancer Cells to Natural Products with Proteasome-Inhibitory Activity Leading to Apoptosis
Article Snippet: .. Bisbenzimide, methylene blue, 3-[4, 5-dimethyltiazol-2-yl]-2.5-diphenyl-tetrazolium bromide (MTT), RNaseA, reverse transcription and real-time quantitative polymerase chain reaction (RT-qPCR) kits were purchased from Promega (San Luis Obispo, CA, USA). .. Ac-Asp-Glu-Val-Asp-AMC and Z-Gly-Gly-Leu-AMC, the substrates for caspase-3 and the chymotrypsin (CT)-like activities respectively were obtained from Calbiochem Inc. (San Diego, CA).

Quantitative RT-PCR:

Article Title: Tumor Necrosis Factor-α Sensitizes Breast Cancer Cells to Natural Products with Proteasome-Inhibitory Activity Leading to Apoptosis
Article Snippet: .. Bisbenzimide, methylene blue, 3-[4, 5-dimethyltiazol-2-yl]-2.5-diphenyl-tetrazolium bromide (MTT), RNaseA, reverse transcription and real-time quantitative polymerase chain reaction (RT-qPCR) kits were purchased from Promega (San Luis Obispo, CA, USA). .. Ac-Asp-Glu-Val-Asp-AMC and Z-Gly-Gly-Leu-AMC, the substrates for caspase-3 and the chymotrypsin (CT)-like activities respectively were obtained from Calbiochem Inc. (San Diego, CA).

Real-time Polymerase Chain Reaction:

Article Title: Tumor Necrosis Factor-α Sensitizes Breast Cancer Cells to Natural Products with Proteasome-Inhibitory Activity Leading to Apoptosis
Article Snippet: .. Bisbenzimide, methylene blue, 3-[4, 5-dimethyltiazol-2-yl]-2.5-diphenyl-tetrazolium bromide (MTT), RNaseA, reverse transcription and real-time quantitative polymerase chain reaction (RT-qPCR) kits were purchased from Promega (San Luis Obispo, CA, USA). .. Ac-Asp-Glu-Val-Asp-AMC and Z-Gly-Gly-Leu-AMC, the substrates for caspase-3 and the chymotrypsin (CT)-like activities respectively were obtained from Calbiochem Inc. (San Diego, CA).

Concentration Assay:

Article Title: Trypanosome CNOT10 is essential for the integrity of the NOT deadenylase complex and for degradation of many mRNAs
Article Snippet: .. To test the RNA dependence of interactions, RNaseA was added to the lysis and wash buffers at a concentration of 200 µg/ml, with or without RNasin® Ribonuclease inhibitor (Promega) at a concentration of 48 µg/ml. .. For IP, 30 µl of anti-V5-antibody- or anti-c-myc-antibody-coupled agarose (both from Bethyl Laboratories) was washed four times with 1× phosphate buffered saline (PBS) and once with IP lysis buffer adjusted to 180 mM NaCl at 4°C, with centrifugation at 0.9 × g for 2 min. A sample equivalent to 5 × 105 cells was taken from the input lysate and 2× Laemmli buffer was added.

Incubation:

Article Title: Comparison Between Several Integrase-defective Lentiviral Vectors Reveals Increased Integration of an HIV Vector Bearing a D167H Mutant
Article Snippet: .. Concentrated viral suspension (2 µl) was suspended in 353 µl DNase- and RNase-free water, 5 µl of DNAseI and 50 pg of RNaseA, and incubated for 10 minutes at room temperature before adding 20 µl of RNasin (Promega, Madison, WI). .. The mixture was incubated for 10 minutes at 37 °C, and DNase was inactivated by addition of 10 µl of 25 mmol/l EDTA and heating at 70 °C for 10 minutes.

Article Title: Self-replication of DNA by its encoded proteins in liposome-based synthetic cells
Article Snippet: .. Then, RNA was removed by addition of 2 µL of 5–10 U/µL RNaseONETM (Promega) and 2 µL of 4 mg/mL RNaseA (Promega) followed by an incubation step at 30 °C for 40 min. RNase treatment was stopped by addition of 12 µL STOP mix. .. The control samples were subsequently incubated with 2 µL of 0.1 mg/mL Proteinase K to remove all proteins attached to the DNA.

