rnas  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86
    Name:
    ERCC RNA Spike In Mix
    Description:
    Variation in RNA expression data can be attributed to a variety of factors including the quality of the starting material the level of cellularity and RNA yield the platform employed and the person performing the experiment To control for these sources of variability a common set of external RNA controls has been developed by the External RNA Controls Consortium ERCC an ad hoc group of academic private and public organizations hosted by the National Institute of Standards and Technology NIST The controls consist of a set of unlabeled polyadenylated transcripts designed to be added to an RNA analysis experiment after sample isolation in order to measure against defined performance criteria Up until the design of such universally accepted controls it has been difficult to execute a thorough investigation of fundamental analytical performance metrics From the trusted brand of quality RNA reagents Ambion ERCC Spike In Control Mixes are commercially available pre formulated blends of 92 transcripts derived and traceable from NIST certified DNA plasmids The transcripts are designed to be 250 to 2 000 nt in length which mimic natural eukaryotic mRNAs Key product features Achieve a standard measure for data comparison across gene expression experiments• Measure sensitivity lower limit of detection and dynamic range of an experiment• Quantitate differential gene expressionUnlock the Potential of RNA AnalysisRNA analysis including gene expression profiling and whole transcriptome surveying can lead to better understanding of expression patterns in disease states and provides greater insights into biological pathways and molecular mechanisms that regulate cell fate development and disease progression Traditional methods of RNA analysis such as qRT PCR and microarrays are well established but are being replaced by next generation sequencing a high throughput digital alternative Because each method carries multiple platforms and with the need to compare various samples across platforms throughout the world a standard measure for data comparison is necessary As the capabilities of RNA analysis expand the necessity to create a standardized view of data will become even more important Achieve and Compare Results with Confirmed AccuracyAmbion ERCC RNA Spike In Controls are used to create a standard baseline measurement of RNA both within an experiment and across multiple experiments performed using various samples and platforms With two spike in mix formulations Figure 1 various measurements such as sensitivity or dynamic range can be examined to assess different parameters in an experiment or across experiments Figure 2 Furthermore expression fold change ratios between two samples can be calculated with a high degree of confidence using the highly concordant relationship between ExFold RNA Spike In 1 and ExFold RNA Spike In 2 Figure 3 Measurements are determined via known molar concentrations for each transcript within a spike in mix and through association of the two mixes using a combination of ratios across 4 different subgroups of the 92 transcripts The controls are ideal for next generation sequencing experiments such as on SOLiD System and supported microarray platforms such as the Illumina Sentrix BeadChip Choose Among Flexible Options for ERCC Kit ConfigurationsWhether measuring dynamic range or gene expression fold change Ambion ERCC Spike In Control Mixes are available in two kit configurations to meet your experimental needs Use the ERCC Spike In Mix to determine the dynamic range and lower limit of detection on your platform and use the ERCC ExFold Spike In Mixes to assess the accuracy of differential gene expression measurements ERCC RNA Spike In Mix 1 ExFold Spike In Mix 1 ExFold Spike In Mix 2 Nuclease free WaterERCC RNA Spike In Mix Cat No 4456740 10 µL 1 75 mLERCC ExFold RNA Spike In Mixes Cat No 4456739 10 µL10 µL1 75 mL Although ERCC RNA Spike In Mix 1 and ExFold Spike In Mix 1 contain the same formulation of ERCC transcripts do not substitute ERCC RNA Spike In Mix 1 for ExFold Spike In Mix 1 for fold change assessment Use only ExFold Spike In Mix 1 and Mix 2 with the same manufacturing lot number For Research Use Only Not for use in diagnostics procedures
    Catalog Number:
    4456740
    Price:
    None
    Category:
    Standards Ladders Controls
    Applications:
    PCR & Real-Time PCR|RNA Sequencing|Real Time PCR (qPCR)|Real-Time PCR Primers, Probes, Arrays & Controls|SOLiD® Next-Generation Sequencing|Sample & Library Preparation for SOLiD® Next-Generation Sequencing|Whole Transcriptome Sequencing|Sequencing|Gene Expression Analysis & Genotyping|Microarray Hybridization & General Reagents
    Buy from Supplier


    Structured Review

    Thermo Fisher rnas
    Characteristics of YB-1–associated short <t>RNAs.</t> ( A ) Analysis of distinct YB-1–associated short RNAs (shyRNAs) after removal of input RNAs. ( B ) The RNY3 <t>RNA</t> is matched to YB-1–associated shyRNAs (blue) and low abundance small RNAs
    Variation in RNA expression data can be attributed to a variety of factors including the quality of the starting material the level of cellularity and RNA yield the platform employed and the person performing the experiment To control for these sources of variability a common set of external RNA controls has been developed by the External RNA Controls Consortium ERCC an ad hoc group of academic private and public organizations hosted by the National Institute of Standards and Technology NIST The controls consist of a set of unlabeled polyadenylated transcripts designed to be added to an RNA analysis experiment after sample isolation in order to measure against defined performance criteria Up until the design of such universally accepted controls it has been difficult to execute a thorough investigation of fundamental analytical performance metrics From the trusted brand of quality RNA reagents Ambion ERCC Spike In Control Mixes are commercially available pre formulated blends of 92 transcripts derived and traceable from NIST certified DNA plasmids The transcripts are designed to be 250 to 2 000 nt in length which mimic natural eukaryotic mRNAs Key product features Achieve a standard measure for data comparison across gene expression experiments• Measure sensitivity lower limit of detection and dynamic range of an experiment• Quantitate differential gene expressionUnlock the Potential of RNA AnalysisRNA analysis including gene expression profiling and whole transcriptome surveying can lead to better understanding of expression patterns in disease states and provides greater insights into biological pathways and molecular mechanisms that regulate cell fate development and disease progression Traditional methods of RNA analysis such as qRT PCR and microarrays are well established but are being replaced by next generation sequencing a high throughput digital alternative Because each method carries multiple platforms and with the need to compare various samples across platforms throughout the world a standard measure for data comparison is necessary As the capabilities of RNA analysis expand the necessity to create a standardized view of data will become even more important Achieve and Compare Results with Confirmed AccuracyAmbion ERCC RNA Spike In Controls are used to create a standard baseline measurement of RNA both within an experiment and across multiple experiments performed using various samples and platforms With two spike in mix formulations Figure 1 various measurements such as sensitivity or dynamic range can be examined to assess different parameters in an experiment or across experiments Figure 2 Furthermore expression fold change ratios between two samples can be calculated with a high degree of confidence using the highly concordant relationship between ExFold RNA Spike In 1 and ExFold RNA Spike In 2 Figure 3 Measurements are determined via known molar concentrations for each transcript within a spike in mix and through association of the two mixes using a combination of ratios across 4 different subgroups of the 92 transcripts The controls are ideal for next generation sequencing experiments such as on SOLiD System and supported microarray platforms such as the Illumina Sentrix BeadChip Choose Among Flexible Options for ERCC Kit ConfigurationsWhether measuring dynamic range or gene expression fold change Ambion ERCC Spike In Control Mixes are available in two kit configurations to meet your experimental needs Use the ERCC Spike In Mix to determine the dynamic range and lower limit of detection on your platform and use the ERCC ExFold Spike In Mixes to assess the accuracy of differential gene expression measurements ERCC RNA Spike In Mix 1 ExFold Spike In Mix 1 ExFold Spike In Mix 2 Nuclease free WaterERCC RNA Spike In Mix Cat No 4456740 10 µL 1 75 mLERCC ExFold RNA Spike In Mixes Cat No 4456739 10 µL10 µL1 75 mL Although ERCC RNA Spike In Mix 1 and ExFold Spike In Mix 1 contain the same formulation of ERCC transcripts do not substitute ERCC RNA Spike In Mix 1 for ExFold Spike In Mix 1 for fold change assessment Use only ExFold Spike In Mix 1 and Mix 2 with the same manufacturing lot number For Research Use Only Not for use in diagnostics procedures
    https://www.bioz.com/result/rnas/product/Thermo Fisher
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    rnas - by Bioz Stars, 2021-07
    86/100 stars

    Images

    1) Product Images from "Noncoding RNAs that associate with YB-1 alter proliferation in prostate cancer cells"

    Article Title: Noncoding RNAs that associate with YB-1 alter proliferation in prostate cancer cells

    Journal: RNA

    doi: 10.1261/rna.045559.114

    Characteristics of YB-1–associated short RNAs. ( A ) Analysis of distinct YB-1–associated short RNAs (shyRNAs) after removal of input RNAs. ( B ) The RNY3 RNA is matched to YB-1–associated shyRNAs (blue) and low abundance small RNAs
    Figure Legend Snippet: Characteristics of YB-1–associated short RNAs. ( A ) Analysis of distinct YB-1–associated short RNAs (shyRNAs) after removal of input RNAs. ( B ) The RNY3 RNA is matched to YB-1–associated shyRNAs (blue) and low abundance small RNAs

    Techniques Used:

    2) Product Images from "Efficient Translation Initiation Is Required for Replication of Bovine Viral Diarrhea Virus Subgenomic Replicons"

    Article Title: Efficient Translation Initiation Is Required for Replication of Bovine Viral Diarrhea Virus Subgenomic Replicons

    Journal: Journal of Virology

    doi: 10.1128/JVI.75.9.4226-4238.2001

    RNA and protein accumulation in MDBK cells transfected with the wt and reconstructed MetNS3 RNAs, ad3.1, ad3.2, ad3.4, ad3.5, and ad3.6. (A) Sequence changes identified in five individual cDNA clones after replacing the wt MetNS3 sequence with the corresponding RT-PCR product amplified from passage 4 MetNS3 RNA as described in Materials and Methods. The wt MetNS3 nucleotide sequence is shown at the top with the single-letter amino acid code above. The 1st, 13th, 25th, and 50th amino acids are indicated along with the first nucleotide number of the codons. Hash marks (⫽) represent breaks in the linear sequence. Mutations are indicated in bold, and any resulting amino acid change is above the codon. Dots indicate homology with the wt MetNS3 sequences. (B and C) Analysis of RNA and protein accumulation, respectively, per ∼4 × 10 6 cells transfected with in vitro-transcribed RNAs. Shown are wt MetNS3 (lanes 2) and the adapted derivatives MetNS3 RNAs (lanes 3 to 7). Mock (—) transfections (lanes 1) lacked RNA. RNA accumulation was detected by radiolabeling the transfected cells with H 3 32 PO 4 between 16 and 24 h p.t. in the presence of dactinomycin. Total cellular RNA was glyoxylated, separated on a 1% agarose gel, and visualized by autoradiography. The position of the sg RNA is indicated. The radiolabeled bands were quantitated with a Molecular Imager (Bio-Rad Laboratories) and normalized to transfection efficiency and total 18S rRNA as described in Materials and Methods. The percentages of each sg RNA relative to ad3.4 (100%) are indicated. (B). Transfected cell lysates were prepared at 18 h p.t. and separated by SDS–8% PAGE. NS3 levels were detected with polyclonal rabbit NS3-specific antisera by Western blot analysis. Molecular mass markers are indicated on the right and the migration of NS3 is indicated on the left (C).
    Figure Legend Snippet: RNA and protein accumulation in MDBK cells transfected with the wt and reconstructed MetNS3 RNAs, ad3.1, ad3.2, ad3.4, ad3.5, and ad3.6. (A) Sequence changes identified in five individual cDNA clones after replacing the wt MetNS3 sequence with the corresponding RT-PCR product amplified from passage 4 MetNS3 RNA as described in Materials and Methods. The wt MetNS3 nucleotide sequence is shown at the top with the single-letter amino acid code above. The 1st, 13th, 25th, and 50th amino acids are indicated along with the first nucleotide number of the codons. Hash marks (⫽) represent breaks in the linear sequence. Mutations are indicated in bold, and any resulting amino acid change is above the codon. Dots indicate homology with the wt MetNS3 sequences. (B and C) Analysis of RNA and protein accumulation, respectively, per ∼4 × 10 6 cells transfected with in vitro-transcribed RNAs. Shown are wt MetNS3 (lanes 2) and the adapted derivatives MetNS3 RNAs (lanes 3 to 7). Mock (—) transfections (lanes 1) lacked RNA. RNA accumulation was detected by radiolabeling the transfected cells with H 3 32 PO 4 between 16 and 24 h p.t. in the presence of dactinomycin. Total cellular RNA was glyoxylated, separated on a 1% agarose gel, and visualized by autoradiography. The position of the sg RNA is indicated. The radiolabeled bands were quantitated with a Molecular Imager (Bio-Rad Laboratories) and normalized to transfection efficiency and total 18S rRNA as described in Materials and Methods. The percentages of each sg RNA relative to ad3.4 (100%) are indicated. (B). Transfected cell lysates were prepared at 18 h p.t. and separated by SDS–8% PAGE. NS3 levels were detected with polyclonal rabbit NS3-specific antisera by Western blot analysis. Molecular mass markers are indicated on the right and the migration of NS3 is indicated on the left (C).

    Techniques Used: Transfection, Sequencing, Clone Assay, Reverse Transcription Polymerase Chain Reaction, Amplification, In Vitro, Radioactivity, Agarose Gel Electrophoresis, Autoradiography, Polyacrylamide Gel Electrophoresis, Western Blot, Migration

    In vitro translation of wt and adapted NS3 proteins. The wt and reconstructed MetNS3 RNAs were cotranslated with a capped monocistronic CAT RNA in the presence of [ 35 S]methionine as described in Materials and Methods. Reaction products were diluted 10-fold in Laemmli sample buffer and separated by SDS–9% PAGE, and the labeled proteins were visualized by autoradiography. The mock reaction mixture (m; lane 1) contained ddH 2 O only, whereas mock plus CAT (m+c), wt MetNS3, ad3.1, ad3.2, ad3.4, ad3.5, and ad3.6 RNAs each contained CAT RNA (lanes 2, 3, 4, 5, 6, 7, and 8, respectively). The radiolabeled bands were quantitated with a Molecular Imager (Bio-Rad Laboratories). The data are representative of two experiments.
    Figure Legend Snippet: In vitro translation of wt and adapted NS3 proteins. The wt and reconstructed MetNS3 RNAs were cotranslated with a capped monocistronic CAT RNA in the presence of [ 35 S]methionine as described in Materials and Methods. Reaction products were diluted 10-fold in Laemmli sample buffer and separated by SDS–9% PAGE, and the labeled proteins were visualized by autoradiography. The mock reaction mixture (m; lane 1) contained ddH 2 O only, whereas mock plus CAT (m+c), wt MetNS3, ad3.1, ad3.2, ad3.4, ad3.5, and ad3.6 RNAs each contained CAT RNA (lanes 2, 3, 4, 5, 6, 7, and 8, respectively). The radiolabeled bands were quantitated with a Molecular Imager (Bio-Rad Laboratories). The data are representative of two experiments.

    Techniques Used: In Vitro, Polyacrylamide Gel Electrophoresis, Labeling, Autoradiography

    3) Product Images from "Analysis of the interaction between host factor Sam68 and viral elements during foot-and-mouth disease virus infections"

    Article Title: Analysis of the interaction between host factor Sam68 and viral elements during foot-and-mouth disease virus infections

    Journal: Virology Journal

    doi: 10.1186/s12985-015-0452-8

    Replication and translation kinetics of WT G-luc, I 3 G-luc, I 4 G-luc and I 34 G-luc replicon constructs. a Schematic representation of the G-luc replicon construct digested with SwaI restriction enzyme ( above ). The luciferase activity of transcript RNAs for WT G-luc, I 3 G-luc, I 4 G-luc and I 34 G-luc S wa I digested replicon plasmids. On the Y-axis, G-luc signals are expressed in relative luciferase units (RLU) per nanogram of protein and the error bars represent the standard deviation from two independent experiments. X-axis values indicate the time points of G-luc measurement (hours post-transfection). WT, I 3, I 4 and I 34 G-luc are marked as solid black, solid gray, dotted gray and point gray lines, respectively. b Schematic representation of truncated G-luc replicon produced by digestion with M fe I restriction enzyme ( above )
    Figure Legend Snippet: Replication and translation kinetics of WT G-luc, I 3 G-luc, I 4 G-luc and I 34 G-luc replicon constructs. a Schematic representation of the G-luc replicon construct digested with SwaI restriction enzyme ( above ). The luciferase activity of transcript RNAs for WT G-luc, I 3 G-luc, I 4 G-luc and I 34 G-luc S wa I digested replicon plasmids. On the Y-axis, G-luc signals are expressed in relative luciferase units (RLU) per nanogram of protein and the error bars represent the standard deviation from two independent experiments. X-axis values indicate the time points of G-luc measurement (hours post-transfection). WT, I 3, I 4 and I 34 G-luc are marked as solid black, solid gray, dotted gray and point gray lines, respectively. b Schematic representation of truncated G-luc replicon produced by digestion with M fe I restriction enzyme ( above )

    Techniques Used: Construct, Luciferase, Activity Assay, Standard Deviation, Transfection, Produced

    4) Product Images from "Translation of cellular inhibitor of apoptosis protein 1 (c-IAP1) mRNA is IRES mediated and regulated during cell stress"

    Article Title: Translation of cellular inhibitor of apoptosis protein 1 (c-IAP1) mRNA is IRES mediated and regulated during cell stress

    Journal: RNA

    doi: 10.1261/rna.5156804

    The c-IAP1 5′-UTR mediates internal translation initiation in cells transfected with capped, polyadenylated dicistronic RNA constructs. ( A ) Schematic of capped RNAs transcribed in vitro and used in transient transfection of HepG2, 293T, and HeLa
    Figure Legend Snippet: The c-IAP1 5′-UTR mediates internal translation initiation in cells transfected with capped, polyadenylated dicistronic RNA constructs. ( A ) Schematic of capped RNAs transcribed in vitro and used in transient transfection of HepG2, 293T, and HeLa

    Techniques Used: Transfection, Construct, In Vitro

    5) Product Images from "Genome‐wide analysis of long non‐coding RNAs in esophageal squamous cell carcinoma reveals their potential role in invasion and metastasis"

    Article Title: Genome‐wide analysis of long non‐coding RNAs in esophageal squamous cell carcinoma reveals their potential role in invasion and metastasis

    Journal: Thoracic Cancer

    doi: 10.1111/1759-7714.12904

    Hierarchical cluster analysis plots of the samples show the differentially expressed ( a ) long non‐coding RNAs (lncRNAs) and ( b ) messenger RNAs (mRNAs) in esophageal squamous cell carcinoma (ESCC) tissues compared to para‐cancer tissues. Red denotes high relative expression and green low relative expression. Each RNA is represented by a single row of colored boxes and each sample by a single column. The scatter and volcano plots illustrate the distributions of the data in the ( c,e ) lncRNA and ( d,f ) mRNA profiles. The values of the x and y axes in the scatter plot are the averaged normalized signal values of the group (log2 scaled). Red dots represent significantly upregulated genes, green dots represent significantly downregulated genes, and black dots represent genes without significant differences in the scatter and volcano plots. All of these plots directly reflect the quantity and reliability of the genes with significant differences.
    Figure Legend Snippet: Hierarchical cluster analysis plots of the samples show the differentially expressed ( a ) long non‐coding RNAs (lncRNAs) and ( b ) messenger RNAs (mRNAs) in esophageal squamous cell carcinoma (ESCC) tissues compared to para‐cancer tissues. Red denotes high relative expression and green low relative expression. Each RNA is represented by a single row of colored boxes and each sample by a single column. The scatter and volcano plots illustrate the distributions of the data in the ( c,e ) lncRNA and ( d,f ) mRNA profiles. The values of the x and y axes in the scatter plot are the averaged normalized signal values of the group (log2 scaled). Red dots represent significantly upregulated genes, green dots represent significantly downregulated genes, and black dots represent genes without significant differences in the scatter and volcano plots. All of these plots directly reflect the quantity and reliability of the genes with significant differences.

    Techniques Used: Expressing

    Plots of the microarray analysis data of the samples. Hierarchical cluster analysis plots of the expression of ( a ) long non‐coding RNAs (lncRNAs) and ( b ) messenger RNAs (mRNAs) in esophageal squamous cell carcinoma (ESCC) and para‐cancer tissues show good similarities among cancer tissues and among para‐cancer tissues, respectively. Red denotes high relative expression and green denotes low relative expression. Each RNA is represented by a single row of colored boxes and each sample by a single column. The three‐dimensional principal component analysis plots for normalized data of ( c ) lncRNAs and ( d ) mRNAs of the samples, respectively, shows good similarities among cancer tissues and among para‐cancer tissues. Groups ( ) para‐cancer and ( ) cancer. ( e ) The box plots for overall gene expression level in each sample before and after normalization show overall gene expression levels among all samples tended to be the same after normalization.
    Figure Legend Snippet: Plots of the microarray analysis data of the samples. Hierarchical cluster analysis plots of the expression of ( a ) long non‐coding RNAs (lncRNAs) and ( b ) messenger RNAs (mRNAs) in esophageal squamous cell carcinoma (ESCC) and para‐cancer tissues show good similarities among cancer tissues and among para‐cancer tissues, respectively. Red denotes high relative expression and green denotes low relative expression. Each RNA is represented by a single row of colored boxes and each sample by a single column. The three‐dimensional principal component analysis plots for normalized data of ( c ) lncRNAs and ( d ) mRNAs of the samples, respectively, shows good similarities among cancer tissues and among para‐cancer tissues. Groups ( ) para‐cancer and ( ) cancer. ( e ) The box plots for overall gene expression level in each sample before and after normalization show overall gene expression levels among all samples tended to be the same after normalization.

