rna oligos  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86
    Name:
    Oligo dT Primer 50 µM
    Description:
    These are the same Ambion primers that are currently included in the RETROscript Kit SKU AM1710 They are provided at a stock concentration of 50 µM and are functionally tested using the RETROscript Kit
    Catalog Number:
    AM5730G
    Price:
    None
    Category:
    Oligos Primers Probes Nucleotides
    Applications:
    PCR & Real-Time PCR|RT-PCR|Reverse Transcription|Two-Step RT-PCR
    Buy from Supplier


    Structured Review

    Thermo Fisher rna oligos
    Ligation of 128-nt, synthetic pre-mRNA. ( A ) Strategy for making synthetic YOL047c transcript. The YOL047c gene contains a single 63-nt intron near the 5′ end of the gene. Dashed lines indicate boundaries of the splicing reporter. The 128-nt splicing reporter contains 35 nt of exon 1, the entire intron (branch point nucleotide, BP), and 30 nt of exon 2. Synthetic oligoribonucleotides (labeled A, B, C) for generating the splicing reporter contain, respectively, the 5′ splice junction, the branch point, and the 3′ splice junction. ( B ) Two-step ligation of transcript (lanes 1 , 2 ). Gel-purified AB product (lane 1 , “AB”) was ligated with oligo C and splint S2, yielding full-length ABC product (lane 2 , “ABC”). One-step ligation of transcript (lanes 3 , 4 ). All three <t>RNA</t> <t>oligonucleotides</t> and both splints were incubated in a single reaction. Reactions were treated with DNAse I after ligation, so no splints are visible.
    These are the same Ambion primers that are currently included in the RETROscript Kit SKU AM1710 They are provided at a stock concentration of 50 µM and are functionally tested using the RETROscript Kit
    https://www.bioz.com/result/rna oligos/product/Thermo Fisher
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    rna oligos - by Bioz Stars, 2021-10
    86/100 stars

    Images

    1) Product Images from "An RNA ligase-mediated method for the efficient creation of large, synthetic RNAs"

    Article Title: An RNA ligase-mediated method for the efficient creation of large, synthetic RNAs

    Journal: RNA

    doi: 10.1261/rna.93506

    Ligation of 128-nt, synthetic pre-mRNA. ( A ) Strategy for making synthetic YOL047c transcript. The YOL047c gene contains a single 63-nt intron near the 5′ end of the gene. Dashed lines indicate boundaries of the splicing reporter. The 128-nt splicing reporter contains 35 nt of exon 1, the entire intron (branch point nucleotide, BP), and 30 nt of exon 2. Synthetic oligoribonucleotides (labeled A, B, C) for generating the splicing reporter contain, respectively, the 5′ splice junction, the branch point, and the 3′ splice junction. ( B ) Two-step ligation of transcript (lanes 1 , 2 ). Gel-purified AB product (lane 1 , “AB”) was ligated with oligo C and splint S2, yielding full-length ABC product (lane 2 , “ABC”). One-step ligation of transcript (lanes 3 , 4 ). All three RNA oligonucleotides and both splints were incubated in a single reaction. Reactions were treated with DNAse I after ligation, so no splints are visible.
    Figure Legend Snippet: Ligation of 128-nt, synthetic pre-mRNA. ( A ) Strategy for making synthetic YOL047c transcript. The YOL047c gene contains a single 63-nt intron near the 5′ end of the gene. Dashed lines indicate boundaries of the splicing reporter. The 128-nt splicing reporter contains 35 nt of exon 1, the entire intron (branch point nucleotide, BP), and 30 nt of exon 2. Synthetic oligoribonucleotides (labeled A, B, C) for generating the splicing reporter contain, respectively, the 5′ splice junction, the branch point, and the 3′ splice junction. ( B ) Two-step ligation of transcript (lanes 1 , 2 ). Gel-purified AB product (lane 1 , “AB”) was ligated with oligo C and splint S2, yielding full-length ABC product (lane 2 , “ABC”). One-step ligation of transcript (lanes 3 , 4 ). All three RNA oligonucleotides and both splints were incubated in a single reaction. Reactions were treated with DNAse I after ligation, so no splints are visible.

    Techniques Used: Ligation, Labeling, Purification, Incubation

    2) Product Images from "HuR stabilizes HTT mRNA via interacting with its exon 11 in a mutant HTT-dependent manner"

    Article Title: HuR stabilizes HTT mRNA via interacting with its exon 11 in a mutant HTT-dependent manner

    Journal: RNA Biology

    doi: 10.1080/15476286.2020.1712894

    HuR interacts with #105708 site in exon 11 of the HTT mRNA. (A) RT-qPCR quantifications of HuR-bound exogenously expressed HTT mRNA 5ʹ fragment (exon 1–10 or exon 1–11) levels in the wild-type mouse striatal cells (STHdh Q7/Q7 ) by RNA-IP (12 technical replicates from 3 biological replicates). IgG was used as a negative control for the IP, and the 18S level was quantified as a baseline control to normalize the signals. HuR interacted with exon 1–11 but not exon 1–10, suggesting that exon 11 contains the HuR-binding site.(B) Similar to (A), but in HD cells (STHdh Q7/Q111 ) transfected with cDNA plasmids expressing EGFP mRNAs containing different candidate binding sites in its 3ʹ UTR region (12 technical replicates from 3 biological replicates). The EGFP mRNA with #105708 site sequences (mouse or human) showed interaction with HuR, suggesting that #105708 (located in exon 11 of HTT mRNA) is a potential HuR-binding site.(C) A representative R-EMSA gel image of different Cy3-labelled RNA oligos of potential binding site sequences after co-incubation with purified HuR-MBP.His proteins (see Fig. S3). The first lanes in each group were loaded by the indicated RNA oligos alone. In the 2 nd and 3 rd lanes in each group, the indicated RNA oligos were incubated and loaded with purified HuR-MBP.His protein at different concentration ratios as indicated. Five repeats were performed, showing consistent results. HuR-binding with the RNA oligo leads to an apparent molecular weight shift to the top (dark arrows), due to mobility block caused by protein-binding.(D) Quantification of the ratio between firefly luciferase and renilla luciferase signals in HD mouse striatal cells (STHdh Q7/Q111 ) transfected with the pmirGLO reporter plasmids (12 technical replicates from 3 biological replicates). The firefly/renilla signal ratio is an indicator of the level of firefly luciferase mRNA, of which the 3ʹ UTR region contained different sequences of potential HuR-binding sites. The HuR knockdown by siRNA caused lowering of the firefly/renilla signal ratio only for #105708-containing plasmids, suggesting that #105708 is likely a functional binding site.(E) RT-qPCR quantifications of HuR-bound endogenous mouse HTT ( msHTT ) mRNA levels in HD mouse striatal cells (STHdh Q7/Q111 ) transfected with pmirGLO plasmids expressing firefly luciferase mRNAs containing different potential binding sites (12 technical replicates from 3 biological replicates). The mRNAs with functional binding sites may compete with endogenous msHTT mRNA for HuR binding (illustrated in the schematic picture in the left panel). Thus, the RNA-IP signals of the corresponding samples could be reduced ( right panel). IgG was used as a negative control for the IP, and the 18S level was quantified as a baseline control to normalize the signals.For all plotted data, error bars represent mean and SEM. The statistical analysis was performed by two-tailed unpaired t tests, ****P
    Figure Legend Snippet: HuR interacts with #105708 site in exon 11 of the HTT mRNA. (A) RT-qPCR quantifications of HuR-bound exogenously expressed HTT mRNA 5ʹ fragment (exon 1–10 or exon 1–11) levels in the wild-type mouse striatal cells (STHdh Q7/Q7 ) by RNA-IP (12 technical replicates from 3 biological replicates). IgG was used as a negative control for the IP, and the 18S level was quantified as a baseline control to normalize the signals. HuR interacted with exon 1–11 but not exon 1–10, suggesting that exon 11 contains the HuR-binding site.(B) Similar to (A), but in HD cells (STHdh Q7/Q111 ) transfected with cDNA plasmids expressing EGFP mRNAs containing different candidate binding sites in its 3ʹ UTR region (12 technical replicates from 3 biological replicates). The EGFP mRNA with #105708 site sequences (mouse or human) showed interaction with HuR, suggesting that #105708 (located in exon 11 of HTT mRNA) is a potential HuR-binding site.(C) A representative R-EMSA gel image of different Cy3-labelled RNA oligos of potential binding site sequences after co-incubation with purified HuR-MBP.His proteins (see Fig. S3). The first lanes in each group were loaded by the indicated RNA oligos alone. In the 2 nd and 3 rd lanes in each group, the indicated RNA oligos were incubated and loaded with purified HuR-MBP.His protein at different concentration ratios as indicated. Five repeats were performed, showing consistent results. HuR-binding with the RNA oligo leads to an apparent molecular weight shift to the top (dark arrows), due to mobility block caused by protein-binding.(D) Quantification of the ratio between firefly luciferase and renilla luciferase signals in HD mouse striatal cells (STHdh Q7/Q111 ) transfected with the pmirGLO reporter plasmids (12 technical replicates from 3 biological replicates). The firefly/renilla signal ratio is an indicator of the level of firefly luciferase mRNA, of which the 3ʹ UTR region contained different sequences of potential HuR-binding sites. The HuR knockdown by siRNA caused lowering of the firefly/renilla signal ratio only for #105708-containing plasmids, suggesting that #105708 is likely a functional binding site.(E) RT-qPCR quantifications of HuR-bound endogenous mouse HTT ( msHTT ) mRNA levels in HD mouse striatal cells (STHdh Q7/Q111 ) transfected with pmirGLO plasmids expressing firefly luciferase mRNAs containing different potential binding sites (12 technical replicates from 3 biological replicates). The mRNAs with functional binding sites may compete with endogenous msHTT mRNA for HuR binding (illustrated in the schematic picture in the left panel). Thus, the RNA-IP signals of the corresponding samples could be reduced ( right panel). IgG was used as a negative control for the IP, and the 18S level was quantified as a baseline control to normalize the signals.For all plotted data, error bars represent mean and SEM. The statistical analysis was performed by two-tailed unpaired t tests, ****P