Article Title: The Role of HOXB9 and miR-196a in Head and Neck Squamous Cell Carcinoma
Article Snippet: .. Nested primers were designed to give a 295bp product within this transcript (forward: 5’ AAAGTCAGGGCAGGAGAGGGAAGGGGAA 3’, reverse: 5’ CAATTTGCCAGCCCTATGAAGTCTGCT 3’), with RNaseA treated (RNA was incubated for 1 hour at 37°C with 100μg/ml RNaseA (Promega, Southampton, UK) and no-reverse transcriptase (RT) controls. .. The PCR products were separated on a 2% (w/v) agarose gel, visualised under UV transillumination and purified using gel extraction kit (Bioline, London, UK).

Article Title: DVL1 and DVL3 differentially localize to CYP19A1 promoters and regulate aromatase mRNA in breast cancer cells
Article Snippet: .. Crosslinks were reversed overnight at 65°C, followed by RNAseA (Promega) at 37°C for 2 hours, and proteinase K incubation (Promega) at 55°C for 2 hours. .. DNA was eluted using Qiaquick PCR purification kit (Qiagen) and amplified by PCR (Table ).

Lysis:

Article Title: Trypanosome CNOT10 is essential for the integrity of the NOT deadenylase complex and for degradation of many mRNAs
Article Snippet: .. To test the RNA dependence of interactions, RNaseA was added to the lysis and wash buffers at a concentration of 200 µg/ml, with or without RNasin® Ribonuclease inhibitor (Promega) at a concentration of 48 µg/ml. .. For IP, 30 µl of anti-V5-antibody- or anti-c-myc-antibody-coupled agarose (both from Bethyl Laboratories) was washed four times with 1× phosphate buffered saline (PBS) and once with IP lysis buffer adjusted to 180 mM NaCl at 4°C, with centrifugation at 0.9 × g for 2 min. A sample equivalent to 5 × 105 cells was taken from the input lysate and 2× Laemmli buffer was added.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92
    Promega rnase h
    Fig. 7.  Extent of RNA hybridized to switch DNA sequences in the presence and absence of DNA gyrase. The RNA species were radiolabeled internally with [α– 32 P]UTP during RNA–DNA hybrid formation. Transcription was performed with supercoiled pGD44 (lanes 1–3), pGD231 (lanes 4–6), pSG3-2 (lanes 7–9) or pGD100 (lanes 10–12). pGD44 contains 900 bp of Sμ, pGD231 contains 2.2 kb of Sγ3, pSG3-2 contains 129 bp of Sγ3 and pGD100 contains 832 bp of Sγ2b. Lanes 1, 4, 7 and 10 are plasmids transcribed in the absence of DNA gyrase; lanes 2, 5, 8 and 11 are plasmids transcribed in the presence of DNA gyrase; lanes 3, 6, 9 and 12 are plasmids transcribed in the presence of DNA gyrase and then treated with RNase H. M designates a 1 kb ladder.
    Rnase H, supplied by Promega, used in various techniques. Bioz Stars score: 92/100, based on 71 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rnase h/product/Promega
    Average 92 stars, based on 71 article reviews
    Price from $9.99 to $1999.99
    rnase h - by Bioz Stars, 2020-09
    92/100 stars
      Buy from Supplier

    92
    Promega rnase free dnase
    Individual poly(A) site validation. ( A ) Outline of experiment. mRNAs are reverse-transcribed using a pool of poly(T)-derived primers containing a sequence of 17 T, with an adaptor sequence in its 5′ end, and a one-nucleotide anchor in its 3′ end (A, G or C). (A) The PCR amplification is done with a forward gene-specific primer for each tested poly(A) site (SP1 or SP2) and the adaptor primer (AP) as a reverse primer and the PCR product are resolved on agarose gel. ( B ) When no satisfying result is obtained, a reverse gene-specific primer is also designed (SRP1 or SRP2) that overlaps part of the poly(A) tail and the sequence just upstream the poly(A) site. B: Controls. Quality of samples was assessed by PCR amplification with primers for beta actin. mRNAs were treated with a <t>RNAse-free</t> <t>DNAse</t> and cDNAs were prepared with reverse transcriptase (D for cDNA) or without (R for RT-). NTC stands for ‘no template control.’ Expected size: 651 bp. ( C ) Absence of amplification using primers downstream of poly(A) site. A PCR amplification was performed using the primers designed to validate the last poly(A) site, (Cpeb2, PAS2 [649 bp expected] and Atp9a, PAS2 [516 bp expected]) or primers downstream of this last poly(A) site, i.e. located in intergenic DNA (Cpeb2, genomic [360 bp expected] and Atp9a, genomic [434 bp expected]). Templates were cDNAs prepared with reverse transcriptase (cDNA) or without (RT-), or genomic DNA (GEN). NTC stands for ‘no template control.’ ( D ) Example. RT-PCR is performed as described from the three pools of cDNAs (A, B or C) for the two NM_175294 tested isoforms corresponding to use of poly(A) sites 4 (399 bp expected) and 6 (573 bp expected). Templates were cDNAs prepared with reverse transcriptase (cDNA) or without (RT-). NTC stands for ‘no template control’.
    Rnase Free Dnase, supplied by Promega, used in various techniques. Bioz Stars score: 92/100, based on 633 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rnase free dnase/product/Promega
    Average 92 stars, based on 633 article reviews
    Price from $9.99 to $1999.99
    rnase free dnase - by Bioz Stars, 2020-09
    92/100 stars
      Buy from Supplier