    Techniques Used: Microarray, Expressing

    6) Product Images from "DHX9 regulates production of hepatitis B virus-derived circular RNA and viral protein levels"

    Article Title: DHX9 regulates production of hepatitis B virus-derived circular RNA and viral protein levels

    Journal: Oncotarget

    doi: 10.18632/oncotarget.25104

    Viral circular RNA is produced during HBV replication ( A ) HepG2 cells were transfected with HBV minicircle construct (mc). Three days after transfection, RNAs were extracted and subjected to complementary DNA (cDNA) synthesis by reverse transcription using oligo-dT (Oligo-dT) or random (Random) primers as indicated. Cells without transfection were used as negative controls (NC). PCR was performed using the indicated primer sets. Primer set #1 was used to amplify the core region, and set #2 and set #3 were outward facing primers, which would theoretically result in no amplification. Mcl1 amplification was used as an internal control. RNAs that were not reverse transcribed (RT(−)) were included as negative controls for the PCR to confirm no DNA contamination. Mr, DNA marker. A representative image of two independent experiments is shown. ( B ) RNAs extracted from HepG2 cells transfected with HBV minicircle construct (mc) for 3 days were treated with RNase R and subjected to RT-PCR using random primers and primer set #2. Untransfected cells were used as a negative control (NC). ( C ) HepG2 cells were transfected with HBV pgRNA expressing plasmid (pg). Two days after transfection, extracted RNA was treated with or without RNase R and reverse transcribed using random primers. PCR was performed using primer set #2 and primers for Mcl1 gene amplification as a control. RNAs that were not reverse transcribed (RT(−)) were used as negative controls. Mr, DNA marker. A representative image of two independent experiments is shown. ( D ) DHX9 knockdown leads to increased viral circular RNA production. HepAD38 cells with HBV shut off (Off), HBV continuous expression (On), and HBV continuous expression with shDHX9 expression (On + shDHX9) were subjected to northern blotting with or without RNase R treatment. Probes against HBV RNA primarily spanning the core region and β-actin were used. Gel staining with ethidium bromide is shown to confirm RNA integrity (bands of 28S and 18S ribosomal RNA) and the effects of RNase treatment (disappearance of ribosomal RNA bands). A representative image of two independent experiments is shown.
    Figure Legend Snippet: Viral circular RNA is produced during HBV replication ( A ) HepG2 cells were transfected with HBV minicircle construct (mc). Three days after transfection, RNAs were extracted and subjected to complementary DNA (cDNA) synthesis by reverse transcription using oligo-dT (Oligo-dT) or random (Random) primers as indicated. Cells without transfection were used as negative controls (NC). PCR was performed using the indicated primer sets. Primer set #1 was used to amplify the core region, and set #2 and set #3 were outward facing primers, which would theoretically result in no amplification. Mcl1 amplification was used as an internal control. RNAs that were not reverse transcribed (RT(−)) were included as negative controls for the PCR to confirm no DNA contamination. Mr, DNA marker. A representative image of two independent experiments is shown. ( B ) RNAs extracted from HepG2 cells transfected with HBV minicircle construct (mc) for 3 days were treated with RNase R and subjected to RT-PCR using random primers and primer set #2. Untransfected cells were used as a negative control (NC). ( C ) HepG2 cells were transfected with HBV pgRNA expressing plasmid (pg). Two days after transfection, extracted RNA was treated with or without RNase R and reverse transcribed using random primers. PCR was performed using primer set #2 and primers for Mcl1 gene amplification as a control. RNAs that were not reverse transcribed (RT(−)) were used as negative controls. Mr, DNA marker. A representative image of two independent experiments is shown. ( D ) DHX9 knockdown leads to increased viral circular RNA production. HepAD38 cells with HBV shut off (Off), HBV continuous expression (On), and HBV continuous expression with shDHX9 expression (On + shDHX9) were subjected to northern blotting with or without RNase R treatment. Probes against HBV RNA primarily spanning the core region and β-actin were used. Gel staining with ethidium bromide is shown to confirm RNA integrity (bands of 28S and 18S ribosomal RNA) and the effects of RNase treatment (disappearance of ribosomal RNA bands). A representative image of two independent experiments is shown.

    Techniques Used: Produced, Transfection, Construct, Polymerase Chain Reaction, Amplification, Marker, Reverse Transcription Polymerase Chain Reaction, Negative Control, Expressing, Plasmid Preparation, Northern Blot, Staining

    DExH-box helicase 9 (DHX9) knockdown downregulates viral protein levels ( A ) DHX9 co-precipitated with HBV RNAs. RNAs corresponding to each region (S, X, and Core) were mixed with HepG2 cellular lysates in vitro and precipitated. Co-precipitated protein was blotted with anti-DHX9. Five percent of the cell lysates was used as an input. NC: negative control (no RNA). A representative image of two independent experiments is shown. ( B ) HepAD38 cells with hepatitis B virus (HBV) expression were used for the immunoprecipitation of the indicated proteins. Western blotting was used to confirm immunoprecipitation of the targeted proteins. Five percent of the cell lysates was used as an input. Normal rabbit IgG was used as a negative control for the immunoprecipitation. A representative image of two independent experiments is shown. ( C ) RNA was extracted from the precipitants by the indicated proteins and was subjected to reverse transcription-polymerase chain reaction (RT-PCR) to determine if the indicated RNA regions (S, X, Core) were included. A representative image of two independent experiments is shown. ( D ) HepAD38 cells with stably expressing short hairpin RNAs (shRNAs) against the indicated proteins were used for determining the expression levels of the HBV S protein. Before the assay, doxycycline (1.0 μg/ml) was added to the cells for 3 days to shut off the newly synthesized HBV transcripts. HepAD38 cells continuously treated with (Off) or without (On) doxycycline were included as controls. A representative image of two independent experiments is shown.
    Figure Legend Snippet: DExH-box helicase 9 (DHX9) knockdown downregulates viral protein levels ( A ) DHX9 co-precipitated with HBV RNAs. RNAs corresponding to each region (S, X, and Core) were mixed with HepG2 cellular lysates in vitro and precipitated. Co-precipitated protein was blotted with anti-DHX9. Five percent of the cell lysates was used as an input. NC: negative control (no RNA). A representative image of two independent experiments is shown. ( B ) HepAD38 cells with hepatitis B virus (HBV) expression were used for the immunoprecipitation of the indicated proteins. Western blotting was used to confirm immunoprecipitation of the targeted proteins. Five percent of the cell lysates was used as an input. Normal rabbit IgG was used as a negative control for the immunoprecipitation. A representative image of two independent experiments is shown. ( C ) RNA was extracted from the precipitants by the indicated proteins and was subjected to reverse transcription-polymerase chain reaction (RT-PCR) to determine if the indicated RNA regions (S, X, Core) were included. A representative image of two independent experiments is shown. ( D ) HepAD38 cells with stably expressing short hairpin RNAs (shRNAs) against the indicated proteins were used for determining the expression levels of the HBV S protein. Before the assay, doxycycline (1.0 μg/ml) was added to the cells for 3 days to shut off the newly synthesized HBV transcripts. HepAD38 cells continuously treated with (Off) or without (On) doxycycline were included as controls. A representative image of two independent experiments is shown.

    Techniques Used: In Vitro, Negative Control, Expressing, Immunoprecipitation, Western Blot, Reverse Transcription Polymerase Chain Reaction, Stable Transfection, Synthesized

    DHX9 and ribosomal proteins are associated with viral circular RNA ( A ) HepAD38 cells with or without HBV expression (On or Off) were used for DHX9 precipitation. Normal rabbit IgG was used for the negative control (NC). DHX9 precipitation was confirmed by western blotting. A representative image of two independent experiments is shown. ( B ) RNAs were extracted from the immunoprecipitations and reverse transcribed using random primers. PCR was performed using primer set #2. RNAs that were not reverse transcribed were included as negative controls (RT(−)). Mr, DNA marker. A representative image of two independent experiments is shown. ( C ) Ribosomal P0/P1/P2 protein (Ribo0-2) was immunoprecipitated as described in (a). Five percent of the cell lysates was used as an input. A representative image of two independent experiments is shown. ( D ) Extracted RNAs from the immunoprecipitations (RIP) were treated with or without RNase R, followed by reverse transcription using random primers. PCR was performed using primer set #2 and MCl1 gene primers as a control. RNA extracted directly from cells was used as an input. RNAs that were not reverse transcribed were included as negative controls (RT(−)). Mr, DNA marker. A representative image of two independent experiments is shown.
    Figure Legend Snippet: DHX9 and ribosomal proteins are associated with viral circular RNA ( A ) HepAD38 cells with or without HBV expression (On or Off) were used for DHX9 precipitation. Normal rabbit IgG was used for the negative control (NC). DHX9 precipitation was confirmed by western blotting. A representative image of two independent experiments is shown. ( B ) RNAs were extracted from the immunoprecipitations and reverse transcribed using random primers. PCR was performed using primer set #2. RNAs that were not reverse transcribed were included as negative controls (RT(−)). Mr, DNA marker. A representative image of two independent experiments is shown. ( C ) Ribosomal P0/P1/P2 protein (Ribo0-2) was immunoprecipitated as described in (a). Five percent of the cell lysates was used as an input. A representative image of two independent experiments is shown. ( D ) Extracted RNAs from the immunoprecipitations (RIP) were treated with or without RNase R, followed by reverse transcription using random primers. PCR was performed using primer set #2 and MCl1 gene primers as a control. RNA extracted directly from cells was used as an input. RNAs that were not reverse transcribed were included as negative controls (RT(−)). Mr, DNA marker. A representative image of two independent experiments is shown.

    Techniques Used: Expressing, Negative Control, Western Blot, Polymerase Chain Reaction, Marker, Immunoprecipitation

    DHX9 regulates viral circular RNA production and viral protein levels ( A ) A scheme for HBV infection in human primary hepatocytes. At HBV infection, lentivirus-expressing shDHX9 was also applied simultaneously to knock down DHX9. Cells were harvested at 17 days after infection. ( B ) Cell lysates were subjected to western blotting to determine DHX9 and HBV surface protein levels in DHX9-knockdown cells. ( C ) RNAs extracted from the HBV-infected human primary hepatocytes were treated with DNase and subsequently with RNase R, followed by reverse transcription using random primers. cDNAs were subjected to droplet digital PCR using Taqman primers for the absolute quantification of HBV circular DNA. The measurement was performed in triplicate. Data represent the mean ± standard error (SE) of the absolute copy numbers from two independent experiments. * p
    Figure Legend Snippet: DHX9 regulates viral circular RNA production and viral protein levels ( A ) A scheme for HBV infection in human primary hepatocytes. At HBV infection, lentivirus-expressing shDHX9 was also applied simultaneously to knock down DHX9. Cells were harvested at 17 days after infection. ( B ) Cell lysates were subjected to western blotting to determine DHX9 and HBV surface protein levels in DHX9-knockdown cells. ( C ) RNAs extracted from the HBV-infected human primary hepatocytes were treated with DNase and subsequently with RNase R, followed by reverse transcription using random primers. cDNAs were subjected to droplet digital PCR using Taqman primers for the absolute quantification of HBV circular DNA. The measurement was performed in triplicate. Data represent the mean ± standard error (SE) of the absolute copy numbers from two independent experiments. * p

    Techniques Used: Infection, Expressing, Western Blot, Digital PCR

    7) Product Images from "Argonaute proteins regulate HIV-1 multiply spliced RNA and viral production in a Dicer independent manner"

    Article Title: Argonaute proteins regulate HIV-1 multiply spliced RNA and viral production in a Dicer independent manner

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkw1289

    HITS-CLIP reveals HIV-1 regions bound by Ago2 in HIV-1 infected cells. ( A ) HEK293T cells were transfected with plasmid expressing either GFP-Ago2 or control GFP. Twenty-four hours later, they were infected with VSVg-pseudotyped HIV-1 NL4-3 at a M.O.I. of 1 or mock infected. Twenty-four hours later, cells were subjected to UV cross-linking and RNA–protein complexes were subjected to immunoprecipitation using an anti-GFP antibody. IPed RNA was radiolabeled with [γ- 32 P]ATP and samples resolved on SDS-PAGE. Radiolabeled RNA was visualized by autoradiography. RNAs migrating at a higher molecular mass than the protein of interest (GFP-Ago2:RNA, between 125 and 225 kDa) were extracted from the membrane, reverse transcribed into cDNA and subjected to high throughput sequencing. ( B ) Reads obtained from non-infected (NI) and infected (INF) samples were uploaded to CLIPZ software. Reads that aligned to the human genome were sorted into categories: messenger RNA (mRNA), microRNA (miRNA), ribosomal RNA (rRNA), repeat, small non-coding RNA (snRNA), small nucleolar RNA (snoRNA), transfer RNA (tRNA) and other. Pie charts correspond to the distribution of the mean value of three biological replicates. ( C ) Reads obtained from infected samples were aligned to the HIV-1 NL4-3 sequence. Only reads ≥50 nucleotides length that aligned once without mismatch were considered for this analysis. Reads obtained from three independent HITS-CLIP experiments are presented in shades of orange and those obtained from the corresponding inputs in shades of blue. The map of the HIV-1 genome is presented below. Splice donor (D) and acceptor (A) sites are indicated. Peaks corresponding to clusters 2, 13, 16, 21, 25 and 30 are indicated by arrows.
    Figure Legend Snippet: HITS-CLIP reveals HIV-1 regions bound by Ago2 in HIV-1 infected cells. ( A ) HEK293T cells were transfected with plasmid expressing either GFP-Ago2 or control GFP. Twenty-four hours later, they were infected with VSVg-pseudotyped HIV-1 NL4-3 at a M.O.I. of 1 or mock infected. Twenty-four hours later, cells were subjected to UV cross-linking and RNA–protein complexes were subjected to immunoprecipitation using an anti-GFP antibody. IPed RNA was radiolabeled with [γ- 32 P]ATP and samples resolved on SDS-PAGE. Radiolabeled RNA was visualized by autoradiography. RNAs migrating at a higher molecular mass than the protein of interest (GFP-Ago2:RNA, between 125 and 225 kDa) were extracted from the membrane, reverse transcribed into cDNA and subjected to high throughput sequencing. ( B ) Reads obtained from non-infected (NI) and infected (INF) samples were uploaded to CLIPZ software. Reads that aligned to the human genome were sorted into categories: messenger RNA (mRNA), microRNA (miRNA), ribosomal RNA (rRNA), repeat, small non-coding RNA (snRNA), small nucleolar RNA (snoRNA), transfer RNA (tRNA) and other. Pie charts correspond to the distribution of the mean value of three biological replicates. ( C ) Reads obtained from infected samples were aligned to the HIV-1 NL4-3 sequence. Only reads ≥50 nucleotides length that aligned once without mismatch were considered for this analysis. Reads obtained from three independent HITS-CLIP experiments are presented in shades of orange and those obtained from the corresponding inputs in shades of blue. The map of the HIV-1 genome is presented below. Splice donor (D) and acceptor (A) sites are indicated. Peaks corresponding to clusters 2, 13, 16, 21, 25 and 30 are indicated by arrows.

    Techniques Used: Cross-linking Immunoprecipitation, Infection, Transfection, Plasmid Preparation, Expressing, Immunoprecipitation, SDS Page, Autoradiography, Next-Generation Sequencing, Software, Sequencing

    8) Product Images from "Scavenger Chemokine (CXC Motif) Receptor 7 (CXCR7) Is a Direct Target Gene of HIC1 (Hypermethylated in Cancer 1) *"

    Article Title: Scavenger Chemokine (CXC Motif) Receptor 7 (CXCR7) Is a Direct Target Gene of HIC1 (Hypermethylated in Cancer 1) *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M109.022350

    CXCR7 is down-regulated in Ad-FLAG-HIC1-infected U2OS cells, whereas SIRT1 is activated. A , expression levels of CXCR7 and of SIRT1 . Total RNAs from U2OS cells (HIC1 null) infected with Ad-FLAG-HIC1 and Ad-GFP were prepared at the indicated times after infection (from 8 to 26 h), and Affymetrix HG U133A chips were used to measure the gene expression. Expression values were normalized to Ad-GFP-infected control cells at the same time points. The Percent of control corresponds to the ratio between the expression levels of CXCR7 and SIRT1 measured in Ad-GFP and in Ad-FLAG-HIC1-infected cells at each time point. B , confirmation of the microarray results for CXCR7 and SIRT1 by quantitative RT-PCR. qRT-PCR analyses were performed using total RNAs isolated from U2OS cells infected (time course point 16 h) with Ad-GFP ( gray boxes ) or with Ad-FLAG-HIC1 ( black boxes ) for CXCR7 ( left column ) and SIRT1 ( right column ). Values were normalized to GAPDH or actin as indicated.
    Figure Legend Snippet: CXCR7 is down-regulated in Ad-FLAG-HIC1-infected U2OS cells, whereas SIRT1 is activated. A , expression levels of CXCR7 and of SIRT1 . Total RNAs from U2OS cells (HIC1 null) infected with Ad-FLAG-HIC1 and Ad-GFP were prepared at the indicated times after infection (from 8 to 26 h), and Affymetrix HG U133A chips were used to measure the gene expression. Expression values were normalized to Ad-GFP-infected control cells at the same time points. The Percent of control corresponds to the ratio between the expression levels of CXCR7 and SIRT1 measured in Ad-GFP and in Ad-FLAG-HIC1-infected cells at each time point. B , confirmation of the microarray results for CXCR7 and SIRT1 by quantitative RT-PCR. qRT-PCR analyses were performed using total RNAs isolated from U2OS cells infected (time course point 16 h) with Ad-GFP ( gray boxes ) or with Ad-FLAG-HIC1 ( black boxes ) for CXCR7 ( left column ) and SIRT1 ( right column ). Values were normalized to GAPDH or actin as indicated.

    Techniques Used: Infection, Expressing, Microarray, Quantitative RT-PCR, Isolation

    9) Product Images from "Loss of RIG-I leads to a functional replacement with MDA5 in the Chinese tree shrew"

    Article Title: Loss of RIG-I leads to a functional replacement with MDA5 in the Chinese tree shrew

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    doi: 10.1073/pnas.1604939113

    A functional substitute for the lost RIG-I as the ligand of RNA viruses and 5′ triphosphate RNA (5′ ppp RNA) in TSPRCs. ( A ) Overexpression of human RIG-I (hRIG-I) can advance tIFNB1 mRNA expression in response to different viral infections in TSPRCs. Cells (1 × 10 5 ) were transfected with hRIG-I expression vector or empty vector (1 μg) for 24 h and then were infected by viruses for indicated times. The 5′ ppp RNA ( B ) and SeV vRNAs ( C ) up-regulate IFNB1 mRNA expression in HeLa and TSPRCs with a different time-dependent pattern; 5′ ppp RNA (100 ng/mL), 5′ ppp RNA control (100 ng/mL), SeV RNAs (100 ng/mL), and CIAP-treated SeV RNAs (100 ng/mL) were transfected into 1 × 10 5 cells for the indicated times, respectively. The IFNB1 mRNA expression was measured by qRT-PCR. Experiments were performed in duplicate. Data are representative of three independent experiments.
    Figure Legend Snippet: A functional substitute for the lost RIG-I as the ligand of RNA viruses and 5′ triphosphate RNA (5′ ppp RNA) in TSPRCs. ( A ) Overexpression of human RIG-I (hRIG-I) can advance tIFNB1 mRNA expression in response to different viral infections in TSPRCs. Cells (1 × 10 5 ) were transfected with hRIG-I expression vector or empty vector (1 μg) for 24 h and then were infected by viruses for indicated times. The 5′ ppp RNA ( B ) and SeV vRNAs ( C ) up-regulate IFNB1 mRNA expression in HeLa and TSPRCs with a different time-dependent pattern; 5′ ppp RNA (100 ng/mL), 5′ ppp RNA control (100 ng/mL), SeV RNAs (100 ng/mL), and CIAP-treated SeV RNAs (100 ng/mL) were transfected into 1 × 10 5 cells for the indicated times, respectively. The IFNB1 mRNA expression was measured by qRT-PCR. Experiments were performed in duplicate. Data are representative of three independent experiments.

    Techniques Used: Functional Assay, Over Expression, Expressing, Transfection, Plasmid Preparation, Infection, Quantitative RT-PCR

    tMDA5 or tMDA5/tLGP2 can sense SeV. ( A ) tLGP2 or tMDA5 activates the IFN-β-Luc reporter. TSPRCs (1 × 10 4 ) were transfected with IFN-β-Luc (100 ng), TK (10 ng), and expression vector for tLGP2 or tMDA5 (400 ng) for 36 h, and then were infected with SeV (20 HAU/mL) for 12 h before the luciferase assay. ( B ) Knockdown of tLGP2, tMDA5, or tLGP2/tMDA5 inhibits virus-induced tIFNB1 mRNA expression. TSPRCs (1 × 10 5 ) were transfected with siRNA negative control (Scramble, 50 nM) or indicated siRNA (50 nM) for 24 h, followed by SeV infection for 12 h. ( C ) Overexpression of tLGP2 or tMDA5 inhibits VSV replication. TSPRCs (1 × 10 5 ) were transfected with equal amount of empty vector, hRIG-I, tLGP2, or tMDA5 expression vector (1 μg) for 12 h, followed by VSV-GFP (MOI = 0.01) infection for 12 h. Proportion of the GFP-positive cells was quantified by flow cytometry. ( D–F ) tMDA5 pull-down captures agonistic RNA from SeV-infected cells. About 1 × 10 8 TSPRCs were transfected with 30 µg FLAG-tagged tMDA5 expression vector and were cultured for 24 h and then infected with SeV for 16 h, followed by immunoprecipitation assays. Precipitation efficiency was verified by immunoblotting with an anti-Flag antibody ( D ). The RNAs from SeV-infected Flag-tMDA5-overexpressing TSPRCs (input), RNAs associated with tMDA5 or IgG immunoprecipitation (IP), or RNAs remaining after tMDA5 or IgG precipitations (unbound) were tested for the ability to stimulate the IFN-β-Luc activity in HEK293 cells ( E ) and to induce tIFNB1 mRNA in TSPRCs ( F ). ( G ) Effect of the tMDA5-associated SeV RNAs was dependent on tMDA5. TSPRCs (1 × 10 5 ) were transfected with the indicated siRNA (50 nM) for 24 h and then transfected with the indicated amount of SeV RNAs for 6 h for measuring tIFNB1 mRNA levels by qRT-PCR. ( H ) Up-regulation of tMDA5 mRNA level by tMDA5-associated immunoprecipitated SeV RNAs in a dose-dependent manner. TSPRCs (1 × 10 5 ) were transfected with the indicated amount of SeV RNAs for 6 h. ( I ) Quantification of viral RNA bound by the Flag-tagged proteins from SeV-infected TSPRCs. ( Top ) Immunoblots showing Flag-tagged hRIG-I, hMDA5, tMDA5, and tMDA5/tLGP2 in IP. ( Bottom ) SeV RNA level was measured by the strand-specific qRT-PCR in vector, hRIG-I, hMDA5, tMDA5, tMDA5-tLGP2, and IgG immunoprecipitates. ( J–L ) tLGP2 enhances the ability to sense SeV by tMDA5 in TSPRCs. The procedures were similar to D–F . Data are representative of three independent experiments. * P
    Figure Legend Snippet: tMDA5 or tMDA5/tLGP2 can sense SeV. ( A ) tLGP2 or tMDA5 activates the IFN-β-Luc reporter. TSPRCs (1 × 10 4 ) were transfected with IFN-β-Luc (100 ng), TK (10 ng), and expression vector for tLGP2 or tMDA5 (400 ng) for 36 h, and then were infected with SeV (20 HAU/mL) for 12 h before the luciferase assay. ( B ) Knockdown of tLGP2, tMDA5, or tLGP2/tMDA5 inhibits virus-induced tIFNB1 mRNA expression. TSPRCs (1 × 10 5 ) were transfected with siRNA negative control (Scramble, 50 nM) or indicated siRNA (50 nM) for 24 h, followed by SeV infection for 12 h. ( C ) Overexpression of tLGP2 or tMDA5 inhibits VSV replication. TSPRCs (1 × 10 5 ) were transfected with equal amount of empty vector, hRIG-I, tLGP2, or tMDA5 expression vector (1 μg) for 12 h, followed by VSV-GFP (MOI = 0.01) infection for 12 h. Proportion of the GFP-positive cells was quantified by flow cytometry. ( D–F ) tMDA5 pull-down captures agonistic RNA from SeV-infected cells. About 1 × 10 8 TSPRCs were transfected with 30 µg FLAG-tagged tMDA5 expression vector and were cultured for 24 h and then infected with SeV for 16 h, followed by immunoprecipitation assays. Precipitation efficiency was verified by immunoblotting with an anti-Flag antibody ( D ). The RNAs from SeV-infected Flag-tMDA5-overexpressing TSPRCs (input), RNAs associated with tMDA5 or IgG immunoprecipitation (IP), or RNAs remaining after tMDA5 or IgG precipitations (unbound) were tested for the ability to stimulate the IFN-β-Luc activity in HEK293 cells ( E ) and to induce tIFNB1 mRNA in TSPRCs ( F ). ( G ) Effect of the tMDA5-associated SeV RNAs was dependent on tMDA5. TSPRCs (1 × 10 5 ) were transfected with the indicated siRNA (50 nM) for 24 h and then transfected with the indicated amount of SeV RNAs for 6 h for measuring tIFNB1 mRNA levels by qRT-PCR. ( H ) Up-regulation of tMDA5 mRNA level by tMDA5-associated immunoprecipitated SeV RNAs in a dose-dependent manner. TSPRCs (1 × 10 5 ) were transfected with the indicated amount of SeV RNAs for 6 h. ( I ) Quantification of viral RNA bound by the Flag-tagged proteins from SeV-infected TSPRCs. ( Top ) Immunoblots showing Flag-tagged hRIG-I, hMDA5, tMDA5, and tMDA5/tLGP2 in IP. ( Bottom ) SeV RNA level was measured by the strand-specific qRT-PCR in vector, hRIG-I, hMDA5, tMDA5, tMDA5-tLGP2, and IgG immunoprecipitates. ( J–L ) tLGP2 enhances the ability to sense SeV by tMDA5 in TSPRCs. The procedures were similar to D–F . Data are representative of three independent experiments. * P