    Techniques Used: Quantitative RT-PCR, Negative Control, Binding Assay, Transfection, Expressing, Incubation, Purification, Concentration Assay, Molecular Weight, Blocking Assay, Protein Binding, Luciferase, Functional Assay, Two Tailed Test

    3) Product Images from "The downregulation of ATG4B mediated by microRNA-34a/34c-5p suppresses rapamycin-induced autophagy"

    Article Title: The downregulation of ATG4B mediated by microRNA-34a/34c-5p suppresses rapamycin-induced autophagy

    Journal: Iranian Journal of Basic Medical Sciences

    doi: 10.22038/IJBMS.2017.9446

    miR-34a and miR-34c-5p downregulate the expression of ATG4B (A, C) qPCR analysis for ATG4B mRNA levels in HeLa and SKOV3 cells after transfection with equal amount of indicated plasmids and/or RNA oligos for 24 hr. ATG4B mRNA level was normalized with β-actin mRNA, and the data were represented as fold induction over the NC control (B, D)Western blot analysis for ATG4B protein level in HeLa and SKOV3 cells after transfection with equal amount of indicated plasmids and/or RNA oligos for 24hr
    Figure Legend Snippet: miR-34a and miR-34c-5p downregulate the expression of ATG4B (A, C) qPCR analysis for ATG4B mRNA levels in HeLa and SKOV3 cells after transfection with equal amount of indicated plasmids and/or RNA oligos for 24 hr. ATG4B mRNA level was normalized with β-actin mRNA, and the data were represented as fold induction over the NC control (B, D)Western blot analysis for ATG4B protein level in HeLa and SKOV3 cells after transfection with equal amount of indicated plasmids and/or RNA oligos for 24hr

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction, Transfection

    3′-Untranslational region of ATG4B mRNA contains a functional target site for miR-34a and miR-34c-5p (A) A putative binding site of miR-34a/miR-34c-5p in the 3′-UTR of human ATG4B mRNA. The potential functional target sites have also been deleted artificially (B-D) The wild-type ATG4B 3′-UTR reporter plasmid was transiently co-transfected with RNA oligos (NC oligo and NC inhibitor, NC inhibitor and miR-34a/miR-34c-5p mimics, miR-34a/miR-34c-5p mimics and inhibitor of itself) (B), or with miR-34a/miR-34c-5p inhibitor or inhibitor NC(C) into HeLa cells for 24hr. The mutated-type ATG4B 3’-UTR reporter plasmid was also transiently co-transfected with equal amount of miR-34a/miR-34c-5p mimics into HeLa cells (D) for 24hr. Then the luciferase assay was conducted. The data were the firefly luciferase activities normalized with the Renilla luciferase activity. The transfection experiments were performed at least 3 times in triplicate, and the data were represented as fold induction over the NC control
    Figure Legend Snippet: 3′-Untranslational region of ATG4B mRNA contains a functional target site for miR-34a and miR-34c-5p (A) A putative binding site of miR-34a/miR-34c-5p in the 3′-UTR of human ATG4B mRNA. The potential functional target sites have also been deleted artificially (B-D) The wild-type ATG4B 3′-UTR reporter plasmid was transiently co-transfected with RNA oligos (NC oligo and NC inhibitor, NC inhibitor and miR-34a/miR-34c-5p mimics, miR-34a/miR-34c-5p mimics and inhibitor of itself) (B), or with miR-34a/miR-34c-5p inhibitor or inhibitor NC(C) into HeLa cells for 24hr. The mutated-type ATG4B 3’-UTR reporter plasmid was also transiently co-transfected with equal amount of miR-34a/miR-34c-5p mimics into HeLa cells (D) for 24hr. Then the luciferase assay was conducted. The data were the firefly luciferase activities normalized with the Renilla luciferase activity. The transfection experiments were performed at least 3 times in triplicate, and the data were represented as fold induction over the NC control

    Techniques Used: Functional Assay, Binding Assay, Plasmid Preparation, Transfection, Luciferase, Activity Assay

    Overexpression of either miR-34a or miR-34c-5p represses rapamycin-triggered autophagy (A, B) HeLa and SKOV3 cells were seeded in 6-well plates and transfected with indicated plasmids and/or RNA oligos. After 12hr, the cells were treated with 0.5μMrapamycin for additional 12hr. Then the protein levels of p62 and LC3 were detected by Western blot, taking Tubulin as a loading control
    Figure Legend Snippet: Overexpression of either miR-34a or miR-34c-5p represses rapamycin-triggered autophagy (A, B) HeLa and SKOV3 cells were seeded in 6-well plates and transfected with indicated plasmids and/or RNA oligos. After 12hr, the cells were treated with 0.5μMrapamycin for additional 12hr. Then the protein levels of p62 and LC3 were detected by Western blot, taking Tubulin as a loading control

