rna pcr kit amv  (TaKaRa)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    RNA PCR Kit AMV Version 3 0
    Description:

    Catalog Number:
    rr019a
    Price:
    None
    Size:
    100 Rxns
    Category:
    cDNA synthesis kits cDNA synthesis
    Buy from Supplier


    Structured Review

    TaKaRa rna pcr kit amv
    pTT5-Act1 expression vector construction. (A) Total <t>RNA</t> extraction from Raji cells. (B) A gel extraction kit was used to purify cDNA fragments of Act1 and pTT5 following dual restriction enzyme digestion (M, Marker; 1, 2 and 3, polymerase chain reaction products of Act1). (C) Construction of the pTT5-Act1 expression vector (M, Marker; 1, 2, 3 and 5, recombinant plasmid of pTT5-Act1). (D) A positive clone of pTT5-Act1 was verified using dual digestion (M, Marker; 1 and 2, sequences of pTT5 and Act1). Act1, nuclear factor-κB Activator 1.

    https://www.bioz.com/result/rna pcr kit amv/product/TaKaRa
    Average 99 stars, based on 277 article reviews
    Price from $9.99 to $1999.99
    rna pcr kit amv - by Bioz Stars, 2020-09
    99/100 stars

    Images

    1) Product Images from "Regulatory effect of Act1 on the BAFF pathway in B-cell malignancy"

    Article Title: Regulatory effect of Act1 on the BAFF pathway in B-cell malignancy

    Journal: Oncology Letters

    doi: 10.3892/ol.2019.10047

    pTT5-Act1 expression vector construction. (A) Total RNA extraction from Raji cells. (B) A gel extraction kit was used to purify cDNA fragments of Act1 and pTT5 following dual restriction enzyme digestion (M, Marker; 1, 2 and 3, polymerase chain reaction products of Act1). (C) Construction of the pTT5-Act1 expression vector (M, Marker; 1, 2, 3 and 5, recombinant plasmid of pTT5-Act1). (D) A positive clone of pTT5-Act1 was verified using dual digestion (M, Marker; 1 and 2, sequences of pTT5 and Act1). Act1, nuclear factor-κB Activator 1.
    Figure Legend Snippet: pTT5-Act1 expression vector construction. (A) Total RNA extraction from Raji cells. (B) A gel extraction kit was used to purify cDNA fragments of Act1 and pTT5 following dual restriction enzyme digestion (M, Marker; 1, 2 and 3, polymerase chain reaction products of Act1). (C) Construction of the pTT5-Act1 expression vector (M, Marker; 1, 2, 3 and 5, recombinant plasmid of pTT5-Act1). (D) A positive clone of pTT5-Act1 was verified using dual digestion (M, Marker; 1 and 2, sequences of pTT5 and Act1). Act1, nuclear factor-κB Activator 1.

    Techniques Used: Expressing, Plasmid Preparation, RNA Extraction, Gel Extraction, Marker, Polymerase Chain Reaction, Recombinant

    2) Product Images from "Modeling Sj?gren's Syndrome with Id3 Conditional Knockout Mice"

    Article Title: Modeling Sj?gren's Syndrome with Id3 Conditional Knockout Mice

    Journal: Immunology letters

    doi: 10.1016/j.imlet.2010.09.009

    Conditional deletion of the Id3 gene in developing thymocytes (A) Generation of the Id3 conditional deletion allele. Open box: exon. Hatch box: selection markers. Solid arrowhead: loxP. Open arrowhead: FRT. Arrows: primers. (B) Representative genotyping results of the Id3 f allele. DNA samples were prepared from mouse toes. 4 primers were used: Id3-2 and Id3-3 for the loxP (1.25 kb) and the wild type (1.15 kb) Id3 allele, Tek-F and Tek-R for the LckCre transgene (0.48 kb). M: 1 kb plus DNA ladder. (C) Deletion of Id3 in thymocytes sorted from 7-week-old mice. Thymocytes were separated into the DN (CD4 − CD8 − ) and DP/SP (CD4 + CD8 + , CD4 + CD8 − , and CD4 − CD8 + ) groups by magnetic beads. For the upper panel, the floxed and deletion alleles were determined by competitive PCR using three primers, Id3-2, Id3ckoF and Id3ckoB shown in (A). It produced a 1.07-kb band for the Id3 f allele and a 1.34-kb band for the deleted allele. For the bottom panel, only two primers (Id3ckoF and Id3ckoB) were used to detect the floxed allele. (D) Real-time quantitative PCR analysis of Id3 expression. RNA was prepared from total thymocytes of 7-week old Id3 f/f (open bar, n=4) and Id3 f/f ;LckCre (filled bar, n=3) mice. **P=0.006. The graphed results are means with SEM.
    Figure Legend Snippet: Conditional deletion of the Id3 gene in developing thymocytes (A) Generation of the Id3 conditional deletion allele. Open box: exon. Hatch box: selection markers. Solid arrowhead: loxP. Open arrowhead: FRT. Arrows: primers. (B) Representative genotyping results of the Id3 f allele. DNA samples were prepared from mouse toes. 4 primers were used: Id3-2 and Id3-3 for the loxP (1.25 kb) and the wild type (1.15 kb) Id3 allele, Tek-F and Tek-R for the LckCre transgene (0.48 kb). M: 1 kb plus DNA ladder. (C) Deletion of Id3 in thymocytes sorted from 7-week-old mice. Thymocytes were separated into the DN (CD4 − CD8 − ) and DP/SP (CD4 + CD8 + , CD4 + CD8 − , and CD4 − CD8 + ) groups by magnetic beads. For the upper panel, the floxed and deletion alleles were determined by competitive PCR using three primers, Id3-2, Id3ckoF and Id3ckoB shown in (A). It produced a 1.07-kb band for the Id3 f allele and a 1.34-kb band for the deleted allele. For the bottom panel, only two primers (Id3ckoF and Id3ckoB) were used to detect the floxed allele. (D) Real-time quantitative PCR analysis of Id3 expression. RNA was prepared from total thymocytes of 7-week old Id3 f/f (open bar, n=4) and Id3 f/f ;LckCre (filled bar, n=3) mice. **P=0.006. The graphed results are means with SEM.

    Techniques Used: Selection, Mouse Assay, Magnetic Beads, Polymerase Chain Reaction, Produced, Real-time Polymerase Chain Reaction, Expressing

    3) Product Images from "Localization of Eimeripain, an Eimeria tenellaCathepsin B-Like Cysteine Protease, during Asexual and Sexual Intracellular Development in Chicken Ceca"

    Article Title: Localization of Eimeripain, an Eimeria tenellaCathepsin B-Like Cysteine Protease, during Asexual and Sexual Intracellular Development in Chicken Ceca

    Journal: The Journal of Veterinary Medical Science

    doi: 10.1292/jvms.13-0509

    Expression of eimeripain genes during the developmental stages of E. tenella . Detection of eimeripain (499 bp) (A) and E. tenella actin (350 bp) (B) specific RNA. L; DNA marker, 1; RNA from unsporulated oocysts, 2; from oocysts sporulated at 48 hr, 3; from oocysts sporulated at 144 hr, 4; from purified sporozoites, 5; from purified schizonts, 6; from purified merozoites, 7 and 8; from chicken cells separated on a 30%, and 50% Percoll layer using uninfected chicken ceca, respectively, 9; only PCR buffer, 10; genomic DNA from sporulated oocysts.
    Figure Legend Snippet: Expression of eimeripain genes during the developmental stages of E. tenella . Detection of eimeripain (499 bp) (A) and E. tenella actin (350 bp) (B) specific RNA. L; DNA marker, 1; RNA from unsporulated oocysts, 2; from oocysts sporulated at 48 hr, 3; from oocysts sporulated at 144 hr, 4; from purified sporozoites, 5; from purified schizonts, 6; from purified merozoites, 7 and 8; from chicken cells separated on a 30%, and 50% Percoll layer using uninfected chicken ceca, respectively, 9; only PCR buffer, 10; genomic DNA from sporulated oocysts.

    Techniques Used: Expressing, Marker, Purification, Polymerase Chain Reaction

    4) Product Images from "Expression of mRNA for the t;chcomplex polypeptide-1, a subunit of chaperonin CCT, is upregulated in association with increased cold hardiness in Delia antiqua"

    Article Title: Expression of mRNA for the t;chcomplex polypeptide-1, a subunit of chaperonin CCT, is upregulated in association with increased cold hardiness in Delia antiqua

    Journal:

    doi: 10.1379/CSC-106R.1

    Quantitative real-time PCR analysis of DaTCP -1 messenger RNA (mRNA) levels. The levels of DaTCP -1 mRNA were normalized to those of the internal standard, 18S ribosomal RNA (3 replicates). DaTCP -1 mRNA levels in cold-acclimated nondiapause pupae
    Figure Legend Snippet: Quantitative real-time PCR analysis of DaTCP -1 messenger RNA (mRNA) levels. The levels of DaTCP -1 mRNA were normalized to those of the internal standard, 18S ribosomal RNA (3 replicates). DaTCP -1 mRNA levels in cold-acclimated nondiapause pupae

    Techniques Used: Real-time Polymerase Chain Reaction

    5) Product Images from "Conditioned medium from gerbil—mouse T cell heterohybridomas improved antibody secretion"

    Article Title: Conditioned medium from gerbil—mouse T cell heterohybridomas improved antibody secretion

    Journal: Experimental Animals

    doi: 10.1538/expanim.14-0078

    Expression of gerbil IGHC mRNAs by B11D2(C2) cells. Total RNA was extracted from gerbil spleen (SP; lane 1), B11D2(C2) with no stimulation (lane 2), B11D2(C2) after 4 h culture in 20% D9(E6)C2B3-CM (lane 3), or after 12 h in 20% D9(E6)C2B3-CM (lane 4). RT-PCR products were electrophoresed and stained with ethidium bromide.
    Figure Legend Snippet: Expression of gerbil IGHC mRNAs by B11D2(C2) cells. Total RNA was extracted from gerbil spleen (SP; lane 1), B11D2(C2) with no stimulation (lane 2), B11D2(C2) after 4 h culture in 20% D9(E6)C2B3-CM (lane 3), or after 12 h in 20% D9(E6)C2B3-CM (lane 4). RT-PCR products were electrophoresed and stained with ethidium bromide.

    Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction, Staining

    Expression of gerbil CD3G and cytokine mRNAs in gerbil–mouse heterohybridomas D9(E4) and D9(E6)C2B3. Total RNA was extracted from gerbil spleen (lane 1), mouse myeloma P3-X63-Ag8.653 (lane 2), D9(E4) (lane 3), and D9(E6)C2B3 (lane 4). RT-PCR products were electrophoresed and stained with ethidium bromide.
    Figure Legend Snippet: Expression of gerbil CD3G and cytokine mRNAs in gerbil–mouse heterohybridomas D9(E4) and D9(E6)C2B3. Total RNA was extracted from gerbil spleen (lane 1), mouse myeloma P3-X63-Ag8.653 (lane 2), D9(E4) (lane 3), and D9(E6)C2B3 (lane 4). RT-PCR products were electrophoresed and stained with ethidium bromide.

    Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction, Staining

    6) Product Images from "A novel antimicrobial protein for plant protection consisting of a Xanthomonas oryzae harpin and active domains of cecropin A and melittin"

    Article Title: A novel antimicrobial protein for plant protection consisting of a Xanthomonas oryzae harpin and active domains of cecropin A and melittin

    Journal: Microbial biotechnology

    doi: 10.1111/j.1751-7915.2011.00281.x

    In vitro assays of chimeric proteins for antimicrobial activity against X. oryzae pv. oryzicola and for HR induction in N. tabacum cv. Xanthi nn. A. Antimicrobial activity of Hpa1, Pep1, Pep2, Pep3, Pep4 and Hcm1 against rice pathogen X. oryzae pv. oryzicola RS105. Three microlitres of CFEPs of chimeric proteins at approximately 0.1 µM, extracted from the E. coli expression strains containing hpa1 , pep1 , pep2 , pep3 , pep4 and hcm1 genes ( Table 1 ), respectively, was added to sterile filter paper discs (0.5 cm diameter), which had been laid on NA plates where 100 µl of X. oryzae pv. oryzicola RS105 at approximately 1 × 10 6 cfu ml −1 had been spread previously. After 2 days incubation at 28°C, antimicrobial haloes around the discs were recorded. Kanamycin at 10 µg ml −1 and PBS buffer were used as the positive and negative controls respectively. B. Response of tobacco to the chimeric proteins. The CFEPs of Pep1, Pep2, Pep3, Pep4 and Hcm1 at 0.1 µM were infiltrated via needleless syringe into fully expanded leaves of N. tabacum cv. Xanthi nn. The HR response was photographed 48 h after infiltration. The CFEP of Hpa1 at 0.1 µM and PBS buffer were used as positive and negative controls respectively. C. HR marker gene expression was explored by reverse transcription polymerase chain reaction (RT‐PCR). Tobacco leaves, infiltrated by the HR‐elicitor Hpa1, the chimeric protein Hcm1 (both at 0.1 µM), or PBS buffer, were collected 8 h post infiltration. The same amount of RNA extracted from each sample was used to make cDNA using a TaKaRa RNA PCR Kit (AMV ver. 3.0; TaKaRa). PCR amplifications with Taq polymerase were performed using the obtained cDNAs as templates with paired primers ( Table 2 ) of the HR marker genes, HIN1, HSR203J and PR1‐a ( Takahashi et al ., 2004 ), in tobacco. The obtained PCR products were analysed in 1.2% agarose gels. The EF1a gene was used as the internal control to verify the absence of significant variation at the cDNA level in the samples. The above experiments were replicated three times. The results presented are from a representative experiment and similar results were obtained in all other independent experiments.
    Figure Legend Snippet: In vitro assays of chimeric proteins for antimicrobial activity against X. oryzae pv. oryzicola and for HR induction in N. tabacum cv. Xanthi nn. A. Antimicrobial activity of Hpa1, Pep1, Pep2, Pep3, Pep4 and Hcm1 against rice pathogen X. oryzae pv. oryzicola RS105. Three microlitres of CFEPs of chimeric proteins at approximately 0.1 µM, extracted from the E. coli expression strains containing hpa1 , pep1 , pep2 , pep3 , pep4 and hcm1 genes ( Table 1 ), respectively, was added to sterile filter paper discs (0.5 cm diameter), which had been laid on NA plates where 100 µl of X. oryzae pv. oryzicola RS105 at approximately 1 × 10 6 cfu ml −1 had been spread previously. After 2 days incubation at 28°C, antimicrobial haloes around the discs were recorded. Kanamycin at 10 µg ml −1 and PBS buffer were used as the positive and negative controls respectively. B. Response of tobacco to the chimeric proteins. The CFEPs of Pep1, Pep2, Pep3, Pep4 and Hcm1 at 0.1 µM were infiltrated via needleless syringe into fully expanded leaves of N. tabacum cv. Xanthi nn. The HR response was photographed 48 h after infiltration. The CFEP of Hpa1 at 0.1 µM and PBS buffer were used as positive and negative controls respectively. C. HR marker gene expression was explored by reverse transcription polymerase chain reaction (RT‐PCR). Tobacco leaves, infiltrated by the HR‐elicitor Hpa1, the chimeric protein Hcm1 (both at 0.1 µM), or PBS buffer, were collected 8 h post infiltration. The same amount of RNA extracted from each sample was used to make cDNA using a TaKaRa RNA PCR Kit (AMV ver. 3.0; TaKaRa). PCR amplifications with Taq polymerase were performed using the obtained cDNAs as templates with paired primers ( Table 2 ) of the HR marker genes, HIN1, HSR203J and PR1‐a ( Takahashi et al ., 2004 ), in tobacco. The obtained PCR products were analysed in 1.2% agarose gels. The EF1a gene was used as the internal control to verify the absence of significant variation at the cDNA level in the samples. The above experiments were replicated three times. The results presented are from a representative experiment and similar results were obtained in all other independent experiments.

    Techniques Used: In Vitro, Activity Assay, Expressing, Incubation, Marker, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction

    7) Product Images from "Adenovirus vector-mediated assay system for hepatitis C virus replication"

    Article Title: Adenovirus vector-mediated assay system for hepatitis C virus replication

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkr047

    Preparation of Ad vector to monitor HCV replication. ( A ) Construct of Ad vector. The Ad vector contained the chimeric RNA pol I promoter (P I 235) and the HCV replicon to monitor HCV replication as the luciferase expression. ( B ) Expression of HCV NS5A protein in Huh7 cells transfected with AdP I 235-HCV. The cells were transfected with AdP I 235-HCV (10 MOI) and Ad-tTA (50 MOI). After 72 h of incubation, the cells were harvested, and the lysates (30 µg) were subjected to SDS–PAGE, followed by immunoblotting with antibody against NS5A. Huh7 cells and Huh7.5.1 1bFeo cells were used as the negative and positive controls, respectively. Lane 1, Huh7 cells; lane 2, Huh7 cells infected with AdP I 235-HCV; lane 3, Huh7.5.1 1bFeo cells. ( C ) Expression of luciferase in the Ad vector-transfected cells. Huh7 cells were co-infected with AdP I 235-HCV (10 MOI) and 0 or 50 MOI of Ad-tTA. After an additional 48 h of incubation, the luciferase activity was measured. Data represent the mean ± SD ( n = 3). ( D ) Involvement of NS5B in expression of luciferase in the Ad vector-transfected cells. Huh7 cells were infected with AdP I 235-HCV or AdP I 235-ΔGDD (3 MOI) and Ad-tTA (15 MOI). After 24 h, the cells were treated with 10 µg/ml of Dox for 48 h. Then, the luciferase activity was measured. Data represent the mean ± SD ( n = 3). ( E ) Expression of minus-stranded HCV RNA in the Ad vector-transfected cells. Huh7 cells were co-infected with AdP I 235-HCV or AdP I 235-ΔGDD at 3 MOI and Ad-tTA at 15 MOI. After 24 h, the cells were treated with 10 µg/ml of Dox for 48 h. Then RT-PCR analysis was performed for detection of minus-stranded HCV NS3 and GAPDH. The PCR products were separated on 2% agarose gel. Huh7 cells and Huh7.5.1 1bFeo cells were used as the negative and positive controls, respectively. Lane 1, Huh7 cells; lane 2, Huh7.5.1 1bFeo cells; lane 3, Huh7 cells infected with AdP I 235-ΔGDD; lane 4, Huh7 cells infected with AdP I 235-HCV. ( F and G ) Effect of IFN on the replication of HCV replicon. Huh7 cells were infected with AdP I 235-HCV (10 MOI) and Ad-rtTA (50 MOI). After 1.5 h of infection, the cells were treated with IFN at the indicated concentration for 72 h. Then, the luciferase activity (F) and the cell viability (G) were measured. Data represent the percentage of vehicle-treated cells. Data are the mean ± SD ( n = 3).
    Figure Legend Snippet: Preparation of Ad vector to monitor HCV replication. ( A ) Construct of Ad vector. The Ad vector contained the chimeric RNA pol I promoter (P I 235) and the HCV replicon to monitor HCV replication as the luciferase expression. ( B ) Expression of HCV NS5A protein in Huh7 cells transfected with AdP I 235-HCV. The cells were transfected with AdP I 235-HCV (10 MOI) and Ad-tTA (50 MOI). After 72 h of incubation, the cells were harvested, and the lysates (30 µg) were subjected to SDS–PAGE, followed by immunoblotting with antibody against NS5A. Huh7 cells and Huh7.5.1 1bFeo cells were used as the negative and positive controls, respectively. Lane 1, Huh7 cells; lane 2, Huh7 cells infected with AdP I 235-HCV; lane 3, Huh7.5.1 1bFeo cells. ( C ) Expression of luciferase in the Ad vector-transfected cells. Huh7 cells were co-infected with AdP I 235-HCV (10 MOI) and 0 or 50 MOI of Ad-tTA. After an additional 48 h of incubation, the luciferase activity was measured. Data represent the mean ± SD ( n = 3). ( D ) Involvement of NS5B in expression of luciferase in the Ad vector-transfected cells. Huh7 cells were infected with AdP I 235-HCV or AdP I 235-ΔGDD (3 MOI) and Ad-tTA (15 MOI). After 24 h, the cells were treated with 10 µg/ml of Dox for 48 h. Then, the luciferase activity was measured. Data represent the mean ± SD ( n = 3). ( E ) Expression of minus-stranded HCV RNA in the Ad vector-transfected cells. Huh7 cells were co-infected with AdP I 235-HCV or AdP I 235-ΔGDD at 3 MOI and Ad-tTA at 15 MOI. After 24 h, the cells were treated with 10 µg/ml of Dox for 48 h. Then RT-PCR analysis was performed for detection of minus-stranded HCV NS3 and GAPDH. The PCR products were separated on 2% agarose gel. Huh7 cells and Huh7.5.1 1bFeo cells were used as the negative and positive controls, respectively. Lane 1, Huh7 cells; lane 2, Huh7.5.1 1bFeo cells; lane 3, Huh7 cells infected with AdP I 235-ΔGDD; lane 4, Huh7 cells infected with AdP I 235-HCV. ( F and G ) Effect of IFN on the replication of HCV replicon. Huh7 cells were infected with AdP I 235-HCV (10 MOI) and Ad-rtTA (50 MOI). After 1.5 h of infection, the cells were treated with IFN at the indicated concentration for 72 h. Then, the luciferase activity (F) and the cell viability (G) were measured. Data represent the percentage of vehicle-treated cells. Data are the mean ± SD ( n = 3).

