rnase dnase treatment  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    DNase I Solution 1 unit µL
    Description:
    Thermo Scientific DNase I removes unwanted DNA from cell lysates to improve protein extraction efficiency Features of RNase free DNase I • Degrades and removes unwanted DNA from samples • Cleaves both single stranded and double stranded DNA • Compatible with Thermo Scientific Pierce Cell Lysis Reagents • Reduces viscosity of bacterial lysates protein extracts to facilitate pipetting Deoxyribonuclease I DNase I is a single glycosylated polypeptide that degrades unwanted single and double stranded DNA The enzyme works by cleaving DNA into 5 phosphodinucleotide and small oligonucleotide fragments DNase I is commonly added to cell lysis reagents to remove the viscosity caused by the DNA content in bacterial cell lysates or to remove the DNA templates from RNAs produced by in vitro transcription RNase free DNase is useful for any application requiring the digestion of DNA in which it is crucial to avoid damage to RNA General information about the use of DNase I • Calcium ions are required for activity of DNase I Trace amounts of Ca may be present at high enough concentration for DNase I to be active however use of EGTA or calcium free buffers can reduce DNase I activity to undetectable levels • High levels i e 100 mM of monovalent ions such as Na and K will decrease DNase I activity • DNase I is inactivated by heating to 65°C for 10 minutes • Kunitz unit 1 Kunitz unit is the amount of enzyme required to cause an increase of 0 001 A260nm min mL at 25°C in 0 1M NaOAc pH 5 0 due to degradation of highly polymerized DNA • Degradation assay units 1 unit is defined as the amount of enzyme required to completely degrade 1 µg of plasmid DNA in the 10 minutes at 37°C in 10 mM Tris HCl pH 7 5 50 mM MgCl2 13 mM CaCl2 Specifications • Quantity 1000 units 1 mL • Concentration 1 unit µL 20 • Unit definition 1 unit completely degrades 1 µg of plasmid DNA in 10 minutes at 37°C One DNase I unit is equivalent to 0 3 Kunitz units • RNase Contamination No ribonuclease activity detectable based on incubation with RNA transcript • Source E coli containing cloned gene encoding bovine DNase I • Molecular Weight Approx 29 000 • Formulation Bovine DNase I in 50 mM Tris HCl pH 7 5 10 mM CaCl2 50 glycerol • Supplied with 1 mL of 10X Reaction Buffer 100 mM Tris HCl pH 7 5 25 mM MgCl2 1 mM CaCl2 50 mM EDTA Related Products DNase I Solution 2500 U mL
    Catalog Number:
    89836
    Price:
    None
    Applications:
    Cell Lysis|Cell Lysis & Fractionation|Protein Biology|Protein Purification & Isolation
    Category:
    Proteins Enzymes Peptides
    Buy from Supplier


    Structured Review

    Thermo Fisher rnase dnase treatment
    Analysis of viral protein and DNA in HAV5.EGFP capsids . (A) Proteins from lysates of <t>RNase/DNase</t> treated or untreated mature and empty/intermediate capsids were separated by 10% SDS-PAGE, and stained by SYPRO Ruby protein stains. A 100 kDa hexon protein band was used for determining the capsid protein concentration using Kodak IM Network software. (B) Total yields of DNAs isolated from mature and empty/intermediate capsids with or without RNase/DNase treatment. ( C ) EGFP expression. 293 cells were transduced by 10 fold serially diluted mature and empty/intermediate capsids with or without RNase/DNase treatment. At 48 h post transduction, cells were analysed for EGFP expression by a fluorescent microscope (i) EGFP, (ii) Phase contrast. Presence (+). Absence (-). Mature (Ma); Empty/Intermediate (E-I).
    Thermo Scientific DNase I removes unwanted DNA from cell lysates to improve protein extraction efficiency Features of RNase free DNase I • Degrades and removes unwanted DNA from samples • Cleaves both single stranded and double stranded DNA • Compatible with Thermo Scientific Pierce Cell Lysis Reagents • Reduces viscosity of bacterial lysates protein extracts to facilitate pipetting Deoxyribonuclease I DNase I is a single glycosylated polypeptide that degrades unwanted single and double stranded DNA The enzyme works by cleaving DNA into 5 phosphodinucleotide and small oligonucleotide fragments DNase I is commonly added to cell lysis reagents to remove the viscosity caused by the DNA content in bacterial cell lysates or to remove the DNA templates from RNAs produced by in vitro transcription RNase free DNase is useful for any application requiring the digestion of DNA in which it is crucial to avoid damage to RNA General information about the use of DNase I • Calcium ions are required for activity of DNase I Trace amounts of Ca may be present at high enough concentration for DNase I to be active however use of EGTA or calcium free buffers can reduce DNase I activity to undetectable levels • High levels i e 100 mM of monovalent ions such as Na and K will decrease DNase I activity • DNase I is inactivated by heating to 65°C for 10 minutes • Kunitz unit 1 Kunitz unit is the amount of enzyme required to cause an increase of 0 001 A260nm min mL at 25°C in 0 1M NaOAc pH 5 0 due to degradation of highly polymerized DNA • Degradation assay units 1 unit is defined as the amount of enzyme required to completely degrade 1 µg of plasmid DNA in the 10 minutes at 37°C in 10 mM Tris HCl pH 7 5 50 mM MgCl2 13 mM CaCl2 Specifications • Quantity 1000 units 1 mL • Concentration 1 unit µL 20 • Unit definition 1 unit completely degrades 1 µg of plasmid DNA in 10 minutes at 37°C One DNase I unit is equivalent to 0 3 Kunitz units • RNase Contamination No ribonuclease activity detectable based on incubation with RNA transcript • Source E coli containing cloned gene encoding bovine DNase I • Molecular Weight Approx 29 000 • Formulation Bovine DNase I in 50 mM Tris HCl pH 7 5 10 mM CaCl2 50 glycerol • Supplied with 1 mL of 10X Reaction Buffer 100 mM Tris HCl pH 7 5 25 mM MgCl2 1 mM CaCl2 50 mM EDTA Related Products DNase I Solution 2500 U mL
    https://www.bioz.com/result/rnase dnase treatment/product/Thermo Fisher
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    rnase dnase treatment - by Bioz Stars, 2020-04
    99/100 stars

    Images

    1) Product Images from "Packaging of viral RNAs in virions of adenoviruses"

    Article Title: Packaging of viral RNAs in virions of adenoviruses

    Journal: Virology Journal

    doi: 10.1186/1743-422X-6-16

    Analysis of viral protein and DNA in HAV5.EGFP capsids . (A) Proteins from lysates of RNase/DNase treated or untreated mature and empty/intermediate capsids were separated by 10% SDS-PAGE, and stained by SYPRO Ruby protein stains. A 100 kDa hexon protein band was used for determining the capsid protein concentration using Kodak IM Network software. (B) Total yields of DNAs isolated from mature and empty/intermediate capsids with or without RNase/DNase treatment. ( C ) EGFP expression. 293 cells were transduced by 10 fold serially diluted mature and empty/intermediate capsids with or without RNase/DNase treatment. At 48 h post transduction, cells were analysed for EGFP expression by a fluorescent microscope (i) EGFP, (ii) Phase contrast. Presence (+). Absence (-). Mature (Ma); Empty/Intermediate (E-I).
    Figure Legend Snippet: Analysis of viral protein and DNA in HAV5.EGFP capsids . (A) Proteins from lysates of RNase/DNase treated or untreated mature and empty/intermediate capsids were separated by 10% SDS-PAGE, and stained by SYPRO Ruby protein stains. A 100 kDa hexon protein band was used for determining the capsid protein concentration using Kodak IM Network software. (B) Total yields of DNAs isolated from mature and empty/intermediate capsids with or without RNase/DNase treatment. ( C ) EGFP expression. 293 cells were transduced by 10 fold serially diluted mature and empty/intermediate capsids with or without RNase/DNase treatment. At 48 h post transduction, cells were analysed for EGFP expression by a fluorescent microscope (i) EGFP, (ii) Phase contrast. Presence (+). Absence (-). Mature (Ma); Empty/Intermediate (E-I).