    Techniques Used: Over Expression, Transfection, Western Blot

    4) Product Images from "miR‐206 inhibits the growth of hepatocellular carcinoma cells via targeting CDK9"

    Article Title: miR‐206 inhibits the growth of hepatocellular carcinoma cells via targeting CDK9

    Journal: Cancer Medicine

    doi: 10.1002/cam4.1188

    miR‐206 inhibits the proliferation, induces apoptosis, and cell cycle arrest in HCC cells. (A) Bell7402 and HepG2 cells were transfected withGV251‐miRNA‐206 and screened with G418 for 2–4 weeks to establish the stable cell lines.(B and C). Bell7402 and HepG2 cells were seeded in 96‐well plates after transfected with indicated plasmids and/or RNA oligos for 48 h. Then the CCK‐8 assays were performed for evaluating the cell proliferation. The apoptosis (D–G) and cell cycle phase distribution (H) were detected by flow cytometry. * P
    Figure Legend Snippet: miR‐206 inhibits the proliferation, induces apoptosis, and cell cycle arrest in HCC cells. (A) Bell7402 and HepG2 cells were transfected withGV251‐miRNA‐206 and screened with G418 for 2–4 weeks to establish the stable cell lines.(B and C). Bell7402 and HepG2 cells were seeded in 96‐well plates after transfected with indicated plasmids and/or RNA oligos for 48 h. Then the CCK‐8 assays were performed for evaluating the cell proliferation. The apoptosis (D–G) and cell cycle phase distribution (H) were detected by flow cytometry. * P

    Techniques Used: Transfection, Stable Transfection, CCK-8 Assay, Flow Cytometry, Cytometry

    miR‐206 downregulates the expression of CDK9. Bell7402 and HepG2 cells were transfected with equal amount of indicated plasmids and/or RNA oligos for 24 h. Then the levels of CDK9 mRNA were assayed by qPCR (A, C) taking β‐actin as a control, and the protein level of CDK9 was detected by western blot (B, D) taking tubulin as the loading control. * P
    Figure Legend Snippet: miR‐206 downregulates the expression of CDK9. Bell7402 and HepG2 cells were transfected with equal amount of indicated plasmids and/or RNA oligos for 24 h. Then the levels of CDK9 mRNA were assayed by qPCR (A, C) taking β‐actin as a control, and the protein level of CDK9 was detected by western blot (B, D) taking tubulin as the loading control. * P

    Techniques Used: Expressing, Transfection, Real-time Polymerase Chain Reaction, Western Blot

    3′ UTR of CDK9 mRNA contains a functional target site for miR‐206. (A) A predicted binding site of miR‐206 in 3′ UTR of CDK9 mRNA was underlined. (B) HepG2 cells were cultured in 48‐well plates and were cotransfected with the reporter plasmids (pmir‐CDK9, pmir‐CDK9‐M, or empty pmir‐GLO) and RNA oligos (NC or miR‐206 mimics) for 24 h. Then the luciferase activity was determined with Dual‐Luciferase Reporter System. Firefly luciferase activity was normalized against the renilla luciferase activity. The transfection experiments were performed at least 3 times in triplicate, and the data were represented as fold induction over the NC control. * P
    Figure Legend Snippet: 3′ UTR of CDK9 mRNA contains a functional target site for miR‐206. (A) A predicted binding site of miR‐206 in 3′ UTR of CDK9 mRNA was underlined. (B) HepG2 cells were cultured in 48‐well plates and were cotransfected with the reporter plasmids (pmir‐CDK9, pmir‐CDK9‐M, or empty pmir‐GLO) and RNA oligos (NC or miR‐206 mimics) for 24 h. Then the luciferase activity was determined with Dual‐Luciferase Reporter System. Firefly luciferase activity was normalized against the renilla luciferase activity. The transfection experiments were performed at least 3 times in triplicate, and the data were represented as fold induction over the NC control. * P

    Techniques Used: Functional Assay, Binding Assay, Cell Culture, Luciferase, Activity Assay, Transfection

    miR‐206 blocks the activation of RNA polymerase II. (A) Bell7402 and (B) HepG2 cells were transfected with indicated plasmids and/or RNA oligos for 48 h, then p‐RNAII, t‐RNAII, and MCL‐1 were measured by western blot taking tubulin as the loading control. p‐RNAII‐ser2, phospho‐RNA polymerase II ser2; t‐RNAII, total‐RNA polymerase II. * P
    Figure Legend Snippet: miR‐206 blocks the activation of RNA polymerase II. (A) Bell7402 and (B) HepG2 cells were transfected with indicated plasmids and/or RNA oligos for 48 h, then p‐RNAII, t‐RNAII, and MCL‐1 were measured by western blot taking tubulin as the loading control. p‐RNAII‐ser2, phospho‐RNA polymerase II ser2; t‐RNAII, total‐RNA polymerase II. * P

    Techniques Used: Activation Assay, Transfection, Western Blot

    5) Product Images from "Structure of the Yeast SR protein Npl3 and Interaction with mRNA 3?-End Processing Signals"

    Article Title: Structure of the Yeast SR protein Npl3 and Interaction with mRNA 3?-End Processing Signals

    Journal:

    doi: 10.1016/j.jmb.2007.09.029

    RNA binding activity of full length Npl3 for different RNA sequences corresponding to yeast 3′-end processing signals. RNA oligonucleotides N1-N5 () were 5′-end labeled and incubated with increasing amounts of recombinant Npl3,
    Figure Legend Snippet: RNA binding activity of full length Npl3 for different RNA sequences corresponding to yeast 3′-end processing signals. RNA oligonucleotides N1-N5 () were 5′-end labeled and incubated with increasing amounts of recombinant Npl3,

    Techniques Used: RNA Binding Assay, Activity Assay, Labeling, Incubation, Recombinant

    6) Product Images from "The Landscape of DNA Methylation Associated With the Transcriptomic Network of Intramuscular Adipocytes Generates Insight Into Intramuscular Fat Deposition in Chicken"

    Article Title: The Landscape of DNA Methylation Associated With the Transcriptomic Network of Intramuscular Adipocytes Generates Insight Into Intramuscular Fat Deposition in Chicken