    Techniques Used: Plasmid Preparation, Construct, Luciferase, Expressing, Transfection, Incubation, SDS Page, Infection, Activity Assay, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Concentration Assay

    8) Product Images from "Development of one-step SYBR Green real-time RT-PCR for quantifying bovine viral diarrhea virus type-1 and its comparison with conventional RT-PCR"

    Article Title: Development of one-step SYBR Green real-time RT-PCR for quantifying bovine viral diarrhea virus type-1 and its comparison with conventional RT-PCR

    Journal: Virology Journal

    doi: 10.1186/1743-422X-8-374

    BVDV RNA melting curves (a) and BVDV RNA standard curve (b) . (a) BVDV RNA melting curves showing 10-fold serial dilutions of standard RNA from 10 7 to 10 2 copies/ml amplified by SYBR Green RT-PCR on Bio-Rad iQ5 Multicolor Real-Time PCR Detection System. (b) BVDV RNA standard curve produced by SYBR Green RT-PCR on Bio-Rad iQ5 Multicolor Real-Time PCR Detection System using 10-fold serial dilutions of standard RNA transcribed in vitro as standard templates.
    Figure Legend Snippet: BVDV RNA melting curves (a) and BVDV RNA standard curve (b) . (a) BVDV RNA melting curves showing 10-fold serial dilutions of standard RNA from 10 7 to 10 2 copies/ml amplified by SYBR Green RT-PCR on Bio-Rad iQ5 Multicolor Real-Time PCR Detection System. (b) BVDV RNA standard curve produced by SYBR Green RT-PCR on Bio-Rad iQ5 Multicolor Real-Time PCR Detection System using 10-fold serial dilutions of standard RNA transcribed in vitro as standard templates.

    Techniques Used: Amplification, SYBR Green Assay, Reverse Transcription Polymerase Chain Reaction, Real-time Polymerase Chain Reaction, Produced, In Vitro

    Agarose gel electrophoresis of cDNA template (a) and cRNA standard (b) . (a) 1% agarose gel electrophoresis of cDNA template synthesized by RT-PCR. Complementary DNA (cDNA) template with a length of 201 bp synthesized using viral RNA as template by reverse-transcriptase and subsequently amplified by PCR. Marker: 100 bp DNA Ladders. (b) 3% agarose gel electrophoresis of cRNA standard. Complementary RNA (cRNA) standard with a length of 184 b synthesized using the amplified cDNA as a template by in vitro transcription. Marker: RNA Marker RL1,000.
    Figure Legend Snippet: Agarose gel electrophoresis of cDNA template (a) and cRNA standard (b) . (a) 1% agarose gel electrophoresis of cDNA template synthesized by RT-PCR. Complementary DNA (cDNA) template with a length of 201 bp synthesized using viral RNA as template by reverse-transcriptase and subsequently amplified by PCR. Marker: 100 bp DNA Ladders. (b) 3% agarose gel electrophoresis of cRNA standard. Complementary RNA (cRNA) standard with a length of 184 b synthesized using the amplified cDNA as a template by in vitro transcription. Marker: RNA Marker RL1,000.

    Techniques Used: Agarose Gel Electrophoresis, Synthesized, Reverse Transcription Polymerase Chain Reaction, Amplification, Polymerase Chain Reaction, Marker, In Vitro

    Melting peaks analysis on the PCR products of SYBR Green RT-PCR on Bio-Rad iQ5 Multicolor Real-Time PCR Detection System . (a) Melting peaks of PCR product from cRNA standards. (b) Melting peaks of PCR product from BVDV RNA of 10-fold serial dilutions of titrated virus.
    Figure Legend Snippet: Melting peaks analysis on the PCR products of SYBR Green RT-PCR on Bio-Rad iQ5 Multicolor Real-Time PCR Detection System . (a) Melting peaks of PCR product from cRNA standards. (b) Melting peaks of PCR product from BVDV RNA of 10-fold serial dilutions of titrated virus.

    Techniques Used: Polymerase Chain Reaction, SYBR Green Assay, Reverse Transcription Polymerase Chain Reaction, Real-time Polymerase Chain Reaction

    Comparison of one-step SYBR Green I RT-PCR with conventional RT-PCR for dectecting BVDV RNA of titrated viruses at 10-fold serial dilutions . (a) 2.5% agarose gel electrophoresis of the amplified products with a length of 84 bp obtained by one-step SYBR Green I RT-PCR. Marker: 50 bp DNA Marker, Lane 1: 100 TCID 50 , Lane 2: 10 TCID 50 , Lane 3: 1 TCID 50 , Lane 4: 10 -1 TCID 50 , Lane 5: 10 -2 TCID 50 , Lane 6: 10 -3 TCID 50 , Lane 7: 10 -4 TCID 50 , Lane 8: 10 -5 TCID 50 . (b) 2.5% agarose gel electrophoresis of the amplified products with a length of 84 bp obtained by conventional RT-PCR. Marker: DNA Marker DL 500, lane 1: 100 TCID 50 , lane 2: 10 TCID 50 , lane 3: 1 TCID 50 , lane 4: 10 -1 TCID 50 , lane 5: 10 -2 TCID 50 , lane 6: 10 -3 TCID 50 , lane 7: 10 -4 TCID 50 , lane 8: 10 -5 TCID 50 .
    Figure Legend Snippet: Comparison of one-step SYBR Green I RT-PCR with conventional RT-PCR for dectecting BVDV RNA of titrated viruses at 10-fold serial dilutions . (a) 2.5% agarose gel electrophoresis of the amplified products with a length of 84 bp obtained by one-step SYBR Green I RT-PCR. Marker: 50 bp DNA Marker, Lane 1: 100 TCID 50 , Lane 2: 10 TCID 50 , Lane 3: 1 TCID 50 , Lane 4: 10 -1 TCID 50 , Lane 5: 10 -2 TCID 50 , Lane 6: 10 -3 TCID 50 , Lane 7: 10 -4 TCID 50 , Lane 8: 10 -5 TCID 50 . (b) 2.5% agarose gel electrophoresis of the amplified products with a length of 84 bp obtained by conventional RT-PCR. Marker: DNA Marker DL 500, lane 1: 100 TCID 50 , lane 2: 10 TCID 50 , lane 3: 1 TCID 50 , lane 4: 10 -1 TCID 50 , lane 5: 10 -2 TCID 50 , lane 6: 10 -3 TCID 50 , lane 7: 10 -4 TCID 50 , lane 8: 10 -5 TCID 50 .

    Techniques Used: SYBR Green Assay, Reverse Transcription Polymerase Chain Reaction, Agarose Gel Electrophoresis, Amplification, Marker

    9) Product Images from "Expression, Purification, and Characterization of Cu/ZnSOD from Panax Ginseng"

    Article Title: Expression, Purification, and Characterization of Cu/ZnSOD from Panax Ginseng

    Journal: Molecules

    doi: 10.3390/molecules19068112

    Nucleic acid electrophoresis analysis of the RNA and PCR products. ( a ) Line A, the total RNA of ginseng, 28S/18S was 2.5. Line M, DL2000 Marker; ( b ) Line B, RT-PCR products of ginseng Cu/ZnSOD, the 459 bp band was present. Line M, DL2000 Marker.
    Figure Legend Snippet: Nucleic acid electrophoresis analysis of the RNA and PCR products. ( a ) Line A, the total RNA of ginseng, 28S/18S was 2.5. Line M, DL2000 Marker; ( b ) Line B, RT-PCR products of ginseng Cu/ZnSOD, the 459 bp band was present. Line M, DL2000 Marker.

    Techniques Used: Nucleic Acid Electrophoresis, Polymerase Chain Reaction, Marker, Reverse Transcription Polymerase Chain Reaction

    10) Product Images from "Keratinocyte growth factor induces matrix metalloproteinase-9 expression and correlates with venous invasion in pancreatic cancer"

    Article Title: Keratinocyte growth factor induces matrix metalloproteinase-9 expression and correlates with venous invasion in pancreatic cancer

    Journal: International Journal of Oncology

    doi: 10.3892/ijo.2011.1280

    qRT-PCR analysis of MMP-9 in pancreatic cancer cells. Total RNA was extracted from eight pancreatic cancer cell lines and qRT-PCR was performed. MMP-9 mRNA was expressed in all the cancer cell lines at varying levels, and the expression levels had the highest measurements in Capan-1.
    Figure Legend Snippet: qRT-PCR analysis of MMP-9 in pancreatic cancer cells. Total RNA was extracted from eight pancreatic cancer cell lines and qRT-PCR was performed. MMP-9 mRNA was expressed in all the cancer cell lines at varying levels, and the expression levels had the highest measurements in Capan-1.

    Techniques Used: Quantitative RT-PCR, Expressing

    11) Product Images from "Rapid Construction of Stable Infectious Full-Length cDNA Clone of Papaya Leaf Distortion Mosaic Virus Using In-Fusion Cloning"

    Article Title: Rapid Construction of Stable Infectious Full-Length cDNA Clone of Papaya Leaf Distortion Mosaic Virus Using In-Fusion Cloning

    Journal: Viruses

    doi: 10.3390/v7122935

    Symptoms and PLDMV detection in papaya plants inoculated with pT7-PLDMV and pT7-PLDMV-In2 transcripts. ( A ) Systemically infected leaves showed typical mosaic on leaves at 20 dpi, and developed severe distortion on leaves similar to those caused by the wild-type PLDMV at 40 and 60 dpi, while plants inoculated with pT7-PLDMV-1 transcripts containing one non-sense- or pT7-PLDMV-4-containing deletion mutation showed no symptoms; ( B ) Accumulation of PLDMV in the upper non-inoculated leaves of 10 papaya plants inoculated with pT7-PLDMV-1, pT7-PLDMV-4, or pT7-PLDMV-In2 transcripts at various times post-inoculation by ID-ELISA. The positive controls were inoculated with papaya sap known to be infected with PLDMV (wt PLDMV); negative controls were inoculated with inoculation buffer; ( C ) Detection of PLDMV RNA in systemically infected leaves and identification of the splicing of intron 2 from the progeny viruses from the pT7-PLDMV-In2-inoculated plants at 60 dpi by RT-PCR. Lane M: DNA Marker; 1: RT-PCR products from a papaya plant inoculated with wild-type PLDMV; 2–7: RT-PCR products from seven papaya plants inoculated with pT7-PLDMV-In2 transcripts; 8: RT-PCR products from a papaya plant inoculated with inoculation buffer; 9: PCR fragment amplified from pT7-PLDMV-In2 plasmid.
    Figure Legend Snippet: Symptoms and PLDMV detection in papaya plants inoculated with pT7-PLDMV and pT7-PLDMV-In2 transcripts. ( A ) Systemically infected leaves showed typical mosaic on leaves at 20 dpi, and developed severe distortion on leaves similar to those caused by the wild-type PLDMV at 40 and 60 dpi, while plants inoculated with pT7-PLDMV-1 transcripts containing one non-sense- or pT7-PLDMV-4-containing deletion mutation showed no symptoms; ( B ) Accumulation of PLDMV in the upper non-inoculated leaves of 10 papaya plants inoculated with pT7-PLDMV-1, pT7-PLDMV-4, or pT7-PLDMV-In2 transcripts at various times post-inoculation by ID-ELISA. The positive controls were inoculated with papaya sap known to be infected with PLDMV (wt PLDMV); negative controls were inoculated with inoculation buffer; ( C ) Detection of PLDMV RNA in systemically infected leaves and identification of the splicing of intron 2 from the progeny viruses from the pT7-PLDMV-In2-inoculated plants at 60 dpi by RT-PCR. Lane M: DNA Marker; 1: RT-PCR products from a papaya plant inoculated with wild-type PLDMV; 2–7: RT-PCR products from seven papaya plants inoculated with pT7-PLDMV-In2 transcripts; 8: RT-PCR products from a papaya plant inoculated with inoculation buffer; 9: PCR fragment amplified from pT7-PLDMV-In2 plasmid.