    Techniques Used: SDS Page, Staining, Protein Concentration, Software, Isolation, Expressing, Transduction, Microscopy

    Analysis of RNA in HAV5.EGFP capsids with or without RNase/DNase treatment . (A) Total yields of RNAs isolated from mature and empty/intermediate capsids with or without RNase/DNase treatment. (B) The [ 32 P]-labeled cDNAs were made by reverse transcription of 2 μg, RNase-free DNase treated RNAs from mature and empty/intermediate capsids with or without RNase/DNase treatment and hybridized to Hind III-digested pFHAV5, which contains E1A-deleted HAdV-5 genome. RT was primed by oligo-dT/hexamers. (C) Viral RNAs detected in RNAs from mature (Ma) and empty/intermediate (E-I) capsids after RNase/DNase treatment in Southern hybridization in panel B were quantitated by using PhosphorImager software.
    Figure Legend Snippet: Analysis of RNA in HAV5.EGFP capsids with or without RNase/DNase treatment . (A) Total yields of RNAs isolated from mature and empty/intermediate capsids with or without RNase/DNase treatment. (B) The [ 32 P]-labeled cDNAs were made by reverse transcription of 2 μg, RNase-free DNase treated RNAs from mature and empty/intermediate capsids with or without RNase/DNase treatment and hybridized to Hind III-digested pFHAV5, which contains E1A-deleted HAdV-5 genome. RT was primed by oligo-dT/hexamers. (C) Viral RNAs detected in RNAs from mature (Ma) and empty/intermediate (E-I) capsids after RNase/DNase treatment in Southern hybridization in panel B were quantitated by using PhosphorImager software.

    Techniques Used: Isolation, Labeling, Hybridization, Software

    Related Articles

    Amplification:

    Article Title: A tumor-promoting mechanism mediated by retrotransposon-encoded reverse transcriptase is active in human transformed cell lines
    Article Snippet: DNA was ethanol-precipitated from each fraction, washed in 70% ethanol, resuspended in 300 ul H2O and 5 ul aliquots from each fraction were PCR amplified using the indicated oligonucleotide pairs: ORF2: Fw- TCCAGCAGCACATCAAAAAG; Rev- CCAGTTTTTGCCCATTCAGT Alu115: Fw- CCTGAGGTCAGGAGTTCGAG; Rev- CCCGAGTAGCTGGGATTACA GAPDH: Fw- GAGTCAACGGATTTGGTCGT; Rev- TGACAAAGTGGTCGTTGAGG Where indicated, fractions 8 and 21 collected from the gradient were digested with either DNAse I alone, or simultaneously with RNAseH/DNAse I and subjected to PCR amplification. .. To determine the product sizes, fractions 8 (bulk) and 21 (hybrid) from control and EFV-treated A375 cells were digested with DNAse I or RNAse H/ DNAse I, labelled with alpha-32 P dCTP using the Invitrogen Random Primers DNA Labeling System kit (18187-013) and fractionated through 1.7% agarose gels; the gels were then dried and exposed to autoradiographic films.

    Positive Control:

    Article Title: RNA and β-Hemolysin of Group B Streptococcus Induce Interleukin-1β (IL-1β) by Activating NLRP3 Inflammasomes in Mouse Macrophages *
    Article Snippet: .. DNase/RNase transfection (10 or 100 ng/well) was performed with Pro-Ject protein transfection reagent (Pierce) for 3 h prior to LPS priming (100 ng/ml for 2 h) and then stimulated for 6 h with WT GBS (NEM 316), the hyperhemolytic strains NEM 2424 or 2802, or silica (500 μg/ml; positive control). .. Supernatants were measured by ELISA for released IL-1β.

    Synthesized:

    Article Title: Packaging of viral RNAs in virions of adenoviruses
    Article Snippet: To analyze the amount of viral RNAs present in the total RNAs isolated from mature and empty/intermediate capsids, 2 μg of RNA isolated from mature or empty/intermediate capsids without RNase/DNase treatment was reversely transcribed by reverse transcriptase II (Invitrogen) in the presence of [32 P]-dCTP. .. Synthesized [32 P]-labeled cDNAs were hybridized to Hind III-digested plasmid pFHAV5 containing E1A-deleted HAdV-5 genome.

    SYBR Green Assay:

    Article Title: Correct Capsid Assembly Mediated by a Conserved YXXLGL Motif in Prototype Foamy Virus Gag Is Essential for Infectivity and Reverse Transcription of the Viral Genome ▿
    Article Snippet: The third sample (reaction 3) analyzed for viral DNA was mock incubated, omitting only the DNase I. DNase I digestion or mock incubation was terminated according to the manufacturer's protocol using DNase inactivation reagent (Ambion), resulting in a total final reaction sample volume of 10 μl each. .. Finally, 5 μl of each reverse transcription reaction product was analyzed by real-time PCR in duplicate in a total volume of 25 μl using the Brilliant SYBR Green QPCR kit (Stratagene) and an MX4000 multiplex quantitative PCR system (Stratagene).

    Incubation:

    Article Title: TEFM is a potent stimulator of mitochondrial transcription elongation in vitro
    Article Snippet: .. The DNase I reaction was stopped after 2 min by the addition of 20 μl stop buffer (200 mM NaCl, 20 mM EDTA, 1% sodium dodecyl sulphate (SDS) and 100 μg/ml yeast tRNA (Ambion)) directly followed by incubation on ice. .. The DNA fragments were recovered with phenol extraction and ethanol precipitation and analyzed on an 8% denaturing polyacrylamide sequencing gel (1× TBE and 7 M urea).

    Article Title: The amino terminal extension of mammalian mitochondrial RNA polymerase ensures promoter specific transcription initiation
    Article Snippet: .. The DNase I reaction was stopped after 2 min by addition of 20 μl stop buffer [200 mM NaCl, 20 mM EDTA, 1% SDS and 100 μg/ml yeast tRNA (Ambion)] directly followed by incubation on ice. .. The DNA fragments were recovered with phenol extraction and ethanol precipitation and analysed on 8% denaturing polyacrylamide sequencing gels (1× TBE and 7M urea).

    Article Title: Modified Whole-Mount In situ Hybridization Protocol for the Detection of Transgene Expression in Electroporated Chick Embryos
    Article Snippet: .. For DNA digestion, embryos were incubated with RNase-free DNase I (50 U/ml in DNase I buffer; Ambion) for 1h at 37°C. ..

    Article Title: Human Mitochondrial Transcription Factor B2 Is Required for Promoter Melting during Initiation of Transcription *
    Article Snippet: .. The DNase I reaction was stopped after 2 min by the addition of 20 μl of stop buffer (200 m m NaCl, 20 m m EDTA, 1% SDS, and 100 μg/ml yeast tRNA (Ambion)) directly followed by incubation on ice. .. The DNA fragments were recovered with phenol extraction and ethanol precipitation.

    Article Title: Campylobacter jejuni biofilms contain extracellular DNA and are sensitive to DNase I treatment
    Article Snippet: .. For the assays assessing the time required for DNase I activity, biofilms were allowed to form for 48 h before addition of 4 U/ml v/v DNase I enzyme (1 U/μl, Fermentas) and 4 μl of DNase I buffer to the samples, followed by incubation for up to 2 h. During the incubation with enzyme the samples were placed in 37°C, aerobic conditions. .. All samples were subsequently stained with crystal violet.

    Article Title: Campylobacter jejuni biofilms contain extracellular DNA and are sensitive to DNase I treatment
    Article Snippet: .. Enzyme treatment of C. jejuni biofilms For DNase I treatments, unless otherwise stated, a volume of 4 μl DNase I enzyme (Fermentas), giving a final concentration within the biofilm of 4 U/ml v/v and 4 μl of DNase I buffer (Fermentas) were added to each test tube, along with 1 ml of diluted cell suspension at either the start of the static incubation or after 12, 24, 36, or 48 h of static incubation. .. Following treatment, static cultures were placed back in 37°C, aerobic conditions to complete the 48 h incubation before staining with crystal violet to allow biofilm quantification.

    Article Title: Correct Capsid Assembly Mediated by a Conserved YXXLGL Motif in Prototype Foamy Virus Gag Is Essential for Infectivity and Reverse Transcription of the Viral Genome ▿
    Article Snippet: .. The third sample (reaction 3) analyzed for viral DNA was mock incubated, omitting only the DNase I. DNase I digestion or mock incubation was terminated according to the manufacturer's protocol using DNase inactivation reagent (Ambion), resulting in a total final reaction sample volume of 10 μl each. .. Subsequently, all three reaction samples were reverse transcribed (reaction 1) or mock incubated (reactions 2 and 3) in a total volume of 20 μl using the Superscript II reverse transcription kit (Invitrogen) and oligo(dT)30 as the primer according to the manufacturer's instructions.

    Activity Assay:

    Article Title: Campylobacter jejuni biofilms contain extracellular DNA and are sensitive to DNase I treatment
    Article Snippet: .. For the assays assessing the time required for DNase I activity, biofilms were allowed to form for 48 h before addition of 4 U/ml v/v DNase I enzyme (1 U/μl, Fermentas) and 4 μl of DNase I buffer to the samples, followed by incubation for up to 2 h. During the incubation with enzyme the samples were placed in 37°C, aerobic conditions. .. All samples were subsequently stained with crystal violet.