    Journal: Frontiers in Cell and Developmental Biology

    doi: 10.3389/fcell.2020.00206

    The effects of COL6A1 overexpression and knockdown on cell proliferation, differentiation and migration. (A) Overexpressed of COL6A1 promoted the expression of adipogenic differentiation and ECM-related genes (B) of intramuscular adipocytes. The relative mRNA levels of genes were detected by qRT-PCR after transfected with plasmid for 48 h. (C) Knockdown of COL6A1 suppressed the expression of adipogenic differentiation and ECM-related genes (D) of intramuscular adipocytes. The relative mRNA levels of genes were detected by qRT-PCR after transfected with RNA oligos for 24 h. (E) COL6A1 promoted intramuscular preadipocytes proliferation. The percentage of EDU positive cells was quantified after transfected with plasmid or RNA oligos. (F) COL6A1 accelerated intramuscular preadipocytes differentiation. BODIPY (green) and DAPI (blue) staining of intramuscular adipocytes after transfected with plasmid or RNA oligos. (G) COL6A1 promoted intramuscular adipocytes migration. The width of the scratches was measured by microscope after transfected with plasmid or RNA oligos for 72 h ( n = 3), * p
    Figure Legend Snippet: The effects of COL6A1 overexpression and knockdown on cell proliferation, differentiation and migration. (A) Overexpressed of COL6A1 promoted the expression of adipogenic differentiation and ECM-related genes (B) of intramuscular adipocytes. The relative mRNA levels of genes were detected by qRT-PCR after transfected with plasmid for 48 h. (C) Knockdown of COL6A1 suppressed the expression of adipogenic differentiation and ECM-related genes (D) of intramuscular adipocytes. The relative mRNA levels of genes were detected by qRT-PCR after transfected with RNA oligos for 24 h. (E) COL6A1 promoted intramuscular preadipocytes proliferation. The percentage of EDU positive cells was quantified after transfected with plasmid or RNA oligos. (F) COL6A1 accelerated intramuscular preadipocytes differentiation. BODIPY (green) and DAPI (blue) staining of intramuscular adipocytes after transfected with plasmid or RNA oligos. (G) COL6A1 promoted intramuscular adipocytes migration. The width of the scratches was measured by microscope after transfected with plasmid or RNA oligos for 72 h ( n = 3), * p

    Techniques Used: Over Expression, Migration, Expressing, Quantitative RT-PCR, Transfection, Plasmid Preparation, Staining, Microscopy

    7) Product Images from "Mcl-1 Is a Novel Target of miR-26b That Is Associated with the Apoptosis Induced by TRAIL in HCC Cells"

    Article Title: Mcl-1 Is a Novel Target of miR-26b That Is Associated with the Apoptosis Induced by TRAIL in HCC Cells

    Journal: BioMed Research International

    doi: 10.1155/2015/572738

    miR-26b sensitized TRAIL-induced cell viability inhibition and apoptosis in HepG2 cells. Three independent experiments were performed. (a) HepG2 cells were transfected with indicated RNA oligos with/without TRAIL. Then the MTT assay was performed for evaluating the cell viability. ∗ P
    Figure Legend Snippet: miR-26b sensitized TRAIL-induced cell viability inhibition and apoptosis in HepG2 cells. Three independent experiments were performed. (a) HepG2 cells were transfected with indicated RNA oligos with/without TRAIL. Then the MTT assay was performed for evaluating the cell viability. ∗ P

    Techniques Used: Inhibition, Transfection, MTT Assay

    Mcl-1 abolished the sensitization of miR-26b to TRAIL-induced cytotoxicity. Three independent experiments were performed. (a) HepG2 cells were transfected with indicated RNA oligos with/without TRAIL. Then the MTT assay was performed for evaluating the cell viability. ∗ P
    Figure Legend Snippet: Mcl-1 abolished the sensitization of miR-26b to TRAIL-induced cytotoxicity. Three independent experiments were performed. (a) HepG2 cells were transfected with indicated RNA oligos with/without TRAIL. Then the MTT assay was performed for evaluating the cell viability. ∗ P

    Techniques Used: Transfection, MTT Assay

    Mcl-1 mRNA 3′-UTR is the direct target of miR-26b. Three independent experiments were performed. (a) A predicted binding site of miR-26b in 3′-UTR of human Mcl-1 mRNA. (b) HepG2 cells were cultured in 48-well plates and were cotransfected with the reporter plasmids (pMIR-Mcl-1, pMIR-Mcl-1-M, or empty pMIR) and RNA oligos (miR-26b mimics or NC oligo) for 24 h. Then the luciferase activity was determined with Dual-Luciferase Reporter System. The expression of the reporter containing wild type 3′-UTR of Mcl-1 was suppressed by miR-26b, but not in the mutated construct or empty plasmid. ∗ P
    Figure Legend Snippet: Mcl-1 mRNA 3′-UTR is the direct target of miR-26b. Three independent experiments were performed. (a) A predicted binding site of miR-26b in 3′-UTR of human Mcl-1 mRNA. (b) HepG2 cells were cultured in 48-well plates and were cotransfected with the reporter plasmids (pMIR-Mcl-1, pMIR-Mcl-1-M, or empty pMIR) and RNA oligos (miR-26b mimics or NC oligo) for 24 h. Then the luciferase activity was determined with Dual-Luciferase Reporter System. The expression of the reporter containing wild type 3′-UTR of Mcl-1 was suppressed by miR-26b, but not in the mutated construct or empty plasmid. ∗ P

    Techniques Used: Binding Assay, Cell Culture, Luciferase, Activity Assay, Expressing, Construct, Plasmid Preparation

    8) Product Images from "Structural bias in T4 RNA ligase-mediated 3?-adapter ligation"

    Article Title: Structural bias in T4 RNA ligase-mediated 3?-adapter ligation

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkr1263

    Scheme of in vitro ligation selection and sequencing library preparation. For each ligase selected library, an equal amount of 4 random RNA oligos containing a constant region (solid line), a randomized region (wavy line) and a known 3′-nt were combined to make a random oligo pool and used as substrates in a ligation reaction with pre-adenylated SR1 DNA adapter using a specific T4 RNA ligase. The ligated products were reverse transcribed and amplified to introduce the required primer regions for Ion Torrent sequencing. To determine the sequence content of the random RNA oligo pool, each of the four RNA oligos was sequenced independently. First, the oligos were poly A tailed for the random RNA oligo U, C and G or poly C tailed for the random RNA oligo A using poly(A) polymerase. The tailed RNA oligos were then reverse transcribed using primers complementary to the polymer tails ( Supplementary Table S1 ). The cDNA libraries were amplified and processed in the same manner as the ligase selected libraries described above.
    Figure Legend Snippet: Scheme of in vitro ligation selection and sequencing library preparation. For each ligase selected library, an equal amount of 4 random RNA oligos containing a constant region (solid line), a randomized region (wavy line) and a known 3′-nt were combined to make a random oligo pool and used as substrates in a ligation reaction with pre-adenylated SR1 DNA adapter using a specific T4 RNA ligase. The ligated products were reverse transcribed and amplified to introduce the required primer regions for Ion Torrent sequencing. To determine the sequence content of the random RNA oligo pool, each of the four RNA oligos was sequenced independently. First, the oligos were poly A tailed for the random RNA oligo U, C and G or poly C tailed for the random RNA oligo A using poly(A) polymerase. The tailed RNA oligos were then reverse transcribed using primers complementary to the polymer tails ( Supplementary Table S1 ). The cDNA libraries were amplified and processed in the same manner as the ligase selected libraries described above.