    Techniques Used: Infection, Mutagenesis, Enzyme-linked Immunosorbent Assay, Reverse Transcription Polymerase Chain Reaction, Marker, Polymerase Chain Reaction, Amplification, Plasmid Preparation

    12) Product Images from "Liposome mediated double-stranded RNA delivery to silence ribosomal protein P0 in the tick Rhipicephalus haemaphysaloides"

    Article Title: Liposome mediated double-stranded RNA delivery to silence ribosomal protein P0 in the tick Rhipicephalus haemaphysaloides

    Journal: Ticks and Tick-Borne Diseases

    doi: 10.1016/j.ttbdis.2018.01.015

    Effects of dsRNA concentrations on gene silencing. R. haemaphysaloides ticks were soaked in different concentrations of P0 dsRNA (0.5, 1 and 2 μg/μl) in Lipofectamine 2000 for 24 h. Then, ticks were washed and rested for 5 d before extracting RNA for real-time PCR analysis. The relative expression of P0 gene was calculated using the tick elongation factor-1α as the reference gene and the ticks soaked in Lipofectamine 2000 solution without P0 dsRNA as the control. Significant differences between the different groups are marked with two asterisks (p
    Figure Legend Snippet: Effects of dsRNA concentrations on gene silencing. R. haemaphysaloides ticks were soaked in different concentrations of P0 dsRNA (0.5, 1 and 2 μg/μl) in Lipofectamine 2000 for 24 h. Then, ticks were washed and rested for 5 d before extracting RNA for real-time PCR analysis. The relative expression of P0 gene was calculated using the tick elongation factor-1α as the reference gene and the ticks soaked in Lipofectamine 2000 solution without P0 dsRNA as the control. Significant differences between the different groups are marked with two asterisks (p

    Techniques Used: Real-time Polymerase Chain Reaction, Expressing

    P0 gene silencing via dsRNA by soaking with different liposomes and water. R. haemaphysaloides ticks were soaked for 24 h by setting a tube on a vertical rotating device at room temperature. After soaking, ticks were rinsed in distilled water and dried on paper towels. They were then allowed to rest for 5 d before RNA was extracted for real-time PCR analysis. Each test was repeated three times. Relative expression of P0 against the tick elongation factor-1α was calculated using the ticks soaked in water without P0 dsRNA as the control. Significant differences between different groups are marked with asterisks (p
    Figure Legend Snippet: P0 gene silencing via dsRNA by soaking with different liposomes and water. R. haemaphysaloides ticks were soaked for 24 h by setting a tube on a vertical rotating device at room temperature. After soaking, ticks were rinsed in distilled water and dried on paper towels. They were then allowed to rest for 5 d before RNA was extracted for real-time PCR analysis. Each test was repeated three times. Relative expression of P0 against the tick elongation factor-1α was calculated using the ticks soaked in water without P0 dsRNA as the control. Significant differences between different groups are marked with asterisks (p

    Techniques Used: Real-time Polymerase Chain Reaction, Expressing

    13) Product Images from "Knockdown of FRAT1 Expression by RNA Interference Inhibits Human Glioblastoma Cell Growth, Migration and Invasion"

    Article Title: Knockdown of FRAT1 Expression by RNA Interference Inhibits Human Glioblastoma Cell Growth, Migration and Invasion

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0061206

    RNA interference reduced the expression of FRAT1 in U251 cells. Down-regulation of FRAT1 mRNA and protein expression in U251-S cells as compared to the parental U251, U251-NC, and U251-neo control cell lines was confirmed by RT-PCR and Western blot (WB). GAPDH was amplified as an internal control for the RT-PCR, and β-actin levels were examined as a loading control for the Western blot. 1: parental U251 cells; 2: U251-NC; 3: U251-neo; 4: U251-S.
    Figure Legend Snippet: RNA interference reduced the expression of FRAT1 in U251 cells. Down-regulation of FRAT1 mRNA and protein expression in U251-S cells as compared to the parental U251, U251-NC, and U251-neo control cell lines was confirmed by RT-PCR and Western blot (WB). GAPDH was amplified as an internal control for the RT-PCR, and β-actin levels were examined as a loading control for the Western blot. 1: parental U251 cells; 2: U251-NC; 3: U251-neo; 4: U251-S.

    Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction, Western Blot, Amplification

    14) Product Images from "Evaluation of the yield of abiotic-stress-tolerant AtDREB1A transgenic potato under saline conditions in advance of field trials"

    Article Title: Evaluation of the yield of abiotic-stress-tolerant AtDREB1A transgenic potato under saline conditions in advance of field trials

    Journal: Breeding Science

    doi: 10.1270/jsbbs.16054

    Expression profiles of the AtDREB1A gene. Expression profiles of the AtDREB1A gene (upper panel), with ubiquitin as an internal control (lower panel), detected with RT-PCR. Total RNA was extracted from the leaves of non-transgenic potato (NT) and two transgenic lines (D163 and D164) under non-saline and salinity stress conditions (100 and 150 mM NaCl), both before and one week after the start of cultivation in the special netted-house.
    Figure Legend Snippet: Expression profiles of the AtDREB1A gene. Expression profiles of the AtDREB1A gene (upper panel), with ubiquitin as an internal control (lower panel), detected with RT-PCR. Total RNA was extracted from the leaves of non-transgenic potato (NT) and two transgenic lines (D163 and D164) under non-saline and salinity stress conditions (100 and 150 mM NaCl), both before and one week after the start of cultivation in the special netted-house.

    Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction, Transgenic Assay

    Screening of transgenic lines in a growth room. To identify transgenic lines with the same growth parameters as those of the non-transgenic (NT) plants, six transgenic lines (D19, D22, D103, D138, D163 and D164) along with non-transgenic lines were kept in a growth room under non-saline conditions for 30 days. (A) Representative features of each potato line 30 days after the start of cultivation in the growth room. Scale bar represents 5 cm. Lines selected for further study are indicated with an asterisk. (B) The average shoot length of each potato line 30 days after the start of cultivation. Bars represent the means ± SE of three replications. Double asterisks indicate significant differences from non-transgenic potato at the 1% level by Tukey’s test. (C) Expression level of the AtDREB1A gene. Total RNA was extracted from leaves of transgenic and non-transgenic potato plants 30 days after the start of cultivation in the growth room. The expression level was evaluated by real-time PCR. Bars represent the means ± SE of three replications.
    Figure Legend Snippet: Screening of transgenic lines in a growth room. To identify transgenic lines with the same growth parameters as those of the non-transgenic (NT) plants, six transgenic lines (D19, D22, D103, D138, D163 and D164) along with non-transgenic lines were kept in a growth room under non-saline conditions for 30 days. (A) Representative features of each potato line 30 days after the start of cultivation in the growth room. Scale bar represents 5 cm. Lines selected for further study are indicated with an asterisk. (B) The average shoot length of each potato line 30 days after the start of cultivation. Bars represent the means ± SE of three replications. Double asterisks indicate significant differences from non-transgenic potato at the 1% level by Tukey’s test. (C) Expression level of the AtDREB1A gene. Total RNA was extracted from leaves of transgenic and non-transgenic potato plants 30 days after the start of cultivation in the growth room. The expression level was evaluated by real-time PCR. Bars represent the means ± SE of three replications.

    Techniques Used: Transgenic Assay, Expressing, Real-time Polymerase Chain Reaction

    15) Product Images from "MCA1 and MCA2 That Mediate Ca2+ Uptake Have Distinct and Overlapping Roles in Arabidopsis 1 Uptake Have Distinct and Overlapping Roles in Arabidopsis 1 [W] Uptake Have Distinct and Overlapping Roles in Arabidopsis 1 [W] [OA]"

    Article Title: MCA1 and MCA2 That Mediate Ca2+ Uptake Have Distinct and Overlapping Roles in Arabidopsis 1 Uptake Have Distinct and Overlapping Roles in Arabidopsis 1 [W] Uptake Have Distinct and Overlapping Roles in Arabidopsis 1 [W] [OA]

    Journal: Plant Physiology

    doi: 10.1104/pp.109.147371

    Construction of the mca1 -null mca2 -null double mutant. A, Genomic organization of the MCA1 and MCA2 genes. Boxes represent exons, and their black areas show the open reading frame. The T-DNA is drawn to an arbitrary size. B, RT-PCR showing no detectable production of the MCA2 transcript in the mca2 and mca1 -null mca2 -null line. β -Tubulin mRNA is a control. RNA was purified from whole seedlings grown for 10 d.
    Figure Legend Snippet: Construction of the mca1 -null mca2 -null double mutant. A, Genomic organization of the MCA1 and MCA2 genes. Boxes represent exons, and their black areas show the open reading frame. The T-DNA is drawn to an arbitrary size. B, RT-PCR showing no detectable production of the MCA2 transcript in the mca2 and mca1 -null mca2 -null line. β -Tubulin mRNA is a control. RNA was purified from whole seedlings grown for 10 d.