    Western Blot:

    Article Title: Correct Capsid Assembly Mediated by a Conserved YXXLGL Motif in Prototype Foamy Virus Gag Is Essential for Infectivity and Reverse Transcription of the Viral Genome ▿
    Article Snippet: Seventy-five microliters of the sample was added to an equal volume of 2× sodium dodecyl sulfate protein sample buffer, separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and analyzed by Western blotting as described above. .. The third sample (reaction 3) analyzed for viral DNA was mock incubated, omitting only the DNase I. DNase I digestion or mock incubation was terminated according to the manufacturer's protocol using DNase inactivation reagent (Ambion), resulting in a total final reaction sample volume of 10 μl each.

    Real-time Polymerase Chain Reaction:

    Article Title: Correct Capsid Assembly Mediated by a Conserved YXXLGL Motif in Prototype Foamy Virus Gag Is Essential for Infectivity and Reverse Transcription of the Viral Genome ▿
    Article Snippet: Paragraph title: Real-time PCR analysis. ... The third sample (reaction 3) analyzed for viral DNA was mock incubated, omitting only the DNase I. DNase I digestion or mock incubation was terminated according to the manufacturer's protocol using DNase inactivation reagent (Ambion), resulting in a total final reaction sample volume of 10 μl each.

    Hybridization:

    Article Title: Modified Whole-Mount In situ Hybridization Protocol for the Detection of Transgene Expression in Electroporated Chick Embryos
    Article Snippet: Whole-mount in situ hybridization Embryos were fixed overnight in 4% paraformaldehyde (PFA) in phosphate-buffered saline (PBS) plus 0.1% Tween® 20 (PBT) at 4°C, dehydrated though a series of methanol/PBT solutions (25%, 50%, 75% and 100% methanol), and stored at −20°C until hybridization. .. For DNA digestion, embryos were incubated with RNase-free DNase I (50 U/ml in DNase I buffer; Ambion) for 1h at 37°C.

    Countercurrent Chromatography:

    Article Title: TEFM is a potent stimulator of mitochondrial transcription elongation in vitro
    Article Snippet: DNase I footprinting The footprinting template was produced by PCR on the pUC18 human LSP vector using the primer pair 5′-GCA CTT AAA CAC ATC TCT GCC AAA CCC C (forward) and 5′-GTA AAA CGA CGG CCA GTG CCA AGC (reversed, found in vector). .. The DNase I reaction was stopped after 2 min by the addition of 20 μl stop buffer (200 mM NaCl, 20 mM EDTA, 1% sodium dodecyl sulphate (SDS) and 100 μg/ml yeast tRNA (Ambion)) directly followed by incubation on ice.

    Transfection:

    Article Title: Human RNase H1 Is Associated with Protein P32 and Is Involved in Mitochondrial Pre-rRNA Processing
    Article Snippet: Detection of DNA or RNA in affinity purified RNase H1 complex 2–5 mg cell lysate prepared from HA-RNase H1 cells and HA-P32 transiently transfected cells were used for immunoprecipitation with anti-HA beads (Sigma, St. Louis, MO). .. The IP samples on the beads were washed at least 3 times and treated with or without DNase I digestion (10 unit/ml in TE buffer) (Invitrogen, Carlsbad, CA) at 37°C for 30 min. After washing two more times, the IP samples were subjected to phenol-chloroform extraction.

    Article Title: RNA and β-Hemolysin of Group B Streptococcus Induce Interleukin-1β (IL-1β) by Activating NLRP3 Inflammasomes in Mouse Macrophages *
    Article Snippet: .. DNase/RNase transfection (10 or 100 ng/well) was performed with Pro-Ject protein transfection reagent (Pierce) for 3 h prior to LPS priming (100 ng/ml for 2 h) and then stimulated for 6 h with WT GBS (NEM 316), the hyperhemolytic strains NEM 2424 or 2802, or silica (500 μg/ml; positive control). .. Supernatants were measured by ELISA for released IL-1β.

    Article Title: miR-200c regulates FGFR-dependent epithelial proliferation via Vldlr during submandibular gland branching morphogenesis
    Article Snippet: Paragraph title: Transfection of antagomirs and miRNA mimics during SMG and epithelial cultures ... DNase-free total RNA was prepared using micro-RNAqueous and mirVana miRNA isolation kits (Ambion, Austin, TX, USA).

    Immunoprecipitation:

    Article Title: Human RNase H1 Is Associated with Protein P32 and Is Involved in Mitochondrial Pre-rRNA Processing
    Article Snippet: Detection of DNA or RNA in affinity purified RNase H1 complex 2–5 mg cell lysate prepared from HA-RNase H1 cells and HA-P32 transiently transfected cells were used for immunoprecipitation with anti-HA beads (Sigma, St. Louis, MO). .. The IP samples on the beads were washed at least 3 times and treated with or without DNase I digestion (10 unit/ml in TE buffer) (Invitrogen, Carlsbad, CA) at 37°C for 30 min. After washing two more times, the IP samples were subjected to phenol-chloroform extraction.

    Footprinting:

    Article Title: TEFM is a potent stimulator of mitochondrial transcription elongation in vitro
    Article Snippet: Paragraph title: DNase I footprinting ... The DNase I reaction was stopped after 2 min by the addition of 20 μl stop buffer (200 mM NaCl, 20 mM EDTA, 1% sodium dodecyl sulphate (SDS) and 100 μg/ml yeast tRNA (Ambion)) directly followed by incubation on ice.

    Article Title: The amino terminal extension of mammalian mitochondrial RNA polymerase ensures promoter specific transcription initiation
    Article Snippet: Paragraph title: DNase I footprinting assay ... The DNase I reaction was stopped after 2 min by addition of 20 μl stop buffer [200 mM NaCl, 20 mM EDTA, 1% SDS and 100 μg/ml yeast tRNA (Ambion)] directly followed by incubation on ice.

    Article Title: Human Mitochondrial Transcription Factor B2 Is Required for Promoter Melting during Initiation of Transcription *
    Article Snippet: Paragraph title: DNase I Footprinting ... The DNase I reaction was stopped after 2 min by the addition of 20 μl of stop buffer (200 m m NaCl, 20 m m EDTA, 1% SDS, and 100 μg/ml yeast tRNA (Ambion)) directly followed by incubation on ice.

    Infection:

    Article Title: Packaging of viral RNAs in virions of adenoviruses
    Article Snippet: To analyze the amount of viral RNAs present in the total RNAs isolated from mature and empty/intermediate capsids, 2 μg of RNA isolated from mature or empty/intermediate capsids without RNase/DNase treatment was reversely transcribed by reverse transcriptase II (Invitrogen) in the presence of [32 P]-dCTP. .. As expected, the cDNA probes resulted in positive signals as strong as the cDNA probes made from wt HAdV-5 infected 293 cell RNA (Fig. ).

    other:

    Article Title: Development of a versatile TaqMan(TM) real-time quantitative PCR (RT-qPCR) compliant anchor sequence to quantify bacterial gene transcripts from RNA samples containing carryover genomic DNA
    Article Snippet: To rule out RNA hydrolysis due to heat/cation [ ] or organic based procedure (phenol/proteinase K), two of the commonly used procedures to inactivate the DNase I enzyme, we in our study made use of a commonly used proprietary, non-thermal/cationic inactivation system ( http://tools.invitrogen.com/content/sfs/manuals/cms_055740.pdf ).

    Article Title: Mapping cis- and trans- chromatin interaction networks using Chromosome Conformation Capture (3C)
    Article Snippet: 20 mg/mL proteinase K in TE buffer, pH 8.0 5 M potassium acetate 80% ethanol 100% ethanol TE buffer, pH 8.0 containing 10 μg/mL DNase-free Rnase A 1:1 phenol/chloroform 100% isopropanol 1 mg/mL bovine serum albumin (BSA) 10 mM adenosine triphosphate (ATP) T4 DNA ligase (Invitrogen) 0.5 M EDTA, pH 8.0 10 mg/ml DNase-free RNase A (Sigma)

    DNA Labeling:

    Article Title: A tumor-promoting mechanism mediated by retrotransposon-encoded reverse transcriptase is active in human transformed cell lines
    Article Snippet: .. To determine the product sizes, fractions 8 (bulk) and 21 (hybrid) from control and EFV-treated A375 cells were digested with DNAse I or RNAse H/ DNAse I, labelled with alpha-32 P dCTP using the Invitrogen Random Primers DNA Labeling System kit (18187-013) and fractionated through 1.7% agarose gels; the gels were then dried and exposed to autoradiographic films. ..