    Techniques Used: In Vitro, Ligation, Selection, Sequencing, Amplification, Introduce

    9) Product Images from "Down-regulation of p53-inducible microRNAs 192, 194 and 215 impairs the p53/MDM2 auto-regulatory loop in multiple myeloma development"

    Article Title: Down-regulation of p53-inducible microRNAs 192, 194 and 215 impairs the p53/MDM2 auto-regulatory loop in multiple myeloma development

    Journal: Cancer cell

    doi: 10.1016/j.ccr.2010.09.005

    miR -194, 215 and 194 block invasion ability of MM cells A) MM1s and RPMI-8226 cells (pre-miRNA- 192, 194, 215, Scr-transfected) were harvested 72 hr after transfection. Whole cell lysates were imunoblotted using IGF-1, IGF-1 R, pS6, S6, p-Akt, Akt and Gapdh antibodies; Scr sequence and miR- 194 . C-D) In vivo confocal imaging. 8×10 6 GFP+/Luc+ MM1s cells were transfected using either pre-miRNA -192, -194, 215 and Scr RNA oligos and then iv injected into mice immediately after transfection. After 1 wk the mice were miRNAs iv injected (10ug) once a wk for 4 wk and the bioluminescence intensity was assessed before every injection (C). (D) Representative bioluminescence imaging (BLI) after 5 wk from the injection. (E) Bone marrow cells from the mice used for the experiment were isolated and human CD-138 positive cells (engrafted cells) were detected using anti-CD-138 antibody by flow cytometry (P2 fraction) (E).
    Figure Legend Snippet: miR -194, 215 and 194 block invasion ability of MM cells A) MM1s and RPMI-8226 cells (pre-miRNA- 192, 194, 215, Scr-transfected) were harvested 72 hr after transfection. Whole cell lysates were imunoblotted using IGF-1, IGF-1 R, pS6, S6, p-Akt, Akt and Gapdh antibodies; Scr sequence and miR- 194 . C-D) In vivo confocal imaging. 8×10 6 GFP+/Luc+ MM1s cells were transfected using either pre-miRNA -192, -194, 215 and Scr RNA oligos and then iv injected into mice immediately after transfection. After 1 wk the mice were miRNAs iv injected (10ug) once a wk for 4 wk and the bioluminescence intensity was assessed before every injection (C). (D) Representative bioluminescence imaging (BLI) after 5 wk from the injection. (E) Bone marrow cells from the mice used for the experiment were isolated and human CD-138 positive cells (engrafted cells) were detected using anti-CD-138 antibody by flow cytometry (P2 fraction) (E).

    Techniques Used: Blocking Assay, Transfection, Sequencing, In Vivo, Imaging, Injection, Mouse Assay, Isolation, Flow Cytometry, Cytometry

    miR -192-215 regulate IGF-1 and IGF1-R expression in MM cells Western blot showing IGF-1R and IGF-1 expression after miR -192 and miR -215 transfection using pre (A) and ASOs (B) for miR -192 , 215, 194 . C) Western blots after IGF-1 knockdown in MM1s (si-RNA) using anti-IGF-1R, IGF-1 and Gapdh antibodies. D-E) miRNAs predicted to interact with IGF-1 and IGF-1R gene at their 3′-UTR, according to “in silico” Target Scan ( IGF-1 ) and RNA-22 ( IGF-1R ). Luciferase assay showing decreased luciferase activity in MM 1s cells co-transfected with pGL3- IGF-1 -3′UTR (D) or pGL3- IGF-1R -3′UTR (full) (E) and miR- 192, 194, 215 or Scr. Deletion of 6 bases in all putative consensus sequences on IGF-1 . Bars indicate relative luciferase activity ± SD. All experiments were performed in triplicate. F-G) Immunofluorescence using anti-IGF-1R (F) and anti-IGF-1 (G) in red and blue nuclear DNA, from CD-138+ PCs from 9 MM patients transfected with miR -192 and miR -215 (pool) or Scr and intensity of the signal was assessed ± SD. The efficiency of the transfection in the 9 samples was evaluated using fluorescent double strand RNA oligos (H). Scale bars indicate 25μM.
    Figure Legend Snippet: miR -192-215 regulate IGF-1 and IGF1-R expression in MM cells Western blot showing IGF-1R and IGF-1 expression after miR -192 and miR -215 transfection using pre (A) and ASOs (B) for miR -192 , 215, 194 . C) Western blots after IGF-1 knockdown in MM1s (si-RNA) using anti-IGF-1R, IGF-1 and Gapdh antibodies. D-E) miRNAs predicted to interact with IGF-1 and IGF-1R gene at their 3′-UTR, according to “in silico” Target Scan ( IGF-1 ) and RNA-22 ( IGF-1R ). Luciferase assay showing decreased luciferase activity in MM 1s cells co-transfected with pGL3- IGF-1 -3′UTR (D) or pGL3- IGF-1R -3′UTR (full) (E) and miR- 192, 194, 215 or Scr. Deletion of 6 bases in all putative consensus sequences on IGF-1 . Bars indicate relative luciferase activity ± SD. All experiments were performed in triplicate. F-G) Immunofluorescence using anti-IGF-1R (F) and anti-IGF-1 (G) in red and blue nuclear DNA, from CD-138+ PCs from 9 MM patients transfected with miR -192 and miR -215 (pool) or Scr and intensity of the signal was assessed ± SD. The efficiency of the transfection in the 9 samples was evaluated using fluorescent double strand RNA oligos (H). Scale bars indicate 25μM.

    Techniques Used: Expressing, Western Blot, Transfection, Luciferase, Activity Assay, Immunofluorescence

    Related Articles

    Real-time Polymerase Chain Reaction:

    Article Title: Cysteine cross-linking in native membranes establishes the transmembrane architecture of Ire1
    Article Snippet: .. RNA preparation, cDNA synthesis, and qPCR analysis The level of the spliced HAC1 mRNA and the PDI1 mRNA in stressed and unstressed cells was determined via RT-qPCR using Oligo(dT) primers, the Superscript II RT protocol (Invitrogen), the ORA qPCR Green ROX L Mix (HighQu), and a Piko Real PCR system (Thermo Fisher Scientific). ..

    Article Title: The transcriptional cofactor IRF2BP2 plays a key role in T cell homeostasis and Treg cell expansion
    Article Snippet: .. The RNA from activated or differentiated T cells was extracted using TRIzol (Thermo Fisher Scientific). cDNA was synthesized using Superscript reverse transcriptase and oligo(dT) primers (Invitrogen), and gene expression was examined with Step One Plus (Applied Biosystems) using TaqMan® Real Time PCR Assay. ..

    Article Title: Cysteine cross-linking in native membranes establishes the transmembrane architecture of Ire1
    Article Snippet: .. 500 ng RNA of the total isolated RNA was used as a template for the synthesis of cDNA using Oligo(dT) primers and the Superscript II RT protocol (Invitrogen). qPCR was performed using ORA qPCR Green ROX L Mix (HighQu) in a Piko Real PCR system (Thermo Fisher Scientific). ..

    Quantitative RT-PCR:

    Article Title: Cysteine cross-linking in native membranes establishes the transmembrane architecture of Ire1
    Article Snippet: .. RNA preparation, cDNA synthesis, and qPCR analysis The level of the spliced HAC1 mRNA and the PDI1 mRNA in stressed and unstressed cells was determined via RT-qPCR using Oligo(dT) primers, the Superscript II RT protocol (Invitrogen), the ORA qPCR Green ROX L Mix (HighQu), and a Piko Real PCR system (Thermo Fisher Scientific). ..

    Polymerase Chain Reaction:

    Article Title: Cysteine cross-linking in native membranes establishes the transmembrane architecture of Ire1
    Article Snippet: .. RNA preparation, cDNA synthesis, and qPCR analysis The level of the spliced HAC1 mRNA and the PDI1 mRNA in stressed and unstressed cells was determined via RT-qPCR using Oligo(dT) primers, the Superscript II RT protocol (Invitrogen), the ORA qPCR Green ROX L Mix (HighQu), and a Piko Real PCR system (Thermo Fisher Scientific). ..