    Techniques Used: Mutagenesis, Reverse Transcription Polymerase Chain Reaction, Purification

    16) Product Images from "Longistatin, a Plasminogen Activator, Is Key to the Availability of Blood-Meals for Ixodid Ticks"

    Article Title: Longistatin, a Plasminogen Activator, Is Key to the Availability of Blood-Meals for Ixodid Ticks

    Journal: PLoS Pathogens

    doi: 10.1371/journal.ppat.1001312

    Post-transcriptional silencing of longistatin-specific gene in adult ticks by injecting dsRNA. (A) Semiquantitative RT-PCR analysis. One microgram of longistatin dsRNA was injected into the hemolymph of ticks of the RNAi-treated group. Ticks of the control group were treated with 1 µg of mal E dsRNA. Actin was used as an internal control. Eng, engorged. (B) Quantitative RT-PCR using total RNA and primers specific for longistatin as in A. Eng, engorged. (C) In situ detection of longistatin expression in ticks' salivary glands. Salivary glands from the ticks of control and RNAi-treated groups. Endogenous longistatin was reacted with mouse anti-longistatin sera (1∶100). (D) Effect of gene silencing on longistatin post-translation by Western blot analysis. Salivary gland extracts were electrophoresed and transferred onto nitrocellulose membrane. Endogenous longistatin was probed with mouse anti-longistatin (1: 100). Eng, engorged.
    Figure Legend Snippet: Post-transcriptional silencing of longistatin-specific gene in adult ticks by injecting dsRNA. (A) Semiquantitative RT-PCR analysis. One microgram of longistatin dsRNA was injected into the hemolymph of ticks of the RNAi-treated group. Ticks of the control group were treated with 1 µg of mal E dsRNA. Actin was used as an internal control. Eng, engorged. (B) Quantitative RT-PCR using total RNA and primers specific for longistatin as in A. Eng, engorged. (C) In situ detection of longistatin expression in ticks' salivary glands. Salivary glands from the ticks of control and RNAi-treated groups. Endogenous longistatin was reacted with mouse anti-longistatin sera (1∶100). (D) Effect of gene silencing on longistatin post-translation by Western blot analysis. Salivary gland extracts were electrophoresed and transferred onto nitrocellulose membrane. Endogenous longistatin was probed with mouse anti-longistatin (1: 100). Eng, engorged.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Injection, Quantitative RT-PCR, In Situ, Expressing, Western Blot

    17) Product Images from "Downregulation of transforming growth factor-? type II receptor prohibit epithelial-to-mesenchymal transition in lens epithelium"

    Article Title: Downregulation of transforming growth factor-? type II receptor prohibit epithelial-to-mesenchymal transition in lens epithelium

    Journal: Molecular Vision

    doi:

    Effect of targeting siRNAs suppressed TβRII protein and mRNA expression by western blot and RT–PCR. A : siRNAs suppress TβRII protein expression in SRA01/04 cells. Total cell lysates from SRA01/04 cells treated with hT1, hT2, and hT3 siRNA or control, scrambled siRNA for 48 h were separated on 12% SDS polyacrylamide gels and immunoblotted with a TβRII specific antibody. Lane 5 contains lysate from cells incubated with Lipofectamine™ 2000 reagent alone (no siRNA). Lane 4 contains lysate from cells treated with 80 nM scrambled siRNA. Lanes 1, 2, and 3 contain lysates of cells treated with hT1,hT2, and hT3 siRNA at a final concentration of 80 nM. The TβRII band is indicated. B : siRNA reduces levels of TβRII transcript. RNA was prepared from cells treated with scrambled siRNA or hT 3 siRNA for 48 h at 80 nM/ concentration. Following conversion to cDNA, the samples were analyzed by real time PCR using primers to TβRII . The bar graphs show the mean expression levels of TβRII transcript normalized to ACTB relative to that of scrambled siRNA treated controls. Asterisks indicate that the data are significantly different from the scrambled controls (p
    Figure Legend Snippet: Effect of targeting siRNAs suppressed TβRII protein and mRNA expression by western blot and RT–PCR. A : siRNAs suppress TβRII protein expression in SRA01/04 cells. Total cell lysates from SRA01/04 cells treated with hT1, hT2, and hT3 siRNA or control, scrambled siRNA for 48 h were separated on 12% SDS polyacrylamide gels and immunoblotted with a TβRII specific antibody. Lane 5 contains lysate from cells incubated with Lipofectamine™ 2000 reagent alone (no siRNA). Lane 4 contains lysate from cells treated with 80 nM scrambled siRNA. Lanes 1, 2, and 3 contain lysates of cells treated with hT1,hT2, and hT3 siRNA at a final concentration of 80 nM. The TβRII band is indicated. B : siRNA reduces levels of TβRII transcript. RNA was prepared from cells treated with scrambled siRNA or hT 3 siRNA for 48 h at 80 nM/ concentration. Following conversion to cDNA, the samples were analyzed by real time PCR using primers to TβRII . The bar graphs show the mean expression levels of TβRII transcript normalized to ACTB relative to that of scrambled siRNA treated controls. Asterisks indicate that the data are significantly different from the scrambled controls (p

    Techniques Used: Expressing, Western Blot, Reverse Transcription Polymerase Chain Reaction, Incubation, Concentration Assay, Real-time Polymerase Chain Reaction

    18) Product Images from "Development of one-step SYBR Green real-time RT-PCR for quantifying bovine viral diarrhea virus type-1 and its comparison with conventional RT-PCR"

    Article Title: Development of one-step SYBR Green real-time RT-PCR for quantifying bovine viral diarrhea virus type-1 and its comparison with conventional RT-PCR

    Journal: Virology Journal

    doi: 10.1186/1743-422X-8-374

    BVDV RNA melting curves (a) and BVDV RNA standard curve (b) . (a) BVDV RNA melting curves showing 10-fold serial dilutions of standard RNA from 10 7 to 10 2 copies/ml amplified by SYBR Green RT-PCR on Bio-Rad iQ5 Multicolor Real-Time PCR Detection System. (b) BVDV RNA standard curve produced by SYBR Green RT-PCR on Bio-Rad iQ5 Multicolor Real-Time PCR Detection System using 10-fold serial dilutions of standard RNA transcribed in vitro as standard templates.
    Figure Legend Snippet: BVDV RNA melting curves (a) and BVDV RNA standard curve (b) . (a) BVDV RNA melting curves showing 10-fold serial dilutions of standard RNA from 10 7 to 10 2 copies/ml amplified by SYBR Green RT-PCR on Bio-Rad iQ5 Multicolor Real-Time PCR Detection System. (b) BVDV RNA standard curve produced by SYBR Green RT-PCR on Bio-Rad iQ5 Multicolor Real-Time PCR Detection System using 10-fold serial dilutions of standard RNA transcribed in vitro as standard templates.

    Techniques Used: Amplification, SYBR Green Assay, Reverse Transcription Polymerase Chain Reaction, Real-time Polymerase Chain Reaction, Produced, In Vitro

    Agarose gel electrophoresis of cDNA template (a) and cRNA standard (b) . (a) 1% agarose gel electrophoresis of cDNA template synthesized by RT-PCR. Complementary DNA (cDNA) template with a length of 201 bp synthesized using viral RNA as template by reverse-transcriptase and subsequently amplified by PCR. Marker: 100 bp DNA Ladders. (b) 3% agarose gel electrophoresis of cRNA standard. Complementary RNA (cRNA) standard with a length of 184 b synthesized using the amplified cDNA as a template by in vitro transcription. Marker: RNA Marker RL1,000.
    Figure Legend Snippet: Agarose gel electrophoresis of cDNA template (a) and cRNA standard (b) . (a) 1% agarose gel electrophoresis of cDNA template synthesized by RT-PCR. Complementary DNA (cDNA) template with a length of 201 bp synthesized using viral RNA as template by reverse-transcriptase and subsequently amplified by PCR. Marker: 100 bp DNA Ladders. (b) 3% agarose gel electrophoresis of cRNA standard. Complementary RNA (cRNA) standard with a length of 184 b synthesized using the amplified cDNA as a template by in vitro transcription. Marker: RNA Marker RL1,000.

    Techniques Used: Agarose Gel Electrophoresis, Synthesized, Reverse Transcription Polymerase Chain Reaction, Amplification, Polymerase Chain Reaction, Marker, In Vitro

    Melting peaks analysis on the PCR products of SYBR Green RT-PCR on Bio-Rad iQ5 Multicolor Real-Time PCR Detection System . (a) Melting peaks of PCR product from cRNA standards. (b) Melting peaks of PCR product from BVDV RNA of 10-fold serial dilutions of titrated virus.
    Figure Legend Snippet: Melting peaks analysis on the PCR products of SYBR Green RT-PCR on Bio-Rad iQ5 Multicolor Real-Time PCR Detection System . (a) Melting peaks of PCR product from cRNA standards. (b) Melting peaks of PCR product from BVDV RNA of 10-fold serial dilutions of titrated virus.

    Techniques Used: Polymerase Chain Reaction, SYBR Green Assay, Reverse Transcription Polymerase Chain Reaction, Real-time Polymerase Chain Reaction

    Comparison of one-step SYBR Green I RT-PCR with conventional RT-PCR for dectecting BVDV RNA of titrated viruses at 10-fold serial dilutions . (a) 2.5% agarose gel electrophoresis of the amplified products with a length of 84 bp obtained by one-step SYBR Green I RT-PCR. Marker: 50 bp DNA Marker, Lane 1: 100 TCID 50 , Lane 2: 10 TCID 50 , Lane 3: 1 TCID 50 , Lane 4: 10 -1 TCID 50 , Lane 5: 10 -2 TCID 50 , Lane 6: 10 -3 TCID 50 , Lane 7: 10 -4 TCID 50 , Lane 8: 10 -5 TCID 50 . (b) 2.5% agarose gel electrophoresis of the amplified products with a length of 84 bp obtained by conventional RT-PCR. Marker: DNA Marker DL 500, lane 1: 100 TCID 50 , lane 2: 10 TCID 50 , lane 3: 1 TCID 50 , lane 4: 10 -1 TCID 50 , lane 5: 10 -2 TCID 50 , lane 6: 10 -3 TCID 50 , lane 7: 10 -4 TCID 50 , lane 8: 10 -5 TCID 50 .
    Figure Legend Snippet: Comparison of one-step SYBR Green I RT-PCR with conventional RT-PCR for dectecting BVDV RNA of titrated viruses at 10-fold serial dilutions . (a) 2.5% agarose gel electrophoresis of the amplified products with a length of 84 bp obtained by one-step SYBR Green I RT-PCR. Marker: 50 bp DNA Marker, Lane 1: 100 TCID 50 , Lane 2: 10 TCID 50 , Lane 3: 1 TCID 50 , Lane 4: 10 -1 TCID 50 , Lane 5: 10 -2 TCID 50 , Lane 6: 10 -3 TCID 50 , Lane 7: 10 -4 TCID 50 , Lane 8: 10 -5 TCID 50 . (b) 2.5% agarose gel electrophoresis of the amplified products with a length of 84 bp obtained by conventional RT-PCR. Marker: DNA Marker DL 500, lane 1: 100 TCID 50 , lane 2: 10 TCID 50 , lane 3: 1 TCID 50 , lane 4: 10 -1 TCID 50 , lane 5: 10 -2 TCID 50 , lane 6: 10 -3 TCID 50 , lane 7: 10 -4 TCID 50 , lane 8: 10 -5 TCID 50 .