    85
    Promega rnase protection assay rpa complementary dna
    <t>RNase</t> protection assay with the set of coagulation/fibrinolytic genes. (a) Typical eight-band protection pattern resulting from the analysis of 5 μg of mouse-skin total RNA. (b) Kidney RNA prepared from various knockout (KO) mice ( PAI1- , UPA-, or PAR1 -deficient mice) and from wild-type (WT) mice, analyzed using <t>RPA.</t> (c) Kidney RNA prepared from lipopolysaccharide (LPS)-treated or untreated mice, analyzed using RPA. (d) RNA from murine hypoxic or normal endothelial cells, analyzed using RPA. In all these RPA experiments, 5 μg of total RNA/lane was analyzed.
    Rnase Protection Assay Rpa Complementary Dna, supplied by Promega, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rnase protection assay rpa complementary dna/product/Promega
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    rnase protection assay rpa complementary dna - by Bioz Stars, 2020-09
    85/100 stars
      Buy from Supplier

    92
    Promega rnase t1
    Enzymatic structure probing of the JN2C and shorter JN2C-derived RNA fragments. ( A ) Schematic representation of the folding trajectories, in which the A nucleotides can base pair with B , resulting in the boldface/italics loop, or B with C , resulting in the boldface/underlined loop. In the kinetic experiments there should not be an interchange between the two mutually exclusive structures, while in the thermodynamic experiments they should be in equilibrium. The dashed lines delimit the size of the two smaller JN2C-derived 5′ and 3′ end hairpin fragments. Δ G values were calculated using RNA-fold ( ) ( B ) Structure probing of JN2C and JN2C-derived fragments. CK is the control lane (without enzyme) for the kinetic probings and CT for the thermodynamic ones. K indicates the kinetic probing experiments and T the thermodynamic ones. Al is alkaline hydrolysis, T1D is digestion with <t>RNase</t> T1 under denaturing conditions, T1, V1 and T2 represent digestions with RNases T1, V1 and T2 under native conditions. Probing times are 5 and 15 min. The brackets indicate the position of the hairpin loops and single-stranded regions and the letters A , B and C indicate their respective positions in (A).
    Rnase T1, supplied by Promega, used in various techniques. Bioz Stars score: 92/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rnase t1/product/Promega
    Average 92 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    rnase t1 - by Bioz Stars, 2020-09
    92/100 stars
      Buy from Supplier

    Image Search Results


    Fig. 7.  Extent of RNA hybridized to switch DNA sequences in the presence and absence of DNA gyrase. The RNA species were radiolabeled internally with [α– 32 P]UTP during RNA–DNA hybrid formation. Transcription was performed with supercoiled pGD44 (lanes 1–3), pGD231 (lanes 4–6), pSG3-2 (lanes 7–9) or pGD100 (lanes 10–12). pGD44 contains 900 bp of Sμ, pGD231 contains 2.2 kb of Sγ3, pSG3-2 contains 129 bp of Sγ3 and pGD100 contains 832 bp of Sγ2b. Lanes 1, 4, 7 and 10 are plasmids transcribed in the absence of DNA gyrase; lanes 2, 5, 8 and 11 are plasmids transcribed in the presence of DNA gyrase; lanes 3, 6, 9 and 12 are plasmids transcribed in the presence of DNA gyrase and then treated with RNase H. M designates a 1 kb ladder.