    Sequencing:

    Article Title: TEFM is a potent stimulator of mitochondrial transcription elongation in vitro
    Article Snippet: The DNase I reaction was stopped after 2 min by the addition of 20 μl stop buffer (200 mM NaCl, 20 mM EDTA, 1% sodium dodecyl sulphate (SDS) and 100 μg/ml yeast tRNA (Ambion)) directly followed by incubation on ice. .. The DNA fragments were recovered with phenol extraction and ethanol precipitation and analyzed on an 8% denaturing polyacrylamide sequencing gel (1× TBE and 7 M urea).

    Article Title: The amino terminal extension of mammalian mitochondrial RNA polymerase ensures promoter specific transcription initiation
    Article Snippet: The DNase I reaction was stopped after 2 min by addition of 20 μl stop buffer [200 mM NaCl, 20 mM EDTA, 1% SDS and 100 μg/ml yeast tRNA (Ambion)] directly followed by incubation on ice. .. The DNA fragments were recovered with phenol extraction and ethanol precipitation and analysed on 8% denaturing polyacrylamide sequencing gels (1× TBE and 7M urea).

    Affinity Purification:

    Article Title: Human RNase H1 Is Associated with Protein P32 and Is Involved in Mitochondrial Pre-rRNA Processing
    Article Snippet: Paragraph title: Detection of DNA or RNA in affinity purified RNase H1 complex ... The IP samples on the beads were washed at least 3 times and treated with or without DNase I digestion (10 unit/ml in TE buffer) (Invitrogen, Carlsbad, CA) at 37°C for 30 min. After washing two more times, the IP samples were subjected to phenol-chloroform extraction.

    Cellular Antioxidant Activity Assay:

    Article Title: The amino terminal extension of mammalian mitochondrial RNA polymerase ensures promoter specific transcription initiation
    Article Snippet: DNase I footprinting assay The footprinting template was produced by PCR using the primer pair 5′ CAT GCT TGT TAG ACA TAA ATG C (forward) and 5′ CAT GAT TTT GTA AAA TTT TTA CAA GTA C (reversed). .. The DNase I reaction was stopped after 2 min by addition of 20 μl stop buffer [200 mM NaCl, 20 mM EDTA, 1% SDS and 100 μg/ml yeast tRNA (Ambion)] directly followed by incubation on ice.

    Nucleic Acid Electrophoresis:

    Article Title: Correct Capsid Assembly Mediated by a Conserved YXXLGL Motif in Prototype Foamy Virus Gag Is Essential for Infectivity and Reverse Transcription of the Viral Genome ▿
    Article Snippet: Seventy-five microliters of the sample was added to an equal volume of 2× sodium dodecyl sulfate protein sample buffer, separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and analyzed by Western blotting as described above. .. The third sample (reaction 3) analyzed for viral DNA was mock incubated, omitting only the DNase I. DNase I digestion or mock incubation was terminated according to the manufacturer's protocol using DNase inactivation reagent (Ambion), resulting in a total final reaction sample volume of 10 μl each.

    Article Title: Improving Cry8Ka toxin activity towards the cotton boll weevil (Anthonomus grandis)
    Article Snippet: First, 10 μg of the purified cry8Ka1 gene was randomly digested in a mixture containing 70 U of DNAse I enzyme (Invitrogen) in DNase I buffer (50 mM Tris buffer, pH 7.6, containing 1 mM MnCl2 and 0.1 mg/mL BSA). .. The digestion product was analysed by 2.5% agarose (w/v) gel electrophoresis and the 30-50-bp fragments were jointly purified using the High Pure PCR Product Purification Kit (ROCHE).

    Isolation:

    Article Title: Packaging of viral RNAs in virions of adenoviruses
    Article Snippet: .. To analyze the amount of viral RNAs present in the total RNAs isolated from mature and empty/intermediate capsids, 2 μg of RNA isolated from mature or empty/intermediate capsids without RNase/DNase treatment was reversely transcribed by reverse transcriptase II (Invitrogen) in the presence of [32 P]-dCTP. .. Synthesized [32 P]-labeled cDNAs were hybridized to Hind III-digested plasmid pFHAV5 containing E1A-deleted HAdV-5 genome.

    Article Title: Correct Capsid Assembly Mediated by a Conserved YXXLGL Motif in Prototype Foamy Virus Gag Is Essential for Infectivity and Reverse Transcription of the Viral Genome ▿
    Article Snippet: The residual 62 μl was adjusted to 140 μl with PBS, used for isolation of viral nucleic acids using the QIAmp viral RNA minikit (QIAGEN) according to the manufacturer's instructions without the optional DNase I digest, and eluted in 60 μl. .. The third sample (reaction 3) analyzed for viral DNA was mock incubated, omitting only the DNase I. DNase I digestion or mock incubation was terminated according to the manufacturer's protocol using DNase inactivation reagent (Ambion), resulting in a total final reaction sample volume of 10 μl each.

    Article Title: miR-200c regulates FGFR-dependent epithelial proliferation via Vldlr during submandibular gland branching morphogenesis
    Article Snippet: .. DNase-free total RNA was prepared using micro-RNAqueous and mirVana miRNA isolation kits (Ambion, Austin, TX, USA). .. Total RNA samples were DNase treated (Ambion) prior to cDNA synthesis using iScript reagents (BioRad, Hercules, CA, USA).

    Labeling:

    Article Title: TEFM is a potent stimulator of mitochondrial transcription elongation in vitro
    Article Snippet: The footprint reaction was performed in 20 μl containing 25 mM Tris–HCl pH 8.0, 10 mM MgCl2 , 1 mM ATP, 100 μg/ml BSA, 1 mM DTT, 50 mM NaCl, labeled template (22 500 cpm), and proteins as indicated (1 pmol TFAM, 1 pmol POLRMT, 2 pmol TFB2M and 2 pmol TEFM). .. The DNase I reaction was stopped after 2 min by the addition of 20 μl stop buffer (200 mM NaCl, 20 mM EDTA, 1% sodium dodecyl sulphate (SDS) and 100 μg/ml yeast tRNA (Ambion)) directly followed by incubation on ice.

    Article Title: The amino terminal extension of mammalian mitochondrial RNA polymerase ensures promoter specific transcription initiation
    Article Snippet: The reversed primer was labeled with T4 polynucleotide kinase enzyme (New England Biolabs) and γ-32 P ATP (3000 Ci/mmol). .. The DNase I reaction was stopped after 2 min by addition of 20 μl stop buffer [200 mM NaCl, 20 mM EDTA, 1% SDS and 100 μg/ml yeast tRNA (Ambion)] directly followed by incubation on ice.

    Article Title: Human Mitochondrial Transcription Factor B2 Is Required for Promoter Melting during Initiation of Transcription *
    Article Snippet: The template (forward primer labeled) and reaction conditions were the same as those used for potassium permanganate footprinting. .. The DNase I reaction was stopped after 2 min by the addition of 20 μl of stop buffer (200 m m NaCl, 20 m m EDTA, 1% SDS, and 100 μg/ml yeast tRNA (Ambion)) directly followed by incubation on ice.

    Purification:

    Article Title: Packaging of viral RNAs in virions of adenoviruses
    Article Snippet: RNA was extracted from equal amounts (based on protein concentrations) of CsCl purified HAV5. .. To analyze the amount of viral RNAs present in the total RNAs isolated from mature and empty/intermediate capsids, 2 μg of RNA isolated from mature or empty/intermediate capsids without RNase/DNase treatment was reversely transcribed by reverse transcriptase II (Invitrogen) in the presence of [32 P]-dCTP.

    Article Title: Improving Cry8Ka toxin activity towards the cotton boll weevil (Anthonomus grandis)
    Article Snippet: .. First, 10 μg of the purified cry8Ka1 gene was randomly digested in a mixture containing 70 U of DNAse I enzyme (Invitrogen) in DNase I buffer (50 mM Tris buffer, pH 7.6, containing 1 mM MnCl2 and 0.1 mg/mL BSA). ..

    Polymerase Chain Reaction:

    Article Title: Human RNase H1 Is Associated with Protein P32 and Is Involved in Mitochondrial Pre-rRNA Processing
    Article Snippet: The IP samples on the beads were washed at least 3 times and treated with or without DNase I digestion (10 unit/ml in TE buffer) (Invitrogen, Carlsbad, CA) at 37°C for 30 min. After washing two more times, the IP samples were subjected to phenol-chloroform extraction. .. The RNA samples were reverse transcribed for 30 minutes at 48°C in 50 µl reaction buffer followed by PCR reaction: 10–40 thermal cycles of 30 s at 94°C and 1 minute at 60°C.