    Techniques Used: SYBR Green Assay, Reverse Transcription Polymerase Chain Reaction, Agarose Gel Electrophoresis, Amplification, Marker

    19) Product Images from "A genetic variant of miR-148a binding site in the SCRN1 3′-UTR is associated with susceptibility and prognosis of gastric cancer"

    Article Title: A genetic variant of miR-148a binding site in the SCRN1 3′-UTR is associated with susceptibility and prognosis of gastric cancer

    Journal: Scientific Reports

    doi: 10.1038/srep07080

    Effect of the miR-148a and SNP rs6976789 on the expression of SCRN1 in gastric cancer. Relative expression levels of (A) SCRN1 mRNA and (B) miR-148a were detected in 32 pairs of human gastric cancer tissues and adjacent normal tissues via qRT-PCR. Abundance of and SCRN1 mRNA and miRNA was normalized to GAPDH and U6 RNA, respectively. (C) Spearman's correlation analysis of SCRN1 mRNA expression levels to miR-148a in 32 gastric cancer tissues. (D) Association between rs6976789 polymorphism and SCRN1 mRNA levels in gastric cancer cases.
    Figure Legend Snippet: Effect of the miR-148a and SNP rs6976789 on the expression of SCRN1 in gastric cancer. Relative expression levels of (A) SCRN1 mRNA and (B) miR-148a were detected in 32 pairs of human gastric cancer tissues and adjacent normal tissues via qRT-PCR. Abundance of and SCRN1 mRNA and miRNA was normalized to GAPDH and U6 RNA, respectively. (C) Spearman's correlation analysis of SCRN1 mRNA expression levels to miR-148a in 32 gastric cancer tissues. (D) Association between rs6976789 polymorphism and SCRN1 mRNA levels in gastric cancer cases.

    Techniques Used: Expressing, Quantitative RT-PCR

    20) Product Images from "Comparison of methods for detecting asymptomatic malaria infections in the China–Myanmar border area"

    Article Title: Comparison of methods for detecting asymptomatic malaria infections in the China–Myanmar border area

    Journal: Malaria Journal

    doi: 10.1186/s12936-017-1813-0

    Venn diagram showing the overlap in the number (percent) of individuals with asymptomatic Plasmodium infections in a population of 1005 as detected by light microscopy (LM) and one of the three molecular methods targeting parasite 18S rRNA genes ( nD-PCR nested PCR using genomic DNA, nRT-PCR nested RT-PCR using parasite total RNA, CLIP-PCR capture and ligation probe-PCR)
    Figure Legend Snippet: Venn diagram showing the overlap in the number (percent) of individuals with asymptomatic Plasmodium infections in a population of 1005 as detected by light microscopy (LM) and one of the three molecular methods targeting parasite 18S rRNA genes ( nD-PCR nested PCR using genomic DNA, nRT-PCR nested RT-PCR using parasite total RNA, CLIP-PCR capture and ligation probe-PCR)

    Techniques Used: Light Microscopy, Polymerase Chain Reaction, Nested PCR, Reverse Transcription Polymerase Chain Reaction, Cross-linking Immunoprecipitation, Ligation

    21) Product Images from "MCA1 and MCA2 That Mediate Ca2+ Uptake Have Distinct and Overlapping Roles in Arabidopsis 1 Uptake Have Distinct and Overlapping Roles in Arabidopsis 1 [W] Uptake Have Distinct and Overlapping Roles in Arabidopsis 1 [W] [OA]"

    Article Title: MCA1 and MCA2 That Mediate Ca2+ Uptake Have Distinct and Overlapping Roles in Arabidopsis 1 Uptake Have Distinct and Overlapping Roles in Arabidopsis 1 [W] Uptake Have Distinct and Overlapping Roles in Arabidopsis 1 [W] [OA]

    Journal: Plant Physiology

    doi: 10.1104/pp.109.147371

    Construction of the mca1 -null mca2 -null double mutant. A, Genomic organization of the MCA1 and MCA2 genes. Boxes represent exons, and their black areas show the open reading frame. The T-DNA is drawn to an arbitrary size. B, RT-PCR showing no detectable production of the MCA2 transcript in the mca2 and mca1 -null mca2 -null line. β -Tubulin mRNA is a control. RNA was purified from whole seedlings grown for 10 d.
    Figure Legend Snippet: Construction of the mca1 -null mca2 -null double mutant. A, Genomic organization of the MCA1 and MCA2 genes. Boxes represent exons, and their black areas show the open reading frame. The T-DNA is drawn to an arbitrary size. B, RT-PCR showing no detectable production of the MCA2 transcript in the mca2 and mca1 -null mca2 -null line. β -Tubulin mRNA is a control. RNA was purified from whole seedlings grown for 10 d.

    Techniques Used: Mutagenesis, Reverse Transcription Polymerase Chain Reaction, Purification

    22) Product Images from "Enhanced Expression of Keratinocyte Growth Factor and Its Receptor Correlates with Venous Invasion in Pancreatic Cancer"

    Article Title: Enhanced Expression of Keratinocyte Growth Factor and Its Receptor Correlates with Venous Invasion in Pancreatic Cancer

    Journal: The American Journal of Pathology

    doi: 10.2353/ajpath.2007.060935

    KGFR and KGF in pancreatic cancer cell lines. A: RT-PCR analysis of KGFR and KGF mRNA in pancreatic cancer cell lines. Total RNA was extracted from PANC-1; MIA PaCa-2; KLM-1; Capan-1; and PK-1, -8, -9, and -59 cells and used to perform cDNA synthesis and PCR analysis. KGFR mRNA (150 bp) was detected in all cell lines (top). KGF mRNA (163-bp) was detected in all pancreatic cancer cell lines, except for MIA PaCa-2 cells (middle). β-Actin mRNA (163 bp) served as a loading control (bottom). B and C: Q-PCR analysis of KGFR and KGF mRNA in pancreatic cancer cell lines. KGFR mRNA was expressed at variable levels in all pancreatic cancer cell lines. KGF mRNA was not detected in MIA PaCa-2 cells and was expressed at variable levels in the other pancreatic cancer cell lines. Results are expressed as KGFR/β-actin and KGF/β-actin. Gene expression measurements were performed in triplicate. Bars represent the mean ± SE. D: Western blot analysis of KGFR in pancreatic cancer cell lines. A band corresponding to the 105-kd KGFR protein was detected in all pancreatic cancer cell lines (top). β-Actin served as a loading control (bottom). E: Immunofluorescent analysis of KGFR expression in MIA PaCa-2 cells. KGFR immunoreactivity was detected in the cytoplasm and/or on the membrane of cancer cells. In some cases, a strong KGFR signal was detected at the cell membrane ( arrowheads ). Bar = 50 μm.
    Figure Legend Snippet: KGFR and KGF in pancreatic cancer cell lines. A: RT-PCR analysis of KGFR and KGF mRNA in pancreatic cancer cell lines. Total RNA was extracted from PANC-1; MIA PaCa-2; KLM-1; Capan-1; and PK-1, -8, -9, and -59 cells and used to perform cDNA synthesis and PCR analysis. KGFR mRNA (150 bp) was detected in all cell lines (top). KGF mRNA (163-bp) was detected in all pancreatic cancer cell lines, except for MIA PaCa-2 cells (middle). β-Actin mRNA (163 bp) served as a loading control (bottom). B and C: Q-PCR analysis of KGFR and KGF mRNA in pancreatic cancer cell lines. KGFR mRNA was expressed at variable levels in all pancreatic cancer cell lines. KGF mRNA was not detected in MIA PaCa-2 cells and was expressed at variable levels in the other pancreatic cancer cell lines. Results are expressed as KGFR/β-actin and KGF/β-actin. Gene expression measurements were performed in triplicate. Bars represent the mean ± SE. D: Western blot analysis of KGFR in pancreatic cancer cell lines. A band corresponding to the 105-kd KGFR protein was detected in all pancreatic cancer cell lines (top). β-Actin served as a loading control (bottom). E: Immunofluorescent analysis of KGFR expression in MIA PaCa-2 cells. KGFR immunoreactivity was detected in the cytoplasm and/or on the membrane of cancer cells. In some cases, a strong KGFR signal was detected at the cell membrane ( arrowheads ). Bar = 50 μm.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Expressing, Western Blot

    23) Product Images from "Identification and characterization of pig adipose-derived progenitor cells"

    Article Title: Identification and characterization of pig adipose-derived progenitor cells

    Journal: Canadian Journal of Veterinary Research

    doi:

    RNA isolation and RT-PCR
    Figure Legend Snippet: RNA isolation and RT-PCR

    Techniques Used: Isolation, Reverse Transcription Polymerase Chain Reaction

    24) Product Images from "Liposome mediated double-stranded RNA delivery to silence ribosomal protein P0 in the tick Rhipicephalus haemaphysaloides"

    Article Title: Liposome mediated double-stranded RNA delivery to silence ribosomal protein P0 in the tick Rhipicephalus haemaphysaloides

    Journal: Ticks and Tick-Borne Diseases

    doi: 10.1016/j.ttbdis.2018.01.015

    P0 gene silencing via dsRNA by soaking with different liposomes and water. R. haemaphysaloides ticks were soaked for 24 h by setting a tube on a vertical rotating device at room temperature. After soaking, ticks were rinsed in distilled water and dried on paper towels. They were then allowed to rest for 5 d before RNA was extracted for real-time PCR analysis. Each test was repeated three times. Relative expression of P0 against the tick elongation factor-1α was calculated using the ticks soaked in water without P0 dsRNA as the control. Significant differences between different groups are marked with asterisks (p
    Figure Legend Snippet: P0 gene silencing via dsRNA by soaking with different liposomes and water. R. haemaphysaloides ticks were soaked for 24 h by setting a tube on a vertical rotating device at room temperature. After soaking, ticks were rinsed in distilled water and dried on paper towels. They were then allowed to rest for 5 d before RNA was extracted for real-time PCR analysis. Each test was repeated three times. Relative expression of P0 against the tick elongation factor-1α was calculated using the ticks soaked in water without P0 dsRNA as the control. Significant differences between different groups are marked with asterisks (p

    Techniques Used: Real-time Polymerase Chain Reaction, Expressing

    25) Product Images from "Construction and characterization of an infectious cDNA clone of potato virus S developed from selected populations that survived genetic bottlenecks"

    Article Title: Construction and characterization of an infectious cDNA clone of potato virus S developed from selected populations that survived genetic bottlenecks

    Journal: Virology Journal

    doi: 10.1186/s12985-019-1124-x

    Construction of chimeric cDNA between pPVS-H-FL-β and pPVS-H-FL-H, and the infectivity of RNA transcripts. A unique Bsi WI restriction site was introduced by C5850G substitution without an amino acid change by PCR. Two chimeric cDNA clones between pPVS-H-FL-β and pPVS-H-FL-H were constructed by exchanging ORF1 sequence at the Bsi WI restriction site. The length of each poly(A) tail was determined by DNA sequence analysis. Capped RNA transcribed from each clone was used to inoculate N. occidentalis plants
    Figure Legend Snippet: Construction of chimeric cDNA between pPVS-H-FL-β and pPVS-H-FL-H, and the infectivity of RNA transcripts. A unique Bsi WI restriction site was introduced by C5850G substitution without an amino acid change by PCR. Two chimeric cDNA clones between pPVS-H-FL-β and pPVS-H-FL-H were constructed by exchanging ORF1 sequence at the Bsi WI restriction site. The length of each poly(A) tail was determined by DNA sequence analysis. Capped RNA transcribed from each clone was used to inoculate N. occidentalis plants

    Techniques Used: Infection, Polymerase Chain Reaction, Clone Assay, Construct, Sequencing

    26) Product Images from "Role of Vacuolar H+-inorganic Pyrophosphatase in Tomato Fruit Development"

    Article Title: Role of Vacuolar H+-inorganic Pyrophosphatase in Tomato Fruit Development

    Journal: Journal of Experimental Botany

    doi: 10.1093/jxb/ers213

    Expression analysis of type-I V-PPase genes, Sl VP1 and Sl VP2 , in three RNAi lines (TPR43, TPR79, TPR81). Real-time PCR was performed with cDNA prepared from total RNA extracted from fruit at 2 weeks after anthesis. Relative expression was determined in triplicate measurements in three independent biological replicates. Data shows the relative expression levels normalized against rRNA (TPR43) and Actin (TPR79, TPR81) with the standard errors.
    Figure Legend Snippet: Expression analysis of type-I V-PPase genes, Sl VP1 and Sl VP2 , in three RNAi lines (TPR43, TPR79, TPR81). Real-time PCR was performed with cDNA prepared from total RNA extracted from fruit at 2 weeks after anthesis. Relative expression was determined in triplicate measurements in three independent biological replicates. Data shows the relative expression levels normalized against rRNA (TPR43) and Actin (TPR79, TPR81) with the standard errors.