    Journal: The EMBO Journal

    Article Title: Transcription-dependent R-loop formation at mammalian class switch sequences

    doi: 10.1093/emboj/19.5.1055

    Figure Lengend Snippet: Fig. 7. Extent of RNA hybridized to switch DNA sequences in the presence and absence of DNA gyrase. The RNA species were radiolabeled internally with [α– 32 P]UTP during RNA–DNA hybrid formation. Transcription was performed with supercoiled pGD44 (lanes 1–3), pGD231 (lanes 4–6), pSG3-2 (lanes 7–9) or pGD100 (lanes 10–12). pGD44 contains 900 bp of Sμ, pGD231 contains 2.2 kb of Sγ3, pSG3-2 contains 129 bp of Sγ3 and pGD100 contains 832 bp of Sγ2b. Lanes 1, 4, 7 and 10 are plasmids transcribed in the absence of DNA gyrase; lanes 2, 5, 8 and 11 are plasmids transcribed in the presence of DNA gyrase; lanes 3, 6, 9 and 12 are plasmids transcribed in the presence of DNA gyrase and then treated with RNase H. M designates a 1 kb ladder.

    Article Snippet: T3 and T7 RNA polymerases, and RNase H were purchased from Promega (Madison, WI).

    Techniques:

    Fig. 1.  Altered DNA mobility upon  in vitro  transcription of murine class switch sequences Sμ, Sγ3 and Sγ2b. ( A ) Diagram of switch sequences on plasmids showing the direction of physiological transcription. The bent arrows indicate the direction of transcription by either T3 or T7 RNA polymerase. ( B ) Supercoiled plasmid DNA containing either a 900 bp fragment of Sμ (pGD44), a 2.2 kb fragment of Sγ3 (pGD231), a 267 bp fragment of Sγ3 (pSG3-5), a 129 bp fragment of Sγ3 (pSG3-2), an 832 bp fragment of Sγ2b (pGD100) or a 564 bp  Hin dIII fragment from λ phage (pTWEL5) was transcribed, treated with RNase A, run out on a 1% agarose gel and post-stained with ethidium bromide as described in Materials and methods. Lanes 1, 4, 7, 10, 13 and 16 are non-transcribed plasmids; lanes 2, 5, 8, 11, 14 and 17 are plasmids transcribed with T7 RNA polymerase; lanes 3, 6, 9, 12, 15 and 18 are plasmids transcribed with T7 RNA polymerase and treated with RNase H. A 1 kb ladder (Gibco-BRL) was used as a molecular weight marker (M). The positions of supercoiled (SC) and nicked circular (NC) forms of the plasmids are indicated. ( C ) Radioactive image of the gel shown in (B).

    Journal: The EMBO Journal

    Article Title: Transcription-dependent R-loop formation at mammalian class switch sequences

    doi: 10.1093/emboj/19.5.1055

    Figure Lengend Snippet: Fig. 1. Altered DNA mobility upon in vitro transcription of murine class switch sequences Sμ, Sγ3 and Sγ2b. ( A ) Diagram of switch sequences on plasmids showing the direction of physiological transcription. The bent arrows indicate the direction of transcription by either T3 or T7 RNA polymerase. ( B ) Supercoiled plasmid DNA containing either a 900 bp fragment of Sμ (pGD44), a 2.2 kb fragment of Sγ3 (pGD231), a 267 bp fragment of Sγ3 (pSG3-5), a 129 bp fragment of Sγ3 (pSG3-2), an 832 bp fragment of Sγ2b (pGD100) or a 564 bp Hin dIII fragment from λ phage (pTWEL5) was transcribed, treated with RNase A, run out on a 1% agarose gel and post-stained with ethidium bromide as described in Materials and methods. Lanes 1, 4, 7, 10, 13 and 16 are non-transcribed plasmids; lanes 2, 5, 8, 11, 14 and 17 are plasmids transcribed with T7 RNA polymerase; lanes 3, 6, 9, 12, 15 and 18 are plasmids transcribed with T7 RNA polymerase and treated with RNase H. A 1 kb ladder (Gibco-BRL) was used as a molecular weight marker (M). The positions of supercoiled (SC) and nicked circular (NC) forms of the plasmids are indicated. ( C ) Radioactive image of the gel shown in (B).

    Article Snippet: T3 and T7 RNA polymerases, and RNase H were purchased from Promega (Madison, WI).