    Article Title: TEFM is a potent stimulator of mitochondrial transcription elongation in vitro
    Article Snippet: DNase I footprinting The footprinting template was produced by PCR on the pUC18 human LSP vector using the primer pair 5′-GCA CTT AAA CAC ATC TCT GCC AAA CCC C (forward) and 5′-GTA AAA CGA CGG CCA GTG CCA AGC (reversed, found in vector). .. The DNase I reaction was stopped after 2 min by the addition of 20 μl stop buffer (200 mM NaCl, 20 mM EDTA, 1% sodium dodecyl sulphate (SDS) and 100 μg/ml yeast tRNA (Ambion)) directly followed by incubation on ice.

    Article Title: The amino terminal extension of mammalian mitochondrial RNA polymerase ensures promoter specific transcription initiation
    Article Snippet: DNase I footprinting assay The footprinting template was produced by PCR using the primer pair 5′ CAT GCT TGT TAG ACA TAA ATG C (forward) and 5′ CAT GAT TTT GTA AAA TTT TTA CAA GTA C (reversed). .. The DNase I reaction was stopped after 2 min by addition of 20 μl stop buffer [200 mM NaCl, 20 mM EDTA, 1% SDS and 100 μg/ml yeast tRNA (Ambion)] directly followed by incubation on ice.

    Article Title: A tumor-promoting mechanism mediated by retrotransposon-encoded reverse transcriptase is active in human transformed cell lines
    Article Snippet: DNA was ethanol-precipitated from each fraction, washed in 70% ethanol, resuspended in 300 ul H2O and 5 ul aliquots from each fraction were PCR amplified using the indicated oligonucleotide pairs: ORF2: Fw- TCCAGCAGCACATCAAAAAG; Rev- CCAGTTTTTGCCCATTCAGT Alu115: Fw- CCTGAGGTCAGGAGTTCGAG; Rev- CCCGAGTAGCTGGGATTACA GAPDH: Fw- GAGTCAACGGATTTGGTCGT; Rev- TGACAAAGTGGTCGTTGAGG Where indicated, fractions 8 and 21 collected from the gradient were digested with either DNAse I alone, or simultaneously with RNAseH/DNAse I and subjected to PCR amplification. .. To determine the product sizes, fractions 8 (bulk) and 21 (hybrid) from control and EFV-treated A375 cells were digested with DNAse I or RNAse H/ DNAse I, labelled with alpha-32 P dCTP using the Invitrogen Random Primers DNA Labeling System kit (18187-013) and fractionated through 1.7% agarose gels; the gels were then dried and exposed to autoradiographic films.

    Article Title: Improving Cry8Ka toxin activity towards the cotton boll weevil (Anthonomus grandis)
    Article Snippet: 2.3 Generation of a combinatorial library using DNA shuffling and phage display The Sfi I-digested, PCR-amplified cry8Ka1 gene was used as the starting material for the DNA-shuffling procedure [ , ]. .. First, 10 μg of the purified cry8Ka1 gene was randomly digested in a mixture containing 70 U of DNAse I enzyme (Invitrogen) in DNase I buffer (50 mM Tris buffer, pH 7.6, containing 1 mM MnCl2 and 0.1 mg/mL BSA).

    Staining:

    Article Title: Campylobacter jejuni biofilms contain extracellular DNA and are sensitive to DNase I treatment
    Article Snippet: Following treatment, static cultures were placed back in 37°C, aerobic conditions to complete the 48 h incubation before staining with crystal violet to allow biofilm quantification. .. For the assays assessing the time required for DNase I activity, biofilms were allowed to form for 48 h before addition of 4 U/ml v/v DNase I enzyme (1 U/μl, Fermentas) and 4 μl of DNase I buffer to the samples, followed by incubation for up to 2 h. During the incubation with enzyme the samples were placed in 37°C, aerobic conditions.

    Chloramphenicol Acetyltransferase Assay:

    Article Title: The amino terminal extension of mammalian mitochondrial RNA polymerase ensures promoter specific transcription initiation
    Article Snippet: DNase I footprinting assay The footprinting template was produced by PCR using the primer pair 5′ CAT GCT TGT TAG ACA TAA ATG C (forward) and 5′ CAT GAT TTT GTA AAA TTT TTA CAA GTA C (reversed). .. The DNase I reaction was stopped after 2 min by addition of 20 μl stop buffer [200 mM NaCl, 20 mM EDTA, 1% SDS and 100 μg/ml yeast tRNA (Ambion)] directly followed by incubation on ice.

    In Situ Hybridization:

    Article Title: Modified Whole-Mount In situ Hybridization Protocol for the Detection of Transgene Expression in Electroporated Chick Embryos
    Article Snippet: Paragraph title: Whole-mount in situ hybridization ... For DNA digestion, embryos were incubated with RNase-free DNase I (50 U/ml in DNase I buffer; Ambion) for 1h at 37°C.

    Plasmid Preparation:

    Article Title: Packaging of viral RNAs in virions of adenoviruses
    Article Snippet: To analyze the amount of viral RNAs present in the total RNAs isolated from mature and empty/intermediate capsids, 2 μg of RNA isolated from mature or empty/intermediate capsids without RNase/DNase treatment was reversely transcribed by reverse transcriptase II (Invitrogen) in the presence of [32 P]-dCTP. .. Synthesized [32 P]-labeled cDNAs were hybridized to Hind III-digested plasmid pFHAV5 containing E1A-deleted HAdV-5 genome.

    Article Title: TEFM is a potent stimulator of mitochondrial transcription elongation in vitro
    Article Snippet: DNase I footprinting The footprinting template was produced by PCR on the pUC18 human LSP vector using the primer pair 5′-GCA CTT AAA CAC ATC TCT GCC AAA CCC C (forward) and 5′-GTA AAA CGA CGG CCA GTG CCA AGC (reversed, found in vector). .. The DNase I reaction was stopped after 2 min by the addition of 20 μl stop buffer (200 mM NaCl, 20 mM EDTA, 1% sodium dodecyl sulphate (SDS) and 100 μg/ml yeast tRNA (Ambion)) directly followed by incubation on ice.

    Article Title: The amino terminal extension of mammalian mitochondrial RNA polymerase ensures promoter specific transcription initiation
    Article Snippet: The labelled template was produced using a plasmid (pCR2.1-TOPO) containing the mouse mitochondrial promoter region (mtDNA positions 15942-341) as template. .. The DNase I reaction was stopped after 2 min by addition of 20 μl stop buffer [200 mM NaCl, 20 mM EDTA, 1% SDS and 100 μg/ml yeast tRNA (Ambion)] directly followed by incubation on ice.

    Article Title: A tumor-promoting mechanism mediated by retrotransposon-encoded reverse transcriptase is active in human transformed cell lines
    Article Snippet: Circular and Bam H1-linearized pCMV-EGFP plasmid DNA (Clontech) were used as DNA density markers while [3 H] end-labelled polyU (100 nt) and [3 H] end-labelled poly dA:U were RNA and DNA:RNA hybrid density markers, respectively; densities of these latters were determined by mixing aliquots of gradient fractions with scintillation cocktail (Pico-Fluor 40, Perkin Elmer) and counting in a Beckman scintillation counter. .. To determine the product sizes, fractions 8 (bulk) and 21 (hybrid) from control and EFV-treated A375 cells were digested with DNAse I or RNAse H/ DNAse I, labelled with alpha-32 P dCTP using the Invitrogen Random Primers DNA Labeling System kit (18187-013) and fractionated through 1.7% agarose gels; the gels were then dried and exposed to autoradiographic films.

    Enzyme-linked Immunosorbent Assay:

    Article Title: RNA and β-Hemolysin of Group B Streptococcus Induce Interleukin-1β (IL-1β) by Activating NLRP3 Inflammasomes in Mouse Macrophages *
    Article Snippet: DNase/RNase transfection (10 or 100 ng/well) was performed with Pro-Ject protein transfection reagent (Pierce) for 3 h prior to LPS priming (100 ng/ml for 2 h) and then stimulated for 6 h with WT GBS (NEM 316), the hyperhemolytic strains NEM 2424 or 2802, or silica (500 μg/ml; positive control). .. Supernatants were measured by ELISA for released IL-1β.