    Techniques Used: Transfection, Expressing, Plasmid Preparation, Infection, Luciferase, Negative Control, Over Expression, Flow Cytometry, Cytometry, Cell Culture, Immunoprecipitation, Activity Assay, Quantitative RT-PCR, Western Blot

    10) Product Images from "Expression of Steroid Receptors in Ameloblasts during Amelogenesis in Rat Incisors"

    Article Title: Expression of Steroid Receptors in Ameloblasts during Amelogenesis in Rat Incisors

    Journal: Frontiers in Physiology

    doi: 10.3389/fphys.2016.00503

    Expression profiles of steroid receptors during amelogenesis . RNAs extracted from microdissected rat enamel organ were analyzed by RT-qPCR after verifying the absence of mesenchymal and bone contamination. Dental cells from the secretion stage (S) and the maturation stage (M) were separately dissected using the molar reference line for isolation (See Materials and Methods). The cervical loop (L) that contains dental precursor cells, was anatomically distinguishable. The highest expression level ratio calculated for each studied and reference gene, using the standard curve method was set to 100% to compare data from the three independent experiments. Males (black bars) and females (white bars) were treated separately. The compared values were considered to be significantly different when * p
    Figure Legend Snippet: Expression profiles of steroid receptors during amelogenesis . RNAs extracted from microdissected rat enamel organ were analyzed by RT-qPCR after verifying the absence of mesenchymal and bone contamination. Dental cells from the secretion stage (S) and the maturation stage (M) were separately dissected using the molar reference line for isolation (See Materials and Methods). The cervical loop (L) that contains dental precursor cells, was anatomically distinguishable. The highest expression level ratio calculated for each studied and reference gene, using the standard curve method was set to 100% to compare data from the three independent experiments. Males (black bars) and females (white bars) were treated separately. The compared values were considered to be significantly different when * p

    Techniques Used: Expressing, Quantitative RT-PCR, Isolation

    11) Product Images from "lncAKHE enhances cell growth and migration in hepatocellular carcinoma via activation of NOTCH2 signaling"

    Article Title: lncAKHE enhances cell growth and migration in hepatocellular carcinoma via activation of NOTCH2 signaling

    Journal: Cell Death & Disease

    doi: 10.1038/s41419-018-0554-5

    LncAKHE is positively correlated with HCC severity. a HCC samples were divided into three groups based on the clinical stage (18 samples in stage I, 30 samples in Stage II, and 12 samples in stage III). Then the expression of lncAKHE was analyzed by RT-qPCR. b lncAKHE expression was checked by ISH in non-tumor, early HCC (eHCC) and advanced HCC (aHCC) tissues. Scale bar = 100 μm. c Total RNAs were extracted from non-tumor, eHCC, and aHCC samples. lncAKHE expression was analyzed by RT-qPCR. d , e The survival rates in patients with higher lncAKHE expression were lower. Sixty HCC samples were divided into two groups based on the levels of lncAKHE expression. Then Kaplan–Meier survival analyses were conducted. Data is from three independent experiments and expressed as mean ± SD. * p
    Figure Legend Snippet: LncAKHE is positively correlated with HCC severity. a HCC samples were divided into three groups based on the clinical stage (18 samples in stage I, 30 samples in Stage II, and 12 samples in stage III). Then the expression of lncAKHE was analyzed by RT-qPCR. b lncAKHE expression was checked by ISH in non-tumor, early HCC (eHCC) and advanced HCC (aHCC) tissues. Scale bar = 100 μm. c Total RNAs were extracted from non-tumor, eHCC, and aHCC samples. lncAKHE expression was analyzed by RT-qPCR. d , e The survival rates in patients with higher lncAKHE expression were lower. Sixty HCC samples were divided into two groups based on the levels of lncAKHE expression. Then Kaplan–Meier survival analyses were conducted. Data is from three independent experiments and expressed as mean ± SD. * p

    Techniques Used: Expressing, Quantitative RT-PCR, In Situ Hybridization

    12) Product Images from "Numerous post-translational modifications of RNA polymerase II subunit Rpb4 link transcription to post-transcriptional mechanisms"

    Article Title: Numerous post-translational modifications of RNA polymerase II subunit Rpb4 link transcription to post-transcriptional mechanisms

    Journal: bioRxiv

    doi: 10.1101/798603

    Mutations in Rpb4 E19-22 motif affect mRNA buffering. (A-B) Volcano plots showing fold changes of mRNA levels in the indicated mutant relative to those in WT cells, plotted relative to their significance [Log 10 (p-value)]. Three replicates of WT and the indicated mutant cells were cultures on rich medium (YPD) at 30°C till early mid-log phase (5×10 6 cells/ml). Cells were shifted to 33°C and incubated for 6 h. RNA was extracted while cells were still at logarithmic phase (1.5 - 2×10 7 cells/ml). Spike-in were added to 500 ng of RNA and RNA-seq was performed as detailed in Methods. Fold changes (FC) were calculated as the Log 2 of the ratio of the expression value of each gene after normalization to the spike-in (~100 poly(A)+ RNAs) signals. (C-F) mRNA synthesis and decay kinetics. The indicated strains were cultured on rich medium (YPD) and allowed to proliferate at 24°C. Mid-log phase cultures were rapidly shifted to 42°C and incubated for 30 minutes at this temperature. The temperature shift blocked transcription ( Lotan et al., 2007 , 2005 ). The cultures were then rapidly shifted down to 24°C to permit transcriptional induction. Cell samples were taken just before the temperature shiftup (time 0) and at the indicated time points post temperature shiftup. (C-D) Standard Northern analyses. RNA, extracted from the indicated cell samples, was subjected to Northern analysis using the indicated radioactive probes, as described in Methods. Membranes were exposed to PhosphoImager screens and the amount of RNA was quantified using TotalLab Inc. software. The level of SCR1 RNA, transcribed by Pol III, was used for normalization. Radioactive intensity, relative to that of SCR1 mRNA, was normalized to time 0 that was defined arbitrarily as 100%. Error bars represents standard deviation from two biological replicates. For each biological replicate, three technical repeats were performed, thus a total of six repeats. Inset shows an example of one out of six repeats. The indicated mRNA half-lives (T 1/2 ) were obtained from the slopes of the logarithmic curve. Note the logarithmic scale of the Y-axis. (E). PAGE Northern analysis. mRNA synthesis and decay analyses were done as in C-D except that the RNA samples were analyzed by the polyacrylamide Northern technique and probed with RPL29 or RPL25 , as indicated (see Methods). Lane “Δ(A) n ” shows the position of fully deadenylated RNA, obtained by hybridizing mRNAs with oligo(dT) and digesting the hybrids with RNase H. Asterisk (*) marks the lanes showing the first time point where de novo transcription was observed in the mutant. A 0 and A n , depicted on the left, denote the positions of deadenylated (A 0 ) and poly(A) containing RNAs, respectively. Note that the newly transcribed transcripts (seen at time points 120-210 min.) run slower than the deadenylated RNAs (shown in the earlier time point) because of their long tail ( Brown and Sachs, 1998 ), which helps identifying de novo transcription unambiguously. See also Fig. S6 .
    Figure Legend Snippet: Mutations in Rpb4 E19-22 motif affect mRNA buffering. (A-B) Volcano plots showing fold changes of mRNA levels in the indicated mutant relative to those in WT cells, plotted relative to their significance [Log 10 (p-value)]. Three replicates of WT and the indicated mutant cells were cultures on rich medium (YPD) at 30°C till early mid-log phase (5×10 6 cells/ml). Cells were shifted to 33°C and incubated for 6 h. RNA was extracted while cells were still at logarithmic phase (1.5 - 2×10 7 cells/ml). Spike-in were added to 500 ng of RNA and RNA-seq was performed as detailed in Methods. Fold changes (FC) were calculated as the Log 2 of the ratio of the expression value of each gene after normalization to the spike-in (~100 poly(A)+ RNAs) signals. (C-F) mRNA synthesis and decay kinetics. The indicated strains were cultured on rich medium (YPD) and allowed to proliferate at 24°C. Mid-log phase cultures were rapidly shifted to 42°C and incubated for 30 minutes at this temperature. The temperature shift blocked transcription ( Lotan et al., 2007 , 2005 ). The cultures were then rapidly shifted down to 24°C to permit transcriptional induction. Cell samples were taken just before the temperature shiftup (time 0) and at the indicated time points post temperature shiftup. (C-D) Standard Northern analyses. RNA, extracted from the indicated cell samples, was subjected to Northern analysis using the indicated radioactive probes, as described in Methods. Membranes were exposed to PhosphoImager screens and the amount of RNA was quantified using TotalLab Inc. software. The level of SCR1 RNA, transcribed by Pol III, was used for normalization. Radioactive intensity, relative to that of SCR1 mRNA, was normalized to time 0 that was defined arbitrarily as 100%. Error bars represents standard deviation from two biological replicates. For each biological replicate, three technical repeats were performed, thus a total of six repeats. Inset shows an example of one out of six repeats. The indicated mRNA half-lives (T 1/2 ) were obtained from the slopes of the logarithmic curve. Note the logarithmic scale of the Y-axis. (E). PAGE Northern analysis. mRNA synthesis and decay analyses were done as in C-D except that the RNA samples were analyzed by the polyacrylamide Northern technique and probed with RPL29 or RPL25 , as indicated (see Methods). Lane “Δ(A) n ” shows the position of fully deadenylated RNA, obtained by hybridizing mRNAs with oligo(dT) and digesting the hybrids with RNase H. Asterisk (*) marks the lanes showing the first time point where de novo transcription was observed in the mutant. A 0 and A n , depicted on the left, denote the positions of deadenylated (A 0 ) and poly(A) containing RNAs, respectively. Note that the newly transcribed transcripts (seen at time points 120-210 min.) run slower than the deadenylated RNAs (shown in the earlier time point) because of their long tail ( Brown and Sachs, 1998 ), which helps identifying de novo transcription unambiguously. See also Fig. S6 .

    Techniques Used: Mutagenesis, Significance Assay, Incubation, RNA Sequencing Assay, Expressing, Cell Culture, Northern Blot, Software, Standard Deviation, Polyacrylamide Gel Electrophoresis

    13) Product Images from "Model structure of APOBEC3C reveals a binding pocket modulating ribonucleic acid interaction required for encapsidation"

    Article Title: Model structure of APOBEC3C reveals a binding pocket modulating ribonucleic acid interaction required for encapsidation

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    doi: 10.1073/pnas.0900979106

    ( A ) Immunoblot analysis of the expression and Vif-dependent degradation of WT A3C and the mutants K22A, T92A, R122A, and N177A. The respective A3C constructs were detected by an anti(α)-HA antibody. Tubulin (Tub) served as loading control. ( B ) Antiviral activity of the mutants K22A, T92A, R122A, and N177A against SIV agm , compared with WT A3C and background of nontransduced cells (no virus) and vector-only control (vector) without A3C. 293T cells were cotransfected with WT or Δ vif SIV agm luc (VSV-G), respectively, and the respective A3C mutant. Virions were normalized by RT and human osteosarcoma (HOS) cells were transduced. Luciferase activity was determined at 3 days after infection. ( C ) Immunoblot analysis of A3C packaging. 293T cells were cotransfected with Δ vif SIV agm luc (VSV-G), the respective HA-tagged A3C construct (mutant R122A and WT). Virions were harvested and normalized by RT. Physically equal amounts of virions were lysed and subjected to immunoblot analysis. Presence of A3C in the virions was detected using α-HA-antibodies. p27 (capsid) served as loading control. ( D ) Antiviral activity of Vpr-A3C and Vpr-R122A fusion proteins against SIV agm , compared with WT A3C and R122A and background of nontransduced cells (no virus) and vector-only control without A3C. Δ vif SIV agm luc (VSV-G) virions were generated by cotransfection with the respective A3C mutant. Virions were normalized by RT activity and used for transduction. Luciferase activity was measured 3 days after infection. ( E ) Immunoblot analysis of the expression and encapsidation of WT A3C and R122A compared with the respective Vpr fusion proteins. A3C constructs (with or without Vpr) were detected by an anti(α)-HA antibody. Tubulin (Tub) served as loading control for cell lysates and p27 (capsid) for viral lysates. ( F ) RNA interacting with A3 proteins. A3C WT or mutant proteins and WT A3G were expressed in 293T, and cell lysates were subjected to immunoprecipitation. RNA bound to immunoprecipitated proteins was radioactively labeled with 32 P through RT-PCR and separated on a 12% PAA gel and exposed on x-ray film. Background was set to signal of untransfected cells (mock). An equal amount of precipitated A3 protein was proven by immunoblot analysis of the elution fraction with an anti(α)-HA antibody. ( G ) RT-PCR on RNA interacting with A3 proteins. Isolated and A3 bound RNA (IP) was reverse-transcribed and amplified using specific primers for 7 SL and 5.8S RNA. Background signal was determined with RNA from untransfected cells (mock). Availability of the tested RNAs was confirmed for each sample through RT-PCR on RNA from cells before IP (cells).
    Figure Legend Snippet: ( A ) Immunoblot analysis of the expression and Vif-dependent degradation of WT A3C and the mutants K22A, T92A, R122A, and N177A. The respective A3C constructs were detected by an anti(α)-HA antibody. Tubulin (Tub) served as loading control. ( B ) Antiviral activity of the mutants K22A, T92A, R122A, and N177A against SIV agm , compared with WT A3C and background of nontransduced cells (no virus) and vector-only control (vector) without A3C. 293T cells were cotransfected with WT or Δ vif SIV agm luc (VSV-G), respectively, and the respective A3C mutant. Virions were normalized by RT and human osteosarcoma (HOS) cells were transduced. Luciferase activity was determined at 3 days after infection. ( C ) Immunoblot analysis of A3C packaging. 293T cells were cotransfected with Δ vif SIV agm luc (VSV-G), the respective HA-tagged A3C construct (mutant R122A and WT). Virions were harvested and normalized by RT. Physically equal amounts of virions were lysed and subjected to immunoblot analysis. Presence of A3C in the virions was detected using α-HA-antibodies. p27 (capsid) served as loading control. ( D ) Antiviral activity of Vpr-A3C and Vpr-R122A fusion proteins against SIV agm , compared with WT A3C and R122A and background of nontransduced cells (no virus) and vector-only control without A3C. Δ vif SIV agm luc (VSV-G) virions were generated by cotransfection with the respective A3C mutant. Virions were normalized by RT activity and used for transduction. Luciferase activity was measured 3 days after infection. ( E ) Immunoblot analysis of the expression and encapsidation of WT A3C and R122A compared with the respective Vpr fusion proteins. A3C constructs (with or without Vpr) were detected by an anti(α)-HA antibody. Tubulin (Tub) served as loading control for cell lysates and p27 (capsid) for viral lysates. ( F ) RNA interacting with A3 proteins. A3C WT or mutant proteins and WT A3G were expressed in 293T, and cell lysates were subjected to immunoprecipitation. RNA bound to immunoprecipitated proteins was radioactively labeled with 32 P through RT-PCR and separated on a 12% PAA gel and exposed on x-ray film. Background was set to signal of untransfected cells (mock). An equal amount of precipitated A3 protein was proven by immunoblot analysis of the elution fraction with an anti(α)-HA antibody. ( G ) RT-PCR on RNA interacting with A3 proteins. Isolated and A3 bound RNA (IP) was reverse-transcribed and amplified using specific primers for 7 SL and 5.8S RNA. Background signal was determined with RNA from untransfected cells (mock). Availability of the tested RNAs was confirmed for each sample through RT-PCR on RNA from cells before IP (cells).

    Techniques Used: Expressing, Construct, Activity Assay, Plasmid Preparation, Mutagenesis, Luciferase, Infection, Generated, Cotransfection, Transduction, Immunoprecipitation, Labeling, Reverse Transcription Polymerase Chain Reaction, Isolation, Amplification

    14) Product Images from "EPC-Derived Microvesicles Protect Cardiomyocytes from Ang II-Induced Hypertrophy and Apoptosis"

    Article Title: EPC-Derived Microvesicles Protect Cardiomyocytes from Ang II-Induced Hypertrophy and Apoptosis

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0085396

    The incorporation of EPC-MVs with H9c2 and the RNAs depletion from EPC-MVs. (A) Representative images showing that EPC-MVs merge with H9c2 CMs. MVs were labeled with PKH26 (red). Nucleuses were labeled with DAPI (blue). Scale bar, 100 µm. (B) Summarized data of total RNAs in MVs and rdMVs. RNase treatment is effective in depleting RNAs from EPC-MVs. ** P
    Figure Legend Snippet: The incorporation of EPC-MVs with H9c2 and the RNAs depletion from EPC-MVs. (A) Representative images showing that EPC-MVs merge with H9c2 CMs. MVs were labeled with PKH26 (red). Nucleuses were labeled with DAPI (blue). Scale bar, 100 µm. (B) Summarized data of total RNAs in MVs and rdMVs. RNase treatment is effective in depleting RNAs from EPC-MVs. ** P

    Techniques Used: Labeling

    15) Product Images from "Dicer‐independent snRNA/snoRNA‐derived nuclear RNA 3 regulates tumor‐associated macrophage function by epigenetically repressing inducible nitric oxide synthase transcription. Dicer‐independent snRNA/snoRNA‐derived nuclear RNA 3 regulates tumor‐associated macrophage function by epigenetically repressing inducible nitric oxide synthase transcription"

    Article Title: Dicer‐independent snRNA/snoRNA‐derived nuclear RNA 3 regulates tumor‐associated macrophage function by epigenetically repressing inducible nitric oxide synthase transcription. Dicer‐independent snRNA/snoRNA‐derived nuclear RNA 3 regulates tumor‐associated macrophage function by epigenetically repressing inducible nitric oxide synthase transcription

    Journal: Cancer Communications

    doi: 10.1002/cac2.12131

    sdnRNA‐3 in macrophages promotes tumor growth by repressing Nos2 transcription. ( A ) RT‐qPCR analysis of sdnRNA‐3 in M1 and M2 TAMs, and DCs isolated from B16 allograft ( n = 3). Data were normalized by U6 and compared with the M1 group. ( B ) M2 TAMs isolated from B16 allograft were transfected with LNA‐modified sdnRNA‐3 inhibitor (sdnRNA‐3i) and NCi for 36h, RNA levels of indicated genes were detected by RT‐qPCR. ( C, D ) Peritoneal macrophages were transfected with LNA‐modified sdnRNA‐3 inhibitor (sdnRNA‐3i) and NCi for 24h. 5 × 10 6 cells were injected intravenously into each recipient mouse ( n = 6) every 4 days from day 0 when B16‐F10 cells were transplanted. Animals were monitored regularly for tumor growth ( C ). RNAs of M2 TAMs isolated from B16 allografts at day 18 were subjected for RT‐qPCR analysis of indicated gene RNAs ( D ). Data of RT‐qPCR analysis were normalized with GAPDH or U6 and compared to control groups. Data were representative of three independent experiments. Error bars denoted SD. * P
    Figure Legend Snippet: sdnRNA‐3 in macrophages promotes tumor growth by repressing Nos2 transcription. ( A ) RT‐qPCR analysis of sdnRNA‐3 in M1 and M2 TAMs, and DCs isolated from B16 allograft ( n = 3). Data were normalized by U6 and compared with the M1 group. ( B ) M2 TAMs isolated from B16 allograft were transfected with LNA‐modified sdnRNA‐3 inhibitor (sdnRNA‐3i) and NCi for 36h, RNA levels of indicated genes were detected by RT‐qPCR. ( C, D ) Peritoneal macrophages were transfected with LNA‐modified sdnRNA‐3 inhibitor (sdnRNA‐3i) and NCi for 24h. 5 × 10 6 cells were injected intravenously into each recipient mouse ( n = 6) every 4 days from day 0 when B16‐F10 cells were transplanted. Animals were monitored regularly for tumor growth ( C ). RNAs of M2 TAMs isolated from B16 allografts at day 18 were subjected for RT‐qPCR analysis of indicated gene RNAs ( D ). Data of RT‐qPCR analysis were normalized with GAPDH or U6 and compared to control groups. Data were representative of three independent experiments. Error bars denoted SD. * P

    Techniques Used: Quantitative RT-PCR, Isolation, Transfection, Modification, Injection

    16) Product Images from "Viral N6-methyladenosine upregulates replication and pathogenesis of human respiratory syncytial virus"

    Article Title: Viral N6-methyladenosine upregulates replication and pathogenesis of human respiratory syncytial virus