    Techniques: In Vitro, Plasmid Preparation, Agarose Gel Electrophoresis, Staining, Molecular Weight, Marker

    Individual poly(A) site validation. ( A ) Outline of experiment. mRNAs are reverse-transcribed using a pool of poly(T)-derived primers containing a sequence of 17 T, with an adaptor sequence in its 5′ end, and a one-nucleotide anchor in its 3′ end (A, G or C). (A) The PCR amplification is done with a forward gene-specific primer for each tested poly(A) site (SP1 or SP2) and the adaptor primer (AP) as a reverse primer and the PCR product are resolved on agarose gel. ( B ) When no satisfying result is obtained, a reverse gene-specific primer is also designed (SRP1 or SRP2) that overlaps part of the poly(A) tail and the sequence just upstream the poly(A) site. B: Controls. Quality of samples was assessed by PCR amplification with primers for beta actin. mRNAs were treated with a RNAse-free DNAse and cDNAs were prepared with reverse transcriptase (D for cDNA) or without (R for RT-). NTC stands for ‘no template control.’ Expected size: 651 bp. ( C ) Absence of amplification using primers downstream of poly(A) site. A PCR amplification was performed using the primers designed to validate the last poly(A) site, (Cpeb2, PAS2 [649 bp expected] and Atp9a, PAS2 [516 bp expected]) or primers downstream of this last poly(A) site, i.e. located in intergenic DNA (Cpeb2, genomic [360 bp expected] and Atp9a, genomic [434 bp expected]). Templates were cDNAs prepared with reverse transcriptase (cDNA) or without (RT-), or genomic DNA (GEN). NTC stands for ‘no template control.’ ( D ) Example. RT-PCR is performed as described from the three pools of cDNAs (A, B or C) for the two NM_175294 tested isoforms corresponding to use of poly(A) sites 4 (399 bp expected) and 6 (573 bp expected). Templates were cDNAs prepared with reverse transcriptase (cDNA) or without (RT-). NTC stands for ‘no template control’.

    Journal: Nucleic Acids Research

    Article Title: Beyond the 3? end: experimental validation of extended transcript isoforms

    doi: 10.1093/nar/gkm062

    Figure Lengend Snippet: Individual poly(A) site validation. ( A ) Outline of experiment. mRNAs are reverse-transcribed using a pool of poly(T)-derived primers containing a sequence of 17 T, with an adaptor sequence in its 5′ end, and a one-nucleotide anchor in its 3′ end (A, G or C). (A) The PCR amplification is done with a forward gene-specific primer for each tested poly(A) site (SP1 or SP2) and the adaptor primer (AP) as a reverse primer and the PCR product are resolved on agarose gel. ( B ) When no satisfying result is obtained, a reverse gene-specific primer is also designed (SRP1 or SRP2) that overlaps part of the poly(A) tail and the sequence just upstream the poly(A) site. B: Controls. Quality of samples was assessed by PCR amplification with primers for beta actin. mRNAs were treated with a RNAse-free DNAse and cDNAs were prepared with reverse transcriptase (D for cDNA) or without (R for RT-). NTC stands for ‘no template control.’ Expected size: 651 bp. ( C ) Absence of amplification using primers downstream of poly(A) site. A PCR amplification was performed using the primers designed to validate the last poly(A) site, (Cpeb2, PAS2 [649 bp expected] and Atp9a, PAS2 [516 bp expected]) or primers downstream of this last poly(A) site, i.e. located in intergenic DNA (Cpeb2, genomic [360 bp expected] and Atp9a, genomic [434 bp expected]). Templates were cDNAs prepared with reverse transcriptase (cDNA) or without (RT-), or genomic DNA (GEN). NTC stands for ‘no template control.’ ( D ) Example. RT-PCR is performed as described from the three pools of cDNAs (A, B or C) for the two NM_175294 tested isoforms corresponding to use of poly(A) sites 4 (399 bp expected) and 6 (573 bp expected). Templates were cDNAs prepared with reverse transcriptase (cDNA) or without (RT-). NTC stands for ‘no template control’.

    Article Snippet: First, total mRNAs were extracted from different cell lines, treated with a RNAse-free DNAse to remove genomic DNA contamination, and reverse-transcribed using a pool of poly(T)-derived primers containing a sequence of 17 T, a 5′ adaptor sequence and a one-nucleotide anchor at the 3′ end (mixed A, G or C).