    Multiplex Assay:

    Article Title: Correct Capsid Assembly Mediated by a Conserved YXXLGL Motif in Prototype Foamy Virus Gag Is Essential for Infectivity and Reverse Transcription of the Viral Genome ▿
    Article Snippet: The third sample (reaction 3) analyzed for viral DNA was mock incubated, omitting only the DNase I. DNase I digestion or mock incubation was terminated according to the manufacturer's protocol using DNase inactivation reagent (Ambion), resulting in a total final reaction sample volume of 10 μl each. .. Finally, 5 μl of each reverse transcription reaction product was analyzed by real-time PCR in duplicate in a total volume of 25 μl using the Brilliant SYBR Green QPCR kit (Stratagene) and an MX4000 multiplex quantitative PCR system (Stratagene).

    Ethanol Precipitation:

    Article Title: Human RNase H1 Is Associated with Protein P32 and Is Involved in Mitochondrial Pre-rRNA Processing
    Article Snippet: The IP samples on the beads were washed at least 3 times and treated with or without DNase I digestion (10 unit/ml in TE buffer) (Invitrogen, Carlsbad, CA) at 37°C for 30 min. After washing two more times, the IP samples were subjected to phenol-chloroform extraction. .. For RNA preps, the RNA and DNA mixtures were further treated with DNase I followed by phenol-chloroform extraction and ethanol precipitation.

    Article Title: TEFM is a potent stimulator of mitochondrial transcription elongation in vitro
    Article Snippet: The DNase I reaction was stopped after 2 min by the addition of 20 μl stop buffer (200 mM NaCl, 20 mM EDTA, 1% sodium dodecyl sulphate (SDS) and 100 μg/ml yeast tRNA (Ambion)) directly followed by incubation on ice. .. The DNA fragments were recovered with phenol extraction and ethanol precipitation and analyzed on an 8% denaturing polyacrylamide sequencing gel (1× TBE and 7 M urea).

    Article Title: The amino terminal extension of mammalian mitochondrial RNA polymerase ensures promoter specific transcription initiation
    Article Snippet: The DNase I reaction was stopped after 2 min by addition of 20 μl stop buffer [200 mM NaCl, 20 mM EDTA, 1% SDS and 100 μg/ml yeast tRNA (Ambion)] directly followed by incubation on ice. .. The DNA fragments were recovered with phenol extraction and ethanol precipitation and analysed on 8% denaturing polyacrylamide sequencing gels (1× TBE and 7M urea).

    Article Title: Human Mitochondrial Transcription Factor B2 Is Required for Promoter Melting during Initiation of Transcription *
    Article Snippet: The DNase I reaction was stopped after 2 min by the addition of 20 μl of stop buffer (200 m m NaCl, 20 m m EDTA, 1% SDS, and 100 μg/ml yeast tRNA (Ambion)) directly followed by incubation on ice. .. The DNA fragments were recovered with phenol extraction and ethanol precipitation.

    Produced:

    Article Title: TEFM is a potent stimulator of mitochondrial transcription elongation in vitro
    Article Snippet: DNase I footprinting The footprinting template was produced by PCR on the pUC18 human LSP vector using the primer pair 5′-GCA CTT AAA CAC ATC TCT GCC AAA CCC C (forward) and 5′-GTA AAA CGA CGG CCA GTG CCA AGC (reversed, found in vector). .. The DNase I reaction was stopped after 2 min by the addition of 20 μl stop buffer (200 mM NaCl, 20 mM EDTA, 1% sodium dodecyl sulphate (SDS) and 100 μg/ml yeast tRNA (Ambion)) directly followed by incubation on ice.

    Article Title: The amino terminal extension of mammalian mitochondrial RNA polymerase ensures promoter specific transcription initiation
    Article Snippet: The labelled template was produced using a plasmid (pCR2.1-TOPO) containing the mouse mitochondrial promoter region (mtDNA positions 15942-341) as template. .. The DNase I reaction was stopped after 2 min by addition of 20 μl stop buffer [200 mM NaCl, 20 mM EDTA, 1% SDS and 100 μg/ml yeast tRNA (Ambion)] directly followed by incubation on ice.

    Concentration Assay:

    Article Title: Campylobacter jejuni biofilms contain extracellular DNA and are sensitive to DNase I treatment
    Article Snippet: Enzyme treatment of C. jejuni biofilms For DNase I treatments, unless otherwise stated, a volume of 4 μl DNase I enzyme (Fermentas), giving a final concentration within the biofilm of 4 U/ml v/v and 4 μl of DNase I buffer (Fermentas) were added to each test tube, along with 1 ml of diluted cell suspension at either the start of the static incubation or after 12, 24, 36, or 48 h of static incubation. .. For the assays assessing the time required for DNase I activity, biofilms were allowed to form for 48 h before addition of 4 U/ml v/v DNase I enzyme (1 U/μl, Fermentas) and 4 μl of DNase I buffer to the samples, followed by incubation for up to 2 h. During the incubation with enzyme the samples were placed in 37°C, aerobic conditions.

    Article Title: A tumor-promoting mechanism mediated by retrotransposon-encoded reverse transcriptase is active in human transformed cell lines
    Article Snippet: Solid CsCl was added to a final concentration of 1.01 g/ml to 4 ml aliquots containing 20 ug DNA and 200 ug/ml of ethidium bromide [ ] in polyallomer tubes (Beckman 342412) and centrifuged at 60,000 rpm for 24 h at room temperature in a VTi65 rotor in a Thermo Scientific WX Ultra 100 ultracentrifuge. .. To determine the product sizes, fractions 8 (bulk) and 21 (hybrid) from control and EFV-treated A375 cells were digested with DNAse I or RNAse H/ DNAse I, labelled with alpha-32 P dCTP using the Invitrogen Random Primers DNA Labeling System kit (18187-013) and fractionated through 1.7% agarose gels; the gels were then dried and exposed to autoradiographic films.

    Article Title: Campylobacter jejuni biofilms contain extracellular DNA and are sensitive to DNase I treatment
    Article Snippet: .. Enzyme treatment of C. jejuni biofilms For DNase I treatments, unless otherwise stated, a volume of 4 μl DNase I enzyme (Fermentas), giving a final concentration within the biofilm of 4 U/ml v/v and 4 μl of DNase I buffer (Fermentas) were added to each test tube, along with 1 ml of diluted cell suspension at either the start of the static incubation or after 12, 24, 36, or 48 h of static incubation. .. Following treatment, static cultures were placed back in 37°C, aerobic conditions to complete the 48 h incubation before staining with crystal violet to allow biofilm quantification.

    Lysis:

    Article Title: A tumor-promoting mechanism mediated by retrotransposon-encoded reverse transcriptase is active in human transformed cell lines
    Article Snippet: EtBr-CsCl buoyant density gradients and analysis of gradient fractions Genomic DNA was extracted from WI38, PC3 and A-375 cell lines in lysis buffer (50 mM TRIS-HCl pH 7, 2 mM EDTA pH 8, 1% SDS) supplemented with 50 ug/ml Proteinase K (Sigma-Aldrich) and 145 ug/ml RNAse A (Sigma-Aldrich) overnight at 37°C, followed by several phenol/chlorophorm extractions. .. To determine the product sizes, fractions 8 (bulk) and 21 (hybrid) from control and EFV-treated A375 cells were digested with DNAse I or RNAse H/ DNAse I, labelled with alpha-32 P dCTP using the Invitrogen Random Primers DNA Labeling System kit (18187-013) and fractionated through 1.7% agarose gels; the gels were then dried and exposed to autoradiographic films.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher dna digestion mix
    Overview of RT-RamDA and single-cell RamDA-seq. a Schematic diagram of RT-RamDA. 1. RT primers (oligo-dT and not-so-random primers) anneal to a RNA template. 2. Complementary <t>DNA</t> (cDNA) is synthesized by the RNA-dependent DNA polymerase activity of RNase H minus reverse transcriptase (RTase). 3. Endonuclease <t>(DNase</t> I) selectively nicks the cDNA of the RNA:cDNA hybrid strand. 4. The 3′ cDNA strand is displaced by the strand displacement activity of RTase mediated by the T4 gene 32 protein (gp32), starting from the nick randomly introduced by DNase I. cDNA is amplified as a displaced strand and protected by gp32 from DNase I. b Relative yield of cDNA molecules using RT-qPCR ( n = 4). Mouse ESC total RNA (10 pg) was used as a template, and 1/10 the amount of cDNA was used for qPCR. The relative yield was calculated by averaging the amplification efficiency of four mESC ( Nanog , Pou5f1 , Zfp42 , and Sox2 ) and three housekeeping ( Gnb2l1 , Atp5a1 , and Tubb5 ) genes using a conventional method (−) as a standard. c Schematic diagram of RamDA-seq and C1-RamDA-seq. For details, please refer to the Methods section. d Number of detected transcripts with twofold or lower expression changes against rdRNA-seq (count ≥ 10). For the boxplots in b and d , the center line, and lower and upper bounds of each box represent the median, and first and third quartiles, respectively. The lower (upper) whisker extends to smallest (largest) values no further than 1.5 × interquartile range (IQR) from the first (third) quartile. e Squared coefficient of variation of the read count. All conditions were adjusted, and 10 million reads were used in d and e . Transcripts were annotated by GENCODE gene annotation (vM9)
    Dna Digestion Mix, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dna digestion mix/product/Thermo Fisher
    Average 99 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    dna digestion mix - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher rnase a
    Deletions within the A+T region of mtDNA in Schneider S2 cells overexpressing mtDNA helicase. ( A ) Agarose gel electrophoresis of HindIII-treated mtNA (4 μg) obtained from control (lane 1) and mtDNA helicase-overexpressing (lane 2) S2 cells. The uncut material and resulting HindIII A, B and C fragments are indicated on the right. The bracket shows the distribution of RNase A-sensitive material (see   Supplementary Figure S2 ). Fragment size is indicated in kb on the left. ( B ) Agarose gel electrophoresis of HindIII-SacI-treated mtNA (4 μg) obtained from control (lane 1) and mtDNA helicase-overexpressing (lane 2) S2 cells. The resulting bands are labeled relative to the HindIII fragment nomenclature on the right: uncut material and control HindIII B fragment (lane 1) remain undigested; deletion-bearing HindIII B fragments of mtDNA from helicase-overexpressing cells (lane 2) are labeled as B1, B2, B3; SacI digestion of the HindIII A fragment generates derivative fragments A, A’, A’’; SacI digestion of the HindIII C fragment generates derivative fragments C, C’. Fragment size is indicated in kb on the left. ( C ) Southern-blotting analysis of HindIII-treated mtNA samples obtained from control (lane 1) and mtDNA helicase-overexpressing (lane 2) S2 cells. Fragments encompassing the origin of replication were visualized by hybridization with the Ori probe (see Figure   4A , and Materials and Methods). The HindIII B fragment and its deletion-bearing derivatives B1, B2 and B3, as well as uncut material are labeled on the right. ( D ) Southern-blotting analysis of HindIII-treated mtNA samples obtained from control (lanes 1) and mtDNA helicase-overexpressing (lanes 2) S2 cells. Fragments were visualized by ethidium bromide staining in the agarose gel (EtBr), or by hybridization with probes specific to the replication origin site (Ori), and coding region (6, see Figure   1 ). M indicates a molecular weight standard with fragment sizes indicated in kb at left.
    Rnase A, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1236 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rnase a/product/Thermo Fisher
    Average 99 stars, based on 1236 article reviews
    Price from $9.99 to $1999.99
    rnase a - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results


    Overview of RT-RamDA and single-cell RamDA-seq. a Schematic diagram of RT-RamDA. 1. RT primers (oligo-dT and not-so-random primers) anneal to a RNA template. 2. Complementary DNA (cDNA) is synthesized by the RNA-dependent DNA polymerase activity of RNase H minus reverse transcriptase (RTase). 3. Endonuclease (DNase I) selectively nicks the cDNA of the RNA:cDNA hybrid strand. 4. The 3′ cDNA strand is displaced by the strand displacement activity of RTase mediated by the T4 gene 32 protein (gp32), starting from the nick randomly introduced by DNase I. cDNA is amplified as a displaced strand and protected by gp32 from DNase I. b Relative yield of cDNA molecules using RT-qPCR ( n = 4). Mouse ESC total RNA (10 pg) was used as a template, and 1/10 the amount of cDNA was used for qPCR. The relative yield was calculated by averaging the amplification efficiency of four mESC ( Nanog , Pou5f1 , Zfp42 , and Sox2 ) and three housekeeping ( Gnb2l1 , Atp5a1 , and Tubb5 ) genes using a conventional method (−) as a standard. c Schematic diagram of RamDA-seq and C1-RamDA-seq. For details, please refer to the Methods section. d Number of detected transcripts with twofold or lower expression changes against rdRNA-seq (count ≥ 10). For the boxplots in b and d , the center line, and lower and upper bounds of each box represent the median, and first and third quartiles, respectively. The lower (upper) whisker extends to smallest (largest) values no further than 1.5 × interquartile range (IQR) from the first (third) quartile. e Squared coefficient of variation of the read count. All conditions were adjusted, and 10 million reads were used in d and e . Transcripts were annotated by GENCODE gene annotation (vM9)

    Journal: Nature Communications

    Article Title: Single-cell full-length total RNA sequencing uncovers dynamics of recursive splicing and enhancer RNAs

    doi: 10.1038/s41467-018-02866-0

    Figure Lengend Snippet: Overview of RT-RamDA and single-cell RamDA-seq. a Schematic diagram of RT-RamDA. 1. RT primers (oligo-dT and not-so-random primers) anneal to a RNA template. 2. Complementary DNA (cDNA) is synthesized by the RNA-dependent DNA polymerase activity of RNase H minus reverse transcriptase (RTase). 3. Endonuclease (DNase I) selectively nicks the cDNA of the RNA:cDNA hybrid strand. 4. The 3′ cDNA strand is displaced by the strand displacement activity of RTase mediated by the T4 gene 32 protein (gp32), starting from the nick randomly introduced by DNase I. cDNA is amplified as a displaced strand and protected by gp32 from DNase I. b Relative yield of cDNA molecules using RT-qPCR ( n = 4). Mouse ESC total RNA (10 pg) was used as a template, and 1/10 the amount of cDNA was used for qPCR. The relative yield was calculated by averaging the amplification efficiency of four mESC ( Nanog , Pou5f1 , Zfp42 , and Sox2 ) and three housekeeping ( Gnb2l1 , Atp5a1 , and Tubb5 ) genes using a conventional method (−) as a standard. c Schematic diagram of RamDA-seq and C1-RamDA-seq. For details, please refer to the Methods section. d Number of detected transcripts with twofold or lower expression changes against rdRNA-seq (count ≥ 10). For the boxplots in b and d , the center line, and lower and upper bounds of each box represent the median, and first and third quartiles, respectively. The lower (upper) whisker extends to smallest (largest) values no further than 1.5 × interquartile range (IQR) from the first (third) quartile. e Squared coefficient of variation of the read count. All conditions were adjusted, and 10 million reads were used in d and e . Transcripts were annotated by GENCODE gene annotation (vM9)

    Article Snippet: To eliminate genomic DNA contamination, 1 μL of genomic DNA digestion mix (0.5× PrimeScript Buffer, 0.2 U of DNase I Amplification Grade, 1: 5 000 000 ERCC RNA Spike-In Mix I (Thermo Fisher) in RNase-free water) was added to 1 μL of the denatured sample.

    Techniques: Synthesized, Activity Assay, Amplification, Quantitative RT-PCR, Real-time Polymerase Chain Reaction, Expressing, Whisker Assay

    Deletions within the A+T region of mtDNA in Schneider S2 cells overexpressing mtDNA helicase. ( A ) Agarose gel electrophoresis of HindIII-treated mtNA (4 μg) obtained from control (lane 1) and mtDNA helicase-overexpressing (lane 2) S2 cells. The uncut material and resulting HindIII A, B and C fragments are indicated on the right. The bracket shows the distribution of RNase A-sensitive material (see   Supplementary Figure S2 ). Fragment size is indicated in kb on the left. ( B ) Agarose gel electrophoresis of HindIII-SacI-treated mtNA (4 μg) obtained from control (lane 1) and mtDNA helicase-overexpressing (lane 2) S2 cells. The resulting bands are labeled relative to the HindIII fragment nomenclature on the right: uncut material and control HindIII B fragment (lane 1) remain undigested; deletion-bearing HindIII B fragments of mtDNA from helicase-overexpressing cells (lane 2) are labeled as B1, B2, B3; SacI digestion of the HindIII A fragment generates derivative fragments A, A’, A’’; SacI digestion of the HindIII C fragment generates derivative fragments C, C’. Fragment size is indicated in kb on the left. ( C ) Southern-blotting analysis of HindIII-treated mtNA samples obtained from control (lane 1) and mtDNA helicase-overexpressing (lane 2) S2 cells. Fragments encompassing the origin of replication were visualized by hybridization with the Ori probe (see Figure   4A , and Materials and Methods). The HindIII B fragment and its deletion-bearing derivatives B1, B2 and B3, as well as uncut material are labeled on the right. ( D ) Southern-blotting analysis of HindIII-treated mtNA samples obtained from control (lanes 1) and mtDNA helicase-overexpressing (lanes 2) S2 cells. Fragments were visualized by ethidium bromide staining in the agarose gel (EtBr), or by hybridization with probes specific to the replication origin site (Ori), and coding region (6, see Figure   1 ). M indicates a molecular weight standard with fragment sizes indicated in kb at left.