    Journal: Nature Communications

    doi: 10.1038/s41467-019-12504-y

    The attenuated phenotype of m 6 A mutated rgRSVs is m 6 A-related. a rgRSV-G1 and -G12 were less dependent on the m 6 A eraser protein. A549 cells were transfected with a plasmid encoding ALKBH5. At 36 h post-transfection, cells were infected with each rgRSV at an MOI of 0.5. At 18 h post-infection, cell lysates were harvested for western blot analysis. Western blot images are the representatives of three experiments. b rgRSV-G123 expression was less dependent on m 6 A writer protein. A549 cells were transfected with control siRNA or siRNA targeting METTL3 and METTL14. At 36 h post-transfection, cells were infected with each rgRSV at an MOI of 0.5. At 18 h post-infection, cell lysates were harvested for western blot analysis. The density of western blot was quantified by Image J software, and the ratio of the protein bands was calculated. Images are the representatives of three experiments. c Distribution of m 6 A peaks on the RSV mRNAs from A549 cells infected by rgRSV and rgRSV-G123. Confluent A549 cells were infected by each m 6 A-mutated rgRSV at an MOI of 1.0, cell lysates were harvested at 36 h post-infection. Total RNAs were extracted from cell lysates, and were enriched for mRNA by binding to oligo dT, and subjected to m 6 A-seq. The distribution of m 6 A-immunoprecipitated (IP) reads were mapped to the RSV mRNAs (pink block). The baseline distributions for mRNAs from input sample are shown as a pink line. Data presented are the mean coverage from two independent virus-infected A549 cell samples ( n = 2). Red arrow indicates the m 6 A enrichment in G mRNA. d Virion RNA of m 6 A-mutated rgRSVs is defective in binding to anti-m 6 A antibody. Virion RNA was extracted from highly purified RSV virions. Antigenome was quantified by real-time RT-PCR. Each amount of antigenome was bound to strip wells using a RNA high binding solution, and m 6 A was detected using a specific capture anti-m 6 A antibody and then quantified colorimetrically by reading the absorbance in a microplate spectrophotometer at a wavelength of 450 nm. A standard curve was generated using known m 6 A methylated RNA (range from 0.02 to 1 ng of m 6 A) as a positive control. The m 6 A content was calculated from each RNA samples. Data are averages of four independent experiments. The P value (Student’s t -test) for rgRSV-G12, rgRSV-G123, and rgRSV-ΔG is *** P = 0.000325, **** P = 3.09 × 10 −7 , and **** P = 3.74 × 10 −7 , respectively
    Figure Legend Snippet: The attenuated phenotype of m 6 A mutated rgRSVs is m 6 A-related. a rgRSV-G1 and -G12 were less dependent on the m 6 A eraser protein. A549 cells were transfected with a plasmid encoding ALKBH5. At 36 h post-transfection, cells were infected with each rgRSV at an MOI of 0.5. At 18 h post-infection, cell lysates were harvested for western blot analysis. Western blot images are the representatives of three experiments. b rgRSV-G123 expression was less dependent on m 6 A writer protein. A549 cells were transfected with control siRNA or siRNA targeting METTL3 and METTL14. At 36 h post-transfection, cells were infected with each rgRSV at an MOI of 0.5. At 18 h post-infection, cell lysates were harvested for western blot analysis. The density of western blot was quantified by Image J software, and the ratio of the protein bands was calculated. Images are the representatives of three experiments. c Distribution of m 6 A peaks on the RSV mRNAs from A549 cells infected by rgRSV and rgRSV-G123. Confluent A549 cells were infected by each m 6 A-mutated rgRSV at an MOI of 1.0, cell lysates were harvested at 36 h post-infection. Total RNAs were extracted from cell lysates, and were enriched for mRNA by binding to oligo dT, and subjected to m 6 A-seq. The distribution of m 6 A-immunoprecipitated (IP) reads were mapped to the RSV mRNAs (pink block). The baseline distributions for mRNAs from input sample are shown as a pink line. Data presented are the mean coverage from two independent virus-infected A549 cell samples ( n = 2). Red arrow indicates the m 6 A enrichment in G mRNA. d Virion RNA of m 6 A-mutated rgRSVs is defective in binding to anti-m 6 A antibody. Virion RNA was extracted from highly purified RSV virions. Antigenome was quantified by real-time RT-PCR. Each amount of antigenome was bound to strip wells using a RNA high binding solution, and m 6 A was detected using a specific capture anti-m 6 A antibody and then quantified colorimetrically by reading the absorbance in a microplate spectrophotometer at a wavelength of 450 nm. A standard curve was generated using known m 6 A methylated RNA (range from 0.02 to 1 ng of m 6 A) as a positive control. The m 6 A content was calculated from each RNA samples. Data are averages of four independent experiments. The P value (Student’s t -test) for rgRSV-G12, rgRSV-G123, and rgRSV-ΔG is *** P = 0.000325, **** P = 3.09 × 10 −7 , and **** P = 3.74 × 10 −7 , respectively

    Techniques Used: Transfection, Plasmid Preparation, Infection, Western Blot, Expressing, Software, Binding Assay, Immunoprecipitation, Blocking Assay, Purification, Quantitative RT-PCR, Stripping Membranes, Spectrophotometry, Generated, Methylation, Positive Control

    The RSV genome and antigenome/mRNAs are m 6 A methylated. a Distribution of m 6 A peaks in the RSV antigenome and genome of virions grown in HeLa cells. Confluent HeLa cells were infected by rgRSV at an MOI of 1.0, supernatant was harvested at 36 h post-infection. RSV virions were purified by sucrose gradient ultracentrifugation. Total RNAs were extracted from purified virions and were subjected to m 6 A-specific antibody immunoprecipitation followed by high-throughput sequencing (m 6 A-seq). A schematic diagram of partial RSV antigenome (complementary to regions from the leader sequence to M2-2 gene) is shown, as most m 6 A peaks are clustered in these regions. m 6 A sites in full-length antigenome and genome are shown in Supplementary Fig. 2 . The normalized coverage from m 6 A-seq of RSV RNA showing the distribution of m 6 A-immunoprecipitated (IP) reads mapped to the RSV antigenome (blue block) and genome (pink block). The baseline distributions for antigenome and genome from input sample are shown as a blue and pink line respectively. Data presented are the averages from two independent virion samples ( n = 2). b Distribution of m 6 A peaks in the RSV mRNAs from RSV-infected HeLa cells. Confluent HeLa cells were infected by rgRSV at an MOI of 1.0, cell lysates were harvested at 36 h post-infection. Total RNAs were extracted from cell lysates, and were enriched for mRNA by binding to oligo dT, and subjected to m 6 A-seq. The distribution of m 6 A-immunoprecipitated (IP) reads were mapped to the RSV mRNAs (pink block). The baseline distributions for mRNAs from input sample are shown as a pink line. Data presented are the averages from two independent virus-infected HeLa cell samples ( n = 2). c Distribution of m 6 A peaks in the RSV antigenome and genome of virions grown in A549 cells. Data presented are the averages from two independent virion samples ( n = 2). d Distribution of m 6 A peaks in the RSV mRNAs from RSV-infected A549 cells. Data presented are the averages from two independent virus-infected A549 cell samples ( n = 2)
    Figure Legend Snippet: The RSV genome and antigenome/mRNAs are m 6 A methylated. a Distribution of m 6 A peaks in the RSV antigenome and genome of virions grown in HeLa cells. Confluent HeLa cells were infected by rgRSV at an MOI of 1.0, supernatant was harvested at 36 h post-infection. RSV virions were purified by sucrose gradient ultracentrifugation. Total RNAs were extracted from purified virions and were subjected to m 6 A-specific antibody immunoprecipitation followed by high-throughput sequencing (m 6 A-seq). A schematic diagram of partial RSV antigenome (complementary to regions from the leader sequence to M2-2 gene) is shown, as most m 6 A peaks are clustered in these regions. m 6 A sites in full-length antigenome and genome are shown in Supplementary Fig. 2 . The normalized coverage from m 6 A-seq of RSV RNA showing the distribution of m 6 A-immunoprecipitated (IP) reads mapped to the RSV antigenome (blue block) and genome (pink block). The baseline distributions for antigenome and genome from input sample are shown as a blue and pink line respectively. Data presented are the averages from two independent virion samples ( n = 2). b Distribution of m 6 A peaks in the RSV mRNAs from RSV-infected HeLa cells. Confluent HeLa cells were infected by rgRSV at an MOI of 1.0, cell lysates were harvested at 36 h post-infection. Total RNAs were extracted from cell lysates, and were enriched for mRNA by binding to oligo dT, and subjected to m 6 A-seq. The distribution of m 6 A-immunoprecipitated (IP) reads were mapped to the RSV mRNAs (pink block). The baseline distributions for mRNAs from input sample are shown as a pink line. Data presented are the averages from two independent virus-infected HeLa cell samples ( n = 2). c Distribution of m 6 A peaks in the RSV antigenome and genome of virions grown in A549 cells. Data presented are the averages from two independent virion samples ( n = 2). d Distribution of m 6 A peaks in the RSV mRNAs from RSV-infected A549 cells. Data presented are the averages from two independent virus-infected A549 cell samples ( n = 2)

    Techniques Used: Methylation, Infection, Purification, Immunoprecipitation, Next-Generation Sequencing, Sequencing, Blocking Assay, Binding Assay

    17) Product Images from "An improved definition of the RNA-binding specificity of SECIS-binding protein 2, an essential component of the selenocysteine incorporation machinery"

    Article Title: An improved definition of the RNA-binding specificity of SECIS-binding protein 2, an essential component of the selenocysteine incorporation machinery

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkm066

    Sequences of the RNAs recovered from the SELEX experiment and test of their affinities for C-SBP2. ( A ) Alignment of the WT yU3B/C RNA sequence with the degenerated N18 RNA and the selected Se1-Se7 RNAs sequences. Nucleotides in Se1-Se7 RNA, are numbered according to the positions of the homolog nucleotides in the WT yU3B/C RNA. The number of sequenced plasmids encoding each selected RNA is indicated in brackets on the right of the sequences. The nucleotides corresponding to the constant sequence are shown in gray, nucleotides in the degenerated sequence and nucleotides mutated during the RT-PCR cycles are shown in black. The GA dinucleotides are underlined. ( B ) The nucleotide sequences of a series of SECIS motifs from various genes and species ( 30 , 52 ) were aligned with the Se1 RNA sequence taking as references the UGA and GA conserved nucleotides of the K-turn structure (bold characters). A consensus sequence of the SECIS K-turn motifs is deduced from the alignment and indicated below. The positions of the conserved nucleotides in the two strands of helix II are indicated ( C ) Estimation of the affinity of C-SBP2 for the Se1, Se2, Se3, Se5 and Se7 RNAs by gel-shift assays. RNA–protein complexes formed with 5 fmol of labeled RNA and increasing concentrations of C-SBP2 (as indicated below the lanes) were fractionated by gel electrophoresis as in Figure 1 . The apparent K d values are indicated above the autoradiograms.
    Figure Legend Snippet: Sequences of the RNAs recovered from the SELEX experiment and test of their affinities for C-SBP2. ( A ) Alignment of the WT yU3B/C RNA sequence with the degenerated N18 RNA and the selected Se1-Se7 RNAs sequences. Nucleotides in Se1-Se7 RNA, are numbered according to the positions of the homolog nucleotides in the WT yU3B/C RNA. The number of sequenced plasmids encoding each selected RNA is indicated in brackets on the right of the sequences. The nucleotides corresponding to the constant sequence are shown in gray, nucleotides in the degenerated sequence and nucleotides mutated during the RT-PCR cycles are shown in black. The GA dinucleotides are underlined. ( B ) The nucleotide sequences of a series of SECIS motifs from various genes and species ( 30 , 52 ) were aligned with the Se1 RNA sequence taking as references the UGA and GA conserved nucleotides of the K-turn structure (bold characters). A consensus sequence of the SECIS K-turn motifs is deduced from the alignment and indicated below. The positions of the conserved nucleotides in the two strands of helix II are indicated ( C ) Estimation of the affinity of C-SBP2 for the Se1, Se2, Se3, Se5 and Se7 RNAs by gel-shift assays. RNA–protein complexes formed with 5 fmol of labeled RNA and increasing concentrations of C-SBP2 (as indicated below the lanes) were fractionated by gel electrophoresis as in Figure 1 . The apparent K d values are indicated above the autoradiograms.

    Techniques Used: Sequencing, Reverse Transcription Polymerase Chain Reaction, Electrophoretic Mobility Shift Assay, Labeling, Nucleic Acid Electrophoresis

    18) Product Images from "Human Ubc9 Contributes to Production of Fully Infectious Human Immunodeficiency Virus Type 1 Virions "

    Article Title: Human Ubc9 Contributes to Production of Fully Infectious Human Immunodeficiency Virus Type 1 Virions

    Journal: Journal of Virology

    doi: 10.1128/JVI.00237-09

    Biochemical composition of viral particles. The relative levels of vRNAs and proteins packaged into equivalent numbers of defective and infectious virions (normalized to the p24 content) were analyzed. (a) VRNA packaging. RNA from pelleted virions was extracted, reverse transcribed using oligo(dT) 12-18, and quantified by real-time PCR using vRNA-specific primers. Real-time PCR data from three independent experiments is shown as the amount of vRNA packaged into virions relative to that of vRNA packaged into virions produced from cells transfected with pNL4-3 only. The error bars indicate standard deviations. (b) Packaging of cellular and HIV-1 regulatory proteins. The levels of cellular (cyclophilin A [Cyp A]) and viral (Vif, Vpr, and Vpu) regulatory proteins packaged into virions were analyzed by immunoblotting. The bands were quantified using Discovery Series Quantity One software. (c) Glycoprotein packaging into virions. Envelope packaging into virions was analyzed by immunoblotting using polyclonal anti-HIV-1 and monoclonal anti-gp41 antibodies. (d) Glycoprotein production in cell lysates. Envelope production inside transfected cells was analyzed by immunoblotting using polyclonal anti-HIV-1 and monoclonal anti-gp41 antibodies. (e) Decreases in virion infectivity are not due to defects in early postentry events. Cells were transfected with RNAs as in previous experiments, followed by DNA transfections with pNL4-3-ΔE-EGFP and pHyg-VSV-G or pNL4-3 ΔEnv alone. Media containing pseudotyped virions were harvested and clarified 24 h after DNA transfections. Virion infectivity assays were carried out as before using TZM-bl target cells. Ubc9 expression in cell lysates. No RNA (lanes 1 to 4), control RNA (lanes 5 to 7), Ubc9 RNAi (lanes 8 to 10).
    Figure Legend Snippet: Biochemical composition of viral particles. The relative levels of vRNAs and proteins packaged into equivalent numbers of defective and infectious virions (normalized to the p24 content) were analyzed. (a) VRNA packaging. RNA from pelleted virions was extracted, reverse transcribed using oligo(dT) 12-18, and quantified by real-time PCR using vRNA-specific primers. Real-time PCR data from three independent experiments is shown as the amount of vRNA packaged into virions relative to that of vRNA packaged into virions produced from cells transfected with pNL4-3 only. The error bars indicate standard deviations. (b) Packaging of cellular and HIV-1 regulatory proteins. The levels of cellular (cyclophilin A [Cyp A]) and viral (Vif, Vpr, and Vpu) regulatory proteins packaged into virions were analyzed by immunoblotting. The bands were quantified using Discovery Series Quantity One software. (c) Glycoprotein packaging into virions. Envelope packaging into virions was analyzed by immunoblotting using polyclonal anti-HIV-1 and monoclonal anti-gp41 antibodies. (d) Glycoprotein production in cell lysates. Envelope production inside transfected cells was analyzed by immunoblotting using polyclonal anti-HIV-1 and monoclonal anti-gp41 antibodies. (e) Decreases in virion infectivity are not due to defects in early postentry events. Cells were transfected with RNAs as in previous experiments, followed by DNA transfections with pNL4-3-ΔE-EGFP and pHyg-VSV-G or pNL4-3 ΔEnv alone. Media containing pseudotyped virions were harvested and clarified 24 h after DNA transfections. Virion infectivity assays were carried out as before using TZM-bl target cells. Ubc9 expression in cell lysates. No RNA (lanes 1 to 4), control RNA (lanes 5 to 7), Ubc9 RNAi (lanes 8 to 10).

    Techniques Used: Real-time Polymerase Chain Reaction, Produced, Transfection, Software, Infection, Expressing

    19) Product Images from "MicroRNA-222 regulates muscle alternative splicing through Rbm24 during differentiation of skeletal muscle cells"

    Article Title: MicroRNA-222 regulates muscle alternative splicing through Rbm24 during differentiation of skeletal muscle cells

    Journal: Cell Death & Disease

    doi: 10.1038/cddis.2016.10

    MiR-222 overexpression and Rbm24 silencing inhibit muscle alternative splicing during early myoblasts differentiation. ( a ) MSC myoblasts transfected in GM with siGFP (siGFP), miR-222 (222) or siRbm24 (siRbm) duplex RNAs were shifted to DM for 8 h, 16 h or 24 h and analyzed for expression of Rbm24, p27 and Myogenin proteins by western blot. The table shows a quantification of the expression of Rbm24, p27 and Myogenin proteins normalized to p38, relative to control siGFP, referred as 1. Untransfected MSC in GM (GMnt) and DM (DMnt) at 24 h are shown for comparison. ( b ) RNA from parallel cell cultures was analyzed by semi-quantitative RT-PCR and amplicons were separated on ethidium bromide-stained agarose gels to determine splicing efficiency of muscular isoforms of Coro6 and Fxr1 transcripts. Greyscale of images was inverted for a sharper band definition. In the scheme, the black rectangles represent muscle-specific exons and the black arrows indicate primer positions. ( c ) General and muscular isoforms of NACA transcripts were detected by qPCR analysis and normalized to GAPDH transcript. Expression of muscle-specific isoform of NACA (skNAC) over the general NACA isoform, and relative to siGFP, referred as 1, is shown in the histogram. A representative experiment is shown
    Figure Legend Snippet: MiR-222 overexpression and Rbm24 silencing inhibit muscle alternative splicing during early myoblasts differentiation. ( a ) MSC myoblasts transfected in GM with siGFP (siGFP), miR-222 (222) or siRbm24 (siRbm) duplex RNAs were shifted to DM for 8 h, 16 h or 24 h and analyzed for expression of Rbm24, p27 and Myogenin proteins by western blot. The table shows a quantification of the expression of Rbm24, p27 and Myogenin proteins normalized to p38, relative to control siGFP, referred as 1. Untransfected MSC in GM (GMnt) and DM (DMnt) at 24 h are shown for comparison. ( b ) RNA from parallel cell cultures was analyzed by semi-quantitative RT-PCR and amplicons were separated on ethidium bromide-stained agarose gels to determine splicing efficiency of muscular isoforms of Coro6 and Fxr1 transcripts. Greyscale of images was inverted for a sharper band definition. In the scheme, the black rectangles represent muscle-specific exons and the black arrows indicate primer positions. ( c ) General and muscular isoforms of NACA transcripts were detected by qPCR analysis and normalized to GAPDH transcript. Expression of muscle-specific isoform of NACA (skNAC) over the general NACA isoform, and relative to siGFP, referred as 1, is shown in the histogram. A representative experiment is shown

    Techniques Used: Over Expression, Transfection, Expressing, Western Blot, Quantitative RT-PCR, Staining, Real-time Polymerase Chain Reaction

    Ectopic expression of Rbm24 rescues muscle alternative splicing inhibited by miR-222. ( a ) MSC myoblasts were infected with Lenti-GFP and Lenti-Rbm24 and grown in GM for 48 h (GM). Parallel cultures were transfected with miR-222 mimic (222) and negative control duplex RNA (CTL) and shifted to DM for 24 h. Cells were analyzed for expression of Rbm24, p27 and Myogenin proteins by western blot. ( b ) The histogram shows the quantitation of the expression levels of Rbm24, p27 and Myogenin normalized to p38, relative to MSC infected with Lenti-GFP and transfected with control duplex RNA, referred as 1, in three independent experiments. The error bars represent the average±S.E. ( c ) RNAs from parallel cell cultures were analyzed by semi-quantitative RT-PCR, and amplicons were separated on ethidium bromide-stained agarose gels to determine splicing efficiency of muscular isoforms of Coro6 and Fxr1 transcripts. Two different exposures of the same amplified bands for Coro6 or amplification at different PCR cycles for Frx1 are shown, to better highlight differences in the muscle-specific isoforms (top panels, black arrows) and in the general isoforms (bottom panels, white arrows). ( d ) Real-time PCR analysis to detect general and muscular isoforms of NACA transcripts normalized to GAPDH transcript. The histogram shows expression of muscle-specific isoform of NACA (skNAC) over the general isoform, and relative to Lenti-GFP transfected with control duplex RNA, referred as 1, in three independent experiments. The error bars represent the average±S.E.
    Figure Legend Snippet: Ectopic expression of Rbm24 rescues muscle alternative splicing inhibited by miR-222. ( a ) MSC myoblasts were infected with Lenti-GFP and Lenti-Rbm24 and grown in GM for 48 h (GM). Parallel cultures were transfected with miR-222 mimic (222) and negative control duplex RNA (CTL) and shifted to DM for 24 h. Cells were analyzed for expression of Rbm24, p27 and Myogenin proteins by western blot. ( b ) The histogram shows the quantitation of the expression levels of Rbm24, p27 and Myogenin normalized to p38, relative to MSC infected with Lenti-GFP and transfected with control duplex RNA, referred as 1, in three independent experiments. The error bars represent the average±S.E. ( c ) RNAs from parallel cell cultures were analyzed by semi-quantitative RT-PCR, and amplicons were separated on ethidium bromide-stained agarose gels to determine splicing efficiency of muscular isoforms of Coro6 and Fxr1 transcripts. Two different exposures of the same amplified bands for Coro6 or amplification at different PCR cycles for Frx1 are shown, to better highlight differences in the muscle-specific isoforms (top panels, black arrows) and in the general isoforms (bottom panels, white arrows). ( d ) Real-time PCR analysis to detect general and muscular isoforms of NACA transcripts normalized to GAPDH transcript. The histogram shows expression of muscle-specific isoform of NACA (skNAC) over the general isoform, and relative to Lenti-GFP transfected with control duplex RNA, referred as 1, in three independent experiments. The error bars represent the average±S.E.