    Article Title: Cysteine cross-linking in native membranes establishes the transmembrane architecture of Ire1
    Article Snippet: .. 500 ng RNA of the total isolated RNA was used as a template for the synthesis of cDNA using Oligo(dT) primers and the Superscript II RT protocol (Invitrogen). qPCR was performed using ORA qPCR Green ROX L Mix (HighQu) in a Piko Real PCR system (Thermo Fisher Scientific). ..

    Article Title: Selection for non-specific adhesion is a driver of FimH evolution increasing Escherichia coli biofilm capacity
    Article Snippet: .. Determination of the frequency of fimH mutation The evolution of frequency of the identified mutations in fimH was performed using Sanger sequencing analysis of PCR products centered on the fimH region using the following oligonucleotides - oligo up: AGGATGACAGTGGCAACACA and oligo down: GTTTTGGCTTTTCGCACAAT. ..

    Synthesized:

    Article Title: The transcriptional cofactor IRF2BP2 plays a key role in T cell homeostasis and Treg cell expansion
    Article Snippet: .. The RNA from activated or differentiated T cells was extracted using TRIzol (Thermo Fisher Scientific). cDNA was synthesized using Superscript reverse transcriptase and oligo(dT) primers (Invitrogen), and gene expression was examined with Step One Plus (Applied Biosystems) using TaqMan® Real Time PCR Assay. ..

    Article Title: Th1/17 Cells Infiltrate Murine Cytomegalovirus-Infected Renal Allografts via Virus-Induced CCL20 and Promote Th1 Cells through IL-17A
    Article Snippet: .. First strand cDNA was synthesized from 200 ng of total RNA and a mixture of Oligo (dT) and random hexamer primers in a 20 μl reaction volume using RevertAid first strand cDNA synthesis Kit (Thermofisher Scientific, Waltham, MA). ..

    Expressing:

    Article Title: The transcriptional cofactor IRF2BP2 plays a key role in T cell homeostasis and Treg cell expansion
    Article Snippet: .. The RNA from activated or differentiated T cells was extracted using TRIzol (Thermo Fisher Scientific). cDNA was synthesized using Superscript reverse transcriptase and oligo(dT) primers (Invitrogen), and gene expression was examined with Step One Plus (Applied Biosystems) using TaqMan® Real Time PCR Assay. ..

    Isolation:

    Article Title: Cysteine cross-linking in native membranes establishes the transmembrane architecture of Ire1
    Article Snippet: .. 500 ng RNA of the total isolated RNA was used as a template for the synthesis of cDNA using Oligo(dT) primers and the Superscript II RT protocol (Invitrogen). qPCR was performed using ORA qPCR Green ROX L Mix (HighQu) in a Piko Real PCR system (Thermo Fisher Scientific). ..

    Amplification:

    Article Title: Rabbit haemorrhagic disease virus Lagovirus europaeus/GI.1d strain: genome sequencing, in vivo virus replication kinetics, and viral dose effect
    Article Snippet: .. RNA was reverse transcribed using oligo-dT (Invitrogen) as a primer and SuperScript™ II Reverse Transcriptase (Invitrogen). cDNA was amplified using AmpliTaq Gold DNA polymerase (Applera Applied Biosystems). ..

    Random Hexamer Labeling:

    Article Title: Th1/17 Cells Infiltrate Murine Cytomegalovirus-Infected Renal Allografts via Virus-Induced CCL20 and Promote Th1 Cells through IL-17A
    Article Snippet: .. First strand cDNA was synthesized from 200 ng of total RNA and a mixture of Oligo (dT) and random hexamer primers in a 20 μl reaction volume using RevertAid first strand cDNA synthesis Kit (Thermofisher Scientific, Waltham, MA). ..

    Mutagenesis:

    Article Title: Selection for non-specific adhesion is a driver of FimH evolution increasing Escherichia coli biofilm capacity
    Article Snippet: .. Determination of the frequency of fimH mutation The evolution of frequency of the identified mutations in fimH was performed using Sanger sequencing analysis of PCR products centered on the fimH region using the following oligonucleotides - oligo up: AGGATGACAGTGGCAACACA and oligo down: GTTTTGGCTTTTCGCACAAT. ..

    Sequencing:

    Article Title: Selection for non-specific adhesion is a driver of FimH evolution increasing Escherichia coli biofilm capacity
    Article Snippet: .. Determination of the frequency of fimH mutation The evolution of frequency of the identified mutations in fimH was performed using Sanger sequencing analysis of PCR products centered on the fimH region using the following oligonucleotides - oligo up: AGGATGACAGTGGCAACACA and oligo down: GTTTTGGCTTTTCGCACAAT. ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 97
    Thermo Fisher poly a rna
    Schematic of <t>RNA</t> structure probing by PARS in zebrafish. <t>Poly-A</t> RNA from zebrafish is folded in-vitro. The folded RNA is cleaved by RNase V1 and S1 nuclease separately. The enzyme cut sites generate 5’P ends and 3’ OH ends at the cleaved sites. Long fragments generated by single-hit kinetics are further fragmented by alkaline hydrolysis, which blocks the 3′ site of the enzyme-cut fragments. Sequencing adapters are ligated to the 5′ end followed by alkaline phosphatase treatment to 3’ P group. Adapters are ligated to 3’ends followed cDNA synthesis and PCR purification of the library. Appropriate size of the library is maintained by purification by nucleic acid beads. Sequenced reads are aligned back to the genome and only unique reads with the correct read start positions are considered for PARS score calculation
    Poly A Rna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/poly a rna/product/Thermo Fisher
    Average 97 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    poly a rna - by Bioz Stars, 2021-10
    97/100 stars
      Buy from Supplier

    97
    Thermo Fisher rna
    Quality control of the input samples demonstrated an enrichment of nephron progenitors in the cellular isolate with good quality <t>RNA,</t> and successful <t>cDNA</t> library synthesis. ( a ) qPCR analysis showed that the cells in the isolate are enriched for nephron progenitors ( Six2, Cited1 ) with minimal cellular contamination from ureteric bud ( Calb ), podocytes ( Synpo ), endothelial ( VE-Cad ) and epithelial cells ( Epcam ), but minor contamination from the renal stroma lineage ( Pdgfrβ ). ( b ) TapeStation analysis of the total RNA showed good quality RNA traces with distinct 18S and 28S rRNA peaks with retention of small RNAs as evident by the broad peak to the right of the lower molecular marker. ( c ) TapeStation analysis showed that the purified cDNA libraries exhibited a distinct peak at ~140–150 nucleotides (adaptor ligated small RNA products), indicating that both the cDNA library construction and cleanup are successful. N=3, ∗ p-value
    Rna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rna/product/Thermo Fisher
    Average 97 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    rna - by Bioz Stars, 2021-10
    97/100 stars
      Buy from Supplier

    Image Search Results


    Schematic of RNA structure probing by PARS in zebrafish. Poly-A RNA from zebrafish is folded in-vitro. The folded RNA is cleaved by RNase V1 and S1 nuclease separately. The enzyme cut sites generate 5’P ends and 3’ OH ends at the cleaved sites. Long fragments generated by single-hit kinetics are further fragmented by alkaline hydrolysis, which blocks the 3′ site of the enzyme-cut fragments. Sequencing adapters are ligated to the 5′ end followed by alkaline phosphatase treatment to 3’ P group. Adapters are ligated to 3’ends followed cDNA synthesis and PCR purification of the library. Appropriate size of the library is maintained by purification by nucleic acid beads. Sequenced reads are aligned back to the genome and only unique reads with the correct read start positions are considered for PARS score calculation