    Journal: Nucleic Acids Research

    Article Title: Structural rearrangements in the mitochondrial genome of Drosophila melanogaster induced by elevated levels of the replicative DNA helicase

    doi: 10.1093/nar/gky094

    Figure Lengend Snippet: Deletions within the A+T region of mtDNA in Schneider S2 cells overexpressing mtDNA helicase. ( A ) Agarose gel electrophoresis of HindIII-treated mtNA (4 μg) obtained from control (lane 1) and mtDNA helicase-overexpressing (lane 2) S2 cells. The uncut material and resulting HindIII A, B and C fragments are indicated on the right. The bracket shows the distribution of RNase A-sensitive material (see Supplementary Figure S2 ). Fragment size is indicated in kb on the left. ( B ) Agarose gel electrophoresis of HindIII-SacI-treated mtNA (4 μg) obtained from control (lane 1) and mtDNA helicase-overexpressing (lane 2) S2 cells. The resulting bands are labeled relative to the HindIII fragment nomenclature on the right: uncut material and control HindIII B fragment (lane 1) remain undigested; deletion-bearing HindIII B fragments of mtDNA from helicase-overexpressing cells (lane 2) are labeled as B1, B2, B3; SacI digestion of the HindIII A fragment generates derivative fragments A, A’, A’’; SacI digestion of the HindIII C fragment generates derivative fragments C, C’. Fragment size is indicated in kb on the left. ( C ) Southern-blotting analysis of HindIII-treated mtNA samples obtained from control (lane 1) and mtDNA helicase-overexpressing (lane 2) S2 cells. Fragments encompassing the origin of replication were visualized by hybridization with the Ori probe (see Figure 4A , and Materials and Methods). The HindIII B fragment and its deletion-bearing derivatives B1, B2 and B3, as well as uncut material are labeled on the right. ( D ) Southern-blotting analysis of HindIII-treated mtNA samples obtained from control (lanes 1) and mtDNA helicase-overexpressing (lanes 2) S2 cells. Fragments were visualized by ethidium bromide staining in the agarose gel (EtBr), or by hybridization with probes specific to the replication origin site (Ori), and coding region (6, see Figure 1 ). M indicates a molecular weight standard with fragment sizes indicated in kb at left.

    Article Snippet: Treatment with RNase A (Thermo Scientific) for 2DAGE and EM analyses was performed with 1 unit of enzyme per μg of mtNA in 10 mM Tris–HCl pH 8.0, 1 mM EDTA buffer for 2 h at 37°C.

    Techniques: Agarose Gel Electrophoresis, Labeling, Southern Blot, Hybridization, Staining, Molecular Weight

    Enrichment of triplex-forming RNAs. ( A ) Schematic overview of the method to enrich DNA-associated RNA. ( B ) RT-qPCR monitoring the indicated RNAs recovered from HeLa S3 cells, nuclei and purified chromatin. Values are normalized to cellular RNA (±SEM, N = 3). ( C ) Polyacrylamide gel electrophoresis of 5′-labeled RNA enriched by SPRI-size selection. Control samples were treated with DNase I before size selection or with RNase A before gel loading. ( D ) RT-qPCR analysis of DNA-associated RNA from HeLa S3 cells isolated by SPRI-size selection. Values are normalized to cellular RNA. Control samples were treated with DNase I before size selection (±SEM, N = 3). ( E ) RNA-seq profiles for KHPS1 in DNA-associated RNAs (DNA-IP) and nuclear RNA from U2OS cells. The overlap with the TFR of KHPS1 is shaded. Minus (–) and plus (+) strands are shown.

    Journal: Nucleic Acids Research

    Article Title: Isolation and genome-wide characterization of cellular DNA:RNA triplex structures

    doi: 10.1093/nar/gky1305

    Figure Lengend Snippet: Enrichment of triplex-forming RNAs. ( A ) Schematic overview of the method to enrich DNA-associated RNA. ( B ) RT-qPCR monitoring the indicated RNAs recovered from HeLa S3 cells, nuclei and purified chromatin. Values are normalized to cellular RNA (±SEM, N = 3). ( C ) Polyacrylamide gel electrophoresis of 5′-labeled RNA enriched by SPRI-size selection. Control samples were treated with DNase I before size selection or with RNase A before gel loading. ( D ) RT-qPCR analysis of DNA-associated RNA from HeLa S3 cells isolated by SPRI-size selection. Values are normalized to cellular RNA. Control samples were treated with DNase I before size selection (±SEM, N = 3). ( E ) RNA-seq profiles for KHPS1 in DNA-associated RNAs (DNA-IP) and nuclear RNA from U2OS cells. The overlap with the TFR of KHPS1 is shaded. Minus (–) and plus (+) strands are shown.

    Article Snippet: Treatment with RNase A abolished the labeled signal, demonstrating that the RNA was free of DNA.

    Techniques: Quantitative RT-PCR, Purification, Polyacrylamide Gel Electrophoresis, Labeling, Selection, Isolation, RNA Sequencing Assay

    Extracellular, motor neuron-derived miR-218 is protein-bound and its activity can be blocked using ASOs. ( A ) ALS end-stage rat model CSF was treated with RNase A, proteinase K and Triton™ X-100. Treatment with RNase A only degrades free miR-218 (∼15% of total). Treatment with proteinase K followed by RNase A degrades free and protein-bound miR-218 (∼80% of total). Treatment with Triton ™ X-100, to solubilize vesicles, followed by proteinase K and RNase A has no further effect on the miR-218 signal. Conversely, treatment of rat serum with proteinase K followed by RNase A degrades only ∼50% of let-7a, whereas pretreatment with Triton™ X-100 results in 100% loss of the let-7a signal. n = 3–4/condition. ( B ) Biotinylated anti-miR-218 oligonucleotides can precipitate miR-218, but not control miRNA 103a-3p, from ALS rat model CSF. n = 2/condition. Each trial was normalized to the corresponding no oligonucleotide control. ( C ) Treatment of primary astrocytes with media from sporadic ALS patient (sALS) iPSC-derived motor neurons (iMNs) results in loss of EAAT2 protein, but can be mitigated by addition of anti-miR-218 ASOs. n = 3. ( D ) Primary astrocytes expressing the miR-218 uptake sensor also respond to iPSC-derived motor neuron media, and this response is mitigated by anti-miR-218 ASOs. n = 3 Biological replicates with 2–4 technical replicates/assay. Values represented as mean ± SEM. One-way ANOVA with multiple comparisons ( D ).

    Journal: Brain

    Article Title: Motor neuron-derived microRNAs cause astrocyte dysfunction in amyotrophic lateral sclerosis

    doi: 10.1093/brain/awy182

    Figure Lengend Snippet: Extracellular, motor neuron-derived miR-218 is protein-bound and its activity can be blocked using ASOs. ( A ) ALS end-stage rat model CSF was treated with RNase A, proteinase K and Triton™ X-100. Treatment with RNase A only degrades free miR-218 (∼15% of total). Treatment with proteinase K followed by RNase A degrades free and protein-bound miR-218 (∼80% of total). Treatment with Triton ™ X-100, to solubilize vesicles, followed by proteinase K and RNase A has no further effect on the miR-218 signal. Conversely, treatment of rat serum with proteinase K followed by RNase A degrades only ∼50% of let-7a, whereas pretreatment with Triton™ X-100 results in 100% loss of the let-7a signal. n = 3–4/condition. ( B ) Biotinylated anti-miR-218 oligonucleotides can precipitate miR-218, but not control miRNA 103a-3p, from ALS rat model CSF. n = 2/condition. Each trial was normalized to the corresponding no oligonucleotide control. ( C ) Treatment of primary astrocytes with media from sporadic ALS patient (sALS) iPSC-derived motor neurons (iMNs) results in loss of EAAT2 protein, but can be mitigated by addition of anti-miR-218 ASOs. n = 3. ( D ) Primary astrocytes expressing the miR-218 uptake sensor also respond to iPSC-derived motor neuron media, and this response is mitigated by anti-miR-218 ASOs. n = 3 Biological replicates with 2–4 technical replicates/assay. Values represented as mean ± SEM. One-way ANOVA with multiple comparisons ( D ).

    Article Snippet: For RNase A treatment, 1 μg/ml of RNase A (Thermo; R1253) was added and the sample was incubated for 15 min at 37°C.

    Techniques: Derivative Assay, Activity Assay, Expressing