    Techniques Used: Expressing, Infection, Transfection, Negative Control, CTL Assay, Western Blot, Quantitation Assay, Quantitative RT-PCR, Staining, Amplification, Polymerase Chain Reaction, Real-time Polymerase Chain Reaction

    20) Product Images from "Temporal regulation of expression of immediate early and second phase transcripts by endothelin-1 in cardiomyocytes"

    Article Title: Temporal regulation of expression of immediate early and second phase transcripts by endothelin-1 in cardiomyocytes

    Journal: Genome Biology

    doi: 10.1186/gb-2008-9-2-r32

    Identification of immediate early and second phase RNAs with increased expression in response to ET-1. Cardiomyocytes were unstimulated (Control), exposed to cycloheximide (CX) alone, or to ET-1 (ET) in the absence or presence of cycloheximide for 1 h (solid bars) or 2 h (open bars). (a) RNAs in CXS1, CXS2 and CXS3 (whose induction by ET-1 was further increased by cycloheximide), and CX1a, CX1b and CX1c (whose induction was not inhibited by cycloheximide) were classified as immediate early gene RNAs. (b) CX2a, CX2b, CX2c and CX2d RNAs showed partial inhibition of the response to ET-1 at 1 h by cycloheximide and are probably second phase RNAs. (c) CX3a and CX3b RNAs were clearly second phase RNAs with > 80% inhibition of the response to ET-1 by cycloheximide. The numbers of transcripts in each cluster are shown in parentheses. Statistical significance (repeated measures one-way ANOVA with Tukey post-test) p
    Figure Legend Snippet: Identification of immediate early and second phase RNAs with increased expression in response to ET-1. Cardiomyocytes were unstimulated (Control), exposed to cycloheximide (CX) alone, or to ET-1 (ET) in the absence or presence of cycloheximide for 1 h (solid bars) or 2 h (open bars). (a) RNAs in CXS1, CXS2 and CXS3 (whose induction by ET-1 was further increased by cycloheximide), and CX1a, CX1b and CX1c (whose induction was not inhibited by cycloheximide) were classified as immediate early gene RNAs. (b) CX2a, CX2b, CX2c and CX2d RNAs showed partial inhibition of the response to ET-1 at 1 h by cycloheximide and are probably second phase RNAs. (c) CX3a and CX3b RNAs were clearly second phase RNAs with > 80% inhibition of the response to ET-1 by cycloheximide. The numbers of transcripts in each cluster are shown in parentheses. Statistical significance (repeated measures one-way ANOVA with Tukey post-test) p

    Techniques Used: Expressing, Inhibition

    Analysis of cardiomyocyte polysome RNA. Cardiomyocyte extracts from unstimulated cells (Control) or cells exposed to ET-1 (ET) for 1 h were subjected to sucrose density centrifugation. Fraction 1 is the top and fraction 12 the bottom of the gradient. (a) A 254 profiles for sucrose density gradients. (b) Agarose gel electrophoresis with ethidium bromide staining of RNA isolated from each fraction highlights 28S, 18S and 5S ribosomal RNA. Fractions 6-11 were pooled for preparation of polysomal RNA for expression profiling. (c) All probesets were used for condition clustering (Pearson complete correlation) of polysome and total RNA prepared from individual sets of samples, and a heatmap of the mean normalized expression for each sample is shown (Log 10 scale: cyan = zero, black = 1, red = 6). (d) Principal components analysis identified three components. (e,f) RNAs identified as being significantly changed in the total pool in response to ET-1 at 1 h were clustered according to the profiles in total and polysome RNA giving eight groups with increased expression (e) and four groups with decreased expression (f). Results are means ± SEM for four independent sets of samples. Statistical significance (repeated measures one-way ANOVA with Tukey post-test) p
    Figure Legend Snippet: Analysis of cardiomyocyte polysome RNA. Cardiomyocyte extracts from unstimulated cells (Control) or cells exposed to ET-1 (ET) for 1 h were subjected to sucrose density centrifugation. Fraction 1 is the top and fraction 12 the bottom of the gradient. (a) A 254 profiles for sucrose density gradients. (b) Agarose gel electrophoresis with ethidium bromide staining of RNA isolated from each fraction highlights 28S, 18S and 5S ribosomal RNA. Fractions 6-11 were pooled for preparation of polysomal RNA for expression profiling. (c) All probesets were used for condition clustering (Pearson complete correlation) of polysome and total RNA prepared from individual sets of samples, and a heatmap of the mean normalized expression for each sample is shown (Log 10 scale: cyan = zero, black = 1, red = 6). (d) Principal components analysis identified three components. (e,f) RNAs identified as being significantly changed in the total pool in response to ET-1 at 1 h were clustered according to the profiles in total and polysome RNA giving eight groups with increased expression (e) and four groups with decreased expression (f). Results are means ± SEM for four independent sets of samples. Statistical significance (repeated measures one-way ANOVA with Tukey post-test) p

    Techniques Used: Centrifugation, Agarose Gel Electrophoresis, Staining, Isolation, Expressing

    21) Product Images from "Fragile X mental retardation protein is a Zika virus restriction factor that is antagonized by subgenomic flaviviral RNA"

    Article Title: Fragile X mental retardation protein is a Zika virus restriction factor that is antagonized by subgenomic flaviviral RNA

    Journal: eLife

    doi: 10.7554/eLife.39023

    ZIKV sfRNA increases expression of FXR2 and BRD4 in the absence of infection. Electroporated 5′ triphosphate ( A ) or monophosphate ( D ) RNAs were analyzed by northern blot, 48 hr after electroporation. Total RNA from cells infected with ZIKV-Puerto Rico was analyzed to visualize the presence of sfRNA1, sfRNA2 and sfRNA3. The expression levels of FXR2 and BRD4 were evaluated by flow cytometry in cells electroporated with 5′ triphosphate ( B,C ) or monophosphate ( E,F ) RNAs. Mean fluorescence intensities (MFI) in presence of the mutant control DBSLIII (blue) and sfRNA (red) are shown. Plots in C and F represent the mean ±SD of four and two independent experiments, respectively. (*p
    Figure Legend Snippet: ZIKV sfRNA increases expression of FXR2 and BRD4 in the absence of infection. Electroporated 5′ triphosphate ( A ) or monophosphate ( D ) RNAs were analyzed by northern blot, 48 hr after electroporation. Total RNA from cells infected with ZIKV-Puerto Rico was analyzed to visualize the presence of sfRNA1, sfRNA2 and sfRNA3. The expression levels of FXR2 and BRD4 were evaluated by flow cytometry in cells electroporated with 5′ triphosphate ( B,C ) or monophosphate ( E,F ) RNAs. Mean fluorescence intensities (MFI) in presence of the mutant control DBSLIII (blue) and sfRNA (red) are shown. Plots in C and F represent the mean ±SD of four and two independent experiments, respectively. (*p

    Techniques Used: Expressing, Infection, Northern Blot, Electroporation, Flow Cytometry, Cytometry, Fluorescence, Mutagenesis

    22) Product Images from "HDX-MS reveals dysregulated checkpoints that compromise discrimination against self RNA during RIG-I mediated autoimmunity"

    Article Title: HDX-MS reveals dysregulated checkpoints that compromise discrimination against self RNA during RIG-I mediated autoimmunity

    Journal: Nature Communications

    doi: 10.1038/s41467-018-07780-z

    RNA chemical structures and IFN-β activity. a Domain arrangement of RIG-I (1–925). Autoinhibition is shown between CARD2 latch region and HEL2i gate motif. b The chemical structures of an m7G cap and 2′-O-methylation modification at N 1 or N 2 position are presented. Important features for Cap0, Cap1, Cap0mA, and Cap2 are highlighted. c Schematic representations of studied 8- and 10-mer hairpin RNAs that bear different modifications at the 5′RNA terminus. 3p10l and Cap1-10l represent the molecular signature of viral and self-RNA, respectively. d The IFN-β luciferase signal is plotted as recorded in WT/SMS RIG-I dual reporter assays stimulated with indicated RNAs. Basal IFN-β activity of WT RIG-I in the absence of RNA transfection was subtracted. The significance of differences between groups was evaluated by unpaired Student’s t test (* p
    Figure Legend Snippet: RNA chemical structures and IFN-β activity. a Domain arrangement of RIG-I (1–925). Autoinhibition is shown between CARD2 latch region and HEL2i gate motif. b The chemical structures of an m7G cap and 2′-O-methylation modification at N 1 or N 2 position are presented. Important features for Cap0, Cap1, Cap0mA, and Cap2 are highlighted. c Schematic representations of studied 8- and 10-mer hairpin RNAs that bear different modifications at the 5′RNA terminus. 3p10l and Cap1-10l represent the molecular signature of viral and self-RNA, respectively. d The IFN-β luciferase signal is plotted as recorded in WT/SMS RIG-I dual reporter assays stimulated with indicated RNAs. Basal IFN-β activity of WT RIG-I in the absence of RNA transfection was subtracted. The significance of differences between groups was evaluated by unpaired Student’s t test (* p

    Techniques Used: Activity Assay, Methylation, Modification, Luciferase, Transfection

    Partial opening of CARDs upon RNA surveillance by WT and H830A RIG-I. a MS spectra of RIG-I CARD2 latch peptide Y103–114 derived from various complexes at the indicated on-exchange time points. b HDX single amino acid consolidation view of apo RIG-I (Supplementary Fig. 1a, b and c , column (i) and (ii)) are, respectively, mapped to the CARDs-HEL2i structure model (upper left panel) and single CARDs structure (upper right panel), representing auto-repressed and solvent-exposed CARDs conformational dynamics. The location of CARD2 latch peptide is highlighted in the structure model (below). Percentages of deuterium uptake are color coded according to HDX dynamics key. Black, regions that have no sequence coverage and include proline residue that has no amide hydrogen exchange activity. c and e The fraction of WT or H830A RIG-I CARDs molecules in the higher MS population (open conformation) to the total population is plotted against the on-exchange time points. d , f Half-life ( t 1/2 ) of respective partial opening event is determined by fitting an exponential 3P with the prediction model: a + b × exp( c .time(min)), where a is the asymptote, b is the scale, and c is the growth rate, is used to fit a curve to %D (response) and time (regressor). Inverse prediction is used to solve for the half-life ( t 1/2 ) for each conformational state. (*Means that Cap1-10l-treated group predicted t 1/2 (42.53 min) was higher than the upper limit (24.67, α = 0.05), whereas 3p10l ATP, Cap0-10l, and Cap0mA-10l-treated groups did not exceed the lower or upper limits in this comparison; NS means statistically nonsignificant between compared group. t 1/2 calculated for 3p10l-bound H830A RIG-I and Cap1-10l-bound H830A RIG-I did not exceed the lower or upper limits ( α = 0.05) in this comparison.) g The IFN-β luciferase signal is plotted as recorded in WT/H830A RIG-I dual reporter assays stimulated with indicated RNAs. The significance of differences between groups was evaluated by Student’s t test (* p
    Figure Legend Snippet: Partial opening of CARDs upon RNA surveillance by WT and H830A RIG-I. a MS spectra of RIG-I CARD2 latch peptide Y103–114 derived from various complexes at the indicated on-exchange time points. b HDX single amino acid consolidation view of apo RIG-I (Supplementary Fig. 1a, b and c , column (i) and (ii)) are, respectively, mapped to the CARDs-HEL2i structure model (upper left panel) and single CARDs structure (upper right panel), representing auto-repressed and solvent-exposed CARDs conformational dynamics. The location of CARD2 latch peptide is highlighted in the structure model (below). Percentages of deuterium uptake are color coded according to HDX dynamics key. Black, regions that have no sequence coverage and include proline residue that has no amide hydrogen exchange activity. c and e The fraction of WT or H830A RIG-I CARDs molecules in the higher MS population (open conformation) to the total population is plotted against the on-exchange time points. d , f Half-life ( t 1/2 ) of respective partial opening event is determined by fitting an exponential 3P with the prediction model: a + b × exp( c .time(min)), where a is the asymptote, b is the scale, and c is the growth rate, is used to fit a curve to %D (response) and time (regressor). Inverse prediction is used to solve for the half-life ( t 1/2 ) for each conformational state. (*Means that Cap1-10l-treated group predicted t 1/2 (42.53 min) was higher than the upper limit (24.67, α = 0.05), whereas 3p10l ATP, Cap0-10l, and Cap0mA-10l-treated groups did not exceed the lower or upper limits in this comparison; NS means statistically nonsignificant between compared group. t 1/2 calculated for 3p10l-bound H830A RIG-I and Cap1-10l-bound H830A RIG-I did not exceed the lower or upper limits ( α = 0.05) in this comparison.) g The IFN-β luciferase signal is plotted as recorded in WT/H830A RIG-I dual reporter assays stimulated with indicated RNAs. The significance of differences between groups was evaluated by Student’s t test (* p

    Techniques Used: Mass Spectrometry, Derivative Assay, Sequencing, Activity Assay, Luciferase

    E373A affects RIG-I proofreading in an ATP-dependent manner. a MS spectra of WT and E373A RIG-I CARD2 latch peptide Y103–114 derived from indicated complexes in indicated on-exchange time points. The abundance of each mass population (high and low) is determined as Fig. 2a . b , c In each indicated state, the fraction of E373A ( b ) or WT ( c ) RIG-I CARDs molecules in the higher MS population (open conformation) to the total population is plotted against the on-exchange time points as Fig. 2c . d , e Half-life ( t 1/2 ) of respective partial opening event is determined by fitting an exponential curve as Fig. 2d . (*Means that Cap1-10l-treated E373A RIG-I (20.51 min) and 3p10l-treated E373A RIG-I predicted t 1/2 (72.7 min) was higher than the upper limit (58.44 and 16.95, respectively, α = 0.05), whereas t 1/2 calculated 3p10l- and ATP-treated E373A RIG-I (12.11 min) exceeded lower limit (13.33, α = 0.05). Cap1-10l- and ATP-treated E373A did not exceed the lower or upper limits in this comparison. NS means statistically nonsignificant between compared groups. t 1/2 calculated for Cap1-10l-bound WT RIG-I and Cap1-10l- and ATP-treated WT RIG-I did not exceed the lower or upper limits ( α = 0.05) in this comparison.) f , g Differential deuterium uptake plots of CTD capping loop peptide region (VSRPHPKPKQFSSF, +3) of E373A ( f ) or WT RIG-I ( g ) upon receptor perturbed by 3p10l or Cap1-10l RNA in the presence or absence of ATP. The data are plotted as percent deuterium uptake vs. time on a logarithmic scale. The HDX plots of this CTD capping loop peptide between indicated groups were statistically analyzed by HDX Workbench (Supplementary Fig. 1c ) 41 . h , i Schematic representations of CTD capping loop conformation associated with E373A ( h ) and WT RIG-I ( i ) upon the receptor interaction with ATP in the presence of Cap1-10l and 3p10l RNAs
    Figure Legend Snippet: E373A affects RIG-I proofreading in an ATP-dependent manner. a MS spectra of WT and E373A RIG-I CARD2 latch peptide Y103–114 derived from indicated complexes in indicated on-exchange time points. The abundance of each mass population (high and low) is determined as Fig. 2a . b , c In each indicated state, the fraction of E373A ( b ) or WT ( c ) RIG-I CARDs molecules in the higher MS population (open conformation) to the total population is plotted against the on-exchange time points as Fig. 2c . d , e Half-life ( t 1/2 ) of respective partial opening event is determined by fitting an exponential curve as Fig. 2d . (*Means that Cap1-10l-treated E373A RIG-I (20.51 min) and 3p10l-treated E373A RIG-I predicted t 1/2 (72.7 min) was higher than the upper limit (58.44 and 16.95, respectively, α = 0.05), whereas t 1/2 calculated 3p10l- and ATP-treated E373A RIG-I (12.11 min) exceeded lower limit (13.33, α = 0.05). Cap1-10l- and ATP-treated E373A did not exceed the lower or upper limits in this comparison. NS means statistically nonsignificant between compared groups. t 1/2 calculated for Cap1-10l-bound WT RIG-I and Cap1-10l- and ATP-treated WT RIG-I did not exceed the lower or upper limits ( α = 0.05) in this comparison.) f , g Differential deuterium uptake plots of CTD capping loop peptide region (VSRPHPKPKQFSSF, +3) of E373A ( f ) or WT RIG-I ( g ) upon receptor perturbed by 3p10l or Cap1-10l RNA in the presence or absence of ATP. The data are plotted as percent deuterium uptake vs. time on a logarithmic scale. The HDX plots of this CTD capping loop peptide between indicated groups were statistically analyzed by HDX Workbench (Supplementary Fig. 1c ) 41 . h , i Schematic representations of CTD capping loop conformation associated with E373A ( h ) and WT RIG-I ( i ) upon the receptor interaction with ATP in the presence of Cap1-10l and 3p10l RNAs

    Techniques Used: Mass Spectrometry, Derivative Assay

    23) Product Images from "Effects of Endothelial Progenitor Cell-Derived Microvesicles on Hypoxia/Reoxygenation-Induced Endothelial Dysfunction and Apoptosis"

    Article Title: Effects of Endothelial Progenitor Cell-Derived Microvesicles on Hypoxia/Reoxygenation-Induced Endothelial Dysfunction and Apoptosis

    Journal: Oxidative Medicine and Cellular Longevity

    doi: 10.1155/2013/572729

    EPC-MV characterization, modification, caspase 3 and miR126 expression. (a) Flow cytometric plots showing Annexin V, CD34 and VEGFR2 expressions (isotype controls: left curves; antibodies: right curves) in EPC-MVs. (b) TEM image showing similar spherical morphology of sEPC-MVs and aEPC-MVs. Scale bar: 500 nm. (c) Summarized data showing effective digestion of EPC-MVs total RNAs by RNase treatment. (d) Caspase 3 and miR126 expression in control MVs (generated from basal condition), sEPC-MVs, and aEPC-MVs. * P
    Figure Legend Snippet: EPC-MV characterization, modification, caspase 3 and miR126 expression. (a) Flow cytometric plots showing Annexin V, CD34 and VEGFR2 expressions (isotype controls: left curves; antibodies: right curves) in EPC-MVs. (b) TEM image showing similar spherical morphology of sEPC-MVs and aEPC-MVs. Scale bar: 500 nm. (c) Summarized data showing effective digestion of EPC-MVs total RNAs by RNase treatment. (d) Caspase 3 and miR126 expression in control MVs (generated from basal condition), sEPC-MVs, and aEPC-MVs. * P

    Techniques Used: Modification, Expressing, Flow Cytometry, Transmission Electron Microscopy, Generated

    24) Product Images from "A viral suppressor of RNA silencing differentially regulates the accumulation of short interfering RNAs and micro-RNAs in tobacco"

    Article Title: A viral suppressor of RNA silencing differentially regulates the accumulation of short interfering RNAs and micro-RNAs in tobacco

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    doi: 10.1073/pnas.232434999

    HC-Pro suppression of both IR and amplicon but not sense transgene-induced RNA silencing results in the accumulation of full-length GUS dsRNA. ( A ) RNA gel blot showing the level of GUS RNA before and after RNase A digestion in silenced lines T4 (lanes 1 and 2), 155 (lanes 3 and 4), 6b5 (lanes 5 and 6), and a GUS-expressing control line T19 (lanes 7 and 8). Total RNA (25 μg) was digested for each plant line. EtdBr staining of 25S rRNA is shown as a loading control. ( B ) RNA gel blot showing the level of GUS RNA before and after RNase A digestion in plant lines T4 × HC-Pro (lanes 1–3), 155 × HC-Pro (lanes 4–6), 6b5 × HC-Pro (lanes 7–9), and the GUS expressing line T19 × HC-Pro (lanes 10–12). The position of GUS viral RNA and subgenomic RNAs (sgRNAs) is indicated. Total RNA (25 μg) was digested for each plant line. Heat refers to boiling the samples immediately before RNase A digestion to denature dsRNA. EtdBr staining of 25S rRNA is shown as a loading control. ( C ) RNA gel blot showing the level of GUS mRNA before and after RNase A digestion in silenced line 6b5 (lanes 1–3) and the unsilenced line 6b5 × HC-Pro (lanes 4–6). Total RNA (100 μg) was digested for each plant line, and 10 μg of total RNA was used for the untreated sample. The heat control is described in B . EtdBr staining of 25S rRNA is shown as a loading control.
    Figure Legend Snippet: HC-Pro suppression of both IR and amplicon but not sense transgene-induced RNA silencing results in the accumulation of full-length GUS dsRNA. ( A ) RNA gel blot showing the level of GUS RNA before and after RNase A digestion in silenced lines T4 (lanes 1 and 2), 155 (lanes 3 and 4), 6b5 (lanes 5 and 6), and a GUS-expressing control line T19 (lanes 7 and 8). Total RNA (25 μg) was digested for each plant line. EtdBr staining of 25S rRNA is shown as a loading control. ( B ) RNA gel blot showing the level of GUS RNA before and after RNase A digestion in plant lines T4 × HC-Pro (lanes 1–3), 155 × HC-Pro (lanes 4–6), 6b5 × HC-Pro (lanes 7–9), and the GUS expressing line T19 × HC-Pro (lanes 10–12). The position of GUS viral RNA and subgenomic RNAs (sgRNAs) is indicated. Total RNA (25 μg) was digested for each plant line. Heat refers to boiling the samples immediately before RNase A digestion to denature dsRNA. EtdBr staining of 25S rRNA is shown as a loading control. ( C ) RNA gel blot showing the level of GUS mRNA before and after RNase A digestion in silenced line 6b5 (lanes 1–3) and the unsilenced line 6b5 × HC-Pro (lanes 4–6). Total RNA (100 μg) was digested for each plant line, and 10 μg of total RNA was used for the untreated sample. The heat control is described in B . EtdBr staining of 25S rRNA is shown as a loading control.

    Techniques Used: Amplification, Western Blot, Expressing, Staining

    HC-Pro suppression of IR- and amplicon-induced RNA silencing prevents the accumulation of siRNAs and results in accumulation of a new size class of small RNAs. ( A ). ( B ) RNA gel blot analysis of small RNAs from silenced transgenic lines and lines in which silencing has been suppressed by HC-Pro. Lanes 1–4 and 10 show small RNAs from IR-silenced tobacco line T4 (lanes 1 and 2; lane 1 is a longer exposure of lane 2), sense transgene-silenced tobacco line 6b5 (lanes 3 and 10), and an amplicon-silenced tobacco line 155 (lane 4). Lanes 5–7, 9, and 11 show small RNAs from an IR line expressing HC-Pro (T4 × HC-Pro, lane 5), a sense transgene line expressing HC-Pro (6b5 × HC-Pro, lanes 6 and 11), and an amplicon line expressing HC-Pro (155 × HC-Pro, lane 7; lane 9 is a shorter exposure of lane 7). The probe was 32 P-labeled RNA corresponding to the sense strand of the 3′ 700 nt of the GUS-coding sequence and detects anti-sense strand GUS RNAs. The migration of 21-, 23-, and 26-nt DNA oligomers is shown in lane 8. EtdBr staining of the predominant RNA species in the fractionated sample is shown as a loading control. Low molecular weight RNA (20 μg) was loaded in each lane, except for lanes 7 and 9 (155 × HC-Pro), in which 5 μg was loaded, and lane 11, in which 240 μg was loaded. ( C ) RNA gel blot analysis of small RNAs from the same samples shown in B . The probe was 32 P-labeled RNA corresponding to the anti-sense strand of the 3′ 700 nt of the GUS-coding sequence and detects sense-strand, GUS small RNAs. EtdBr staining of the predominant RNA species in the fractionated sample is shown as a loading control. Low molecular weight RNA (20 μg) was loaded, except for lanes 6 and 7 (155 × HC-Pro), in which 7 μg was loaded. ( D ) The 5′ phosphorylation status of the 25- to 27-nt larger small RNAs. Small RNAs were isolated from the HC-Pro-amplicon transgenic line (155 × HC-Pro) and treated with CIP and polynucleotide kinase (kinase) as indicated, and sizes of the resulting RNAs were analyzed by RNA gel blot analysis. The migration of 21-, 23-, and 26-nt DNA oligomers is indicated.
    Figure Legend Snippet: HC-Pro suppression of IR- and amplicon-induced RNA silencing prevents the accumulation of siRNAs and results in accumulation of a new size class of small RNAs. ( A ). ( B ) RNA gel blot analysis of small RNAs from silenced transgenic lines and lines in which silencing has been suppressed by HC-Pro. Lanes 1–4 and 10 show small RNAs from IR-silenced tobacco line T4 (lanes 1 and 2; lane 1 is a longer exposure of lane 2), sense transgene-silenced tobacco line 6b5 (lanes 3 and 10), and an amplicon-silenced tobacco line 155 (lane 4). Lanes 5–7, 9, and 11 show small RNAs from an IR line expressing HC-Pro (T4 × HC-Pro, lane 5), a sense transgene line expressing HC-Pro (6b5 × HC-Pro, lanes 6 and 11), and an amplicon line expressing HC-Pro (155 × HC-Pro, lane 7; lane 9 is a shorter exposure of lane 7). The probe was 32 P-labeled RNA corresponding to the sense strand of the 3′ 700 nt of the GUS-coding sequence and detects anti-sense strand GUS RNAs. The migration of 21-, 23-, and 26-nt DNA oligomers is shown in lane 8. EtdBr staining of the predominant RNA species in the fractionated sample is shown as a loading control. Low molecular weight RNA (20 μg) was loaded in each lane, except for lanes 7 and 9 (155 × HC-Pro), in which 5 μg was loaded, and lane 11, in which 240 μg was loaded. ( C ) RNA gel blot analysis of small RNAs from the same samples shown in B . The probe was 32 P-labeled RNA corresponding to the anti-sense strand of the 3′ 700 nt of the GUS-coding sequence and detects sense-strand, GUS small RNAs. EtdBr staining of the predominant RNA species in the fractionated sample is shown as a loading control. Low molecular weight RNA (20 μg) was loaded, except for lanes 6 and 7 (155 × HC-Pro), in which 7 μg was loaded. ( D ) The 5′ phosphorylation status of the 25- to 27-nt larger small RNAs. Small RNAs were isolated from the HC-Pro-amplicon transgenic line (155 × HC-Pro) and treated with CIP and polynucleotide kinase (kinase) as indicated, and sizes of the resulting RNAs were analyzed by RNA gel blot analysis. The migration of 21-, 23-, and 26-nt DNA oligomers is indicated.