    Journal: BMC Genomics

    Article Title: RNA secondary structure profiling in zebrafish reveals unique regulatory features

    doi: 10.1186/s12864-018-4497-0

    Figure Lengend Snippet: Schematic of RNA structure probing by PARS in zebrafish. Poly-A RNA from zebrafish is folded in-vitro. The folded RNA is cleaved by RNase V1 and S1 nuclease separately. The enzyme cut sites generate 5’P ends and 3’ OH ends at the cleaved sites. Long fragments generated by single-hit kinetics are further fragmented by alkaline hydrolysis, which blocks the 3′ site of the enzyme-cut fragments. Sequencing adapters are ligated to the 5′ end followed by alkaline phosphatase treatment to 3’ P group. Adapters are ligated to 3’ends followed cDNA synthesis and PCR purification of the library. Appropriate size of the library is maintained by purification by nucleic acid beads. Sequenced reads are aligned back to the genome and only unique reads with the correct read start positions are considered for PARS score calculation

    Article Snippet: Poly-A RNA was enriched using oligo-dT Dynabeads (Life Technologies, USA) using manufacturer’s protocol to yield 4 μg of processed transcripts from the initial pool.

    Techniques: In Vitro, Generated, Sequencing, Polymerase Chain Reaction, Purification

    Integrity analysis of selected High OD exported RNAs by full-length RT-PCR. After OMVs isolation and RNA extraction as described in Section “Materials and Methods,” cDNA synthesis was performed. End-point PCR was then conducted with primers flanking the coding sequence (mRNA) or the full sequence (ncRNA) of 30 selected RNAs. Resulting samples were deposited on a 3% w/v agarose gel in TBE buffer, subjected to electrophoresis and stained with Ethidium Bromide. Only transcripts that were amplified as full-length amplicons are shown (12 out of 30 selected RNAs that were tested). Two biological replicates for SPI-1ind, SPI-2ind High OD and Control High OD conditions are visualized. Primers can be seen in Supplementary Dataset C , –RT controls are displayed in Supplementary Figure S9 and a positive control of full-length amplifications performed on intracellular RNAs is visible in Supplementary Figure S10 .

    Journal: Frontiers in Microbiology

    Article Title: The RNA Complement of Outer Membrane Vesicles From Salmonella enterica Serovar Typhimurium Under Distinct Culture Conditions

    doi: 10.3389/fmicb.2018.02015

    Figure Lengend Snippet: Integrity analysis of selected High OD exported RNAs by full-length RT-PCR. After OMVs isolation and RNA extraction as described in Section “Materials and Methods,” cDNA synthesis was performed. End-point PCR was then conducted with primers flanking the coding sequence (mRNA) or the full sequence (ncRNA) of 30 selected RNAs. Resulting samples were deposited on a 3% w/v agarose gel in TBE buffer, subjected to electrophoresis and stained with Ethidium Bromide. Only transcripts that were amplified as full-length amplicons are shown (12 out of 30 selected RNAs that were tested). Two biological replicates for SPI-1ind, SPI-2ind High OD and Control High OD conditions are visualized. Primers can be seen in Supplementary Dataset C , –RT controls are displayed in Supplementary Figure S9 and a positive control of full-length amplifications performed on intracellular RNAs is visible in Supplementary Figure S10 .

    Article Snippet: Intracellular and OMV-associated RNA was obtained as previously described with the following differences: the initial culture volume was 0.75 l per replicate instead of 1.5 l; RNA extractions were performed using TRIzol Reagent (Invitrogen); cDNA libraries were prepared from 1 μl of OMV-associated RNA or 100 ng of intracellular RNA with the SuperScript III First-Strand Synthesis System (Invitrogen) using random hexamer primers according to the manufacturer instructions and without further cDNA fragmentation step.

    Techniques: Reverse Transcription Polymerase Chain Reaction, Isolation, RNA Extraction, Polymerase Chain Reaction, Sequencing, Agarose Gel Electrophoresis, Electrophoresis, Staining, Amplification, Positive Control

    RNase protection assay of selected protein-associated sRNAs isolated from OMVs. OMV isolation and enzymatic digestions were performed from SPI-1ind condition as described in Section “Materials and Methods (see section “OMV Purification and RNA Extraction”).” Crude OMV preparation was divided in four fractions. One was kept untouched (Untreated). The second was subjected to the same protocol than the third and fourth fraction without any enzyme added (Control). The third was digested by RNaseA. The fourth was digested by ProteinaseK followed by proteinase inactivation and RNAseA digestion. The protocol was then followed as described in Section “OMV Purification and RNA Extraction” until cDNA libraries from OMV-associated RNAs were obtained End-point PCR was then conducted with the same primers and conditions used previously, for SsrS , CsrC , 10Sa , and rnpB genes. Resulting samples were deposited on a 3% w/v agarose gel in TBE buffer, subjected to electrophoresis and stained with Ethidium Bromide. Most of the signal is still present after enzymatic digestion, showing that the RNAs are protected by the vesicle membrane. –RT controls and positive controls for enzymatic digestions can be seen in Supplementary Figure S5 .

    Journal: Frontiers in Microbiology

    Article Title: The RNA Complement of Outer Membrane Vesicles From Salmonella enterica Serovar Typhimurium Under Distinct Culture Conditions

    doi: 10.3389/fmicb.2018.02015

    Figure Lengend Snippet: RNase protection assay of selected protein-associated sRNAs isolated from OMVs. OMV isolation and enzymatic digestions were performed from SPI-1ind condition as described in Section “Materials and Methods (see section “OMV Purification and RNA Extraction”).” Crude OMV preparation was divided in four fractions. One was kept untouched (Untreated). The second was subjected to the same protocol than the third and fourth fraction without any enzyme added (Control). The third was digested by RNaseA. The fourth was digested by ProteinaseK followed by proteinase inactivation and RNAseA digestion. The protocol was then followed as described in Section “OMV Purification and RNA Extraction” until cDNA libraries from OMV-associated RNAs were obtained End-point PCR was then conducted with the same primers and conditions used previously, for SsrS , CsrC , 10Sa , and rnpB genes. Resulting samples were deposited on a 3% w/v agarose gel in TBE buffer, subjected to electrophoresis and stained with Ethidium Bromide. Most of the signal is still present after enzymatic digestion, showing that the RNAs are protected by the vesicle membrane. –RT controls and positive controls for enzymatic digestions can be seen in Supplementary Figure S5 .

    Article Snippet: Intracellular and OMV-associated RNA was obtained as previously described with the following differences: the initial culture volume was 0.75 l per replicate instead of 1.5 l; RNA extractions were performed using TRIzol Reagent (Invitrogen); cDNA libraries were prepared from 1 μl of OMV-associated RNA or 100 ng of intracellular RNA with the SuperScript III First-Strand Synthesis System (Invitrogen) using random hexamer primers according to the manufacturer instructions and without further cDNA fragmentation step.

