Structured Review

TaKaRa rnas free dnaase i
Rnas Free Dnaase I, supplied by TaKaRa, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rnas free dnaase i/product/TaKaRa
Average 91 stars, based on 1 article reviews
Price from $9.99 to $1999.99
rnas free dnaase i - by Bioz Stars, 2020-04
91/100 stars

Related Products / Commonly Used Together

upasi-16
flavonoid gene expression
rneasy plant mini kit
rna

Images

Related Articles

Reverse Transcription Polymerase Chain Reaction:

Article Title: Biochemical and molecular analysis of Camellia sinensis (L.) O. Kuntze tea from the selected P/11/15 clone
Article Snippet: .. 2.8 Analysis of flavonoid gene expression (by semi-quantitative RT-PCR) The total RNA extracted from RNeasy Plant Mini Kit (QIAGEN, USA) the segregated two leaves and an apical bud of UPASI-16 and P/11/15 were treated with RNAs- free DNAase I (TaKaRa). .. DNA free total RNA (100 ng) was used in cDNA synthesis in a reaction volume of 10 μl containing 2.5 units of AMV reverse transcriptase XL (Takara, Japan) and 1 μM of oligo -dt3sap .

Polymerase Chain Reaction:

Article Title: Biochemical and molecular analysis of Camellia sinensis (L.) O. Kuntze tea from the selected P/11/15 clone
Article Snippet: 2.8 Analysis of flavonoid gene expression (by semi-quantitative RT-PCR) The total RNA extracted from RNeasy Plant Mini Kit (QIAGEN, USA) the segregated two leaves and an apical bud of UPASI-16 and P/11/15 were treated with RNAs- free DNAase I (TaKaRa). .. The PCR reaction mixture contained 1.0 μl of template, 2.5 μl of 10× buffer, 0.5 units of Taq polymerase (Fermentas), 1.5 μl of 2.5 mM MgCl2 , 1.0 μl of 2.0 mM dNTP and 0.1 mM of 1 μl gene specific primers.

Activated Clotting Time Assay:

Article Title: Biochemical and molecular analysis of Camellia sinensis (L.) O. Kuntze tea from the selected P/11/15 clone
Article Snippet: 2.8 Analysis of flavonoid gene expression (by semi-quantitative RT-PCR) The total RNA extracted from RNeasy Plant Mini Kit (QIAGEN, USA) the segregated two leaves and an apical bud of UPASI-16 and P/11/15 were treated with RNAs- free DNAase I (TaKaRa). .. The Gene specific primers used were ANS-5′-ATG ACT ACA GTG GCT GCC CCG AGAG-3′; 5′-CTGAGCAAAAGTCCTCGGCGGGAA-3′), F35H-5′-TAGACACCCGTCTTCCTGCTTC GT-3′; 5′GCAGCATAAGCATTGGAGGCAACC-3′), F3H-5′ATGGCGCCACAACGCTTAC-3′; 5′-TCAAGCAAAAATCTCATCAGTC3′) and ANR-5′ATGGAAGCCCAACCGACAGC TC-3′; 5′-TCAATTCTTCAAAATCCCCTTAGCCT-3′).

Expressing:

Article Title: Biochemical and molecular analysis of Camellia sinensis (L.) O. Kuntze tea from the selected P/11/15 clone
Article Snippet: .. 2.8 Analysis of flavonoid gene expression (by semi-quantitative RT-PCR) The total RNA extracted from RNeasy Plant Mini Kit (QIAGEN, USA) the segregated two leaves and an apical bud of UPASI-16 and P/11/15 were treated with RNAs- free DNAase I (TaKaRa). .. DNA free total RNA (100 ng) was used in cDNA synthesis in a reaction volume of 10 μl containing 2.5 units of AMV reverse transcriptase XL (Takara, Japan) and 1 μM of oligo -dt3sap .

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    TaKaRa rnase free dnase i
    The expression and bioinformatic analysis of lamin in Sf9 cells. ( A ) The total protein was extracted from Sf9 cells, subjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), and transferred to a polyvinylidene fluoride (PVDF) membrane. The protein was detected with an anti-Dm0 monoclonal antibody, ADL67, and the bound antibody was detected with an HRP-labeled secondary antibody. The protein sizes are indicated on the right. ( B ) Total RNAs were isolated from Sf9 cells, and the RNA samples were treated with <t>RNase-free</t> DNase I. The first-strand cDNA was synthesized by reverse transcription using 2 μg total RNAs as template. The cDNA mixtures were amplified by KOD polymerase using lamin -specific primers. The approximate molecular size in bp is shown. ( C ) The predicted structure of Sf9 cell lamin. The lamins have a central coiled-coil domain (blue box) flanked by short head and long tail domains. The coiled-coil domain is flanked by cdc2 phosphorylation sites. Two NLSs were predicted in the coiled-coil domain and the tail domain. The CaaX motif is in the C-terminal. ( D ) Sf9 cells were transfected with pIZ- rfp - lamin plasmids to show the sub-cellular distribution of lamin. The nucleus was stained with Hoechst 33258 (blue) at 48 h p.t., and the lamin expression (red) was observed by fluorescence microscopy.
    Rnase Free Dnase I, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 284 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rnase free dnase i/product/TaKaRa
    Average 99 stars, based on 284 article reviews
    Price from $9.99 to $1999.99
    rnase free dnase i - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    TaKaRa dnase i
    The expression and bioinformatic analysis of lamin in Sf9 cells. ( A ) The total protein was extracted from Sf9 cells, subjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), and transferred to a polyvinylidene fluoride (PVDF) membrane. The protein was detected with an anti-Dm0 monoclonal antibody, ADL67, and the bound antibody was detected with an HRP-labeled secondary antibody. The protein sizes are indicated on the right. ( B ) Total RNAs were isolated from Sf9 cells, and the RNA samples were treated with <t>RNase-free</t> DNase I. The first-strand cDNA was synthesized by reverse transcription using 2 μg total RNAs as template. The cDNA mixtures were amplified by KOD polymerase using lamin -specific primers. The approximate molecular size in bp is shown. ( C ) The predicted structure of Sf9 cell lamin. The lamins have a central coiled-coil domain (blue box) flanked by short head and long tail domains. The coiled-coil domain is flanked by cdc2 phosphorylation sites. Two NLSs were predicted in the coiled-coil domain and the tail domain. The CaaX motif is in the C-terminal. ( D ) Sf9 cells were transfected with pIZ- rfp - lamin plasmids to show the sub-cellular distribution of lamin. The nucleus was stained with Hoechst 33258 (blue) at 48 h p.t., and the lamin expression (red) was observed by fluorescence microscopy.
    Dnase I, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 580 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dnase i/product/TaKaRa
    Average 99 stars, based on 580 article reviews
    Price from $9.99 to $1999.99
    dnase i - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results