    Techniques Used: Amplification, Western Blot, Transgenic Assay, Expressing, Labeling, Sequencing, Migration, Staining, Molecular Weight, Isolation

    HC-Pro expression leads to increased miRNA accumulation in tobacco. ( A ) RNA gel blot analysis of 20 μg of small RNAs from leaf tissue of the silenced line 6b5 (lanes 1, 3, 5, 7, and 9), the HC-Pro-expressing line 6b5 × HC-Pro (lanes 2, 4, 6, and 8), and the GUS-expressing control line T19 (lane 10). The specific probe used to detect each miRNA is noted (miR167, miR164, miR156, and miR171). The migration of 21- and 25-nt DNA oligomers is shown on the left, and EtdBr staining of the predominant RNA species in the fractionated sample is shown as a loading control. ( B and C ) RNA gel blot analysis of miR167 and miR164 miRNAs, extracted from flower (F), leaf (L), and stem (St) tissue of a control line Xanthi (lanes 1–3) and the HC-Pro-expressing line X-27-8 (lanes 4–6). The migration of 21- and 25-nt DNA oligomers is shown on the left, and EtdBr staining of the predominant RNA species in the fractionated sample is shown as a loading control.
    Figure Legend Snippet: HC-Pro expression leads to increased miRNA accumulation in tobacco. ( A ) RNA gel blot analysis of 20 μg of small RNAs from leaf tissue of the silenced line 6b5 (lanes 1, 3, 5, 7, and 9), the HC-Pro-expressing line 6b5 × HC-Pro (lanes 2, 4, 6, and 8), and the GUS-expressing control line T19 (lane 10). The specific probe used to detect each miRNA is noted (miR167, miR164, miR156, and miR171). The migration of 21- and 25-nt DNA oligomers is shown on the left, and EtdBr staining of the predominant RNA species in the fractionated sample is shown as a loading control. ( B and C ) RNA gel blot analysis of miR167 and miR164 miRNAs, extracted from flower (F), leaf (L), and stem (St) tissue of a control line Xanthi (lanes 1–3) and the HC-Pro-expressing line X-27-8 (lanes 4–6). The migration of 21- and 25-nt DNA oligomers is shown on the left, and EtdBr staining of the predominant RNA species in the fractionated sample is shown as a loading control.

    Techniques Used: Expressing, Western Blot, Migration, Staining

    25) Product Images from "MiRAR—miRNA Activity Reporter for Living Cells"

    Article Title: MiRAR—miRNA Activity Reporter for Living Cells

    Journal: Genes

    doi: 10.3390/genes9060305

    The MiRAR in live cells. Fluorescence intensity measurements and cell images for different treatments of MiRAR-transfected cells. Human embryonic kidney 293 (HEK 293) cells were grown to confluency, transfected with the MiRAR containing the KRas-3′-UTR, and treated as outlined. ( a ) Fluorescence intensities validate miRAR-let-7 as a miRNA reporter. Background fluorescence of untreated cells was subtracted from the experiments. Error bars are based on at least three biological replicates and represent one standard deviation; ( b ) Western blot of untreated HEK 293 cells and treated cells after a knockdown of Tut4, confirming partial depletion of Tut4; ( c ) Images of live cells co-transfected with MiRAR and indicated as small interfering RNAs (siRNAs) or miRNAs. Row 1: overlay of phase light microscopy and GFP UV microscopy; row 2: GFP UV microscopy alone. The white bar represents 200 µm. p values are ***
    Figure Legend Snippet: The MiRAR in live cells. Fluorescence intensity measurements and cell images for different treatments of MiRAR-transfected cells. Human embryonic kidney 293 (HEK 293) cells were grown to confluency, transfected with the MiRAR containing the KRas-3′-UTR, and treated as outlined. ( a ) Fluorescence intensities validate miRAR-let-7 as a miRNA reporter. Background fluorescence of untreated cells was subtracted from the experiments. Error bars are based on at least three biological replicates and represent one standard deviation; ( b ) Western blot of untreated HEK 293 cells and treated cells after a knockdown of Tut4, confirming partial depletion of Tut4; ( c ) Images of live cells co-transfected with MiRAR and indicated as small interfering RNAs (siRNAs) or miRNAs. Row 1: overlay of phase light microscopy and GFP UV microscopy; row 2: GFP UV microscopy alone. The white bar represents 200 µm. p values are ***

    Techniques Used: Fluorescence, Transfection, Standard Deviation, Western Blot, Light Microscopy, Microscopy

    MiRAR-miR-122: Reporter gene construct for cellular miR-122 levels. Fluorescence intensities ( a ) for HEK 293 cells co-transfected MiRAR-miR-122 (CPEB-3′UTR) and miR-122 or anti-miR-122. HEK 293 cells were grown to 60–80% confluency and treated as indicated. Fluorescence intensities were measured by the Synergy H1 microplate reader at an excitation of 480 nm and emission of 509 nm. Error bars represent one standard deviation. ( a ) Cells transfected with 100 nM RNA; ( b ) MiRAR cell images of cells treated with RNAs as indicated. White bars show 400 µm. p values are *
    Figure Legend Snippet: MiRAR-miR-122: Reporter gene construct for cellular miR-122 levels. Fluorescence intensities ( a ) for HEK 293 cells co-transfected MiRAR-miR-122 (CPEB-3′UTR) and miR-122 or anti-miR-122. HEK 293 cells were grown to 60–80% confluency and treated as indicated. Fluorescence intensities were measured by the Synergy H1 microplate reader at an excitation of 480 nm and emission of 509 nm. Error bars represent one standard deviation. ( a ) Cells transfected with 100 nM RNA; ( b ) MiRAR cell images of cells treated with RNAs as indicated. White bars show 400 µm. p values are *

    Techniques Used: Construct, Fluorescence, Transfection, Standard Deviation

    26) Product Images from "Neuronatin Promotes Neural Lineage in ESCs via Ca2+ Signaling"

    Article Title: Neuronatin Promotes Neural Lineage in ESCs via Ca2+ Signaling

    Journal: Stem Cells (Dayton, Ohio)

    doi: 10.1002/stem.530

    The competence of Nnat overexpressing and knockdown ESCs to give rise to the three primary germ cells. (A): Quantitative RT-PCR analysis for markers of the three primary germ cells using RNAs derived from control, Nnatα-OE, and Nnat-KD ESCs using an embryoid body (EB) formation assay. The total RNA from each ESC line was collected from 6-day differentiated EBs and the cDNAs were used to analyze the various cell markers: Fgf5 (primitive ectodermal cells), Hnf4 (endodermal cells), T and Mesp (mesodermal cells), Otx2 (ectodermal cells), and Six3 and Sox1 (neuroectodermal cells). Data shown are the mean ± SD ( n = 3). *, p
    Figure Legend Snippet: The competence of Nnat overexpressing and knockdown ESCs to give rise to the three primary germ cells. (A): Quantitative RT-PCR analysis for markers of the three primary germ cells using RNAs derived from control, Nnatα-OE, and Nnat-KD ESCs using an embryoid body (EB) formation assay. The total RNA from each ESC line was collected from 6-day differentiated EBs and the cDNAs were used to analyze the various cell markers: Fgf5 (primitive ectodermal cells), Hnf4 (endodermal cells), T and Mesp (mesodermal cells), Otx2 (ectodermal cells), and Six3 and Sox1 (neuroectodermal cells). Data shown are the mean ± SD ( n = 3). *, p

    Techniques Used: Quantitative RT-PCR, Derivative Assay, Tube Formation Assay

    27) Product Images from "Transcriptional and translational S-box riboswitches differ in ligand-binding properties"

    Article Title: Transcriptional and translational S-box riboswitches differ in ligand-binding properties

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.RA120.012853

    SHAPE analysis of the RNA structure. A and B , WT ( A ) and mutant ( B ) translational metI RNAs. Residues in IL3b are highlighted (WT, blue ; mutant, red ). C and D , WT ( C ) and mutant ( D ) transcriptional metI RNAs. Residues in IL3b are highlighted (WT, red ; mutant, blue ). RNAs were incubated with NMIA or DMSO, followed by an RT inhibition reaction. SHAPE reactivity is the difference between the frequency of RT stops at each nucleotide in NMIA versus DMSO samples. Green bars show the conserved residues in IL3a, and black arrows indicate significant changes in reactivity. The nucleotides are numbered below the x axis, and the structural features are labeled at the top. Error bars denote S.D.; n ≥ 3.
    Figure Legend Snippet: SHAPE analysis of the RNA structure. A and B , WT ( A ) and mutant ( B ) translational metI RNAs. Residues in IL3b are highlighted (WT, blue ; mutant, red ). C and D , WT ( C ) and mutant ( D ) transcriptional metI RNAs. Residues in IL3b are highlighted (WT, red ; mutant, blue ). RNAs were incubated with NMIA or DMSO, followed by an RT inhibition reaction. SHAPE reactivity is the difference between the frequency of RT stops at each nucleotide in NMIA versus DMSO samples. Green bars show the conserved residues in IL3a, and black arrows indicate significant changes in reactivity. The nucleotides are numbered below the x axis, and the structural features are labeled at the top. Error bars denote S.D.; n ≥ 3.

    Techniques Used: Mutagenesis, Incubation, Inhibition, Labeling

    28) Product Images from "Crosstalk between Fat Mass and Obesity-related (FTO) and multiple WNT signaling pathways"

    Article Title: Crosstalk between Fat Mass and Obesity-related (FTO) and multiple WNT signaling pathways

    Journal: bioRxiv

    doi: 10.1101/2021.05.20.444911

    FTO regulates DKK1 RNA at the transcriptional level. (A) RNA levels of FTO, TCF3, AXIN2 and DKK1 were measured in FTO-depleted HeLa cells (shFTO#2, shFTO#3 and shFTO#4, see methods for details) and normalized with control HeLa cells (shFTO#2, n = 5; shFTO#3, n = 3; shFTO#4, n = 4). GAPDH was used for the RT-qPCR normalization. (B) RNA levels of FTO, DKK1, DKK4 and AXIN2 in HCT-8 cells stably expressing either shCon or shFTO#2 (see methods for details). GAPDH was used for the RT-qPCR normalization. n = 3. (C) Two different DKK1 antibodies were compared for the detection of secreted DKK1 protein in the culture medium from control or FTO-depleted HeLa cells. DKK1 antibody from R D systems (R D) resulted better immunoprecipitation than the DKK1 antibody from Santa Cruz Biotech. (SC). DKK1 (SC) was used for western blot. IgG was used as a negative control. (D) Secreted DKK1 protein levels were assessed by immunoprecipitation of DKK1 using anti-DKK1 antibody (R D) from the culture media of control, FTO-, ALKBH5- or METTL3-depleted HeLa cells, followed by western blot with anti-DKK1 antibody from Santa Cruz (SC). (E) Culture medium of WNT reporter expressing HeLa cells were replaced with the medium harvested from control or FTO-depleted HepG2 cells and immunodepleted with either IgG or anti-DKK1 antibody. Relative luciferase activities were measured after 16 hours of WNT stimulation (WR, WNT3a and R-spondin1). n = 3. (F) Antibody neutralization assay. Control or FTO-depleted HeLa cells were transiently transfected with WNT reporter (TOP-flash). Cells were treated with either mock or WNT3A and R-spondin1 (WR), together with IgG or anti-DKK1 antibody in the culture medium (see methods for details). Relative luciferase activities were measured. n = 3. (G) Fragmented poly(A)+ RNAs from control or FTO-depleted HeLa cells were immunoprecipitated with anti-m6A antibody. Primer sets targeting different regions in the DKK1 gene (A: 5’UTR, B: CDS, C: 3’UTR targeting) were used for RT-qPCR. m6A enrichment were calculated as relative amounts of m6A immunoprecipitated fraction compared with input. Fold changes were compared after GAPDH normalization between input samples of control and FTO depletion. n = 3. (H) DKK1 RNA levels were measured in control or FTO-depleted SW480 cells treated with actinomycin D for the indicated time. GAPDH was used as a normalization control. n = 2. (I) RNA levels of mature and pre-spliced form of DKK1 (pre-DKK1) were measured by RT-qPCR from shCon or two different shFTO (#2 and #3) expressing HCT-8 cells. GAPDH was used as a normalization control. n = 3. (J) RNA levels of mature and pre-spliced form of DKK1 were measured by RT-qPCR from control or FTO-depleted HeLa cells (shFTO#3). GAPDH was used as a normalization control. n = 3. (K) RNA levels of mature DKK1 or pre-DKK1 were measured in control or FTO-depleted HepG2 cells (shFTO#2) by RT-qPCR. GAPDH was used as a normalization control. n = 2. Error bars are ± s.e.m. One-sided t-test. **: p
    Figure Legend Snippet: FTO regulates DKK1 RNA at the transcriptional level. (A) RNA levels of FTO, TCF3, AXIN2 and DKK1 were measured in FTO-depleted HeLa cells (shFTO#2, shFTO#3 and shFTO#4, see methods for details) and normalized with control HeLa cells (shFTO#2, n = 5; shFTO#3, n = 3; shFTO#4, n = 4). GAPDH was used for the RT-qPCR normalization. (B) RNA levels of FTO, DKK1, DKK4 and AXIN2 in HCT-8 cells stably expressing either shCon or shFTO#2 (see methods for details). GAPDH was used for the RT-qPCR normalization. n = 3. (C) Two different DKK1 antibodies were compared for the detection of secreted DKK1 protein in the culture medium from control or FTO-depleted HeLa cells. DKK1 antibody from R D systems (R D) resulted better immunoprecipitation than the DKK1 antibody from Santa Cruz Biotech. (SC). DKK1 (SC) was used for western blot. IgG was used as a negative control. (D) Secreted DKK1 protein levels were assessed by immunoprecipitation of DKK1 using anti-DKK1 antibody (R D) from the culture media of control, FTO-, ALKBH5- or METTL3-depleted HeLa cells, followed by western blot with anti-DKK1 antibody from Santa Cruz (SC). (E) Culture medium of WNT reporter expressing HeLa cells were replaced with the medium harvested from control or FTO-depleted HepG2 cells and immunodepleted with either IgG or anti-DKK1 antibody. Relative luciferase activities were measured after 16 hours of WNT stimulation (WR, WNT3a and R-spondin1). n = 3. (F) Antibody neutralization assay. Control or FTO-depleted HeLa cells were transiently transfected with WNT reporter (TOP-flash). Cells were treated with either mock or WNT3A and R-spondin1 (WR), together with IgG or anti-DKK1 antibody in the culture medium (see methods for details). Relative luciferase activities were measured. n = 3. (G) Fragmented poly(A)+ RNAs from control or FTO-depleted HeLa cells were immunoprecipitated with anti-m6A antibody. Primer sets targeting different regions in the DKK1 gene (A: 5’UTR, B: CDS, C: 3’UTR targeting) were used for RT-qPCR. m6A enrichment were calculated as relative amounts of m6A immunoprecipitated fraction compared with input. Fold changes were compared after GAPDH normalization between input samples of control and FTO depletion. n = 3. (H) DKK1 RNA levels were measured in control or FTO-depleted SW480 cells treated with actinomycin D for the indicated time. GAPDH was used as a normalization control. n = 2. (I) RNA levels of mature and pre-spliced form of DKK1 (pre-DKK1) were measured by RT-qPCR from shCon or two different shFTO (#2 and #3) expressing HCT-8 cells. GAPDH was used as a normalization control. n = 3. (J) RNA levels of mature and pre-spliced form of DKK1 were measured by RT-qPCR from control or FTO-depleted HeLa cells (shFTO#3). GAPDH was used as a normalization control. n = 3. (K) RNA levels of mature DKK1 or pre-DKK1 were measured in control or FTO-depleted HepG2 cells (shFTO#2) by RT-qPCR. GAPDH was used as a normalization control. n = 2. Error bars are ± s.e.m. One-sided t-test. **: p

    Techniques Used: Quantitative RT-PCR, Stable Transfection, Expressing, Immunoprecipitation, Western Blot, Negative Control, Luciferase, Neutralization, Transfection

    29) Product Images from "Deep Sequencing Analyses of DsiRNAs Reveal the Influence of 3? Terminal Overhangs on Dicing Polarity, Strand Selectivity, and RNA Editing of siRNAs"

    Article Title: Deep Sequencing Analyses of DsiRNAs Reveal the Influence of 3? Terminal Overhangs on Dicing Polarity, Strand Selectivity, and RNA Editing of siRNAs

    Journal: Molecular therapy. Nucleic acids

    doi: 10.1038/mtna.2012.6

    Illumina Deep sequence analyses of asymmetric 27-mer Homo sapiens transportin 3 ( TNPO3 ) Dicer-substrate siRNAs (group II). HEK 293 cells were transfected with 10 nmol/l of the asymmetric group II RNA duplexes. Forty hours post-transfection the total RNAs were isolated and prepared for Illumina Deep sequencing. The data collection and alignment are described in Materials and Methods section. ( a ) The total reads and abundance of sense and antisense strands from each duplex. ( b ) The strand distribution was calculated as the ratio of the abundance of antisense to sense. The ratio of antisense (AS) to sense (S) is ranked by the 3′ overhang GG > GC, AA > CC, UU ≫ tt. ( c ) The dicing pattern L-R and R-L are as previously described. The L-R pattern generates the desired siRNA species for target knockdown. Total reads from the top 10 antisense strands and the abundance of L-R cleavage products from the antisense strand. ( d ) Two types of RNA editing: trimming of the 3′ end and post-transcriptional addition of nucleotides at the 3′ or 5′ ends.
    Figure Legend Snippet: Illumina Deep sequence analyses of asymmetric 27-mer Homo sapiens transportin 3 ( TNPO3 ) Dicer-substrate siRNAs (group II). HEK 293 cells were transfected with 10 nmol/l of the asymmetric group II RNA duplexes. Forty hours post-transfection the total RNAs were isolated and prepared for Illumina Deep sequencing. The data collection and alignment are described in Materials and Methods section. ( a ) The total reads and abundance of sense and antisense strands from each duplex. ( b ) The strand distribution was calculated as the ratio of the abundance of antisense to sense. The ratio of antisense (AS) to sense (S) is ranked by the 3′ overhang GG > GC, AA > CC, UU ≫ tt. ( c ) The dicing pattern L-R and R-L are as previously described. The L-R pattern generates the desired siRNA species for target knockdown. Total reads from the top 10 antisense strands and the abundance of L-R cleavage products from the antisense strand. ( d ) Two types of RNA editing: trimming of the 3′ end and post-transcriptional addition of nucleotides at the 3′ or 5′ ends.

    Techniques Used: Sequencing, Transfection, Isolation

    30) Product Images from "High-throughput analysis of the RNA-induced silencing complex in myotonic dystrophy type 1 patients identifies the dysregulation of miR-29c and its target ASB2"

    Article Title: High-throughput analysis of the RNA-induced silencing complex in myotonic dystrophy type 1 patients identifies the dysregulation of miR-29c and its target ASB2

    Journal: Cell Death & Disease

    doi: 10.1038/s41419-018-0769-5

    Modulation of miRNAs and mRNAs in skeletal muscle tissue. a , b Comparison between RNA-Seq results (DM1, n = 3; CTR, n = 3) and qPCR validation (DM1, n ≥ 5; CTR ≥ 5) in RISC-IP samples of DM1 compared to CTR subjects. Data are represented in Log2 scale, (−ΔΔCt), referred to CTRs. Upregulated and downregulated genes are indicated in red and in green, respectively. a miRNAs; miR-381 was not detectable by qPCR in both input and IP RNAs; b mRNAs; mRNA RNA-Seq of input RNA was not performed. c Dot plots of miR-29c and ASB2 mRNA validation experiments. RISC-IP associated RNAs (IP) and INPUT RNAs obtained from biopsies of DM1 patients vs healthy subjects (CTR) were analyzed by qPCR and normalized to miR-181a and RPL23 mRNA, respectively. Values are indicated as −1*ΔΔCt fold changes (log2FC). Average and error bars are also indicated (CTR n ≥ 5; DM1 n ≥ 5; * P
    Figure Legend Snippet: Modulation of miRNAs and mRNAs in skeletal muscle tissue. a , b Comparison between RNA-Seq results (DM1, n = 3; CTR, n = 3) and qPCR validation (DM1, n ≥ 5; CTR ≥ 5) in RISC-IP samples of DM1 compared to CTR subjects. Data are represented in Log2 scale, (−ΔΔCt), referred to CTRs. Upregulated and downregulated genes are indicated in red and in green, respectively. a miRNAs; miR-381 was not detectable by qPCR in both input and IP RNAs; b mRNAs; mRNA RNA-Seq of input RNA was not performed. c Dot plots of miR-29c and ASB2 mRNA validation experiments. RISC-IP associated RNAs (IP) and INPUT RNAs obtained from biopsies of DM1 patients vs healthy subjects (CTR) were analyzed by qPCR and normalized to miR-181a and RPL23 mRNA, respectively. Values are indicated as −1*ΔΔCt fold changes (log2FC). Average and error bars are also indicated (CTR n ≥ 5; DM1 n ≥ 5; * P

    Techniques Used: RNA Sequencing Assay, Real-time Polymerase Chain Reaction

    31) Product Images from "The pH-Responsive Regulon of HP0244 (FlgS), the Cytoplasmic Histidine Kinase of Helicobacter pylori ▿"

    Article Title: The pH-Responsive Regulon of HP0244 (FlgS), the Cytoplasmic Histidine Kinase of Helicobacter pylori ▿

    Journal: Journal of Bacteriology

    doi: 10.1128/JB.01219-08

    Low-pH-induced transcription of the HP0071 ( ureI ), HP0294 ( amiE ), and HP0073 ( ureAB ) genes is HP0244 dependent. Total RNAs were extracted from H. pylori wild-type strain 26695 (lanes +) and the flgS mutant strain 26695/ΔHP0244::km (lanes −) which were exposed to neutral pH (pH 7.4) (lanes 1 and 2), a low pH (pH 4.5 without urea) (lanes 3 and 4), or a lower pH (pH 2.5 with 30 mM urea) (lanes 5 and 6) for 30 min. RNAs were analyzed by Northern blotting with the HP0071 ( ureI ) (A), HP0294 ( amiE ) (B), and HP0073 ( ureA ) (C) gene-specific probes. Ethidium bromide staining of the gel showed that equal amounts of RNA were analyzed. The size standards used were the 16S and 23S rRNA species. The results for pH 2.5 were obtained in experiments separate from the experiments used to obtain the results for pH 7.4 and 4.5.
    Figure Legend Snippet: Low-pH-induced transcription of the HP0071 ( ureI ), HP0294 ( amiE ), and HP0073 ( ureAB ) genes is HP0244 dependent. Total RNAs were extracted from H. pylori wild-type strain 26695 (lanes +) and the flgS mutant strain 26695/ΔHP0244::km (lanes −) which were exposed to neutral pH (pH 7.4) (lanes 1 and 2), a low pH (pH 4.5 without urea) (lanes 3 and 4), or a lower pH (pH 2.5 with 30 mM urea) (lanes 5 and 6) for 30 min. RNAs were analyzed by Northern blotting with the HP0071 ( ureI ) (A), HP0294 ( amiE ) (B), and HP0073 ( ureA ) (C) gene-specific probes. Ethidium bromide staining of the gel showed that equal amounts of RNA were analyzed. The size standards used were the 16S and 23S rRNA species. The results for pH 2.5 were obtained in experiments separate from the experiments used to obtain the results for pH 7.4 and 4.5.