    Techniques: Derivative Assay, Sequencing, Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis, Reverse Transcription Polymerase Chain Reaction

    RNase protection assay with the set of coagulation/fibrinolytic genes. (a) Typical eight-band protection pattern resulting from the analysis of 5 μg of mouse-skin total RNA. (b) Kidney RNA prepared from various knockout (KO) mice ( PAI1- , UPA-, or PAR1 -deficient mice) and from wild-type (WT) mice, analyzed using RPA. (c) Kidney RNA prepared from lipopolysaccharide (LPS)-treated or untreated mice, analyzed using RPA. (d) RNA from murine hypoxic or normal endothelial cells, analyzed using RPA. In all these RPA experiments, 5 μg of total RNA/lane was analyzed.

    Journal: Arthritis Research

    Article Title: Enhanced expression of genes involved in coagulation and fibrinolysis in murine arthritis

    doi:

    Figure Lengend Snippet: RNase protection assay with the set of coagulation/fibrinolytic genes. (a) Typical eight-band protection pattern resulting from the analysis of 5 μg of mouse-skin total RNA. (b) Kidney RNA prepared from various knockout (KO) mice ( PAI1- , UPA-, or PAR1 -deficient mice) and from wild-type (WT) mice, analyzed using RPA. (c) Kidney RNA prepared from lipopolysaccharide (LPS)-treated or untreated mice, analyzed using RPA. (d) RNA from murine hypoxic or normal endothelial cells, analyzed using RPA. In all these RPA experiments, 5 μg of total RNA/lane was analyzed.

    Article Snippet: DNA template set preparation for RNase protection assay (RPA) Complementary DNA (cDNA) fragments of a different size for each of the chosen genes were recovered by reverse transcriptase-polymerase chain reaction (RT-PCR) and subsequently subcloned into the pGEM-T plasmid (Promega, Wallisen, Switzerland).

    Techniques: Rnase Protection Assay, Coagulation, Knock-Out, Mouse Assay, Recombinase Polymerase Amplification

    Enzymatic structure probing of the JN2C and shorter JN2C-derived RNA fragments. ( A ) Schematic representation of the folding trajectories, in which the A nucleotides can base pair with B , resulting in the boldface/italics loop, or B with C , resulting in the boldface/underlined loop. In the kinetic experiments there should not be an interchange between the two mutually exclusive structures, while in the thermodynamic experiments they should be in equilibrium. The dashed lines delimit the size of the two smaller JN2C-derived 5′ and 3′ end hairpin fragments. Δ G values were calculated using RNA-fold ( ) ( B ) Structure probing of JN2C and JN2C-derived fragments. CK is the control lane (without enzyme) for the kinetic probings and CT for the thermodynamic ones. K indicates the kinetic probing experiments and T the thermodynamic ones. Al is alkaline hydrolysis, T1D is digestion with RNase T1 under denaturing conditions, T1, V1 and T2 represent digestions with RNases T1, V1 and T2 under native conditions. Probing times are 5 and 15 min. The brackets indicate the position of the hairpin loops and single-stranded regions and the letters A , B and C indicate their respective positions in (A).

    Journal: Nucleic Acids Research

    Article Title: Structural parameters affecting the kinetics of RNA hairpin formation

    doi: 10.1093/nar/gkl445

    Figure Lengend Snippet: Enzymatic structure probing of the JN2C and shorter JN2C-derived RNA fragments. ( A ) Schematic representation of the folding trajectories, in which the A nucleotides can base pair with B , resulting in the boldface/italics loop, or B with C , resulting in the boldface/underlined loop. In the kinetic experiments there should not be an interchange between the two mutually exclusive structures, while in the thermodynamic experiments they should be in equilibrium. The dashed lines delimit the size of the two smaller JN2C-derived 5′ and 3′ end hairpin fragments. Δ G values were calculated using RNA-fold ( ) ( B ) Structure probing of JN2C and JN2C-derived fragments. CK is the control lane (without enzyme) for the kinetic probings and CT for the thermodynamic ones. K indicates the kinetic probing experiments and T the thermodynamic ones. Al is alkaline hydrolysis, T1D is digestion with RNase T1 under denaturing conditions, T1, V1 and T2 represent digestions with RNases T1, V1 and T2 under native conditions. Probing times are 5 and 15 min. The brackets indicate the position of the hairpin loops and single-stranded regions and the letters A , B and C indicate their respective positions in (A).

    Article Snippet: Then 1.5 µl of RNase T1 (1 U) was added to the mixture, which was incubated for a further 20 min at 55°C.

    Techniques: Derivative Assay