    The expression and bioinformatic analysis of lamin in Sf9 cells. ( A ) The total protein was extracted from Sf9 cells, subjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), and transferred to a polyvinylidene fluoride (PVDF) membrane. The protein was detected with an anti-Dm0 monoclonal antibody, ADL67, and the bound antibody was detected with an HRP-labeled secondary antibody. The protein sizes are indicated on the right. ( B ) Total RNAs were isolated from Sf9 cells, and the RNA samples were treated with RNase-free DNase I. The first-strand cDNA was synthesized by reverse transcription using 2 μg total RNAs as template. The cDNA mixtures were amplified by KOD polymerase using lamin -specific primers. The approximate molecular size in bp is shown. ( C ) The predicted structure of Sf9 cell lamin. The lamins have a central coiled-coil domain (blue box) flanked by short head and long tail domains. The coiled-coil domain is flanked by cdc2 phosphorylation sites. Two NLSs were predicted in the coiled-coil domain and the tail domain. The CaaX motif is in the C-terminal. ( D ) Sf9 cells were transfected with pIZ- rfp - lamin plasmids to show the sub-cellular distribution of lamin. The nucleus was stained with Hoechst 33258 (blue) at 48 h p.t., and the lamin expression (red) was observed by fluorescence microscopy.

    Journal: Viruses

    Article Title: Cloning and Characterization of Sf9 Cell Lamin and the Lamin Conformational Changes during Autographa californica multiple nucleopolyhedrovirus Infection

    doi: 10.3390/v8050126

    Figure Lengend Snippet: The expression and bioinformatic analysis of lamin in Sf9 cells. ( A ) The total protein was extracted from Sf9 cells, subjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), and transferred to a polyvinylidene fluoride (PVDF) membrane. The protein was detected with an anti-Dm0 monoclonal antibody, ADL67, and the bound antibody was detected with an HRP-labeled secondary antibody. The protein sizes are indicated on the right. ( B ) Total RNAs were isolated from Sf9 cells, and the RNA samples were treated with RNase-free DNase I. The first-strand cDNA was synthesized by reverse transcription using 2 μg total RNAs as template. The cDNA mixtures were amplified by KOD polymerase using lamin -specific primers. The approximate molecular size in bp is shown. ( C ) The predicted structure of Sf9 cell lamin. The lamins have a central coiled-coil domain (blue box) flanked by short head and long tail domains. The coiled-coil domain is flanked by cdc2 phosphorylation sites. Two NLSs were predicted in the coiled-coil domain and the tail domain. The CaaX motif is in the C-terminal. ( D ) Sf9 cells were transfected with pIZ- rfp - lamin plasmids to show the sub-cellular distribution of lamin. The nucleus was stained with Hoechst 33258 (blue) at 48 h p.t., and the lamin expression (red) was observed by fluorescence microscopy.

    Article Snippet: The extracted RNA samples were treated with RNase-Free DNase I (TaKaRa Biotechnology Co. Ltd., Dalian, China) to remove the possible genomic DNA.

    Techniques: Expressing, Polyacrylamide Gel Electrophoresis, SDS Page, Labeling, Isolation, Synthesized, Amplification, Transfection, Staining, Fluorescence, Microscopy

    mRNA differential display. Total RNA from VSAM (V) and TSAM (T) were treated with RNase-free DNase I and analyzed by differential display using T4 and P9 primers. Amplified products were separated on 5% (w/v) denaturing polyacrylamide gels under thermostatic conditions. The arrow indicates the gene (otg7) differentially expressed in the TSAM.

    Journal: Plant Physiology

    Article Title: Identification and Characterization of Three Orchid MADS-Box Genes of the AP1/AGL9 Subfamily during Floral Transition 1

    doi:

    Figure Lengend Snippet: mRNA differential display. Total RNA from VSAM (V) and TSAM (T) were treated with RNase-free DNase I and analyzed by differential display using T4 and P9 primers. Amplified products were separated on 5% (w/v) denaturing polyacrylamide gels under thermostatic conditions. The arrow indicates the gene (otg7) differentially expressed in the TSAM.

    Article Snippet: Total RNA samples from VSAMs (6-week-old culture) and TSAMs (12-week-old culture) were treated with RNase-free DNase I (CLONTECH Laboratories) to remove residual DNA.

    Techniques: Amplification