    Techniques Used: Mutagenesis, Northern Blot, Staining

    32) Product Images from "Light activates the translational regulatory GCN2 kinase via reactive oxygen species emanating from the chloroplast"

    Article Title: Light activates the translational regulatory GCN2 kinase via reactive oxygen species emanating from the chloroplast

    Journal: bioRxiv

    doi: 10.1101/794362

    GCN2 regulation of mRNA translation state. Cell extracts from Arabidopsis seedling shoots treated with 0.5µM chlorosulfuron (2 hr) were fractionated over sucrose gradients to separate polysomal from non-polysomal RNAs. (A, B) UV absorbance profiles of polysome gradients. Upon activation by CSF, GCN2 kinase inhibits polysome loading in the wild type but not in gcn2 mutants. The ratio of polysomes (P) to monosomes (M) is indicated with standard error from 3 replicates. (C) Gradient fractions were pooled into non-polysomal (NP), small (SP) and large polysomal (LP) RNA pools respectively. The histogram shows the average RNA recovered with standard error. (D) Gene set enrichment analysis of mRNA translation states. The differential translations states of 13,551 mRNAs were rank-ordered for each of two pairwise comparisons (Wt±CSF, gcn2 ±CSF). Next, 257 gene sets harboring between 15 and 500 members were examined for a biased distribution along the rank-ordered mRNAs. Gene sets with a bias passing a family-wise error rate
    Figure Legend Snippet: GCN2 regulation of mRNA translation state. Cell extracts from Arabidopsis seedling shoots treated with 0.5µM chlorosulfuron (2 hr) were fractionated over sucrose gradients to separate polysomal from non-polysomal RNAs. (A, B) UV absorbance profiles of polysome gradients. Upon activation by CSF, GCN2 kinase inhibits polysome loading in the wild type but not in gcn2 mutants. The ratio of polysomes (P) to monosomes (M) is indicated with standard error from 3 replicates. (C) Gradient fractions were pooled into non-polysomal (NP), small (SP) and large polysomal (LP) RNA pools respectively. The histogram shows the average RNA recovered with standard error. (D) Gene set enrichment analysis of mRNA translation states. The differential translations states of 13,551 mRNAs were rank-ordered for each of two pairwise comparisons (Wt±CSF, gcn2 ±CSF). Next, 257 gene sets harboring between 15 and 500 members were examined for a biased distribution along the rank-ordered mRNAs. Gene sets with a bias passing a family-wise error rate

    Techniques Used: Activation Assay

    33) Product Images from "HDX-MS reveals dysregulated checkpoints that compromise discrimination against self RNA during RIG-I mediated autoimmunity"

    Article Title: HDX-MS reveals dysregulated checkpoints that compromise discrimination against self RNA during RIG-I mediated autoimmunity

    Journal: Nature Communications

    doi: 10.1038/s41467-018-07780-z

    Partial opening of CARDs upon RNA surveillance by WT and H830A RIG-I. a MS spectra of RIG-I CARD2 latch peptide Y103–114 derived from various complexes at the indicated on-exchange time points. b HDX single amino acid consolidation view of apo , column (i) and (ii)) are, respectively, mapped to the CARDs-HEL2i structure model (upper left panel) and single CARDs structure (upper right panel), representing auto-repressed and solvent-exposed CARDs conformational dynamics. The location of CARD2 latch peptide is highlighted in the structure model (below). Percentages of deuterium uptake are color coded according to HDX dynamics key. Black, regions that have no sequence coverage and include proline residue that has no amide hydrogen exchange activity. c and e The fraction of WT or H830A RIG-I CARDs molecules in the higher MS population (open conformation) to the total population is plotted against the on-exchange time points. d , f Half-life ( t 1/2 ) of respective partial opening event is determined by fitting an exponential 3P with the prediction model: a + b × exp( c .time(min)), where a is the asymptote, b is the scale, and c is the growth rate, is used to fit a curve to %D (response) and time (regressor). Inverse prediction is used to solve for the half-life ( t 1/2 ) for each conformational state. (*Means that Cap1-10l-treated group predicted t 1/2 (42.53 min) was higher than the upper limit (24.67, α = 0.05), whereas 3p10l ATP, Cap0-10l, and Cap0mA-10l-treated groups did not exceed the lower or upper limits in this comparison; NS means statistically nonsignificant between compared group. t 1/2 calculated for 3p10l-bound H830A RIG-I and Cap1-10l-bound H830A RIG-I did not exceed the lower or upper limits ( α = 0.05) in this comparison.) g The IFN-β luciferase signal is plotted as recorded in WT/H830A RIG-I dual reporter assays stimulated with indicated RNAs. The significance of differences between groups was evaluated by Student’s t test (* p
    Figure Legend Snippet: Partial opening of CARDs upon RNA surveillance by WT and H830A RIG-I. a MS spectra of RIG-I CARD2 latch peptide Y103–114 derived from various complexes at the indicated on-exchange time points. b HDX single amino acid consolidation view of apo , column (i) and (ii)) are, respectively, mapped to the CARDs-HEL2i structure model (upper left panel) and single CARDs structure (upper right panel), representing auto-repressed and solvent-exposed CARDs conformational dynamics. The location of CARD2 latch peptide is highlighted in the structure model (below). Percentages of deuterium uptake are color coded according to HDX dynamics key. Black, regions that have no sequence coverage and include proline residue that has no amide hydrogen exchange activity. c and e The fraction of WT or H830A RIG-I CARDs molecules in the higher MS population (open conformation) to the total population is plotted against the on-exchange time points. d , f Half-life ( t 1/2 ) of respective partial opening event is determined by fitting an exponential 3P with the prediction model: a + b × exp( c .time(min)), where a is the asymptote, b is the scale, and c is the growth rate, is used to fit a curve to %D (response) and time (regressor). Inverse prediction is used to solve for the half-life ( t 1/2 ) for each conformational state. (*Means that Cap1-10l-treated group predicted t 1/2 (42.53 min) was higher than the upper limit (24.67, α = 0.05), whereas 3p10l ATP, Cap0-10l, and Cap0mA-10l-treated groups did not exceed the lower or upper limits in this comparison; NS means statistically nonsignificant between compared group. t 1/2 calculated for 3p10l-bound H830A RIG-I and Cap1-10l-bound H830A RIG-I did not exceed the lower or upper limits ( α = 0.05) in this comparison.) g The IFN-β luciferase signal is plotted as recorded in WT/H830A RIG-I dual reporter assays stimulated with indicated RNAs. The significance of differences between groups was evaluated by Student’s t test (* p

    Techniques Used: Mass Spectrometry, Derivative Assay, Sequencing, Activity Assay, Luciferase

    34) Product Images from "A Humanized Mouse Model for the Reduced Folate Carrier"

    Article Title: A Humanized Mouse Model for the Reduced Folate Carrier

    Journal: Molecular genetics and metabolism

    doi: 10.1016/j.ymgme.2007.09.014

    q PCR analysis of hRFC expression in humanized mice Results for total hRFC transcripts for five different humanized mice are shown. RNAs were prepared from tissues isolated from the humanized mice including brain, heart, kidney, liver, intestine, and placenta. RNAs were reverse transcribed and analyzed for total hRFC transcripts by q PCR. hRFC transcript levels were normalized to mouse GAPDH transcripts. Intestinal RNAs were not analyzed for mice A2975 and A2835. Results are presented as average values plus/minus ranges from duplicate measurements.
    Figure Legend Snippet: q PCR analysis of hRFC expression in humanized mice Results for total hRFC transcripts for five different humanized mice are shown. RNAs were prepared from tissues isolated from the humanized mice including brain, heart, kidney, liver, intestine, and placenta. RNAs were reverse transcribed and analyzed for total hRFC transcripts by q PCR. hRFC transcript levels were normalized to mouse GAPDH transcripts. Intestinal RNAs were not analyzed for mice A2975 and A2835. Results are presented as average values plus/minus ranges from duplicate measurements.

    Techniques Used: Polymerase Chain Reaction, Expressing, Mouse Assay, Isolation

    Tissue specific 5’ UTR usage in humanized hRFC mice RNAs were prepared from select tissues isolated from the humanized mice including brain, kidney, liver, and duodenum. RNAs were reverse transcribed and analyzed for hRFC 5’UTRs by q PCR. hRFC transcript levels were normalized to mGAPDH transcripts. The results show that the A1/A2 and B are consistently the major 5’UTRs used with lower levels of A and C. Thus, our results in the humanized mice resemble those in human tissues. In one female mouse (A2835) a significant level of transcripts including the C 5’UTR was detected (not shown). Results are presented as average values plus/minus ranges from duplicate measurements.
    Figure Legend Snippet: Tissue specific 5’ UTR usage in humanized hRFC mice RNAs were prepared from select tissues isolated from the humanized mice including brain, kidney, liver, and duodenum. RNAs were reverse transcribed and analyzed for hRFC 5’UTRs by q PCR. hRFC transcript levels were normalized to mGAPDH transcripts. The results show that the A1/A2 and B are consistently the major 5’UTRs used with lower levels of A and C. Thus, our results in the humanized mice resemble those in human tissues. In one female mouse (A2835) a significant level of transcripts including the C 5’UTR was detected (not shown). Results are presented as average values plus/minus ranges from duplicate measurements.

    Techniques Used: Mouse Assay, Isolation, Polymerase Chain Reaction

    Comparison of hRFC and mRFC expression in Tg mouse tissues Human-specific (left) and mouse-specific (right) PCR primers were used for q PCR to detect relative levels of hRFC and mRFC transcripts in RNAs prepared from tissues from the same hRFC Tg mouse. Normalization was with 18S rRNA. I A through D designate different regions of small intestine (proximal to distal). Only relative transcript levels are reported for hRFC and mRFC. Absolute transcript levels differed by approx. 5- to 10-fold. Results are presented as mean values plus/minus standard error form 3 measurements.
    Figure Legend Snippet: Comparison of hRFC and mRFC expression in Tg mouse tissues Human-specific (left) and mouse-specific (right) PCR primers were used for q PCR to detect relative levels of hRFC and mRFC transcripts in RNAs prepared from tissues from the same hRFC Tg mouse. Normalization was with 18S rRNA. I A through D designate different regions of small intestine (proximal to distal). Only relative transcript levels are reported for hRFC and mRFC. Absolute transcript levels differed by approx. 5- to 10-fold. Results are presented as mean values plus/minus standard error form 3 measurements.

    Techniques Used: Expressing, Polymerase Chain Reaction

    35) Product Images from "Protein-driven RNA nanostructured devices that function in vitro and control mammalian cell fate"

    Article Title: Protein-driven RNA nanostructured devices that function in vitro and control mammalian cell fate

    Journal: Nature Communications

    doi: 10.1038/s41467-017-00459-x

    Actuation of protein-driven RNA nanodevices in vitro. a Schematic representation of structural changes in 2Kt-33-Tri ( left ) and 2Kt-28-Z ( right ) caused by the induced-fit of RNA in response to L7Ae binding. The distance between the two ends of the RNA is indicated by a red double-headed arrows. The in silico predicted lengths of each side of 2Kt-33-Tri and 2Kt-28-Z were ~8.7 nm and 7.4 nm, respectively. b , c EMSA confirmed the interaction between 2Kt-33-Tri ( b ) and 2Kt-28-Z ( c ) RNA nanostructures with L7Ae. Higher order bands ( black arrowheads ) indicate heterogeneous oligomers composed of L- and S-RNA strands. Concentrations of long and short RNAs: each 50 nM. d , e AFM images of the 2Kt-33-Tri ( d ) and 2Kt-28-Z ( e ) RNA nanostructures in the absence ( left ) and presence ( right ) of L7Ae. Scale bars , 20 nm. f , g Statistical distribution of the distance between the two ends of RNA, indicated by the double-headed arrows in a , for 2Kt-33-Tri ( f ) and 2Kt-28-Z RNA ( g ) nanostructures in the absence ( black ) and presence ( red ) of L7Ae ( N number of nanostructures). h Schematic illustration of the ON/OFF switching of biMGA activity caused by structural changes in RNA nanodevices in response to L7Ae binding. Fluorescence emission of Tri-MGA-ON is caused by the formation of an active biMGA that occurs with a L7Ae-induced RNA conformational change that places two split aptamers close to each other ( left ). Fluorescence quenching of Z-MGA-OFF is caused by disassembly of the biMGA that occurs with a L7Ae-induced conformational change that separates the two split aptamers ( right ). i Fluorescence spectra of Tri-MGA-ON ( left ) and Z-MGA-OFF ( right ) in the absence ( black ) and presence ( green ) of L7Ae. j Fraction of open ( black ) and closed ( red ) nanostructures before and after RNP formation ( N number of nanostructures). Tri-MGA-ON: Tri-MGA-ON-stem B (Supplementary Fig. 10 ). Z-MGA-OFF: Z-MGA-OFF-stem D (Supplementary Fig. 11 )
    Figure Legend Snippet: Actuation of protein-driven RNA nanodevices in vitro. a Schematic representation of structural changes in 2Kt-33-Tri ( left ) and 2Kt-28-Z ( right ) caused by the induced-fit of RNA in response to L7Ae binding. The distance between the two ends of the RNA is indicated by a red double-headed arrows. The in silico predicted lengths of each side of 2Kt-33-Tri and 2Kt-28-Z were ~8.7 nm and 7.4 nm, respectively. b , c EMSA confirmed the interaction between 2Kt-33-Tri ( b ) and 2Kt-28-Z ( c ) RNA nanostructures with L7Ae. Higher order bands ( black arrowheads ) indicate heterogeneous oligomers composed of L- and S-RNA strands. Concentrations of long and short RNAs: each 50 nM. d , e AFM images of the 2Kt-33-Tri ( d ) and 2Kt-28-Z ( e ) RNA nanostructures in the absence ( left ) and presence ( right ) of L7Ae. Scale bars , 20 nm. f , g Statistical distribution of the distance between the two ends of RNA, indicated by the double-headed arrows in a , for 2Kt-33-Tri ( f ) and 2Kt-28-Z RNA ( g ) nanostructures in the absence ( black ) and presence ( red ) of L7Ae ( N number of nanostructures). h Schematic illustration of the ON/OFF switching of biMGA activity caused by structural changes in RNA nanodevices in response to L7Ae binding. Fluorescence emission of Tri-MGA-ON is caused by the formation of an active biMGA that occurs with a L7Ae-induced RNA conformational change that places two split aptamers close to each other ( left ). Fluorescence quenching of Z-MGA-OFF is caused by disassembly of the biMGA that occurs with a L7Ae-induced conformational change that separates the two split aptamers ( right ). i Fluorescence spectra of Tri-MGA-ON ( left ) and Z-MGA-OFF ( right ) in the absence ( black ) and presence ( green ) of L7Ae. j Fraction of open ( black ) and closed ( red ) nanostructures before and after RNP formation ( N number of nanostructures). Tri-MGA-ON: Tri-MGA-ON-stem B (Supplementary Fig. 10 ). Z-MGA-OFF: Z-MGA-OFF-stem D (Supplementary Fig. 11 )

    Techniques Used: In Vitro, Binding Assay, In Silico, Activity Assay, Fluorescence

    36) Product Images from "Identification of long noncoding RNAs involved in muscle differentiation"

    Article Title: Identification of long noncoding RNAs involved in muscle differentiation

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0193898

    Identification of long noncoding RNAs (lncRNAs) involved in phenotypic change of vascular smooth muscle cells (VSMCs). (A) The VSMCs with the synthetic phenotype can be differentiated into less the proliferative and contractile phenotypic by the overexpression of myocardin (MYOCD) or by treatment with transforming growth factor beta (TGFβ). The cells with the contractile phenotype can be converted into the more proliferative and synthetic phenotype by treatment with platelet-derived growth factor (PDGF). (B) Expression level of representative genes previously known to be involved in phenotypic change of VSMCs. The RNA-seq data of PDGF-treated venous smooth muscle cells, MYOCD-overexpressing human coronary artery smooth muscle (HCASM) cells, and TGFβ-treated HCASM cells were obtained from the Gene Expression Omnibus (GEO) (see Methods ). The fragments per kilobase of exon model per million mapped fragments (FPKM) values of a protein-coding gene ( CNN1 ) and a long noncoding RNA ( SMILR ) are depicted in the y-axis. Error bars indicate standard errors from four samples for the PDGF set, or deviation from two samples for the MYOCD and TGFβ sets. (C) Expression profiles of lncRNAs during phenotypic change of VSMCs were analyzed. The calculation of lncRNAs’ expression changes is described in Method section. The gene clusters with prominent changes between the synthetic and contractile phenotypes are indicated with boxes. Detailed expression changes of genes from those clusters are depicted in S1 and S2 Figs.
    Figure Legend Snippet: Identification of long noncoding RNAs (lncRNAs) involved in phenotypic change of vascular smooth muscle cells (VSMCs). (A) The VSMCs with the synthetic phenotype can be differentiated into less the proliferative and contractile phenotypic by the overexpression of myocardin (MYOCD) or by treatment with transforming growth factor beta (TGFβ). The cells with the contractile phenotype can be converted into the more proliferative and synthetic phenotype by treatment with platelet-derived growth factor (PDGF). (B) Expression level of representative genes previously known to be involved in phenotypic change of VSMCs. The RNA-seq data of PDGF-treated venous smooth muscle cells, MYOCD-overexpressing human coronary artery smooth muscle (HCASM) cells, and TGFβ-treated HCASM cells were obtained from the Gene Expression Omnibus (GEO) (see Methods ). The fragments per kilobase of exon model per million mapped fragments (FPKM) values of a protein-coding gene ( CNN1 ) and a long noncoding RNA ( SMILR ) are depicted in the y-axis. Error bars indicate standard errors from four samples for the PDGF set, or deviation from two samples for the MYOCD and TGFβ sets. (C) Expression profiles of lncRNAs during phenotypic change of VSMCs were analyzed. The calculation of lncRNAs’ expression changes is described in Method section. The gene clusters with prominent changes between the synthetic and contractile phenotypes are indicated with boxes. Detailed expression changes of genes from those clusters are depicted in S1 and S2 Figs.

    Techniques Used: Over Expression, Derivative Assay, Expressing, RNA Sequencing Assay

    37) Product Images from "Mutagenesis of Dengue Virus Protein NS2A Revealed a Novel Domain Responsible for Virus-Induced Cytopathic Effect and Interactions between NS2A and NS2B Transmembrane Segments"

    Article Title: Mutagenesis of Dengue Virus Protein NS2A Revealed a Novel Domain Responsible for Virus-Induced Cytopathic Effect and Interactions between NS2A and NS2B Transmembrane Segments

    Journal: Journal of Virology

    doi: 10.1128/JVI.01836-16

    Replication activities of various DENV2 reporter replicons containing NS2A mutations. (A) Schematic representation of the DNA-launched DENV2 reporter replicon pCMV-DV2Rep, which was used for a transient replicon assay. The transcriptional expression of the replicon RNA was under the control of the CMVmin promoter, and the processing of the 3′ terminus of the transcript was ensured by the inclusion of HDV ribozyme sequences. The 5′ UTR (left black line), the N-terminal 102 amino acids of the C protein (C102), the Renilla luciferase gene (Rluc), the FMDV2A cleavage site (black box), a neomycin resistance gene (Neo), an encephalomyocarditis virus (EMCV) internal ribosome entry site (IRES) element (gray box), the C-terminal 24 amino acids of E (E24), all of the NS protein regions (NS1 to NS5), the 3′ UTR (right black line), the HDV ribozyme sequence, and the SV40 poly(A) signal sequence are indicated. (B) Replication kinetics of the WT DENV replicon. BHK21 cells were transfected with WT or NS5 mutant replicon plasmid. The luciferase activity of the transfected cells was monitored at 24, 48, 72, and 96 h posttransfection. The error bars represent the standard errors of the mean (SEM) of the results from three independent experiments. (C) Replication activities of transient expression of DNA-launched wild-type and NS2A mutant replicons in BHK21 cells. BHK21 cells were transfected with WT or NS2A mutant replicon plasmids. At 24 h and 72 h posttransfection, the luciferase activities of the transfected cells were measured. Replication efficiency was calculated by determination of the ratio of luciferase activity obtained at 72 h to the average value obtained from all replicon constructs at 24 h posttransfection and compared with that of the WT replicon. The numbers above the bars represent the percentages of luciferase activity relative to the activity of the WT replicon (which was considered to be 100%), and the error bars represent the SEM of the results from three independent experiments. (D) There is no apparent effect of mutations within NM5, NM7, NM9, NM17, NM18, or NM19 on the translation of viral RNAs. BHK21 cells were cotransfected with the pSV-beta-Galactosidase vector and DNA-launched WT or NS2A mutant replicon plasmids. At 24 h posttransfection, the luciferase activity (normalized to β-galactosidase activity) of the transfected cells was measured and normalized to the activity in cells transfected with the WT replicon plasmid, which was set at 100%. The error bars represent the SEM of the results from three independent experiments. (E) Replication activities of transient expression of RNA-launched wild-type and NS2A mutant replicons in BHK21 cells. At 4 h and 48 h posttransfection, the luciferase activities of the transfected cells were measured. Replication efficiency was calculated by determination of the ratio of the luciferase activity obtained at 48 h to the value obtained at 4 h posttransfection and compared with that of the WT replicon. The numbers above the bars represent the percentages of luciferase activity relative to the activity of the WT replicon (which was considered to be 100%), and the error bars represent the SEM of the results from three independent experiments.
    Figure Legend Snippet: Replication activities of various DENV2 reporter replicons containing NS2A mutations. (A) Schematic representation of the DNA-launched DENV2 reporter replicon pCMV-DV2Rep, which was used for a transient replicon assay. The transcriptional expression of the replicon RNA was under the control of the CMVmin promoter, and the processing of the 3′ terminus of the transcript was ensured by the inclusion of HDV ribozyme sequences. The 5′ UTR (left black line), the N-terminal 102 amino acids of the C protein (C102), the Renilla luciferase gene (Rluc), the FMDV2A cleavage site (black box), a neomycin resistance gene (Neo), an encephalomyocarditis virus (EMCV) internal ribosome entry site (IRES) element (gray box), the C-terminal 24 amino acids of E (E24), all of the NS protein regions (NS1 to NS5), the 3′ UTR (right black line), the HDV ribozyme sequence, and the SV40 poly(A) signal sequence are indicated. (B) Replication kinetics of the WT DENV replicon. BHK21 cells were transfected with WT or NS5 mutant replicon plasmid. The luciferase activity of the transfected cells was monitored at 24, 48, 72, and 96 h posttransfection. The error bars represent the standard errors of the mean (SEM) of the results from three independent experiments. (C) Replication activities of transient expression of DNA-launched wild-type and NS2A mutant replicons in BHK21 cells. BHK21 cells were transfected with WT or NS2A mutant replicon plasmids. At 24 h and 72 h posttransfection, the luciferase activities of the transfected cells were measured. Replication efficiency was calculated by determination of the ratio of luciferase activity obtained at 72 h to the average value obtained from all replicon constructs at 24 h posttransfection and compared with that of the WT replicon. The numbers above the bars represent the percentages of luciferase activity relative to the activity of the WT replicon (which was considered to be 100%), and the error bars represent the SEM of the results from three independent experiments. (D) There is no apparent effect of mutations within NM5, NM7, NM9, NM17, NM18, or NM19 on the translation of viral RNAs. BHK21 cells were cotransfected with the pSV-beta-Galactosidase vector and DNA-launched WT or NS2A mutant replicon plasmids. At 24 h posttransfection, the luciferase activity (normalized to β-galactosidase activity) of the transfected cells was measured and normalized to the activity in cells transfected with the WT replicon plasmid, which was set at 100%. The error bars represent the SEM of the results from three independent experiments. (E) Replication activities of transient expression of RNA-launched wild-type and NS2A mutant replicons in BHK21 cells. At 4 h and 48 h posttransfection, the luciferase activities of the transfected cells were measured. Replication efficiency was calculated by determination of the ratio of the luciferase activity obtained at 48 h to the value obtained at 4 h posttransfection and compared with that of the WT replicon. The numbers above the bars represent the percentages of luciferase activity relative to the activity of the WT replicon (which was considered to be 100%), and the error bars represent the SEM of the results from three independent experiments.