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction

    27) Product Images from "Enhanced Anti-Tumor Effect of Zoledronic Acid Combined with Temozolomide against Human Malignant Glioma Cell Expressing O6-Methylguanine DNA Methyltransferase"

    Article Title: Enhanced Anti-Tumor Effect of Zoledronic Acid Combined with Temozolomide against Human Malignant Glioma Cell Expressing O6-Methylguanine DNA Methyltransferase

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0104538

    Expression of MGMT and chemosensitivity to TMZ in human malignant glioma cell lines. A, Expression of MGMT gene in human malignant glioma cell lines. RNA was isolated from ten malignant glioma cell lines. RT-PCR was done to assess MGMT mRNA expression. Expression of MGMT mRNA was detected in T98G, YH-13 and LN-18. B, Expression of MGMT protein in human malignant glioma cell lines. Protein extracts were prepared from ten malignant glioma cell lines. MGMT expression was analyzed by immunoblotting. β-actin was used as a loading control. Expression of MGMT protein was detected in T98G, YH-13 and LN-18. C, Expression and localization of MGMT protein in human malignant glioma cell lines. Cultured cells were fixed and incubated with anti-MGMT antibody. Reactants were processed with the standard streptavidin-biotin immunoperoxidase method. Diaminobenzidine was used as the final chromogen. Expression and intranuclear localization of MGMT protein was observed in T98G, YH-13and LN-18. D, Growth-inhibitory effect of TMZ in human malignant glioma cell lines. One thousand cells per well were placed onto a 96-well tissue culture plate and incubated overnight. TMZ was added at concentrations of 0–800 µM and incubated for 0–7 days before an MTS assay was performed. T98G and LN18 did not exhibit growth inhibition by TMZ even at a longer exposure.
    Figure Legend Snippet: Expression of MGMT and chemosensitivity to TMZ in human malignant glioma cell lines. A, Expression of MGMT gene in human malignant glioma cell lines. RNA was isolated from ten malignant glioma cell lines. RT-PCR was done to assess MGMT mRNA expression. Expression of MGMT mRNA was detected in T98G, YH-13 and LN-18. B, Expression of MGMT protein in human malignant glioma cell lines. Protein extracts were prepared from ten malignant glioma cell lines. MGMT expression was analyzed by immunoblotting. β-actin was used as a loading control. Expression of MGMT protein was detected in T98G, YH-13 and LN-18. C, Expression and localization of MGMT protein in human malignant glioma cell lines. Cultured cells were fixed and incubated with anti-MGMT antibody. Reactants were processed with the standard streptavidin-biotin immunoperoxidase method. Diaminobenzidine was used as the final chromogen. Expression and intranuclear localization of MGMT protein was observed in T98G, YH-13and LN-18. D, Growth-inhibitory effect of TMZ in human malignant glioma cell lines. One thousand cells per well were placed onto a 96-well tissue culture plate and incubated overnight. TMZ was added at concentrations of 0–800 µM and incubated for 0–7 days before an MTS assay was performed. T98G and LN18 did not exhibit growth inhibition by TMZ even at a longer exposure.

    Techniques Used: Expressing, Isolation, Reverse Transcription Polymerase Chain Reaction, Cell Culture, Incubation, MTS Assay, Inhibition

    Effect of co-treatment of ZOL with TMZ on MGMT expression in MGMT-expressing malignant glioma cells. A, Expression of MGMT gene in human malignant glioma cell lines. RNA was isolated from cells treated with or without TMZ (100 µM) and/or ZOL (40 µM) for 72 hours. MGMT mRNA expression was assessed by RT-PCR. GAPDH was used as a loading control. ZOL down-regulated MGMT mRNA expression in T98G and LN-18. B, Expression of MGMT protein in human malignant glioma cell lines. Upper Protein extracts were prepared from cells treated with or without TMZ (100 µM) and/or ZOL (40 µM) for 72 hours. MGMT expression was analyzed by immunoblotting. β-actin was used as a loading control. Lower Relative densitometric units of the Ras-GTP bands in each cell treated with or without TMZ and/or ZOL. The density of the None band is set arbitrarily at 1.0. Bars, SD. ZOL down-regulated MGMT protein expression in T98G and LN-18.
    Figure Legend Snippet: Effect of co-treatment of ZOL with TMZ on MGMT expression in MGMT-expressing malignant glioma cells. A, Expression of MGMT gene in human malignant glioma cell lines. RNA was isolated from cells treated with or without TMZ (100 µM) and/or ZOL (40 µM) for 72 hours. MGMT mRNA expression was assessed by RT-PCR. GAPDH was used as a loading control. ZOL down-regulated MGMT mRNA expression in T98G and LN-18. B, Expression of MGMT protein in human malignant glioma cell lines. Upper Protein extracts were prepared from cells treated with or without TMZ (100 µM) and/or ZOL (40 µM) for 72 hours. MGMT expression was analyzed by immunoblotting. β-actin was used as a loading control. Lower Relative densitometric units of the Ras-GTP bands in each cell treated with or without TMZ and/or ZOL. The density of the None band is set arbitrarily at 1.0. Bars, SD. ZOL down-regulated MGMT protein expression in T98G and LN-18.

    Techniques Used: Expressing, Isolation, Reverse Transcription Polymerase Chain Reaction

    Related Articles

    RNA Extraction:

    Article Title: Knockdown of FRAT1 Expression by RNA Interference Inhibits Human Glioblastoma Cell Growth, Migration and Invasion
    Article Snippet: .. RNA Extraction and RT-PCR According to manufacturers’ instructions, total RNA was extracted with TRIzol Reagent (Invitrogen, Carlsbad, CA, USA), and reverse transcriptase polymerase chain reaction (RT-PCR) was performed with a TaKaRa RNA PCR Kit (AMV) version 3.0 (TaKaRa, Dalian, China). .. The primers for human FRAT1 were: 5′-GCCCTGTCTAAAGTGTATTTTCAG-3′ and 5′-CGCTTGAGTAGGACTGCAGAG-3′ ; and the predicted PCR product was 325 bp.

    Isolation:

    Article Title: Regulatory effect of Act1 on the BAFF pathway in B-cell malignancy
    Article Snippet: .. RNA isolation and reverse transcription-quantittive polymerase chain reaction (RT-qPCR) Total RNA was extracted from cells using the RNA PCR kit (AMV), version 3.0 (Takara Bio, Inc., Otsu, Japan) following the manufacturer's protocols. ..

    Quantitative RT-PCR:

    Article Title: RAP80 expression in breast cancer and its relationship with apoptosis in breast cancer cells
    Article Snippet: .. The reverse transcription was performed with RNA PCR Kit (AMV Ver.3.0, Takara, Kyoto, Japan) according to the manufacturer’s protocols. qRT-PCR was performed by SYBR® Premix Ex TaqTM II Kit (Takara) using 7500 Real-Time PCR system (Applied Biosystems, Thermo Fisher Scientific). ..

    Article Title: Regulatory effect of Act1 on the BAFF pathway in B-cell malignancy
    Article Snippet: .. RNA isolation and reverse transcription-quantittive polymerase chain reaction (RT-qPCR) Total RNA was extracted from cells using the RNA PCR kit (AMV), version 3.0 (Takara Bio, Inc., Otsu, Japan) following the manufacturer's protocols. ..

    Real-time Polymerase Chain Reaction:

    Article Title: RAP80 expression in breast cancer and its relationship with apoptosis in breast cancer cells
    Article Snippet: .. The reverse transcription was performed with RNA PCR Kit (AMV Ver.3.0, Takara, Kyoto, Japan) according to the manufacturer’s protocols. qRT-PCR was performed by SYBR® Premix Ex TaqTM II Kit (Takara) using 7500 Real-Time PCR system (Applied Biosystems, Thermo Fisher Scientific). ..

    Polymerase Chain Reaction:

    Article Title: Knockdown of FRAT1 Expression by RNA Interference Inhibits Human Glioblastoma Cell Growth, Migration and Invasion
    Article Snippet: .. RNA Extraction and RT-PCR According to manufacturers’ instructions, total RNA was extracted with TRIzol Reagent (Invitrogen, Carlsbad, CA, USA), and reverse transcriptase polymerase chain reaction (RT-PCR) was performed with a TaKaRa RNA PCR Kit (AMV) version 3.0 (TaKaRa, Dalian, China). .. The primers for human FRAT1 were: 5′-GCCCTGTCTAAAGTGTATTTTCAG-3′ and 5′-CGCTTGAGTAGGACTGCAGAG-3′ ; and the predicted PCR product was 325 bp.

    Article Title: Sertoli cell-mediated differentiation of male germ cell-like cells from human umbilical cord Wharton’s jelly-derived mesenchymal stem cells in an in vitro co-culture system
    Article Snippet: .. RT-PCR was performed using the RNA PCR Kit (AMV) 3.0 (TaKaRa, Da lian, China, Japan). ..

    Article Title: RAP80 expression in breast cancer and its relationship with apoptosis in breast cancer cells
    Article Snippet: .. The reverse transcription was performed with RNA PCR Kit (AMV Ver.3.0, Takara, Kyoto, Japan) according to the manufacturer’s protocols. qRT-PCR was performed by SYBR® Premix Ex TaqTM II Kit (Takara) using 7500 Real-Time PCR system (Applied Biosystems, Thermo Fisher Scientific). ..