    Techniques: Rnase Protection Assay, Isolation, Purification, RNA Extraction, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Electrophoresis, Staining

    Quality control of the input samples demonstrated an enrichment of nephron progenitors in the cellular isolate with good quality RNA, and successful cDNA library synthesis. ( a ) qPCR analysis showed that the cells in the isolate are enriched for nephron progenitors ( Six2, Cited1 ) with minimal cellular contamination from ureteric bud ( Calb ), podocytes ( Synpo ), endothelial ( VE-Cad ) and epithelial cells ( Epcam ), but minor contamination from the renal stroma lineage ( Pdgfrβ ). ( b ) TapeStation analysis of the total RNA showed good quality RNA traces with distinct 18S and 28S rRNA peaks with retention of small RNAs as evident by the broad peak to the right of the lower molecular marker. ( c ) TapeStation analysis showed that the purified cDNA libraries exhibited a distinct peak at ~140–150 nucleotides (adaptor ligated small RNA products), indicating that both the cDNA library construction and cleanup are successful. N=3, ∗ p-value

    Journal: Scientific Data

    Article Title: Small non-coding RNA expression in mouse nephrogenic mesenchymal progenitors

    doi: 10.1038/sdata.2018.218

    Figure Lengend Snippet: Quality control of the input samples demonstrated an enrichment of nephron progenitors in the cellular isolate with good quality RNA, and successful cDNA library synthesis. ( a ) qPCR analysis showed that the cells in the isolate are enriched for nephron progenitors ( Six2, Cited1 ) with minimal cellular contamination from ureteric bud ( Calb ), podocytes ( Synpo ), endothelial ( VE-Cad ) and epithelial cells ( Epcam ), but minor contamination from the renal stroma lineage ( Pdgfrβ ). ( b ) TapeStation analysis of the total RNA showed good quality RNA traces with distinct 18S and 28S rRNA peaks with retention of small RNAs as evident by the broad peak to the right of the lower molecular marker. ( c ) TapeStation analysis showed that the purified cDNA libraries exhibited a distinct peak at ~140–150 nucleotides (adaptor ligated small RNA products), indicating that both the cDNA library construction and cleanup are successful. N=3, ∗ p-value

    Article Snippet: For the validation of novel miRNAs, cDNA synthesis from total RNA was performed with the use of NCode VILO miRNA cDNA Synthesis Kit (Thermo; #A11193050) in accordance to the manufacturer’s protocol using equivalent amounts of total RNA, and qPCR was performed using standard SYBR Green detection on a BioRad CFX96 Real Time PCR Instrument.

    Techniques: cDNA Library Assay, Real-time Polymerase Chain Reaction, Marker, Purification

    Quality control of the small RNA-Seq dataset showed good sequencing quality reads and congruence of the biological samples. ( a ) FastQC analysis of a sequenced library (MNP1) showing that each sequenced base had a mean value score of > 30, indicating good quality sequencing. ( b ) Principal Component Analysis of the sRNA-Seq dataset showed clear separation of the nephron progenitor (MNP) and whole kidney (MWK) samples. ( c ) Hierarchical clustering correctly grouped samples based on their tissue of origin. ( d ) Heatmap representation of differentially expressed miRNAs in nephron progenitors vs. whole kidney samples with a false discovery rate of 0.05.

    Journal: Scientific Data

    Article Title: Small non-coding RNA expression in mouse nephrogenic mesenchymal progenitors

    doi: 10.1038/sdata.2018.218

    Figure Lengend Snippet: Quality control of the small RNA-Seq dataset showed good sequencing quality reads and congruence of the biological samples. ( a ) FastQC analysis of a sequenced library (MNP1) showing that each sequenced base had a mean value score of > 30, indicating good quality sequencing. ( b ) Principal Component Analysis of the sRNA-Seq dataset showed clear separation of the nephron progenitor (MNP) and whole kidney (MWK) samples. ( c ) Hierarchical clustering correctly grouped samples based on their tissue of origin. ( d ) Heatmap representation of differentially expressed miRNAs in nephron progenitors vs. whole kidney samples with a false discovery rate of 0.05.

    Article Snippet: For the validation of novel miRNAs, cDNA synthesis from total RNA was performed with the use of NCode VILO miRNA cDNA Synthesis Kit (Thermo; #A11193050) in accordance to the manufacturer’s protocol using equivalent amounts of total RNA, and qPCR was performed using standard SYBR Green detection on a BioRad CFX96 Real Time PCR Instrument.

    Techniques: RNA Sequencing Assay, Sequencing

    Small RNA-Seq and miRDeep2 analysis revealed novel unannotated miRNAs expressed in the developing kidney. ( a ) qPCR analysis validated the differential expression profile of miRs-210, 125b and 30c in nephron progenitor when compared to whole kidney. N=3, ∗ p-value

    Journal: Scientific Data

    Article Title: Small non-coding RNA expression in mouse nephrogenic mesenchymal progenitors

    doi: 10.1038/sdata.2018.218

    Figure Lengend Snippet: Small RNA-Seq and miRDeep2 analysis revealed novel unannotated miRNAs expressed in the developing kidney. ( a ) qPCR analysis validated the differential expression profile of miRs-210, 125b and 30c in nephron progenitor when compared to whole kidney. N=3, ∗ p-value

    Article Snippet: For the validation of novel miRNAs, cDNA synthesis from total RNA was performed with the use of NCode VILO miRNA cDNA Synthesis Kit (Thermo; #A11193050) in accordance to the manufacturer’s protocol using equivalent amounts of total RNA, and qPCR was performed using standard SYBR Green detection on a BioRad CFX96 Real Time PCR Instrument.

    Techniques: RNA Sequencing Assay, Real-time Polymerase Chain Reaction, Expressing

    Interaction of chIFIT5 with RNA carrying modifications in their 5′ termini using RNA-protein immunoprecipitation. ( A ) The genomes of negative sense single stranded RNA viruses carry triphosphate linkage (5′ppp) in the first transcribed base of the RNA and removal of 5′ppp structure will leave non-IFN stimulatory hydroxyl group (OH). ( B ) RNA carrying both 5′ppp and OH termini were biotinylated and coated on streptavidin beads before interaction with V5-tagged chIFIT5. Total ribonucleoproteins were isolated and stained for the V5 tag. ( C ) Pull down of biotinylated RNA interacting with chIFIT5 indicated that both human and chicken IFIT5 interacted with RNA carrying 5′ppp structures. EV = empty vector, M = marker.

    Journal: Scientific Reports

    Article Title: Chicken Interferon-induced Protein with Tetratricopeptide Repeats 5 Antagonizes Replication of RNA Viruses

    doi: 10.1038/s41598-018-24905-y

    Figure Lengend Snippet: Interaction of chIFIT5 with RNA carrying modifications in their 5′ termini using RNA-protein immunoprecipitation. ( A ) The genomes of negative sense single stranded RNA viruses carry triphosphate linkage (5′ppp) in the first transcribed base of the RNA and removal of 5′ppp structure will leave non-IFN stimulatory hydroxyl group (OH). ( B ) RNA carrying both 5′ppp and OH termini were biotinylated and coated on streptavidin beads before interaction with V5-tagged chIFIT5. Total ribonucleoproteins were isolated and stained for the V5 tag. ( C ) Pull down of biotinylated RNA interacting with chIFIT5 indicated that both human and chicken IFIT5 interacted with RNA carrying 5′ppp structures. EV = empty vector, M = marker.

    Article Snippet: A total of 30 μg of purified in vitro transcribed and biotinylated ppp-RNA was either mock treated or dephosphorylated using alkaline phosphatase (FastAP, Fermentas) to remove 5′ triphosphate (ppp) which leaves an OH group (OH-RNA).

    Techniques: Immunoprecipitation, Isolation, Staining, Plasmid Preparation, Marker