    Techniques Used: Expressing, Luciferase, Sequencing, Transfection, Mutagenesis, Plasmid Preparation, Activity Assay, Construct

    38) Product Images from "The Sterolgene v0 cDNA microarray: a systemic approach to studies of cholesterol homeostasis and drug metabolism"

    Article Title: The Sterolgene v0 cDNA microarray: a systemic approach to studies of cholesterol homeostasis and drug metabolism

    Journal: BMC Genomics

    doi: 10.1186/1471-2164-9-76

    Normalization of Sterolgene v0 microarray data . MA plots of Sterolgene v0 microarray data illustrating its normalization. Genes are marked with crosses (+), Ambion ArrayControl spikes with circles (○) and diamonds (◇), and Firefly luciferase mRNAs with squares (□). A: data before normalization together with LOWESS curve through normalization spike in RNAs. C: the same data as shown in A, but with normalization controls adjusted according to their RNA concentrations (see text for details). B and D: data after normalization according to LOWESS curves shown in A and C, respectively. Adjusted are 4 types of Ambion spikes marked with green, orange and red circles/diamonds.
    Figure Legend Snippet: Normalization of Sterolgene v0 microarray data . MA plots of Sterolgene v0 microarray data illustrating its normalization. Genes are marked with crosses (+), Ambion ArrayControl spikes with circles (○) and diamonds (◇), and Firefly luciferase mRNAs with squares (□). A: data before normalization together with LOWESS curve through normalization spike in RNAs. C: the same data as shown in A, but with normalization controls adjusted according to their RNA concentrations (see text for details). B and D: data after normalization according to LOWESS curves shown in A and C, respectively. Adjusted are 4 types of Ambion spikes marked with green, orange and red circles/diamonds.

    Techniques Used: Microarray, Luciferase

    39) Product Images from "RNA-Binding Protein Musashi2: Developmentally Regulated Expression in Neural Precursor Cells and Subpopulations of Neurons in Mammalian CNS"

    Article Title: RNA-Binding Protein Musashi2: Developmentally Regulated Expression in Neural Precursor Cells and Subpopulations of Neurons in Mammalian CNS

    Journal: The Journal of Neuroscience

    doi: 10.1523/JNEUROSCI.21-20-08091.2001

    Tissue distribution and developmental expression of the msi2 transcripts. Total RNA (20 μg) from each mouse tissue was prepared, and the levels of msi2 mRNA were determined by Northern blot analysis. A , Tissue distribution of msi2 mRNA in adults. Expression of a 7.0 kb transcript can be seen in most lanes. A short transcript of ∼1.5 kb is observed only in the testis. B , Changes in msi2 mRNA expression in the whole brain associated with development. Msi2 mRNA expression can be seen at E10 , the earliest time point tested. The equal loading and quality of the RNAs were tested by performing the hybridization with a β- actin probe, shown in each bottom panel .
    Figure Legend Snippet: Tissue distribution and developmental expression of the msi2 transcripts. Total RNA (20 μg) from each mouse tissue was prepared, and the levels of msi2 mRNA were determined by Northern blot analysis. A , Tissue distribution of msi2 mRNA in adults. Expression of a 7.0 kb transcript can be seen in most lanes. A short transcript of ∼1.5 kb is observed only in the testis. B , Changes in msi2 mRNA expression in the whole brain associated with development. Msi2 mRNA expression can be seen at E10 , the earliest time point tested. The equal loading and quality of the RNAs were tested by performing the hybridization with a β- actin probe, shown in each bottom panel .

    Techniques Used: Expressing, Northern Blot, Hybridization

    40) Product Images from "Two Inactive Fragments of the Integral RNA Cooperate To Assemble Active Telomerase with the Human Protein Catalytic Subunit (hTERT) In Vitro"

    Article Title: Two Inactive Fragments of the Integral RNA Cooperate To Assemble Active Telomerase with the Human Protein Catalytic Subunit (hTERT) In Vitro

    Journal: Molecular and Cellular Biology

    doi:

    Mapping the 5′ and 3′ boundaries of hTR that define the minimal sequence for assembling active telomerase with hTERT. The templates for hTR truncations were made by PCR using appropriate 5′ and 3′ primers (see Materials and Methods), gel isolated, and subjected to in vitro transcription. Transcribed RNAs were gel isolated to ensure that wild-type hTR was not carried over into the assembly reaction. Mutant nomenclature refers to the 5′ and 3′ nucleotides within hTR. Each mutant (0.2 μg) was added for telomerase assembly under optimized conditions (0.2 μl of hTERT, 200 mM KCl, and 50% rabbit reticulocyte lysate in 4 μl at 30°C for 90 to 120 min). The assembly reaction was analyzed by Northern blot analysis (A) and the TRAP assay (B). The Northern analysis demonstrates that equal amounts of the hTR mutants were still present after the assembly reaction. Relative quantitation is shown for this representative TRAP assay and reflects the ratio between the abundance of extended products versus the 36-bp internal standard.
    Figure Legend Snippet: Mapping the 5′ and 3′ boundaries of hTR that define the minimal sequence for assembling active telomerase with hTERT. The templates for hTR truncations were made by PCR using appropriate 5′ and 3′ primers (see Materials and Methods), gel isolated, and subjected to in vitro transcription. Transcribed RNAs were gel isolated to ensure that wild-type hTR was not carried over into the assembly reaction. Mutant nomenclature refers to the 5′ and 3′ nucleotides within hTR. Each mutant (0.2 μg) was added for telomerase assembly under optimized conditions (0.2 μl of hTERT, 200 mM KCl, and 50% rabbit reticulocyte lysate in 4 μl at 30°C for 90 to 120 min). The assembly reaction was analyzed by Northern blot analysis (A) and the TRAP assay (B). The Northern analysis demonstrates that equal amounts of the hTR mutants were still present after the assembly reaction. Relative quantitation is shown for this representative TRAP assay and reflects the ratio between the abundance of extended products versus the 36-bp internal standard.

    Techniques Used: Sequencing, Polymerase Chain Reaction, Isolation, In Vitro, Mutagenesis, Northern Blot, TRAP Assay, Quantitation Assay

    Complementation of hTR(33-147) with hTR truncations that lack a template to assemble active telomerase. Assembly reactions were performed with hTERT that was synthesized in rabbit reticulocyte lysate (A and C) or in VA13 cells (B), and 1/20 of each assembly reaction product was examined by the TRAP assay. (A) Assembly reactions for lanes 1 to 16 contained 250 ng of hTR(33-147) (7 pmol, the molar equivalent to 1 μg of full-length hTR) and either no additional RNA (lane 1) or a 1/10 molar equivalent amount (0.7 pmol) of the nontemplating RNAs, as indicated (lanes 2 to 16). The assembly reaction for lane 17 contained 70 ng (0.7 pmol) of gel-isolated hTR(33-325); lane 18 contained 100 ng (0.7 pmol) of hTR(1-451). Yeast tRNA (3.3 μg) was included in each sample. Lane 19 is a lysis buffer control to demonstrate the specific assembly of active telomerase. Relative quantitation is shown for this representative TRAP assay and reflects the ratio between the abundance of extended products versus the 36-bp internal standard. (B) S100 extracts prepared from VA13 cells that express exogenous hTERT did not yield telomerase activity when assayed alone (lane 1) or when mixed with either hTR(164-325) (lane 3) or hTR(33-147) (lane 4). However, combining hTR(33-147) and hTR(164-325) with VA13-hTERT extracts yielded telomerase activity in vitro (lane 2). (C) Titration experiments were performed with hTR(33-147) and hTR(164-325). Relative amounts of the RNAs included in the assembly reactions are shown, with 1 U representing 0.07 pmol, which is the molar equivalent of 10 ng of hTR(1-451). When 7 pmol of hTR(33-147) or hTR(164-325) was tested individually in the assembly reactions, no telomerase products were detected (data not shown).
    Figure Legend Snippet: Complementation of hTR(33-147) with hTR truncations that lack a template to assemble active telomerase. Assembly reactions were performed with hTERT that was synthesized in rabbit reticulocyte lysate (A and C) or in VA13 cells (B), and 1/20 of each assembly reaction product was examined by the TRAP assay. (A) Assembly reactions for lanes 1 to 16 contained 250 ng of hTR(33-147) (7 pmol, the molar equivalent to 1 μg of full-length hTR) and either no additional RNA (lane 1) or a 1/10 molar equivalent amount (0.7 pmol) of the nontemplating RNAs, as indicated (lanes 2 to 16). The assembly reaction for lane 17 contained 70 ng (0.7 pmol) of gel-isolated hTR(33-325); lane 18 contained 100 ng (0.7 pmol) of hTR(1-451). Yeast tRNA (3.3 μg) was included in each sample. Lane 19 is a lysis buffer control to demonstrate the specific assembly of active telomerase. Relative quantitation is shown for this representative TRAP assay and reflects the ratio between the abundance of extended products versus the 36-bp internal standard. (B) S100 extracts prepared from VA13 cells that express exogenous hTERT did not yield telomerase activity when assayed alone (lane 1) or when mixed with either hTR(164-325) (lane 3) or hTR(33-147) (lane 4). However, combining hTR(33-147) and hTR(164-325) with VA13-hTERT extracts yielded telomerase activity in vitro (lane 2). (C) Titration experiments were performed with hTR(33-147) and hTR(164-325). Relative amounts of the RNAs included in the assembly reactions are shown, with 1 U representing 0.07 pmol, which is the molar equivalent of 10 ng of hTR(1-451). When 7 pmol of hTR(33-147) or hTR(164-325) was tested individually in the assembly reactions, no telomerase products were detected (data not shown).

    Techniques Used: Synthesized, TRAP Assay, Isolation, Lysis, Quantitation Assay, Activity Assay, In Vitro, Titration

    Related Articles

    Amplification:

    Article Title: Single-cell full-length total RNA sequencing uncovers dynamics of recursive splicing and enhancer RNAs
    Article Snippet: .. To eliminate genomic DNA contamination, 1 μL of genomic DNA digestion mix (0.5× PrimeScript Buffer, 0.2 U of DNase I Amplification Grade, 1: 5 000 000 ERCC RNA Spike-In Mix I (Thermo Fisher) in RNase-free water) was added to 1 μL of the denatured sample. .. The mixtures were agitated for 30 s at 2000 rpm using an ThermoMixer C at 4 °C, incubated in a C1000 thermal cycler at 30 °C for 5 min and held at 4 °C until the next step.

    Polyacrylamide Gel Electrophoresis:

    Article Title: Using RNA Sequencing and Spike-in RNAs to Measure Intracellular Abundance of lncRNAs and mRNAs
    Article Snippet: ERCC annotation files (ERCC92.fa, ERCC92.gtf, and ERCC_Controls_Analysis.txt found in the ERCC RNA Spike-In product page, Thermo Fisher Scientific, catalog number: 4456740). .. ERCC annotation files (ERCC92.fa, ERCC92.gtf, and ERCC_Controls_Analysis.txt found in the ERCC RNA Spike-In product page, Thermo Fisher Scientific, catalog number: 4456740). .. Appropriate genome sequence ( e.g.).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher real time reverse transcriptase polymerase chain reaction rt pcr total rna
    ( a ) Schematic representation of symmetric and asymmetric siRNA-expression cassettes, with the expression of either the sense or the antisense <t>RNA</t> or both being driven by a chimeric promoter(s) for disruption of their equivalent molar levels of production. ( b ) Western blotting analysis of knockdown of p53 expression in 293FT cells transduced with shRNA and with various siRNA-expression cassettes via lentivector pSD31. (c) Levels of expression of p53 mRNA in transduced 293FT cells, as determined by real-time <t>RT-PCR.</t> The data shown are relative to levels of p53 mRNA in pSD31-transduced 293FT cells. Data shown are derived from an experiment that was conducted in triplicate for each sample.
    Real Time Reverse Transcriptase Polymerase Chain Reaction Rt Pcr Total Rna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/real time reverse transcriptase polymerase chain reaction rt pcr total rna/product/Thermo Fisher
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    real time reverse transcriptase polymerase chain reaction rt pcr total rna - by Bioz Stars, 2021-07
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher small interfering rna oligonucleotide sequences
    Effects of <t>CHOP</t> in IL-1β-induced pancreatic β cell apoptosis. A , INS-1 cells were transfected with small interfering <t>RNA</t> oligonucleotides (scrambled or CHOP targeting oligonucleotide 1 or 2) followed by 20 ng/ml IL-1β treatment
    Small Interfering Rna Oligonucleotide Sequences, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/small interfering rna oligonucleotide sequences/product/Thermo Fisher
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    small interfering rna oligonucleotide sequences - by Bioz Stars, 2021-07
    99/100 stars
      Buy from Supplier

    97
    Thermo Fisher rna isolation
    Up-regulation of genes related to Ifn- γ /Il-17 at 16 hpi. (A) The high expression of Ifn- γ and Il-17 after P. multocida infection by <t>Illumina</t> sequencing ( n = 3). The fold change indicated the ratio of the experimental group basemean (sample-WA average expression level) to the control group basemean (sample-WC average expression level) by Illumina sequencing. (B) The high expression of Ifn- γ and Il-17 after P. multocida infection by qRT-PCR ( n = 6, unpaired, two-tailed Student's t -test). (C) The levels of IFN-γ and IL-17 in the lungs or serum using ELISA analysis ( n = 6, unpaired, two-tailed Student's t -test). (D) The abundance of p-STAT1 Y701 and p-STAT3 Y705 in the murine lungs by immunoblotting analysis ( n = 5, unpaired, two-tailed Student's t -test). All data were expressed as means ±SEM. Because Il17 was not detected in control mice, the fold changes of Il17 in treatment mice were showed via presuming expression quantity = 1 of control mice in <t>RNA-Seq</t> (A) and Ct = 30 in qRT-PCR (B) , respectively. * P
    Rna Isolation, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rna isolation/product/Thermo Fisher
    Average 97 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    rna isolation - by Bioz Stars, 2021-07
    97/100 stars
      Buy from Supplier

    97
    Thermo Fisher rna fragmentation reagent
    Translation, methylation and transcriptome profile of GSCs and differentiated progenies. A) MeRIP-seq and <t>RNA-seq</t> normalized Ribo-seq peak profiles representative GSCs subtypes (mesenchymal, classical and proneural) and differentiated progenies (DGCs) (GSC, n=3; DGC, n=3). Specific sequence region shown for illustration of peaks profile across cells. B) Median translation efficiency for GSCs and differentiated progenies. Translation efficiency (TE) derived from the base-2 logarithm of the ratio of <t>mRNA</t> expression levels in the polysome fraction to that of total mRNA per transcript (***p
    Rna Fragmentation Reagent, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rna fragmentation reagent/product/Thermo Fisher
    Average 97 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    rna fragmentation reagent - by Bioz Stars, 2021-07
    97/100 stars
      Buy from Supplier

    Image Search Results


    ( a ) Schematic representation of symmetric and asymmetric siRNA-expression cassettes, with the expression of either the sense or the antisense RNA or both being driven by a chimeric promoter(s) for disruption of their equivalent molar levels of production. ( b ) Western blotting analysis of knockdown of p53 expression in 293FT cells transduced with shRNA and with various siRNA-expression cassettes via lentivector pSD31. (c) Levels of expression of p53 mRNA in transduced 293FT cells, as determined by real-time RT-PCR. The data shown are relative to levels of p53 mRNA in pSD31-transduced 293FT cells. Data shown are derived from an experiment that was conducted in triplicate for each sample.

    Journal: Nucleic Acids Research

    Article Title: Strand antagonism in RNAi: an explanation of differences in potency between intracellularly expressed siRNA and shRNA

    doi: 10.1093/nar/gkr927

    Figure Lengend Snippet: ( a ) Schematic representation of symmetric and asymmetric siRNA-expression cassettes, with the expression of either the sense or the antisense RNA or both being driven by a chimeric promoter(s) for disruption of their equivalent molar levels of production. ( b ) Western blotting analysis of knockdown of p53 expression in 293FT cells transduced with shRNA and with various siRNA-expression cassettes via lentivector pSD31. (c) Levels of expression of p53 mRNA in transduced 293FT cells, as determined by real-time RT-PCR. The data shown are relative to levels of p53 mRNA in pSD31-transduced 293FT cells. Data shown are derived from an experiment that was conducted in triplicate for each sample.

    Article Snippet: Quantitation of mRNA, expressed siRNA duplexes and shRNA by real-time reverse transcriptase-polymerase chain reaction (RT-PCR) Total RNA was prepared from 293FT cells in TRIzol® reagents (Invitrogen, San Diego, CA, USA).

    Techniques: Expressing, Western Blot, Transduction, shRNA, Quantitative RT-PCR, Derivative Assay

    Effects of CHOP in IL-1β-induced pancreatic β cell apoptosis. A , INS-1 cells were transfected with small interfering RNA oligonucleotides (scrambled or CHOP targeting oligonucleotide 1 or 2) followed by 20 ng/ml IL-1β treatment

    Journal: The Journal of Biological Chemistry

    Article Title: Regulation of CCAAT/Enhancer-binding Protein Homologous Protein (CHOP) Expression by Interleukin-1? in Pancreatic ? Cells *

    doi: 10.1074/jbc.M109.087486

    Figure Lengend Snippet: Effects of CHOP in IL-1β-induced pancreatic β cell apoptosis. A , INS-1 cells were transfected with small interfering RNA oligonucleotides (scrambled or CHOP targeting oligonucleotide 1 or 2) followed by 20 ng/ml IL-1β treatment

    Article Snippet: CHOP small interfering RNA oligonucleotide sequences (Ambion) were: 1, AAACCUUCACUACUCUUGATT (sense) and UCAAGAGUAGUGAAGGUUUTT (antisense); 2, GGCUCAACGAGGAAAUCGATT (sense) and UCGAUUUCCUCGUUGAGUUGC (antisense).

    Techniques: Transfection, Small Interfering RNA

    Up-regulation of genes related to Ifn- γ /Il-17 at 16 hpi. (A) The high expression of Ifn- γ and Il-17 after P. multocida infection by Illumina sequencing ( n = 3). The fold change indicated the ratio of the experimental group basemean (sample-WA average expression level) to the control group basemean (sample-WC average expression level) by Illumina sequencing. (B) The high expression of Ifn- γ and Il-17 after P. multocida infection by qRT-PCR ( n = 6, unpaired, two-tailed Student's t -test). (C) The levels of IFN-γ and IL-17 in the lungs or serum using ELISA analysis ( n = 6, unpaired, two-tailed Student's t -test). (D) The abundance of p-STAT1 Y701 and p-STAT3 Y705 in the murine lungs by immunoblotting analysis ( n = 5, unpaired, two-tailed Student's t -test). All data were expressed as means ±SEM. Because Il17 was not detected in control mice, the fold changes of Il17 in treatment mice were showed via presuming expression quantity = 1 of control mice in RNA-Seq (A) and Ct = 30 in qRT-PCR (B) , respectively. * P

    Journal: Frontiers in Cellular and Infection Microbiology

    Article Title: Transcriptomic Analysis on Responses of Murine Lungs to Pasteurella multocida Infection

    doi: 10.3389/fcimb.2017.00251

    Figure Lengend Snippet: Up-regulation of genes related to Ifn- γ /Il-17 at 16 hpi. (A) The high expression of Ifn- γ and Il-17 after P. multocida infection by Illumina sequencing ( n = 3). The fold change indicated the ratio of the experimental group basemean (sample-WA average expression level) to the control group basemean (sample-WC average expression level) by Illumina sequencing. (B) The high expression of Ifn- γ and Il-17 after P. multocida infection by qRT-PCR ( n = 6, unpaired, two-tailed Student's t -test). (C) The levels of IFN-γ and IL-17 in the lungs or serum using ELISA analysis ( n = 6, unpaired, two-tailed Student's t -test). (D) The abundance of p-STAT1 Y701 and p-STAT3 Y705 in the murine lungs by immunoblotting analysis ( n = 5, unpaired, two-tailed Student's t -test). All data were expressed as means ±SEM. Because Il17 was not detected in control mice, the fold changes of Il17 in treatment mice were showed via presuming expression quantity = 1 of control mice in RNA-Seq (A) and Ct = 30 in qRT-PCR (B) , respectively. * P

    Article Snippet: RNA isolation, cDNA library construction and illumina deep sequencing Total RNA from approximately 150 mg lung tissues (n = 3 in each group) was extracted using Trizol reagent (Invitrogen, USA) following the manufacturer's protocol.

    Techniques: Expressing, Infection, Sequencing, Quantitative RT-PCR, Two Tailed Test, Enzyme-linked Immunosorbent Assay, Mouse Assay, RNA Sequencing Assay

    Translation, methylation and transcriptome profile of GSCs and differentiated progenies. A) MeRIP-seq and RNA-seq normalized Ribo-seq peak profiles representative GSCs subtypes (mesenchymal, classical and proneural) and differentiated progenies (DGCs) (GSC, n=3; DGC, n=3). Specific sequence region shown for illustration of peaks profile across cells. B) Median translation efficiency for GSCs and differentiated progenies. Translation efficiency (TE) derived from the base-2 logarithm of the ratio of mRNA expression levels in the polysome fraction to that of total mRNA per transcript (***p

    Journal: bioRxiv

    Article Title: miRNA-mediated loss of m6A increases nascent translation in glioblastoma

    doi: 10.1101/2020.08.28.271536

    Figure Lengend Snippet: Translation, methylation and transcriptome profile of GSCs and differentiated progenies. A) MeRIP-seq and RNA-seq normalized Ribo-seq peak profiles representative GSCs subtypes (mesenchymal, classical and proneural) and differentiated progenies (DGCs) (GSC, n=3; DGC, n=3). Specific sequence region shown for illustration of peaks profile across cells. B) Median translation efficiency for GSCs and differentiated progenies. Translation efficiency (TE) derived from the base-2 logarithm of the ratio of mRNA expression levels in the polysome fraction to that of total mRNA per transcript (***p

    Article Snippet: Identification and Transcriptome-wide Profiling of m6A RNA Methylation Sitesm6A profiling of glioma stem samples before and after miRNA overexpression was performed using the Magna MeRIP™ m6A Kit according to manufacturer instructions. mRNA was isolated from glioma stem and differentiated samples using the Dynabeads® mRNA Purification Kit (Thermofisher) and subsequently fragmented with RNA Fragmentation Reagent (Ambion) prior to immunoprecipitation.

    Techniques: Methylation, RNA Sequencing Assay, Sequencing, Derivative Assay, Expressing