    Article Title: Regulatory effect of Act1 on the BAFF pathway in B-cell malignancy
    Article Snippet: .. RNA isolation and reverse transcription-quantittive polymerase chain reaction (RT-qPCR) Total RNA was extracted from cells using the RNA PCR kit (AMV), version 3.0 (Takara Bio, Inc., Otsu, Japan) following the manufacturer's protocols. ..

    Article Title: CXCL12-CXCR4 axis promotes the natural selection of breast cancer cell metastasis
    Article Snippet: .. The reverse transcription was performed with RNA PCR kit (AMV ver.3.0, Takara, Japan) according to the manufacturer's protocols. .. The sequences of primers used are as follows: CXCL12, forward, 5′-GTCAGCCTGAGCTACAGATGC-3′ and reverse, 5′-CTTTAGCTTCGGGTCAATGC-3 and CXCR4, forward, 5′-CCGTGGCAAACTGGTACTTT-3′ and reverse, 5′-GACGCCAACATAGACCACCT-3′.

    Article Title: Exendin-4 ameliorates oxidized-LDL-induced inhibition of macrophage migration in vitro via the NF-κB pathway
    Article Snippet: .. TaKaRa RNA PCR Kit (AMV; version 3.0) was acquired from Takara Biotechnology Co, Ltd (Dalian, China). .. Proteinase inhibitors and cell lysis buffer were obtained from Cell Signaling Technology Co, Ltd (Trask Ln, Danvers, MA, USA).

    Article Title: Expression of mRNA for the t;chcomplex polypeptide-1, a subunit of chaperonin CCT, is upregulated in association with increased cold hardiness in Delia antiqua
    Article Snippet: .. The total RNA of the brain from CA0, CA2, CA32, and WD50 pupae was reverse-transcribed using an RNA PCR Kit (AMV) (V3.0, TAKARA BIO, Otsu, Shiga, Japan) and dT-ACP1 primer (Seegene; 5′- CTGTGAATGCTGCGACTACGAT XXXXX(T)18 -3′). ..

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Knockdown of FRAT1 Expression by RNA Interference Inhibits Human Glioblastoma Cell Growth, Migration and Invasion
    Article Snippet: .. RNA Extraction and RT-PCR According to manufacturers’ instructions, total RNA was extracted with TRIzol Reagent (Invitrogen, Carlsbad, CA, USA), and reverse transcriptase polymerase chain reaction (RT-PCR) was performed with a TaKaRa RNA PCR Kit (AMV) version 3.0 (TaKaRa, Dalian, China). .. The primers for human FRAT1 were: 5′-GCCCTGTCTAAAGTGTATTTTCAG-3′ and 5′-CGCTTGAGTAGGACTGCAGAG-3′ ; and the predicted PCR product was 325 bp.

    Article Title: Sertoli cell-mediated differentiation of male germ cell-like cells from human umbilical cord Wharton’s jelly-derived mesenchymal stem cells in an in vitro co-culture system
    Article Snippet: .. RT-PCR was performed using the RNA PCR Kit (AMV) 3.0 (TaKaRa, Da lian, China, Japan). ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96
    TaKaRa rna pcr kit amv
    pTT5-Act1 expression vector construction. (A) Total <t>RNA</t> extraction from Raji cells. (B) A gel extraction kit was used to purify cDNA fragments of Act1 and pTT5 following dual restriction enzyme digestion (M, Marker; 1, 2 and 3, polymerase chain reaction products of Act1). (C) Construction of the pTT5-Act1 expression vector (M, Marker; 1, 2, 3 and 5, recombinant plasmid of pTT5-Act1). (D) A positive clone of pTT5-Act1 was verified using dual digestion (M, Marker; 1 and 2, sequences of pTT5 and Act1). Act1, nuclear factor-κB Activator 1.
    Rna Pcr Kit Amv, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 884 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rna pcr kit amv/product/TaKaRa
    Average 96 stars, based on 884 article reviews
    Price from $9.99 to $1999.99
    rna pcr kit amv - by Bioz Stars, 2020-09
    96/100 stars
      Buy from Supplier

    Image Search Results


    pTT5-Act1 expression vector construction. (A) Total RNA extraction from Raji cells. (B) A gel extraction kit was used to purify cDNA fragments of Act1 and pTT5 following dual restriction enzyme digestion (M, Marker; 1, 2 and 3, polymerase chain reaction products of Act1). (C) Construction of the pTT5-Act1 expression vector (M, Marker; 1, 2, 3 and 5, recombinant plasmid of pTT5-Act1). (D) A positive clone of pTT5-Act1 was verified using dual digestion (M, Marker; 1 and 2, sequences of pTT5 and Act1). Act1, nuclear factor-κB Activator 1.

    Journal: Oncology Letters

    Article Title: Regulatory effect of Act1 on the BAFF pathway in B-cell malignancy

    doi: 10.3892/ol.2019.10047

    Figure Lengend Snippet: pTT5-Act1 expression vector construction. (A) Total RNA extraction from Raji cells. (B) A gel extraction kit was used to purify cDNA fragments of Act1 and pTT5 following dual restriction enzyme digestion (M, Marker; 1, 2 and 3, polymerase chain reaction products of Act1). (C) Construction of the pTT5-Act1 expression vector (M, Marker; 1, 2, 3 and 5, recombinant plasmid of pTT5-Act1). (D) A positive clone of pTT5-Act1 was verified using dual digestion (M, Marker; 1 and 2, sequences of pTT5 and Act1). Act1, nuclear factor-κB Activator 1.

    Article Snippet: RNA isolation and reverse transcription-quantittive polymerase chain reaction (RT-qPCR) Total RNA was extracted from cells using the RNA PCR kit (AMV), version 3.0 (Takara Bio, Inc., Otsu, Japan) following the manufacturer's protocols.

    Techniques: Expressing, Plasmid Preparation, RNA Extraction, Gel Extraction, Marker, Polymerase Chain Reaction, Recombinant

    The expression patterns of CXCL12 and CXCR4 in breast cancer cell lines. Total RNA and proteins were extracted from wild-type MCF-7, wild-type MDA-MB-435s, wild-type MDA-MB-231, MDA-MB-231–CXCL12 and MDA-MB-231–ZsGreen1. Then they were subjected to RT-PCR and western blot analysis, respectively, for CXCL12 and CXCR4. Both mRNA ( a ) and protein ( b ) expression of CXCR4 and very weak expression of CXCL12 were observed consistently in MDA-MB-231. CXCR4 and CXCL12 mRNA ( a ) and protein ( b ) expression was found in MDA-MB-435s. MCF-7 has very weak CXCR4 and CXCL12 mRNA and protein expression ( a and b ). So we picked MDA-MB-231 to be transfected with CXCL12. CXCL12 mRNA ( a ) and protein ( b ) expression was observed in MDA-MB-231–CXCL12 cells, but very weak in MDA-MB-231–ZsGreen1 or wild-type MDA-MB-231 cells. It is indicated that the stable CXCL12 transfection in MDA-MB-231 was successfully constructed

    Journal: Tumour Biology

    Article Title: CXCL12-CXCR4 axis promotes the natural selection of breast cancer cell metastasis

    doi: 10.1007/s13277-014-1816-1

    Figure Lengend Snippet: The expression patterns of CXCL12 and CXCR4 in breast cancer cell lines. Total RNA and proteins were extracted from wild-type MCF-7, wild-type MDA-MB-435s, wild-type MDA-MB-231, MDA-MB-231–CXCL12 and MDA-MB-231–ZsGreen1. Then they were subjected to RT-PCR and western blot analysis, respectively, for CXCL12 and CXCR4. Both mRNA ( a ) and protein ( b ) expression of CXCR4 and very weak expression of CXCL12 were observed consistently in MDA-MB-231. CXCR4 and CXCL12 mRNA ( a ) and protein ( b ) expression was found in MDA-MB-435s. MCF-7 has very weak CXCR4 and CXCL12 mRNA and protein expression ( a and b ). So we picked MDA-MB-231 to be transfected with CXCL12. CXCL12 mRNA ( a ) and protein ( b ) expression was observed in MDA-MB-231–CXCL12 cells, but very weak in MDA-MB-231–ZsGreen1 or wild-type MDA-MB-231 cells. It is indicated that the stable CXCL12 transfection in MDA-MB-231 was successfully constructed

    Article Snippet: The reverse transcription was performed with RNA PCR kit (AMV ver.3.0, Takara, Japan) according to the manufacturer's protocols.

    Techniques: Expressing, Multiple Displacement Amplification, Reverse Transcription Polymerase Chain Reaction, Western Blot, Transfection, Construct

    Expression patterns of RAP80 in breast cancer cell lines. Notes: Total RNA and proteins were extracted from wild-type MCF-7, ZR-75, and MDA-MB-231, then subjected to qRT-PCR and Western blotting for RAP80. Both protein ( A – D ) and mRNA ( C , E ) expression of RAP80 were observed consistently in MCF-7, but ZR-75 and MDA-MB-231 had very weak RAP80 mRNA and protein expression. Therefore, we picked MCF-7 for transfection with RAP80 siRNA. Data are presented as mean ± SD of three independent experiments, * P

    Journal: OncoTargets and therapy

    Article Title: RAP80 expression in breast cancer and its relationship with apoptosis in breast cancer cells

    doi: 10.2147/OTT.S186981

    Figure Lengend Snippet: Expression patterns of RAP80 in breast cancer cell lines. Notes: Total RNA and proteins were extracted from wild-type MCF-7, ZR-75, and MDA-MB-231, then subjected to qRT-PCR and Western blotting for RAP80. Both protein ( A – D ) and mRNA ( C , E ) expression of RAP80 were observed consistently in MCF-7, but ZR-75 and MDA-MB-231 had very weak RAP80 mRNA and protein expression. Therefore, we picked MCF-7 for transfection with RAP80 siRNA. Data are presented as mean ± SD of three independent experiments, * P

    Article Snippet: The reverse transcription was performed with RNA PCR Kit (AMV Ver.3.0, Takara, Kyoto, Japan) according to the manufacturer’s protocols. qRT-PCR was performed by SYBR® Premix Ex TaqTM II Kit (Takara) using 7500 Real-Time PCR system (Applied Biosystems, Thermo Fisher Scientific).

    Techniques: Expressing, Multiple Displacement Amplification, Quantitative RT-PCR, Western Blot, Transfection

    RNA extraction and semi-quantitative RT-PCR

    Journal: Acta Pharmacologica Sinica

    Article Title: Exendin-4 ameliorates oxidized-LDL-induced inhibition of macrophage migration in vitro via the NF-κB pathway

    doi: 10.1038/aps.2013.128

    Figure Lengend Snippet: RNA extraction and semi-quantitative RT-PCR

    Article Snippet: TaKaRa RNA PCR Kit (AMV; version 3.0) was acquired from Takara Biotechnology Co, Ltd (Dalian, China).

    Techniques: RNA Extraction, Quantitative RT-PCR